Content uploaded by Ronald J. Kendall
Author content
All content in this area was uploaded by Ronald J. Kendall on Aug 16, 2019
Content may be subject to copyright.
IMMUNOLOGY AND HOST-PARASITE INTERACTIONS - ORIGINAL PAPER
Quantitative analysis of Northern bobwhite (Colinus virginianus)
cytokines and TLR expression to eyeworm (Oxyspirura petrowi)
and caecal worm (Aulonocephalus pennula) glycoproteins
Aravindan Kalyanasundaram
1
&Kendall R. Blanchard
1
&Brett J. Henry
1
&Cassandra Henry
1
&Matthew Z. Brym
1
&
Ronald J. Kendall
1
Received: 8 May 2019 /Accepted: 2 August 2019
#Springer-Verlag GmbH Germany, part of Springer Nature 2019
Abstract
Helminth parasites have been a popular research topic due to their global prevalence and adverse effects on livestock and game
species. The Northern bobwhite (Colinus virginianus), a popular game bird in the USA, is one species subject to helminth
infection and has been experiencing a decline of > 4% annually over recentdecades. In the Rolling Plains Ecoregion of Texas, the
eyeworm (Oxyspirura petrowi) and caecal worm (Aulonocephalus pennula) helminths are found to be highly prevalent in
bobwhite. While there have been increasing studies on the prevalence, pathology, and phylogeny of the eyeworm and caecal
worm, there is still a need to investigate the bobwhite immune response to infection. This study utilizes previously sequenced
bobwhite cytokines and toll-like receptors to develop and optimize qPCR primers and measure gene expression in bobwhite
intramuscularly challenged with eyeworm and caecal worm glycoproteins. For the challenge experiments, separate treatments of
eyeworm and caecal worm glycoproteins were administered to bobwhite on day 1 and day 21. Measurements of primary and
secondary immune responses were taken at day 7 and day 28, respectively. Using the successfully optimized qPCR primers for
TLR7, IL1β,IL6,IFNα,IFNγ, IL10, and β-actin, the gene expression analysis from the challenge experiments revealed that
there was a measurable immune reaction in bobwhite in response to the intramuscular challenge of eyeworm and caecal worm
glycoproteins.
Keywords Bobwhite .Caecal .Eyeworm .Cytokine .qPCR .TLR
Introduction
Helminth parasites have been a popular research area with
their global prevalence (Kamal and Khalifa 2006;Albonico
et al. 2008; Hotez et al. 2008; Yu and Blackburn 2019), neg-
ative effects on livestock and game species (Kellogg and
Prestwood 1968; Hudson et al. 1992; Charlier et al. 2014;
Greter et al. 2017), and ability to remain long-lived in their
hosts (Maizels et al. 2004). They infect a wide variety of hosts
and have evolved to invade numerous locations within their
hosts (Maizels et al. 2004). Helminths have garnered
increased attention to immunologists as well given their abil-
ity to suppress host immune defense mechanisms and regulate
the immune system (Behnke et al. 1992; Maizels and
Yazd a n b akh s h 2003; Maizels et al. 2004).
Helminths have gained notoriety for their ability to modu-
late host immune responses, namely their ability to suppress T
helper 1 (Th1) and induce a modified Th2 environment that
enables helminths to increase their longevity within the host
(Hewitson et al. 2009). A hypothesized route of this immune
modulation is through the excretory/secretory (E/S) products
released by helminths, specifically the glycans located on the
glycoproteins and glycolipids that mimic the host glycans
(Cummings and Nyame 1996, van Die and Cummings
2010). There are numerous studies demonstrating the role of
helminth glycoproteins in other helminth parasites such as H-
gal and H11 from Haemonchus contortus, TSL-1 (43 kDa
antigen) from Trichi nella sp ira lis, ES-62 from filarial nema-
todes, and TES-70 from Toxocara canis and their role in host
immunomodulation (Munn et al. 1987,Appletonetal.1991,
Handling Editor: Una Ryan
*Ronald J. Kendall
ron.kendall@ttu.edu
1
The Wildlife Toxicology Laboratory, Texas Tech University,
Lubbock, TX 79409-3290, USA
Parasitology Research
https://doi.org/10.1007/s00436-019-06418-3
Haslam et al. 1997,Whelanetal.2000). However, many of
these studies assessing host immune response to helminth in-
fections have focused solely on mammals.
As a result, avian models are lacking largely due to low
sequence homologies between birds and mammals in addition
to a lack of information on avian cytokines (Wigley and
Kaiser 2003;Umaretal.2015). While poultry models have
increased since the sequencing of the chicken genome, more
avian models utilizing different species are needed to observe
host immune function in response to a pathogen, like disease
and parasites. These investigations are critical as these patho-
gens can have economic and social impacts on the poultry
industry and wild avian populations, such as the Northern
bobwhite quail (Colinus virginianus, Linneas 1758; hereafter,
bobwhite).
The bobwhite, a popular game bird of economic signifi-
cance to local communities in the Rolling Plains Ecoregion
(Johnson et al. 2012) of Texas, has been experiencing a de-
cline of > 4% annually over recent decades (Sauer et al. 2013).
The decline has been attributed to changes in land use, habitat
loss, and habitat fragmentation (Hernández et al. 2013). This
species exhibits a 5-year “boom and bust”cycle, but the cause
of these “booms”and “busts”is unknown (Guthery 2002;
Hernández et al. 2002). However, the expected “boom”in
the summer of 2010 did not occur despite stable habitat con-
ditions (Dunham et al. 2017a). This sparked increasing inter-
est from hunters, landowners, and researchers as to other pos-
sible causes. During a collaborative effort to investigate po-
tential contributors to the bobwhite decline, eyeworm
(Oxyspirura petrowi Skrjabin, 1929) and caecal worm
(Aulonocephalus pennula Chandler, 1935) were found to be
abundant and widespread in the Rolling Plains (Dunham et al.
2014; Bruno et al. 2018). Subsequent surveys continued to
identify high prevalence of both parasites throughout the
Rolling Plains, with some areas having 100% of infected bob-
white individuals (Dunham et al. 2017a; Henry et al. 2017;
Brym et al. 2018).
The eyeworm, a heteroxenous nematode, has been
identified in various avian species including Galliformes
and Passeriformes (Saunders 1935;Cram1937,McClure
1949; Pence 1972; Dunham et al. 2014). They are typi-
cally found underneath the eyelids and nictitating mem-
brane (Saunders 1935; Jackson 1969; Dunham et al.
