Mutations in CalDAG-GEFI Lead to Striatal Signaling Deficits and Psychomotor Symptoms in Multiple Species Including Human

Abstract

Syndromes caused by mutations in Ras-MAP kinase signaling molecules are known as RASopathies and share features such as developmental delay, autistic traits, and cancer. Syndromic features of Rap-MAP kinase signaling defects remain undefined. CalDAG-GEFI is a calcium-responsive Rap-GTPase activator that is enriched in the matrix of the sensorimotor striatum and down-regulated in Huntington's disease. We show here that CalDAG-GEFI mutations, including striatum-specific deletions and spontaneous mutations in the enzymatic domain, are associated with psychomotor phenotypes in humans, dogs and mice. The identification of these neural mutants was guided by the overt bleeding phenotype in CalDAG-GEFI knockout mice, and then in humans and other species with conserved platelet signaling deficits. Knockout mice exhibit loss of striatal long-term potentiation and deficits in dopamine, acetylcholine and glutamate signaling, along with delayed motor learning and drug-induced perseverative behaviors. Thus, loss of CalDAG-GEFI signaling produces an evolutionarily conserved syndrome characterized by bleeding and psychomotor dysfunction.

Full text

1
Mutations in CalDAG-GEFI Lead to Striatal Signaling Deficits and Psychomotor
Symptoms in Multiple Species Including Human
Jill R. Crittenden1, 2, Magdalena Sauvage1, 3, Takashi Kitsukawa4, Eric Burguière1, 5,
Carlos Cepeda6, Véronique M. André6, Matthias Canault7, Morgane Thomsen8, 16, Hui
Zhang9, 10, Cinzia Costa11, Giuseppina Martella12, Veronica Ghiglieri12, 13, Karen A.
Pescatore14, Ellen M. Unterwald14, Walker Jackson15, David E. Housman2, S. Barak
Caine16, David Sulzer9, Paolo Calabresi11, 12, Michael S. Levine6, Christine Brefel-
Courbon17, Anne C. Smith18, Marie-Christine Alessi7, Jean-Phillipe Azulay19, Ann M.
Graybiel1,20*
1McGovern Institute for Brain Research and Dept. of Brain and Cognitive Sciences, MIT,
Cambridge, MA 02139 USA
2Koch Institute for Integrative Cancer Research, MIT, Cambridge, MA 02139 USA
3Leibniz Institute for Neurobiology, Functional Architecture of Memory Dept.,
Magdeburg, Germany
4 Graduate School of Frontier Biosciences, Osaka University, Osaka, Japan
5Brain and Spine Institute (ICM), CNRS UMR 7225, INSERM U 1127, UPMC-P6 UMR S
1127, Hôpital de la Pitié-Salpêtrière, Paris, France
6Intellectual and Developmental Disabilities Research Center, Jane and Terry Semel
Institute for Neuroscience and Human Behavior, UCLA, Los Angeles, CA 90095 USA
7Aix-Marseille University, INSERM, INRA, C2VN, Marseille, France
8Laboratory of Neuropsychiatry, Psychiatric Centre Copenhagen and University of

2
Copenhagen, DK-2100, Copenhagen, Denmark
9Departments of Psychiatry, Pharmacology, Neurology, Columbia University, New York
State Psychiatric Institute, New York, NY 10032 USA
10Department of Neuroscience, Thomas Jefferson University, Philadelphia, PA 19107
USA
11 Neurological Clinic, Department of Medicine, Hospital Santa Maria della misericordia,
University of Perugia, 06100 Perugia, Italy
12Fondazione Santa Lucia, IRCCS, Rome, Italy
13Department of Philosophy, Human, Social and Educational Sciences, University of
Perugia, 06100 Perugia, Italy
14Department of Pharmacology and Center for Substance Abuse Research, Temple
University School of Medicine, Philadelphia, PA 19140 USA
15Wallenberg Center for Molecular Medicine, Department of Clinical and Experimental
Medicine, Linköping University, 581 83 Linköping, Sweden
16Basic Neuroscience Division, McLean Hospital/Harvard Medical School, Belmont, MA,
USA
17Laboratoire de Pharmacologie Médicale et Clinique, INSERM U 455, Toulouse,
France
18Evelyn F. McKnight Brain Institute, University of Arizona, Tucson, AZ 85724 USA
19Department of Clinical Neurosciences, Aix-Marseille University, AP-HM, Marseille,
France
20Lead Contact
*Correspondence: graybiel@mit.edu

3
SUMMARY
Syndromes caused by mutations in Ras-MAP kinase signaling molecules are known as
RASopathies and share features such as developmental delay, autistic traits, and
cancer. Syndromic features of Rap-MAP kinase signaling defects remain undefined.
CalDAG-GEFI is a calcium-responsive Rap-GTPase activator that is enriched in the
matrix of the sensorimotor striatum and down-regulated in Huntington’s disease. We
show here that CalDAG-GEFI mutations, including striatum-specific deletions and
spontaneous mutations in the enzymatic domain, are associated with psychomotor
phenotypes in humans, dogs and mice. The identification of these neural mutants was
guided by the overt bleeding phenotype in CalDAG-GEFI knockout mice, and then in
humans and other species with conserved platelet signaling deficits. Knockout mice
exhibit loss of striatal long-term potentiation and deficits in dopamine, acetylcholine and
glutamate signaling, along with delayed motor learning and drug-induced perseverative
behaviors. Thus, loss of CalDAG-GEFI signaling produces an evolutionarily conserved
syndrome characterized by bleeding and psychomotor dysfunction.
KEYWORDS
Rap1, stereotypy, Huntington’s disease, amphetamine, platelet, Rasopathy,
sensorimotor, striatal learning, drug addiction

4
INTRODUCTION
Upon binding to calcium, the guanine nucleotide exchange factor (GEF) activity of
CalDAG-GEFI (CDGI) targets Rap-family small G proteins that subsequently drive
integrin-adhesion to surface ligands, vesicle release, and mitogen-activated (MAP)
kinase activation in hematological cell types (Bergmeier et al., 2007; Crittenden et al.,
2004; Ghandour et al., 2007; Kawasaki et al., 1998; Lozano et al., 2016; Niemz et al.,
2017). We found that CDGI is strikingly enriched in the striatum (Kawasaki et al., 1998),
a key node in the basal ganglia. This observation led us to examine striatal levels of
CDGI in Parkinson’s disease and Huntington’s disease, disorders in which striatal
abnormalities are foundational etiologic factors for motor and mood symptoms. We
found strong down-regulation of CDGI expression in post-mortem tissue from the
striatum of Huntington’s disease patients (Crittenden et al., 2010) and in rodent models
of both Huntington’s disease and Parkinson’s disease (Crittenden et al., 2009;
Crittenden et al., 2010). The direct impacts of CDGI down-regulation in the striatum
have, however, remained untested.
To fill this gap, we engineered mice with selective CDGI deletion in the striatum and
mice with constitutive CDGI deletion. Alongside a detailed study of the CDGI-deficient
mice, we performed the first neurologic and cognitive assessments of humans with
deleterious CDGI mutations. We further tested the generalization of the behavioral
phenotypes in CDGI mutants by capitalizing on a loss-of-function CDGI mutation known
in Basset Hounds (Boudreaux et al., 2007). We report here behavioral abnormalities in
the humans, rodents and canines with blocked CDGI signaling, including motor and
psychomotor features in each species. In the mouse mutants, we tested for molecular

5
and cellular phenotypes in the striatum that could underlie these neurologic symptoms.
We found deficits in striatal plasticity, including loss of striatal long-term potentiation
(LTP), and deficits in dopamine and acetylcholine signaling. We conclude that CDGI
mutations disrupt cell-surface receptor signaling pathways in both striatal projection
neurons and in platelets to produce a syndrome with bleeding and psychomotor
symptoms that, with species-specific variations, are evolutionarily conserved from
mouse to human.
RESULTS
Genetic Engineering in Mice and Spontaneous Mutations in Humans and Hounds
Block CDGI Function
We engineered lines of mice with a constitutive or Cre-dependent stop codon near the
5’ end of CDGI (Figure S1). In brain tissue from the global knockout mice, we found
CDGI DNA and mRNA with the expected deletions and loss of CDGI protein expression
(Figures 1A-1F and Figure S1). To enable explicit testing of CDGI function in the post-
natal striatum, we crossed CDGIflox/flox mice to a mouse line in which striatal Cre activity
begins after birth (Lemberger et al., 2007) (Figure 1G).
We tested for loss of CDGI function and expression in humans discovered to have
CDGI mutations based on their presentation with a bleeding phenotype similar to that
which we earlier reported for CDGI knockout mice (Crittenden et al., 2004; Sevivas et
al., 2018; Westbury et al., 2017). We were able to evaluate individuals with four different
CDGI mutations, among the eighteen independent mutations so far identified (Table
S1). We confirmed that the enzymatic target of CDGI, Rap1, exhibited reduced

6
activation in platelets taken from all of the humans that carried bi-allelic CDGI mutations
(Figure S2 and Table S2), as previously reported in CDGI-deficient mice and in a subset
of the human patients (Crittenden et al., 2004; Westbury et al., 2017). Thus, all of these
mutations represent loss-of-function variants of CDGI. With the same C-terminus
antibody used to confirm deletion of CDGI in the mice (Crittenden et al., 2004), we
found that two of the three mutation combinations in the human patients resulted in
reduced CDGI expression (Figures 1H and 1J): a homozygous frameshift mutation
(N67L) and a double heterozygous condition with a premature stop codon in one allele
and a missense mutation in the other allele (E260*/C296R) (Westbury et al., 2017)
appeared to abolish CDGI protein expression. By contrast, we discovered that the
missense mutation G248W within the GEF domain did not block CDGI expression,
thereby providing a way to evaluate the consequences of specifically disrupting CDGI
enzymatic activity. These results defined a cohort of human subjects with which to
examine neurologic functions in relation to discoveries in mice harboring engineered
deletions of CDGI.
We further analyzed how CDGI expression is impacted by a 3 base-pair deletion that
codes for a conserved amino acid in the catalytic domain of CDGI known in Basset
Hounds (Boudreaux et al., 2007). CDGI protein expression was severely down-
regulated, but not completely blocked, by the mutation (Figures 1I and 1J) as assessed
for the first time with a knockout-validated antibody. Together, these results lay the
foundation for cross-species analysis of how loss-of-function CDGI mutations affect
behavior and striatal function.