2014), in the orbital cavity (Addison and Anderson
1969), and within tissues surrounding the eye (Robel
et al. 2003; Bruno et al. 2015). Pathological investigation
of eyeworm-infected individuals by Bruno et al. (2015)
and Dunham et al. (2016) found inflammation in the lac-
rimal duct and lesions on the Harderian gland in bob-
whites harboring eyeworm infection. This may be of con-
cern as these tissues are associated with tear production
(Holly and Lemp 1977) and immune function (Payne
1994;KaiserandBalic2015), respectively. Furthermore,
phylogenetic analyses performed by Kalyanasundaram
et al. (2018) found the eyeworm to be related to the hu-
man eyeworm (Loa loa) and the human and carnivore
eyeworm (Thelazia callipaeda). Both eyeworm species
have been associated with vision impairment and irritation
(Nayak et al. 2016; Barua et al. 2005)whichmaycorre-
late with reports of bobwhite flying into stationary objects
(Jackson 1969;Dunhametal.2017a;Brymetal.2018).
The caecal worm, also a heteroxenous nematode, is de-
scribed as a free-floating parasite of the avian caecum
(Chandler 1935). Dunham et al. (2017b) noted in pathological
investigations that highly infected individuals had reduced
digesta in the caecum which may be associated with nutrient
deficiency in infected individuals. Rollins (1980)alsoreport-
ed hemorrhaging of the caecum in infected quail and suggests
that high worm burdens (> 200) could impede caecum func-
tion. These hypotheses are further supported by the fact that
relatives of the caecal worm, including Toxascaris leonina,
have been associated with adverse effects on their host includ-
ing lethargy, malnutrition, and death (Kalyanasundaram et al.
2017).
While there is increasing research relating to impacts of
the eyeworm and caecal worm on wild bobwhite popula-
tions (Henry et al. 2017;Brymetal.2018), there is a need
to understand immunological influences between these
parasites and bobwhite. Given that parasite infection and
immune function can lead to life history trade-offs
(Nordling et al. 1998), this could also have potential im-
pacts on bobwhite populations. As critical components to
both the innate and adaptive immune system, cytokines
and toll-like receptors (TLRs) are vital in signaling im-
mune responses in the presence of pathogens (Mogensen
2009). This allows them to serve as bioindicators of im-
mune activity post-infection in challenge experiments
(e.g., Lochmiller et al. 1993; Saino et al. 1997;Nordling
et al. 1998; Christe et al. 1998). Both cytokines and toll-
like receptors have been well documented in parasitic in-
fections. For example, there has been observed downreg-
ulation of anti-inflammatory cytokines with oncoming
Leishmania infections (Mosser and Karp 1999) and di-
minished expression of cytokines and TLRs in filarial-
infected individuals (Babu and Nutman 2003).
To date, there are no studies documenting bobwhite
immune response with cytokines and TLRs to infection
of eyeworms and caecal worms. Therefore, in this study,
our objectives include (i) development and optimization
of qPCR primer sequences for bobwhite cytokines and
TLRs; (ii) experimentally challenge captive bobwhite
with glycoproteins of eyeworm and caecal worm sepa-
rately; and (iii) assess resulting cytokine and TLR gene
expression through qPCR to understand host-parasite
dynamics between the bobwhite, eyeworm, and caecal
worm.
Parasitol Res
Materials and methods
Sample collection
Wild bobwhite were collected during April 2018 from private
ranches using trapping procedures as described in Commons
et al. (2019) for glycoprotein collections of eyeworms and
caecal worms. Adult eyeworms were extracted from the eyes
and associated tissues as described in Dunham et al. (2014).
However, instead of physiological saline solution at 37 °C,
tissues were placed in petri dishes containing 0.01 M
phosphate-buffered saline (PBS) pH 7.4 to remove all worms
from the eyes and tissues around the eyes before worms were
transferred to a 2-mL centrifuge tube. Adult caecal worms
were collected from the caecum of bobwhites with procedures
following Dunham et al. (2017b) and identified by morpho-
logical characteristics as described in Kalyanasundaram et al.
(2017). All the samples were stored at −80 °C prior to glyco-
protein extraction.
Glycoprotein extraction
Frozen adult eyeworms and caecal worms were thawed and
washed several times with tris-buffered saline (TBS) contain-
ing 20 mM Tris, 150 mM NaCl, 100 μMCaCl
2
,and10μM
MnCl
2
(pH 7.4). Adult worms were homogenized using a
chilled mortar and pestle on ice in TBS (pH 7.4) with 1.0%
v/v Triton X-100, and centrifuged at 2600×gfor 30 min at
4 °C. The volume of the supernatants was recorded before
and after it was filtered through a 0.45-μM filter.
Concentration of crude whole-body protein extract of
eyeworm and caecal worm was estimated at 280 nm using a
Qubit 3.0 Fluorometer (Thermo Fisher Scientific Inc.,
Waltham, MA, USA) as per manufacturer’sinstructions.We
used Concanavalin A (Con A), a plant metalloprotein with
agarose beads (6%) for the purification of eyeworm and caecal
worm glycoproteins, as it binds molecules containing α-D-
mannopyranosyl, α-D-glucopyranosyl, and sterically related
residues (Alves et al. 2012). Crude whole-body protein ex-
tracts were mixed with Concanavalin A (Con A) (Cat. #786-
217, G-Biosciences, USA) and incubated for 1 h at 4 °C and
mixed every 10 min. The mixtures of Con A and crude whole-
body protein for both eyeworm and caecal worm were sepa-
rately packed in Econo-Pac® columns (Cat. #732-1010,
BioRad, USA). After packing, the columns were washed three
times using column wash buffer with 0.25% v/v TritonX-100.
Glycoproteins were eluted using column elution buffer con-
taining TBS (pH 7.4) 0.25% v/v Triton X-100, 200 mM α-
Methyl-D-mannopyranoside, and α-Methyl-D-
glucopyranoside. Protein elute concentrations were estimated
as described above. Elutes were run in 12% sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Elutes with similar protein profiles as determined by SDS-
PAGE were pooled, elutes E1 and E2 for eyeworm and E1
and E2 for caecal worm, and used in challenge experiment.
All elutes were stored in −80 °C until use.