7
CDGI Mutations Are Associated with Abnormal Striatum-Based Behaviors in Mice
We began by examining global CDGI knockout mice (Figure S3 and Tables S3-S6) and
found that they were fertile and that they had normal gross brain morphology and
expression of striatal protein markers, normal transcriptome-wide striatal mRNA
expression levels, normal levels of total striatal amino acids and biogenic amines and
normal dopamine receptor binding in the striatum. There were no differences between
CDGI knockouts and sibling controls in adult weight, daily chow consumption, rotarod
motor coordination, open field behavior, olfactory acuity, responses on a SHIRPA
(Rogers et al., 1997) neurological exam, bouts of defined gross motor activities
measured in a 24-hour home-cage scan of the mice, marble-burying behavior or social-
recognition memory. Thus, basic behaviors appeared normal in mice with a constitutive
knockout deletion in CDGI.
In tests of striatum-based learning, however, the CDGI mutant mice were impaired.
We employed a pair of maze tasks designed to assess differential striatal and
hippocampal learning strategies (mainly egocentric and allocentric, respectively)
(Packard and McGaugh, 1996). Control mice rapidly acquired an egocentric T-maze
task, but CDGI knockouts exhibited significantly delayed learning, (Figure 2A). The
CDGI knockout mice showed no deficits in the allocentric maze task, or in assays of
amygdaloid complex function (Figure S3).
We next tested the knockout mice on a sensitive peg-wheel running assay of striatal
learning (Kitsukawa et al., 2011; Nakamura et al., 2017) in which the arrangement of the
wheel’s left and right footstep pegs could be changed to test the ability of the mice to
learn different running patterns (Figures 2B and S3). Learning was measured as

8
reduced variance in the timing of paw-placement on the pegs. CDGI knockout mice
performed complex peg-running tasks as well as their sibling controls. When we clipped
their whiskers, however, challenging their sensory feed-back, the CDGI knockouts
learned the task more slowly, as measured by a higher variance in timing of paw-
placement relative to that of whisker-clipped controls. The unmasking of a motor
sequence learning phenotype in the CDGI knockout mice upon sensory deprivation is
consistent with a deficit in the processing of sensorimotor inputs that are known to favor
the matrix compartment (Figures 1D and 1E) in the dorsolateral striatum (Kincaid and
Wilson, 1996; Moussa et al., 2011; Packard and McGaugh, 1996). It is in this striatal
compartment in which CDGI is highly concentrated in the mouse striatum (Kawasaki et
al., 1998).
We then took a clue from the fact that animals exhibit confined, stereotypic
behavioral responses to high or repeated doses of psychomotor stimulants such as
amphetamine, but not to low doses, and that these behaviors reflect signaling in the
dorsal striatum (Canales and Graybiel, 2000; Crittenden and Graybiel, 2017; Kuczenski
and Segal, 1997). CDGI knockouts given high doses of d-amphetamine showed greater
levels of localized, focused stereotypies and less distance traveled than the wildtype
controls (Figures 2C, 2E, S4 and S5) on the very first day of drug treatment. CDGI
knockouts failed to exhibit the drug sensitization shown by wildtypes in response to a
final drug-challenge dose given after repeated drug treatments and a drug washout
period (Figures 2D, 2E, S4 and S5). Similar results were obtained in CDGIflox/flox mice
with Cre-mediated postnatal deletion (Figures S4 and S5). These results indicated that
CDGI acts to oppose drug-induced stereotypy and overly focused behavior.

9
The abnormal amphetamine response phenotype in the knockouts did not appear to
result from differential drug metabolism or from differential sensitivity to the neurotoxic
effects of repeated amphetamine injection, as judged by levels of serum amphetamine
or total striatal dopamine and its metabolite, homovanillic acid (HVA), measured after
amphetamine injection on the challenge day (Figure S4). Measurements of distance
traveled after injection of D1- and D2-type dopamine receptor agonists showed no
genotype differences (Figure S4), suggesting that direct downstream signaling from D1
and D2 dopamine receptors is intact in CDGI knockout mice. These findings could
indicate that the abnormal response of the mice to amphetamine was produced by a
circuit defect upstream or parallel to the dopamine receptor system.
Humans with CDGI Mutations Exhibit Signs Found in Humans with Basal-Ganglia
Related Circuit Disorders
We evaluated behavior in four men and five women aged from 19 to 61 years who carry
CDGI mutations (Figures 1H and 1J and Table 1). Of the nine individuals examined,
four were heterozygous and five were homozygous or double trans-heterozygous for a
mutation in CDGI (Canault et al., 2014). All of these mutations are within highly
conserved domains of the protein that are important for its exchange factor activity
(Figure 1J), domains that we targeted for deletion in the mouse.
The individuals with CDGI mutations exhibited a triad of psychomotor abnormalities
associated with basal ganglia dysfunction. Of the five individuals with mutations on both
chromosomes who were given neurological exams, three were diagnosed with mild
chorea and one with ataxia, movement abnormalities typical of basal ganglia

10
dysfunction. The heterozygotes either received a diagnosis of chorea (n = 1) or dystonia
(n = 1), or were scored as normal on motor exam (n = 2). Notably, six out of the seven
individuals who completed the cognitive tests were scored as having mild executive
dysfunction mainly affecting working memory, cognitive flexibility, attention and
slowness, despite the fact that two were engineers without apparent professional
difficulties. Five of the six individuals queried about addictive substance use confirmed
that they use tobacco, alcohol or cannabis. Finally, seven of the nine individuals
complained of insomnia, tiredness and/or anxiety. No abnormal repetitive behaviors
were reported, paralleling our findings in untreated CDGI knockout mice.
The abnormalities in these individuals were mild, but nonetheless they indicate that
humans with mutations affecting the enzymatic domain of CDGI have a syndromic
disorder consisting of not only an increased tendency for bleeding due to an
evolutionarily conserved failure in integrin-mediated platelet adhesion, but also motor,
cognitive and behavioral abnormalities.
CDGI Mutations Are Associated with Abnormal Behaviors across Species
With veterinarians, we identified a group of Basset Hounds that were either
homozygous for a CDGI mutation (n = 8) that disrupts CDGI protein expression (Figures
1I and 1J) or confirmed not to have the mutation (n = 16) (personal communication, Dr.
M. Boudreaux). The owners (n = 10) were given under single-blind conditions a C-
BARQ behavioral questionnaire (Hsu and Serpell, 2003) modified by the insertions of
eight questions related to the overly focused, repetitive behavioral phenotype of drug-
treated CDGI knockout mice. Of the 14 behavioral domains assessed, CDGI mutants

11
were rated as significantly different from non-mutant hounds in only two of the
categories queried: ‘perseverative behaviors’ including ‘difficulty to disrupt when
engaged’ and ‘persistent begging’ and ‘owner-directed aggression’ (Figures 3A and 3B).
This pre-clinical evidence added to the indications of abnormal psychomotor
behavior in CDGI deficient humans and engineered mice, and indicated that mutations
blocking CDGI activity produce a syndrome of species-modulated behavioral
abnormalities typically associated with basal ganglia dysfunction, and an accompanying
bleeding disorder, across species.
Spontaneous Activity and AMPA and NMDA Currents Are Abnormal in Striatal
Projection Neurons of CDGI Mutant Mice
We explored possible underlying signaling defects in the striatum of CDGI mutants by
examining the activity of the dominant class of striatal neurons, the spiny projection
neurons (SPNs, also called medium spiny neurons), which normally are enriched for
CDGI (Figures 1A-1C). We recorded their spontaneous activity and responses related
to glutamatergic, dopaminergic and cholinergic transmission, three key modulators of
SPN activity.
Whole-cell patch clamp recordings of SPNs in slices from CDGI knockout mice and
sibling controls indicated equivalent membrane capacitance, input resistance and time
constants (Table S7). By contrast, recordings of synaptic currents demonstrated a
significantly greater frequency of spontaneous excitatory post-synaptic currents
(EPSCs) in striatal slices from CDGI knockout mice than from controls under baseline
conditions and with bath-applied bicuculline, a GABA receptor blocker, and with 4-

12
aminopyridine, a potassium channel blocker that promotes neurotransmitter release
(Figure 4A). These results suggested an increase in presynaptic glutamate release in
the striatum of CDGI knockouts. In addition, there were significant changes in the
kinetics of spontaneous synaptic events. Half-width and decay times were significantly
reduced in SPNs from CDGI knockouts compared to controls (Figure 4B), and average
amplitude differences tended to be higher but this trend failed to reach significance
(−9.97 ± 0.45 pA in controls and −11.25 ± 1.23 pA in knockouts).
We next recorded from acutely dissociated striatal neurons to isolate postsynaptic
responses to AMPA and NMDA glutamate receptor activation. Basic membrane
properties were normal in dissociated SPNs from CDGI knockouts (Table S8). However,
average peak currents and current densities of the AMPA-mediated responses were
significantly greater in the knockouts than in wildtypes (Figure 4C). The peak NMDA-
mediated current was equivalent between genotypes, but current density was
significantly greater in knockouts, following normalization for cell capacitance (Figure
4D). These findings suggest that, at least in vitro, SPNs in CDGI mutants exhibited
abnormally high activity both spontaneously and in response to glutamatergic
stimulation.
Dopamine Signaling Is Abnormal in the Striatum of CDGI Mutant Mice
Dissociated SPNs from the CDGI knockout mice exhibited normal reductions of both
AMPA- and NMDA-mediated currents in response to the D2 dopamine receptor agonist,
quinpirole (Figures 4C and 4D). D1-type dopamine receptors were not examined for

13
technical reasons, but these results at least suggest normal post-synaptic D2-type
dopamine receptor modulation of excitatory SPN currents in CDGI knockouts.
However, with in vivo microdialysis in awake, resting CDGI mutants and controls,
extracellular dopamine levels in the striatum of the knockouts were half those of the
wildtypes (Figure 5A). There was also a trend for reduced striatal levels of the dopamine
catabolites dihydroxyphenylacetic acid (DOPAC) and HVA. We tested whether these
diminished levels of striatal dopamine reflected enhanced dopamine catabolism via
catechol-O-methyl transferase (COMT). We found equivalent COMT activity in striatal
tissue from knockouts and controls, after repeated saline or repeated amphetamine (14
mg/kg/day) treatments (Figure S4). Thus, the CDGI knockouts had reduced levels of
extracellular dopamine despite normal total striatal dopamine and HVA content and
apparently normal dopamine metabolism.
Finally, we used fast-scan cyclic voltammetry in striatal slice preparations (Figures
5B-5D) to test for dopamine release evoked in response to single stimuli and trains of
stimuli designed to emulate phasic firing (4 and 10 pulses of 100 Hz). The release with
single stimuli was equivalent in the knockouts and controls. The release with trains of
stimuli was nearly equivalent between genotypes, but with 10 pulses, there was 30%
lower release in knockouts than in wildtypes. Paired pulse depression was normal in
CDGI knockouts at inter-pulse intervals ranging from 1 to 60 sec. Together, these
findings indicate that evoked dopamine release was normal or slightly reduced in the
CDGI knockouts, suggesting that the deficiency in baseline extracellular levels of striatal
dopamine could arise from a circuit-level failure to excite the dopamine-containing