Total RNA extraction
For primer optimization, 1 mL of whole blood was collected
from the jugular vein from wild bobwhite using 25 gauge
needle and transferred into heparin-coated 2-mL BD
Microtainer™Plastic Capillary Blood Collectors (Fisher
Scientific, USA). Total RNA was isolated with 100 μlof
blood using the QIAamp RNA Blood Mini kit (Qiagen,
USA) according to manufacturer’s instructions with final elu-
tions of 50 μl sterile UltraPure DEPC-treated water
(Invitrogen, USA). Quantity and quality of total RNA was
estimated by absorbance at 260–280 nm using Qubit 3.0 and
stored at −80 °C. cDNA was synthesized from total RNA
using the QuantiTect Reverse Transcription kit (Qiagen,
USA) according to manufacturer’s instructions. Synthesized
cDNA stored at −40 °C for primer optimization.
Primer design
Specific primers for the cytokines (IL1β, IL6, IL10, IFNα,
and IFNγ), TLR (TLR7), and β-actin of bobwhite were de-
signed by IDT PrimerQuest using sequences retrieved from
Northern bobwhite whole genome project (PRJNA188411) in
NCBI (Halley et al., 2014; Oldeschulte et al. 2017). We de-
signed primers for all of the above cytokines by multiple se-
quence alignments with other avian cytokines from Japanese
quail (Coturnix japonica)andchicken(Gallus gallus).
However, specific primers for cytokines (IL2, IL4, IL8,
IL12α,IL12β, IL13, IL18, and IL25) and TLRs (TLR2 and
TLR4) were unsuccessful due to lack of quality sequences
from NCBI database and the primer standardization for
qPCR failed because of non-specific amplification.
Newly synthesized primers (Table 1) were optimized with
total RNA template extracted previously. PCR reactions per-
formed with 5 μlofMyTaq™Red Mix (Bioline, USA), 1 μl
of 10 μM forward, 1 μlof10μM reverse primer, 1 μlof
cDNA template, and 2 μl of nuclease free water were used
for 10 μl reactions. PCR run conditions were as follows: 95°C
for 3 min; 30 cycles of 95°C for 40 sec, 60°C for 1 min, and
72°C for 30 sec; and a final extension step of 72°C for 5 min.
Purified PCR products of all the genes were sequenced.
Experimental study
Parasite-free, pen-raised bobwhite were individually housed
indoors and acclimatized for a 2-week period before experi-
mental study. Birds were provided food and water ad libitum.
Prior to starting the experimental study, bird feces were
collected and analyzed for eyeworm and caecal worm
Parasitol Res
presence by PCR using their specific primers as described in
Kistler et al. (2016) and Kalyanasundaram et al. (2017). After
acclimatization, birds were separated into three groups of ten
including a group treated with eyeworm glycoproteins, a
group treated with caecal worm glycoproteins, and an untreat-
ed control group. Each bird in the eyeworm and caecal worm
groups received 200 μg of glycoprotein intramuscularly (IM)
with a primary and secondary dose on days 1 and 21. This was
based on 2 μg per gram of body weight that was used in other
studies (Lung et al. 1996, Kopko et al. 2000, Killpack and
Karasov 2012). The IM route is advantageous as it allows
for rapid passage of protein antigen into the circulatory and
lymphatic systems due to the high concentration of blood
vessels (Turner et al. 2011). For gene expression analysis,
1 mL of whole blood was collected from the jugular vein from
all birds at day 7 and day 28 as described earlier.
Gene expression analysis
Bobwhite cytokines (IL1β, IL6, IL10, IFNα, and IFNγ)and
TLR (TLR7) were used to determine the relative expression,
while β-actin was used as an endogenous control in this study.
Total RNA isolation and cDNA synthesis were done as de-
scribed above. Quantitative real-time PCR (qRT-PCR) was
performed using PowerUp™SYBR™Green Master Mix
(Applied Biosystem, USA). The qRT-PCR reaction volume
follows with 5 μlofPowerUp™SYBR™Green Master
Mix, 1 μlof10μMforward,1μlof10μM reverse primer,
1μl of cDNA template, and 2 μl of nuclease free water were
used for 10 μl reactions. Amplification and detection of spe-
cific products were performed in StepOnePlus real-time PCR
detection system (Applied Biosystems, USA) with the follow-
ing cycle profile: holding stage at 50°C for 2 min, 96°C for
15 sec; and 40 cycles of 96°C for 15 sec, 60°C for 1 min.
Melting temperature (T
m
) of the samples was determined by
melt curve analysis following amplification. The samples
were heated to 95°C for 15 sec and then cooled to 60°C for
5 sec before ramping back to 95°C in 0.5°C increments. The
relative expression of each target gene was calculated using
the methods described in Livak and Schmittgen (2001).
Statistical analysis
All statistical analyses were completed in Minitab (v18). The
data for each gene was assessed for outliers, normality was
assessed using the Ryan-Joiner normality test, and equal var-
iance was analyzed with both the multiple comparison test and
Levene’s method. Data sets that were normally distributed
with 95% confidence interval were analyzed with a two-
sample ttest and data sets that did not have a normal
Table 1 Sequences of the primers
used in qRT-PCR.\ Primer Oligonucleotide sequence Melting temp™
(°C)
Accession
number*
Product
size
(bp)
IFNαF5′CCTTGCTCCTTCAACCACACCCT
3′
61.5 AWGT02000063 100
IFNαR5′CTTTGGCGTTGACGGTCGATCCA
3′
61.8
IFNγF5′TCACGTGCTCTGAAGGGCAC 3′60.0 AWGU01322170 99
IFNγR5′CAAGCTACTGAAGCAGCCTC
TGG 3′
59.8
IL1βF5′GGAGGAGGTTTTTGAGCCTG
TCACC 3′
61.6 AWGT02000201 93
IL1βR5′TCGAAGGACTGTGAGCGGGT
GTA 3′
61.9
IL6F 5′AGTCGCTGTGCTACAGCACG
AAG 3′
61.4 AWGT02000177 103
IL6R 5′AGGGATTTCCGGGCAGCTGA 3′61.5
IL10F 5′TCTACACGGATGAGGTCCTGCCC
3′
62.4 AWGT02000004 128
IL10R 5′GGTGAAGAAGCGGTGACAGCG
3′
60.9
TLR7F 5′TCCTCTTCTGGCCACAGACGT 3′60.4 AWGU01025717 101
TLR7R 5′AGGATGTGTCCAGCTCACAGG 3′59.0
ACTBF 5′TCACCACCACAGCTGAGAGAGA
3′
59.7 AWGU01047659 149
ACTBR 5′GGTGATGACCTGACCATCAGGG
3′
59.5
IFN interferon, IL interleukin, TLR toll-like receptor, ACTB β-Actin
*Accession numbers for the sequences from which primers are derived
Parasitol Res
distribution were analyzed using the Mann-Whitney Utest.
Genes that have statistically significant (P< 0.05) expression
changes compared with the control will be reported as such.
Results
The SDS-PAGE results of Con A–purified elutes exhibited the
pattern of eyeworm and caecal worm glycoproteins with a
molecular weight range from 20 to 260 kDa (Fig. 1). Elutes
1 and 2 for both eyeworm and caecal worms showed high
intensity of prominent bands with concentrations of 234,
234, 456, and 457 μg/ml respectively.
Bobwhite cytokine and toll-like receptor sequence
analysis
All the oligonucleotide primers were confirmed as species-
specific by amplifying a single-gene product for each target
sequence using PCR. Sequence results revealed the bobwhite
cytokines IL1β, IL6, IL10, IFNα, and IFNγ,aswellasTLR7
and β-actin genes. A BLASTX analysis confirmed the genetic
identity to the bobwhite, where β-actin and IFNα,inparticu-
lar, were found to have a 100% identity to bobwhite from
Halley et al. (2014) and Oldeschulte et al. (2017)(Accession
no.: AWGU00000000.2). The analysis also revealed the spec-
ified genes of bobwhite to have a close identity (90–100%)
with the galliform species of chicken (Gallus gallus)and
Japanese quail (Coturnix japonica).
Challenge experiments
Results comparing the gene expression between the control
group and experimental groups dosed with glycoproteins of
eyeworm and caecal worm are represented in Figs. 2and 3,
respectively.
Eyeworm
In the eyeworm experimental group, pro-inflammatory cyto-
kines of IL1β,IL6,IFNα, and IFNγexhibited upregulation at
days 7 and 28 following primary and secondary challenge
with its glycoproteins as related to the control group (Fig. 2).
There was a statistically significant difference inIL1βat day 7
with upregulation greater (78.74-fold) than the other pro-
inflammatory cytokines, IL6, IFNα, and IFNγ.However,at
day 28, there was a statistically significant difference in IL6
expression with upregulation of 123.82-fold. In contrast, IL1β
had a reduced fold change (27.47-fold) at day 28 as compared
with day 7. There was no significant variation in IFNαex-
pression between day 7 (5.25-fold) and day 28 (8.49-fold
change) and little variation in IFNγexpression on either
day. The regulatory cytokine, IL10, displayed increased
expression at day 7 and day 28 as well. Further, IL10 gene
expression was statistically significant as compared with the
control birds on day 7 and day 28. TLR7 transcripts showed a
statistically significant increase in expression level (73.8-fold
change) compared with control at day 7 following primary
challenge (Fig. 2). There was a decline (38.71-fold change)
in TLR7 mRNA expression after secondary challenge at day
28.
Caecal worm
Results of gene expression between the experimental group
treated with caecal worm and the control birds on days 7 and
28 are represented in Fig. 3. The pro-inflammatory cytokines all
showed a low expression level after day 7, with increased ex-
pression at day 28. Among all pro-inflammatory cytokines, IL6
has the highest expression level (173.7-fold) following second-
ary challenge at day 28. Similarly, anti-inflammatory cytokine
IL10 was upregulated on day 28. TLR7 gene showed a low
expression at day 7 following primary challenge, whereas in-
creased expression was seen by day 28 following secondary
challenge. All the pro- and anti-inflammatory cytokine expres-
sions were statistically significant except IFNγat day 28.
Discussion
This preliminary study is the first to design and optimize
qPCR primers for bobwhite cytokines and TLR7 from the
sequenced bobwhite genome documented in Halley et al.
(2014) and Oldeschulte et al. (2017). It is also the first study
to experimentally challenge bobwhite with eyeworm and cae-
cal worm glycoproteins where it was verified that changes in
gene expression could be accomplished by qPCR with the
designed primers. While a challenge experiment with glyco-
proteins may not exactly reflect the immune response of bob-
white infected with these parasites, these primers and qPCR
methods could be utilized in future experiments with parasit-
ized bobwhite in the laboratory. The following discussion will
focus on the changes in gene expression observed and what
these changes might mean if seen in parasitized bobwhite.
For eyeworms, gene expression at day 7 resulted in statis-
tically significant upregulation of TLR7. In humans, TLR ac-
tivation is typically related to strong inflammation and is re-
sponsible for signaling the presence of a pathogen and tissue
damage to the immune system (Alzabin et al. 2012). TLR7
has also been related to detection of bacterial and viral nucleic
acids in humans (Uematsu and Akira 2006) which is similar to
the role of TLR7 in birds (Philibin et al., 2005; Abdul-Cader
et al. 2016). Interestingly, Abdul-Cader et al. (2018) found
that stimulation of avian macrophages at the TLR7 ligand
induced an anti-viral response in the form of an increase in
IL1βexpression. IL1βactivates the avian immune system in
Parasitol Res
an acute-phase response, typically leading to inflammation
and fevers (Wigley and Kaiser 2003Kaiser & Stäheli, 2014).
With the expressions of both TLR7 and IL1β, the combined
reaction may signify an acute inflammatory response. These
results may coincide with inflammation in lacrimal ducts, le-
sions on the Harderian gland, and keratitis observed in bob-
white infected with eyeworms (Bruno et al. 2015;Dunham
et al. 2016).
The resulting upregulation of the anti-inflammatory cyto-
kine, IL10 (Kaiser & Stäheli, 2014), at day 7 after challenge
with eyeworm glycoproteins may signify a reaction to inflam-
mation. IL10 expression is associated with the induction of an
antibody or humoral immune response (Wigley and Kaiser
2003) which may also be occurring at day 7 with the expres-
sion of IL10. Lastly, the lack of significance in IFNα,ananti-
viral cytokine in chicken (Pei et al. 2001), but concurrent
Fig. 1 SDS-PAGE pattern of Con
A–purified native glycoproteins
from eyeworm and caecal worm
used in experimental challenge.