14
neurons or their axonal release sites rather than from factors intrinsic to the state of the
terminals.
Measurements of LTP and LTD Demonstrate Loss of LTP in the Striatum of CDGI
Mouse Mutants
Signaling through dopamine and NMDA receptors is key for corticostriatal plasticity
(Calabresi et al., 1992; Partridge et al., 2000; Shen et al., 2008) that is suggested to be
an electrophysiological correlate of behavioral plasticity (Centonze et al., 2006; Kreitzer
and Malenka, 2008). We tested for the presence of these mechanisms in CDGI
knockout mice and their littermate controls. In this preparation, we found similar resting
membrane potential, input resistance and responses to slow depolarizing ramp voltage
commands and current injections (Figure S6). Stimulation of cortical afferents induced
equivalent long-term depression (LTD) in the dorsolateral striatum in brain slices taken
from CDGI knockouts and sibling controls, as measured by intracellular recordings of
excitatory post-synaptic potentials (EPSPs) in SPNs (Figure 5E). SPNs in slices from
wildtype mice showed normal LTP when input fibers were stimulated in the absence of
magnesium, which blocks NMDA receptors (Calabresi et al., 1992). By contrast,
equivalent stimulation in striatal slices from knockout mice failed to induce LTP (Figure
5F).
We considered the possibility that the striatal LTP deficit in the knockouts resulted
from saturation of striatal LTP in these mice (Centonze et al., 2006). Such slices are
refractory to LTP induction, but they exhibit depotentiation with a protocol that can
reverse LTP. We subjected striatal slices from the knockouts and wildtypes to low-

15
frequency stimulation of cortical fibers, which reverses striatal LTP (Centonze et al.,
2006), but found equivalent responses in striatal slices from knockouts and wildtypes
(Figure 5G). Thus, SPNs from CDGI knockouts were not in a state of saturated LTP.
Striatal activity and LTP are strongly modulated by the M1 muscarinic acetylcholine
receptor (Calabresi et al., 1999; Perez-Burgos et al., 2010; Shen et al., 2007), which is
expressed in SPNs and other striatal cell types. In heterologous cell culture assays,
CDGI can signal downstream of the M1 muscarinic receptor (Guo et al., 2001). In our
experiments, LTP induction in wildtypes was blocked by the M1 inhibitor, pirenzepine
(Figure 5H) as expected (Calabresi et al., 1999), and application of pirenzepine to slices
from CDGI knockout mice did not change their lack of response to LTP induction
protocols. Thus, the blockade of M1 receptors in the wildtypes mimicked the loss of LT P
phenotype from CDGI genetic deletion. These findings are consistent with CDGI
signaling downstream of the M1 muscarinic receptor in SPNs to mediate corticostriatal
LTP.
CDGI Knockout Mice Exhibit Deficits in Behavioral Modulation by the Muscarinic
M1 Receptor
Given the repetitive behaviors in the hounds and drug-treated CDGI mutant mice, the
established links between repetitive behaviors and M1 receptor signaling in the dorsal
striatum (Aliane et al., 2011; McCool et al., 2008), and the in vitro link of M1 cholinergic
receptors to CDGI signaling, we examined CDGI knockout mice in a cocaine self-
administration assay in which self-administration can be blocked by the specific M1
receptor allosteric agonist, VU0357017-5 (Thomsen et al., 2010). Firstly, there were no

16
differences between genotypes in nose-poking behavior when the nose-pokes were
reinforced by administration of liquid food reward (not shown) or by escalating doses of
intravenous cocaine (Figure 6A). As expected, when the wildtype sibling mice were
treated systemically with VU0357017-5, they exhibited a reduction in cocaine self-
administration (Figures 6A and 6B). By contrast, the CDGI knockout mice continued to
self-administer cocaine after VU0357017-5 treatment, indicating that they were
insensitive to M1 modulation of self-administration. When saline replaced cocaine in the
self-administration procedure, the CDGI knockout mice exhibited the normal extinction
of nose-poking behavior (Figures 6A and 6B). These findings suggest that CDGI
normally mediates signal transduction from the M1 muscarinic receptor in SPNs, and
that this signaling could mitigate excessive motoric responses to dopamine receptor
signaling, including signaling augmented by psychomotor stimulants.
DISCUSSION
The striatum is placed in a crucial position within basal ganglia circuitry, as it receives
massive inputs from the neocortex and thalamus, and targets its outputs mainly to the
pallidonigral nuclei that modulate movement control. Much of this input-output circuitry
involves the large matrix compartment of the striatum, which accordingly is viewed as
the principle sensorimotor component of the striatum, as opposed to the limbic
connections of the striosomes. The predominant expression of CDGI in SPNs in the
matrix compartment of the striatum led us to expect that CDGI knockout mice might
mainly exhibit sensory-motor deficits if indeed the CDGI protein were important to SPN
signaling. CDGI deletions did have behavioral consequences, but contrary to