Lane 1: Caecal worm (pooled
elutes 1 and 2); lane 2: Marker;
lane 3: Eyeworm (pooled elutes 1
and 2)
Parasitol Res
0
20
40
60
80
100
120
7th Day 28th Day
Fold change
Days
IL1β
0
50
100
150
200
7th Day 28th Day
Fold change
Days
IL6
0
2
4
6
8
10
12
7th Day 28th Day
Fold change
Days
IFNα
0
10
20
30
40
50
60
70
7th Day 28th Day
Fold change
Days
IFNγ
0
20
40
60
80
100
120
140
7th Day 28th Day
Fold change
Days
IL10
0
20
40
60
80
100
7th Day 28th Day
Fold change
Days
TLR7
Eyeworm O. petrowi
Proinflammatory cytokines
Regulatory cytokines Toll Like Receptors
*
*
*
*
*
*
*
*
Fig. 2 Gene expression analysis of pro-inflammatory (IL1β,IL6,IFNα,
IFNγ), regulatory cytokines (IL10), and toll-like receptor (TLR7) mRNA
levels in lymphocytes of bobwhite quail after primary and secondary
challenges with Con A–purified eyeworm glycoproteins. Statistical sig-
nificance was assessed using Student ttest and Mann-Whitney Utest
(*P<0.01)
0
10
20
30
40
50
7th Day 28th Day
Fold change
Days
IL1β
0
50
100
150
200
250
300
7th Day 28th Day
Fold change
Days
IL6
0
10
20
30
40
50
60
70
7th Day 28th Day
Fold change
Days
IL10
0
10
20
30
40
50
7th Day 28th Day
Fold change
Days
TLR7
0
10
20
30
40
50
7th Day 28th Day
Fold change
Days
IFNα
0
5
10
15
20
25
30
7th Day 28th Day
Fold change
Days
IFNγ
Caecal worm A. pennula
Proinflammatory cytokines
Regulatory cytokines Toll Like Receptors
***
**
Fig. 3 Gene expression analysis of pro-inflammatory (IL1β,IL6,IFNα,
and IFNγ), regulatory cytokine (IL10), and toll-like receptor (TLR7)
mRNA levels in lymphocytes of bobwhite quail after primary and
secondary challenges with Con A–purified caecal worm glycoproteins.
Statistical significance was assessed using Student ttest (*P<0.01)
Parasitol Res
upregulation of TLR7 between the treated and untreated
groups may suggest that eyeworm glycoproteins have few
specifically viral properties to the bobwhite immune system.
At day 28, there is a statistically significant upregulation,
albeit lower, in TLR7 and IL1βexpressions. Based on these
results of persistent upregulation in inflammatory cytokines, it
is possible that this reaction further coincides with pathological
investigations. However, the lower levels of upregulation in
TLR7 and IL1βat day 28 may be linked to the resulting up-
regulation in IL6, IL10, and IFNγ.LikeIL1β, IL6 is often
released by the avian immune system in response to inflamma-
tory stimuli (Amrani et al. 1986). IL6 is also a multi-functional
cytokine in the avian immune system that is involved in acute-
phase responses and immune regulation (Kishimoto et al. 1995;
Wigley and Kaiser 2003). Given IL6’s inflammatory properties,
this may also be in response to a prolonged inflammatory reac-
tion that was followed by an increase in anti-inflammatory ex-
pression from IL10. In the chicken, IL6 has also been associat-
ed with infectious diseases including Eimeria infections
(Lynagh et al. 2000)andSalmonella enterica (Kaiser et al.
2000). Additionally, the expression of IL6 may be related to
the properties of IL6 that have been linked to a susceptibility in
nematode infection (Smith and Maizels 2014). For example,
IL6-deficient mice were noted to have a significant increase
in worm burdens of filarial nematodes (Muhsin et al. 2018) like
those related to the eyeworm (Kalyanasundaram et al. 2018).
As for IFNγ, this pro-inflammatory cytokine is involved with
the induction of macrophages (Wigley and Kaiser 2003)and
controlling infections with intracellular pathogens in the avian
immune system (Kaiser & Stäheli, 2014). The upregulation of
IFNγseen at day 28 may be the bobwhite immune system’s
attempt to control the invasion of eyeworm glycoproteins via
macrophages.
Interestingly, bobwhite treated with caecal worm glycopro-
teins had a reduced expression at day 7, whereas there was a
significant upregulation in most all genes by day 28. On day 28,
with the expression of TLR7, there was an accompanying up-
regulation of pro-inflammatory cytokines, except IFNγ,and
IL10. Similar to the bobwhite response to eyeworm glycopro-
teins, bobwhite challenged with caecal worm glycoproteins
may be associated with anti-inflammatory cytokine expression
to reduce the cellular stress created by pro-inflammatory cyto-
kines from helminth infections (Maizels and Yazdanbakhsh
2003). Considering the roles of each cytokine and TLR7 in
the avian immune system, the response of bobwhite to the
experimental challenge of eyeworm and caecal worm glycopro-
teins may suggest potential immune impacts. However, with
the lack of expression at day 7 and subsequently increased
expression at day 28, these results may suggest that cytokine
and TLR response to caecal worm infection may best be ob-
served in a chronic experimental infection.
In the wild, bobwhite of the Rolling Plains is likely subject
to chronic infection due to the long-lived nature of helminths
such as the eyeworm and caecal worm. Chronic infection of a
parasite is related to the tolerance of the host to maintain
infection at a level below damage (Schmid-Hempel 2009).
However, chronic infection of helminth infections may be
related to the parasite’s ability to evade the immune system
(Maizels et al. 2004; Schmid-Hempel 2009), and prolonged
infection from helminths can lead to inflammatory disorders
and delayed pathology in humans (Bethony et al. 2006;King
2007). Filarial parasites have also been linked to impaired pro-
inflammatory cytokines and a strong response in regulatory
cytokines(Hoeraufetal.2001;Kingetal.1993).
However, assessing the effects of chronic infection was out
of the scope of this study; a long-term study would be valuable
to understand how these parasites impact bobwhite. Future
studies would also benefit if other genes that are commonly
expressed in helminth infections, such as IL4 (Maizels et al.
2004), were designed and optimized. Nevertheless, this study
is valuable as it gives insight into a new avian species with the
optimization of qPCR primers for 6 new immune genes of
bobwhite. Although the results presented here may not be
conclusive, there was a measurable response of these genes
to the intramuscular challenge of eyeworm and caecal worm
glycoproteins showing the usefulness of these genes for future
work. Lastly, future work should include experimentally in-
fected or infected wild bird species to better understand the
role of cytokines and TLRs in species besides poultry.