17
expectation, we found little evidence for primary sensory or motor deficits in the
knockout mice, with either global or striatum-restricted CDGI deletion. Instead, we found
deficits in behavioral learning and plasticity under challenging conditions, across
cognitive as well as motor domains, and a loss of LTP, a cellular marker of synaptic
plasticity. These findings suggest that the matrix compartment as a whole might perform
computations engaged by the motor and action demands of complex environments. Our
surveys of humans and canines that lack CDGI expression or function showed that
they, too, have psychomotor phenotypes, albeit in species-modulated forms. Three of
the humans in our study did not show loss of CDGI expression, but did show loss of
CDGI’s ability to activate Rap1, combined with motor and cognitive features that
overlapped with those found in the other families. Our findings thus suggest that
deficient CDGI enzymatic activity is critical to the expression of a syndrome
characterized by platelet dysfunction and bleeding as well as striatal dysfunction with
psychomotor abnormalities.
Our evidence for the presence of CDGI in the striatum is confirmed by mRNA and
protein analyses in the mouse and human (Crittenden et al., 2010), and traits
compatible with striatal dysfunction (Boraud et al., 2018; Graybiel, 2008) were present
upon neurologic examination of the human subjects: hyperkinetic movement disorders
including mild chorea, tremor and dystonia, behavioral manifestations including anxiety,
insomnia and drug use, and a mild dysexecutive syndrome. Platelet aggregation
responses were clearly better in heterozygous than in biallelic mutant individuals, but
the neurologic symptoms were more variable among the genotypes. Based on the
phenotypes in CDGI mutant mice and canines, we tested for obsessive-compulsive

18
behaviors in these individuals but did not find these. Nevertheless, of the nine
individuals with heterozygous or biallelic mutations in CDGI, all but one (heterozygote
for the E260* mutation) showed motor and/or cognitive problems.
We cannot consider that any of these individuals have an overt neurologic disease,
but the clinical manifestations that we observed are present in major basal ganglia
disorders such as Parkinson's disease and Huntington's disease. Our findings here
suggest that the down-regulation of CDGI, which occurs in Huntington’s disease
(Crittenden et al., 2010) and in models of L-DOPA-induced dyskinesia (Crittenden et al.,
2009), might contribute to the chorea and dystonia that occur in these disorders.
Moreover, the impacts of CDGI loss might be more evident under disease or stress
conditions, as behavioral abnormalities in the mice were only uncovered upon
psychomotor drug treatment and under challenging learning paradigms. These findings
suggest that the functions of CDGI across multiple organ systems are conserved across
species and produce conjoint hematopoietic and striatal defects that underlie bleeding
and behavioral phenotypes.
We were able to test striatal signaling in mouse, but not in human or hound.
However, the experiments in our mouse model were highly informative. Glutamate
signaling was abnormal as tested in dissociated SPNs and in striatal slices from the
mutants. The frequency of spontaneous EPSCs was increased, suggesting presynaptic
alterations. The kinetics of these synaptic events were abnormal for both AMPA and
NMDA receptor signaling. These findings hint at the possibility that thalamic or
neocortical inputs to striatal neurons, or both, could be abnormal in CDGI mutants.
Finally, we found a total absence of corticostriatal LTP in CDGI mutant slice

19
preparations, without detectable changes in corticostriatal LTD. This striking finding
indicates that there is abnormal plasticity in corticostriatal or thalamostriatal circuits, or
other intrinsic basal ganglia circuits impacting striatal function (Mallet et al., 2012)
possibly related to the delayed sensorimotor learning that we found in the CDGI mutant
mice. NMDA receptor function in the dorsolateral (sensorimotor) striatum, which is
particularly enriched for CDGI expression, is essential for normal learning on the wheel-
running assay that we used (Nakamura et al., 2017). Thus, the NMDA signaling
abnormalities in the striatum of CDGI mutants might directly underlie their slowed
learning in this task. The fact that CDGI knockouts were normal in numerous other
memory and motor tests further suggests that the defects occurring in the absence of
CDGI signaling are functionally specific.
Baseline extracellular dopamine content in the striatum of CDGI knockout mice was
half that of the wildtype levels measured in microdialysis experiments, and behavioral
responses to indirect dopamine agonists were abnormal, as manifested by severely
confined and repetitive behaviors. Nevertheless, evoked dopamine release as tested in
vitro with fast-scan cyclic voltammetry was nearly normal in CDGI mutants. A working
hypothesis to account for these findings is that circuit-based dysfunction occurs in the
CDGI mutants. This circuit abnormality could possibly occur through abnormal
anterograde or retrograde SPN signaling that, in turn, controls dopamine terminals or
dopamine-containing neurons themselves to produce diminished baseline dopamine
levels and hyper-responsivity to high doses of psychomotor stimulants.
The sensorimotor and stereotypic symptoms that appear with mutation of CDGI are
similar to those following disturbances of basal ganglia circuits including nigro-striato-

20
nigral loop-circuits. This pattern is consonant with the fact that CDGI is particularly
enriched in the output neurons of the sensorimotor striatum. CDGI immunoreactivity fills
the cell bodies and fine processes of D1- and D2-dopamine receptor-positive SPNs
within the striatal matrix, which receives preferential input from sensorimotor and
prefrontal cortices (Kincaid and Wilson, 1996; Ragsdale and Graybiel, 1990), and in the
D1- and D2-positive SPN output pathways (Kawasaki et al., 1998). By contrast, there is
lower expression of CDGI in striosomes and in the ventral striatum (Kawasaki et al.,
1998), both of which are considered to be related to limbic functions. CDGI knockout
mice exposed to psychomotor stimulants showed nearly normal locomotor responses
and initial self-administration, but they exhibited exacerbated stereotypy and failed to
stop self-administering cocaine in response to M1 muscarinic receptor agonists. Thus,
CDGI signaling defines a circuit that distinguishes locomotor responses from stereotypic
responses, overly focused behaviors and severe habitual responses. These
psychomotor abnormalities resemble aspects of symptoms in autism-spectrum and
attention-deficit disorders (American Psychiatric Association, 2013).
Mice with perturbations in cholinergic signaling show exacerbated stereotypic
responses to amphetamine and cocaine, as did the CDGI mutants, and they maintain
relatively normal locomotor responses (Crittenden et al., 2014; Janickova et al., 2017).
Such drug-induced stereotypic behavior is known to be regulated by dopamine and
acetylcholine signaling in the dorsal striatum (Aliane et al., 2011; Capper-Loup et al.,
2002; Kuczenski and Segal, 1997, 2001). The pattern of cholinergic neuropil in the
striatum is similar to that of CDGI for being abundant in the dorsal striatal matrix
compartment (Crittenden et al., 2014; Crittenden et al., 2017; Dautan, 2014; Graybiel

21
and Ragsdale, 1978). Moreover, in a cell culture system, the M1 muscarinic receptor
was shown to induce CDGI signaling to Rap1 and the MAP kinase cascade (Guo et al.,
2001). Thus, CDGI expression in SPNs is placed to transduce signals from cholinergic
interneurons to basal ganglia outputs that affect specific behaviors.
Our findings leave important issues to be resolved. CDGI functions in relation to the
immune system (Crittenden et al., 2004; Ghandour et al., 2007), but we did not further
explore this system here. The sample sizes for our study of the humans and hounds
were constrained, and our data on the hounds were based on surveys. Although
consistent with basal ganglia dysfunction, the features exhibited by the different species
were individual to the species, insofar as we were able to observe them, and testing for
corticostriatal LTP and other signaling features of mutants was only feasible in the
engineered CDGI knockout mice. The profound loss of corticostriatal LTP in the mice is
of special interest for further work on striatum-based learning and neuroplasticity across
species. Given the possibilities for compensation of the effects of CDGI deletion, it is
notable that CDGI is necessary not only for normal platelet function, but also for normal
psychomotor expression and motor function as tested here. Other CDGI mutations, both
in humans and other animals, have been reported. The effects of these mutations, not
studied here, could expose the full range of CDGI functions based on the observed
CDGI expression in the developing and mature brain and cells of the hematopoietic
system. Our findings do however, introduce a novel syndromic disorder produced by
mutations in a Rap-MAP kinase activating factor.
ACKNOWLEDGMENTS

22
We thank Dr. James Serpell and Dr. Joseph Garner for advice on how to conduct the
behavioral survey with dog owners, Dr. Mary Boudreaux for Basset Hound genotype
and owner-contact information, Dr. James Catalfamo for the gift of blood platelets from
control and mutant hounds, Dr. Charlie Whittaker for bioinformatics analyses, Dr. Yasuo
Kubota for assistance in manuscript preparation, and Tao Liu, Michael Yim, Patricia
Harlan, Hilary Bowden and Kyle Fischer for technical assistance. This work was funded
by the National Institute of Child Health and Development (R37-HD028341, A.M.G.), the
James and Pat Poitras Research Fund (A.M.G.), The Saks Kavanaugh Foundation
(A.M.G.), The Simons Foundation (A.M.G, J.R.C. and D.S.), The Stanley Center for
Psychiatric Research at the Broad Institute, via a grant to Edward Scolnick from the
Stanley Medical Research Institute (A.M.G. and J.R.C.), the National Institute of Mental
Health (R01-MH071847, A.E.S.; F32-MH065815, J.R.C.), the National Institute of
Health (R01-AG050548, A.E.S.), the European Community FP7 – Thematic priority
HEALTH contract number 222918 (REPLACES) (P.C.), the Ministry of Health Grants
(B.P. and P.C.), the JPB Foundation (D.S.) and the National Institute on Drug Abuse
(R00-DA027825, M.T.; R0107418, D.S.)
AUTHOR CONTRIBUTIONS
J.R.C. and A.M.G. conceived of and supervised the project with the assistance of
D.E.H. J.R.C. and A.M.G. wrote the paper with the assistance of M.S., T.K., E.B.,
C.Cepeda., M.C., M.T., H.Z., E.M.U., W.J., D.S., P.C., A.C.S. and J.-P. A. J.R.C. and
A.M.G. analyzed the data, with input from all authors. J.R.C., M.S., T.K. and E.B.
performed motor behavior and learning and memory assays. J.R.C. and M.S. performed

23
amphetamine-response assays. W.J. performed 24-hr behavior scans. C. Cepeda and
V.M.A. performed assays of glutamate receptor currents in slice physiology experiments
under the supervision of M.S.L. M.C. performed human platelet assays under the
supervision of M.-C. A. M.T. performed cocaine self-administration assays with the
assistance and supervision of S.B.C. H.Z. performed fast-scan slice-voltammetry
experiments under the supervision of D.S. C. Costa and G.M. performed long-term
potentiation in slice physiology experiments under the supervision of P.C. V.G.
performed depotentiation in slice physiology experiments under the supervision of P.C.
K.A.P. performed the dopamine receptor ligand radiography under the supervision of
E.M.U. C. B.-C. and J.-P. A. performed neurological and behavioral assays with the
human subjects. A.C.S. evaluated statistical significance of the amphetamine-response
behavioral data from mice.