Funding information This research received funding and support form
Park Cities Quail Coalition and the Rolling Plains Quail Research
Foundation.
Compliance with ethical standards This study contains no
conflicts of interest. This experiment was approved by Texas Tech
University Animal Care and Use Committee under protocol number
18044-05 and 16071-08 for bobwhite collection. All bobwhites were
trapped and handled according to Texas Parks and Wildlife permit SPR-
0715-095.
Conflict of interest The authors declare that they have no conflicts of
interest.
References
Abdul-Cader MS, Amarasinghe A, Abdul-Careem MF (2016) Activation
of toll-like receptor signaling pathways leading to nitric oxide-
mediated antiviral responses. Arch Virol 161:2075–2086
Abdul-Cader MS, Senapathi UDS, Nagy E, Sharif S, Abdul-Careem MF
(2018) Antiviral response elicited against avian influenza virus in-
fection following activation of toll-like receptor (TLR)7 signaling
pathway is attributable to interleukin (IL)-1βproduction. BMC Res
Notes 11:859
Addison EM, Anderson RC (1969) A review of eye worms of the genus
Oxyspirura (Nematoda: Spiruroidea). J Wildl Dis 55:1–58
Albonico M, Allen H, Chitsulo L, Engels D, Gabrielli A-F, Savioli L (2008)
Controlling soil-transmitted helminthiasis in pre-school-age children
through preventive chemotherapy. PLoS Negl Trop Dis 2:e126
Parasitol Res
Alves CR, Silva FS, Oliveira-Junior FO, Pereira BAS, Pires FA, MCS P
(2012) Affinity-based methods for the separation of parasite pro-
teins. In: Magdeldin S (ed) Affinity Chromatography. InTech,
Rijeka, Croatia, pp 333–356
Alzabin S, Kong P, Medghalchi M, Palfreeman A, Williams R, Sacre S
(2012) Investigation of the role of endosomal toll-like receptors in
murine collagen-induced arthritis reveals a potential role for TLR7
in disease maintenance. Arthritis Res Ther 14:R142
Amrani DL, Mauzy-Melitz D, Mosesson MW (1986) Effect of
hepatocyte-stimulating factor and glucocorticoids on plasma fibro-
nectin levels. Biochem J 238:365–371
Appleton JA, Bell RG, Homan W, Van Knapen F (1991) Consensus on
Trichinella spiralis antigens and antibodies. Parasitol Today 7:190–192
Babu S, Nutman TB (2003) Proinflammatory cytokines dominate the early
immune response to filarial parasites. J Immunol 171:6723–6732
Barua P, Barua N, Hazarika NK, Das S (2005) Loa loa in the anterior
chamber of the eye: a case report. Indian J Med Microbiol 23:59–60
Behnke JM, Barnard CJ, Wakelin D (1992) Understanding chronic nem-
atode infections: evolutionary considerations, current hypotheses
and the way forward. Int J Parasitol 22:861–907
Bethony J, Brooker S, Albonico M, Geiger SM, Loukas A, Diemert D,
Hotez PJ (2006) Soil-transmitted helminth infections: ascariasis,
trichuriasis, and hookworm. Lancet 367:1521–1532
Bruno A, Fedynich AM, Smith-Herron A, Rollins D (2015) Pathological
response of Northern bobwhites to Oxyspirura petrowi infections. J
Parasitol 101:364–368
Bruno A, Fedynich AM, Rollins D, Wester DB (2018) Helminth com-
munities and host dynamics in Northern bobwhites from the Rolling
Plains Ecoregion, USA. J. Helminthol 29:1–7
Brym MZ, Henry C, Kendall RJ (2018) Elevated parasite burdens as a
potential mechanism affecting Northern bobwhite (Colinus
virginianus) population dynamics in the Rolling Plains of West
Texas. Parasitol Res 117:1683–1688
Chandler AC (1935) A new genus and species of Subulurinae
(Nematodes). Trans Am Microsc Soc 54:33–35
Charlier J, Soenen K, De Roeck E, Hantson W, Ducheyne E, Van Coillie
F, De Wulf R, Hendrickx G, Vercruysse J (2014) Longitudinal study
on the temporal and micro-spatial distribution of Galba truncatula
in four farms in Belgium as a base for small-scale risk mapping of
Fasciola hepatica. Parasit Vectors 7:528
Christe P, Møller AP, de Lope F (1998) Immuno-competence and nestling
survival in the house martin: the tasty chick hypothesis. Oikos 83:
175–179
Commons KA, Blanchard KR, BrymMZ, Henry C, Kalyanasundaram A,
Skinner K, Kendall RJ (2019) Monitoring Northern bobwhite
(Colinus virginianus) populations in the Rolling Plains of Texas:
Implications of parasitic infection. Rangeland Ecology and
Management. https://doi.org/10.1016/j.rama.2019.04.004
Cram EB (1937) A review of the genus Oxyspirura, with a morphological
study of O. petrowi Skrjabin 1929, recently discovered in galliform
birds of the Northern United States. In Papers on Helminthology
Published in Commemoration of the 30 Year Jubileum of K. I.
Skrjabin and of the 15th Anniversary of the All-Union Institute of
Helminthology, Moscow, pp 89–98
Cummings RD, Nyame AK (1996) Glycobiology of schistosomiasis. The
FASEB J 10:838–848
van Die I, Cummings RD (2010) Glycan gimmickry by parasitic hel-
minths: a strategy for modulating the host immune response?
Glycobiology 20:2–12
Dunham NR, Soliz LA, Fedynich AM, Rollins D, Kendall RJ (2014)
Evidence of an Oxyspirura petrowi epizootic in Northern bobwhites
(Colinus virginianus). J Wildl Dis 50:552–558
Dunham NR, Bruno A, Almas S, Rollins D, Fedynich AM, Presley SM,
Kendall RJ (2016) Eyeworms (Oxyspirura petrowi) in Northern
bobwhite (Colinus virginianus) from the Rolling Plains of Texas
and Oklahoma, 2011–2013. J Wildl Dis 52:562–567
Dunham NR, Peper ST, Downing C, Brake E, Rollins D, Kendall RJ
(2017a) Infection levels of eyeworm Oxyspirura petrowi and caecal
worm Aulonocephalus pennula in the Northern bobwhite and scaled
quail from the Rolling Plains of Texas. J Helminthol 91:569–577
Dunham NR, Henry C, Brym M, Rollins D, Helman RG, Kendall RJ
(2017b) Caecal worm, Aulonocephalus pennula, infection in the
Northern bobwhite quail, Colinus virginianus. Int J Parasitol
Parasites Wildl 6:35–38
Greter H, Cowan N, Ngandolo BN, Kessely H, Alfaroukh IO, Utzinger J,
Keiser J, Zinsstag J (2017) Treatment of human and livestock hel-
minth infections in a mobile pastoralist setting at Lake Chad:
Attitudes to health and analysis of active pharmaceutical ingredients
of locally available anthelminthic drugs. Acta Trop 175:91–99
Guthery FS (2002) The technology of bobwhite management. Iowa State
Press, Ames
Halley YA, Dowd SE, Decker JE, Seabury PM, Bhattarai E (2014) A
draft de novo genome assembly for the Northern bobwhite (Colinus
virginianus) reveals evidence for a rapid decline in effective popu-
lation size beginning in the late Pleistocene. PLoS One 9:e90240
Haslam SM, Khoo KH, Houston KM, Harnett W, Morris HR, Dell A
(1997) Characterisation of the phosphorylcholine-containing N-
linked oligosaccharides in the excretory-secretory 62 kDa glycopro-
tein of Acanthocheilonema viteae. Mol Biochem Parasitol 85:53–66
Henry C, Brym MZ, Kendall RJ (2017) Oxyspirura petrowi and
Aulonocephalus pennula infection in wild Northern bobwhite quail
in the Rolling Plains Ecoregion, Texas: possible evidence of a die-
off. Arch Parasitol 1:2
Hernández F, Guthery FS, Kuvlesky WP Jr (2002) The legacy of bob-
white research in south Texas. J Wildl Manag 66:1–18
Hernández F, Brennan LA, DeMaso SJ, Sands JP, Wester DB (2013) On
reversing the Northern bobwhite population decline: 20 years later.
Wildl Soc Bull 37:177–188
Hewitson JP, Grainger JR, Maizels RM (2009) Helminth immunoregula-
tion: the role of parasite secreted proteins in modulating host immu-
nity. Mol Biochem Parasitol 167:1–11
Hoerauf A, Mand S, Adjei O, Fleischer B, Buttner DW (2001) Depletion of
Wolbachia endobacteria in Onchocerca volvulus by doxycycline and
microfilaridermia after ivermectin treatment. Lancet 357:1415–1416
Holly FJ, Lemp MA (1977) Tear physiology and dry eyes. Surv
Ophthalmol 22:69–87
Hotez PJ, Brindley PJ, Bethony JM, King CH, Pearce EJ, Jacobson J
(2008) Helminth infections: the great neglected tropical diseases. J
Clin Invest 118:1311–1321
Hudson PJ, Newborn D, Dobson AP (1992) Regulation and stability of a
free-living host-parasite system: Trichostrongylus tenuis in red
grouse. I. Monitoring and parasite reduction experiments. J Anim
Ecol 61:477–486
Jackson AS (1969) Quail management handbook for West Texas Rolling
Plains. Bulletin Number 48. Texas Parks and Wildlife Department,
Austin
Johnson JL, Rollins D, Reyna KS (2012) What’s a quail worth? A lon-
gitudinal assessment of quail hunter demographics, attitudes, and
spending habits in Texas. Proc Nat Quail Sym 7:294–299
Kaiser P, Balic A (2015) The avian immune system. In: Scanes CG (ed)
Sturkie’s Avian Physiology. Academic Press, USA, pp 403–418
Kaiser P, Stäheli P (2014) Avian Cytokines and Chemokines. In: Schat
KA, Kaspers B, Kaiser P (eds) Avian Immunology, 2nd edn.
Academic Press, Amsterdam, pp 189–204
Kaiser P, Rothwell L, Galyov EE, Barrow PA, Burnside J, Wigley P
(2000) Differential cytokine expression in avian cells in response
to invasion by Salmanella typhimurium,Salmonella enteritidis,and
Salmonella gallinarum. Microbiology 12:3217–3226
Kalyanasundaram A, Blanchard KR, Kendall RJ (2017) Molecular iden-
tification and characterization of partial COX1 gene from caecal
worm (Aulonocephalus pennula) in Northern bobwhite (Colinus
Parasitol Res
virginianus) from the Rolling Plains Ecoregion of Texas. Int J
Parasitol Parasites Wildl 6:195–201
Kalyanasundaram A, Blanchard KR, Henry C, Brym MZ, Kendall RJ
(2018) Phylogenetic analysis of eyeworm (Oxyspirura petrowi)in
Northern bobwhite quail (Colinus virginianus) based on the nuclear
18S rDNA and mitochondrial cytochrome oxidase 1 gene (COX1).
Parasitology Open 15:65–70
Kamal SM, Khalifa KES (2006) Immune modulation by helminthic in-
fections: worms and viral infections. Parasite Immunol 28:483–496
Kellogg FE, Prestwood AE (1968) Gastrointestinal helminths from wild
and pen-raised bobwhite. J Wildl Manag 32:468–475
Killpack TL, Karasov WH (2012) Ontogeny of adaptive antibody re-
sponse to a model antigen in captive altricial zebra finches. PLoS
One 7:e47294
King CH (2007) Lifting the burden of schistosomiasis –defining ele-
ments of infection–associated disease and the benefits of anti-
parasite treatment. J Infect Dis 196:653–655
King CL, Mahanty S, Kumaraswami V, Abrams SS, Regunathan J,
Ottesen EA, Nutman TB (1993) Cytokine control of parasite-
specific anergy in human lymphatic filariasis. Preferential induction
of a regulatory T helper type 2 lymphocyte subset. J Clin Invest 92:
1667–1673
Kishimoto T, Akira S, Narazaki M, Taga T (1995) Interleukin-6 family of
cytokines and gp130. Blood 86:1243–1254
Kistler WM, Parlos JA, Peper ST, Dunham NR, Kendall RJ (2016) A
quantitative PCR protocol for detection of Oxyspirura petrowi in
Northern bobwhites (Colinus virginianus). PLoS One 11:e0166309
Kopko SH, Martin DS, Barta JR (2000) Responses of chickens to a
recombinant refractile body antigen of Eimeria tenella administered
using various immunizing strategies. Poult Sci 79:336–342
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2−ΔΔCT method.
Method s 25:402–408
Lochmiller RL, Vestey MR, Boren JC (1993) Relationship between pro-
tein nutritional status and immuno-competence in Northern bob-
white chicks. Auk 110:503–510
Lung NP, Thompson JP, Kollias GV Jr, Olsen JH, Zdziarski JM, Klein PA
(1996) Maternal immunoglobulin G antibody transfer and develop-
ment of immunoglobulin G antibody responses in blue and gold
macaw (Ara ararauna) chicks. Am J Vet Res 57:1162–1167
Lynagh GR, Bailey M, Kaiser P (2000) Interleukin-6 is produced during
both murine and avian Eimeria infections. Vet Immunol
Immunopathol 76:89–102
Maizels RM, Yazdanbakhsh M (2003) Immune regulation by helminth
parasites: cellular and molecular mechanisms. Nature Rev.
Immunol 3:733–744
Maizels RM, Balic A, Gomez-Escobar N, Nair M, Taylor MD, Allen JE
(2004) Helminth parasites: masters of regulation. Immunol Rev.
201:89–116
McClure HE (1949) The eyeworm, Oxyspirura petrowi, in Nebraska
pheasants. J Wildl Manag 13:304–307
Mogensen TH (2009) Pathogen recognition and inflammatory signaling
in innate immune defenses. Clin Microbiol Rev. 22:240–273
Mosser DM, Karp CL (1999) Receptor mediated subversion of macro-
phage cytokine production by intracellular pathogens. Curr Opin
Immunol 11:406–411
Muhsin M, Ajendra J, Gentil K, Berbudi A, Neumann AL, Klaas L,
Schmidt KE, Hoerauf A, Hübner MP (2018) IL-6 is required for
protective immune responses against early filarial infection. Int J
Parasitol 48:925–935
Munn EA, Greenwood CA, Coadwell WJ (1987) Vaccination of young
lambs by means of a protein fraction extracted from adult
Haemonchus contortus. Parasitol 94:385–397
Nayak B, Sinha S, Nayak L (2016) Loa loa in the vitreous cavity of the
eye. BMJ Case Rep. https://doi.org/10.1136/bcr-2015-213,879
Nordling D, Andersson M, Zohari S, Gustafsson L (1998) Reproductive
effort reduces specific immune response and parasite resistance.
Proc R Soc Lond B 265:1291–1298
Oldeschulte DL, Halley YA, Wilson ML, Bhattarai EK, Brashear W, Hill
J, Metz RP, Johnson CD, Rollins D, Peterson MJ, Bickhart DM,
Decker JE, Sewell JF, Seabury CM (2017) Annotated draft genome
assemblies for the Northern bobwhite (Colinus virginianus) and the
Scaled quail (Callipepla squamata) reveal disparate estimates of
modern genome diversity and historic effective population size.
G3 (Bethesda) 7:3047–3058
Payne AP (1994) The Harderian gland: a tercentennial review. J Anat
185:1–49
Pei J, Sekellick MJ, Marcus PI, Choi IS, Collisson EW (2001) Chicken
interferon type I inhibits infectious bronchitis virus replication and as-
sociated respiratory illness. J Interferon Cytokine Res 21:1071–1077
Pence DB (1972) The genus Oxyspirura (Nematoda:Thelaziidae) from
birds in Louisiana. Proc Helminthol Soc Wash 39:23–28
Philibin VJ, Iqbal M, Boyd Y, Goodchild MJ, Beal RK, Bumstead N,
Young J, Smith AL (2005) Identification and characterization of a
functional, alternatively spliced toll-like receptor 7 (TLR7) and ge-
nomic disruption of TLR8 in chickens. Immunology 114:507–521
Robel RJ, Walker TL, Hagen CA, Ridley RK, Kemp KE, Applegate RD
(2003) Helminth parasites of the lesser prairie-chicken in southwest-
ern Kansas: incidence, burdens, and effects. Wild Biol 9:341–350
Rollins D (1980) Comparative ecology of bobwhite and scaled quail in
mesquite grassland habitats. M. S. Thesis Oklahoma State University,
Stillwater, Oklahoma, USA
Saino N, Calza S, Møller AP (1997) Immuno-competence of nestling
barn swallows in relation to brood size and parental effort. J Anim
Ecol 66:827–836
Sauer JR, Link WA, Fallon JE, Pardieck KL, Ziolkowski DJ Jr (2013)
The North American breeding bird survey 1966–2011: summary
analysis and species accounts. N Am Fauna 79:1–32
Saunders GB (1935) Michigan’s studies of sharp-tailed grouse. In
Transactions of the American Game Conference 21:342–344
Schmid-Hempel P (2009) Immune defence, parasite evasion strategies
and their relevance for macroscopic phenomena such as virulence.
Philos Trans R Soc Lond B Biol Sci 364:85–98
Smith KA, Maizels RM (2014) IL-6 controls susceptibility to helminth
infection by impeding Th2 responsiveness and altering the Treg
phenotype in vivo. Eur J Immunol 44:150–161
Turner PV, Brabb T, Pekow C, Vasbinder MA (2011) Administration of
substances to laboratory animals: routes of administration and fac-
tors to consider. J Am Assoc Lab Anim Sci 50:600–613
Uematsu S, Akira S (2006) Toll-like receptors and innate immunity. J Mol
Med 84:712–725
Umar S, Arif M, Shah MAA, Munir MT, Yaqoob M, Ahmed S, Khan MI,
Younus M, Shahzad M (2015) Application of avian cytokines as
immuno-modulating agents. World Poultry Sci J 71:643–653
Whelan M, Harnett MM, Houston KM, Patel V, Harnett W, Rigley KP
(2000) A filarial nematode-secreted product signals dendritic cells to
acquire a phenotype that drives development of Th2 cells. J
Immunol 164:6453–6460
Wigley P, Kaiser P (2003) Avian cytokines in health and disease.
Brazilian J Poult Sci 5:1–14
Yu AT, Blackburn BG (2019) Soil-transmitted helminths: Ascaris,
Trichurus, and hookworm infections. In: Selendy JMH, Farmer P,
Fawzi W (eds) Water and sanitation-related diseases and changing
environment: challenges, interventions, and preventative measures,
2nd edn. Wiley, New York, pp 95–110
Publisher’snoteSpringer Nature remains neutral with regard to
jurisdictional claims in published maps and institutional affiliations.
Parasitol Res
A preview of this full-text is provided by Springer Nature.
Content available from Parasitology Research
This content is subject to copyright. Terms and conditions apply.