24
Figure 1. CDGI Is Enriched in Projection Neurons of the Striatal Matrix, and Is Lacking in Mice,
Dogs and Humans with Different CDGI Mutations
(A) CDGI immunostaining in sagittal section through mouse brain showing expression in direct and
indirect striatal output projections from the caudoputamen (CP) to the external globus pallidus (GP) and
substantia nigra pars reticulata (SNpr).
(B and C) CDGI immunofluorescence (red) shows co-expression with green fluorescent protein (GFP) in
D1 BAC (B) or D2 BAC (C) mice.
(D and E) CDGI (red) enriched in matrix, not in striosomes, shown in transverse mouse striatal section co-
labeled for the striosomal marker CalDAG-GEFII (CDGII, green channel, shown in (D).
(F) CDGI immunoreactivity (black) in control (top) and global knockout (bottom) coronal mouse brain
hemisection.
(G) CDGI expression is lost postnatally in conditional CDGIfl ox/flox mice that carry a D1-Cre yeast artificial
chromosome (YAC, bottom) but not in CDGIflox/flox control mice (top).
(H) Immunoblots showing loss of CDGI in platelet lysates from humans with E260*/C296R and
homozygous N67L mutations, but no loss of expression with homozygous G248W mutations.
(I) Immunoblots showing loss of CDGI in striatal lysates from a CDGIko/ko mouse and in platelet lysates
from a CDGI homozygous mutant Basset Hound. Lower-band loading-controls show immunoreactivity for
GAPDH (H) and beta-actin (I).
(J) Diagram of the CDGI protein amino acids showing the mutations tested in mouse, dog and human.
See also Figures S1 and S2 and Tables S1-S5.

25
Figure 2. Global CDGI Knockout Mice Exhibit Deficits in Assays for Striatal Learning
(A) In an egocentric T-maze task, knockout (KO) mice learned more slowly than wildtypes (WTs; P < 0.05
by ANOVA; P = 0.009 on day 6, P = 0.006 on day 7 and P = 0.04 on day 8 by unpaired, two-tailed
Student’s t-test). Error bars show standard errors of the mean.
(B) KO mice showed delayed learning in a motor sequence task. Mice were trained in a running wheel
with unevenly spaced foot-rungs, and learning was measured as a reduction in the variance of paw
placement on a designated rung (Nakamura et al., 2017). Intact KOs and controls learned at equivalent
rates; after whisker-cutting, KOs showed delayed re-acquisition. **P = 0.01 and *P = 0.02 by unpaired,
two-tailed Student’s t-test between genotypes.
(C) KOs spent more time than WTs in sniffing stereotypies after acute amphetamine (7 mg/kg). P value
was calculated by two-tailed Mann-Whitney U test.
(D-F) With increasing amphetamine doses, KOs engaged in less locomotion than WTs, consistent with
increased stereotypy. Locomotor sensitization to high-dose amphetamine was occluded in KOs (D).
Sensitization was calculated as the change in distance travelled on day 1 vs. challenge day at 50-55 min
post-injection (stereotypy-response period). n = 10WT/10KO, 11WT/10KO, 12WT/12KO, 4WT/4KO and
8WT/8KO, respectively, for 1, 2.5, 7, 10 and 14 mg/kg of amphetamine. With high-dose amphetamine,
WTs showed reduced locomotion on challenge day relative to day 1, consistent with stereotypy
sensitization (E). KOs were stereotypic on day 1, so locomotor sensitization was occluded. KOs showed
normal sensitization to low-dose amphetamine as shown by an increase in distance travelled after
repeated treatments (challenge day, right panels in F) relative to the first day of treatment (left panels in
F). Dotted lines represent raw data from each mouse; large open circles are population means; colored
lines are random effects estimates of the median with 90% confidence intervals. Insets show sample
open-field tracker plots (50-55 min post-injection).
See also Figures S3-S5 and Table S6.

26
Figure 3. Compiled Behavioral Questionnaire Responses from Owners of Basset Hounds Lacking
CDGI Expression and from Control Basset Hounds
(A) Dog-owners’ responses on the 105-question survey were divided into the 14 pre-defined behavioral
categories that are listed to left; the scores (ranging from 0 to a maximum of 4) were then averaged.
Hounds with CDGI mutations scored higher in two categories: perseverative/stereotypic behaviors and
owner-directed aggression. P values were calculated by two-tailed Mann-Whitney test. Error bars show
standard error of the mean.
(B) Within the perseverative/stereotypic behaviors category, scores were significantly higher for hounds
with CDGI deletions, relative to controls, in queries of persistent begging and difficulty to disrupt when
engaged.

27
Figure 4. Global CDGI Knockouts Exhibit Increased Spontaneous and Evoked AMPA and NMDA
Receptor Currents in SPNs
(A) Spontaneous EPSCs recorded in SPNs of striatal slices after addition of bicuculline (BIC, 10 µM)
alone or with 4-aminopyridine (4-AP, 100 µM) in artificial cerebral spinal fluid (ACSF). Average frequency
data are shown at right. n (cells) = 16WT/23KO for ACSF, 16WT/23KO for BIC, and 12WT/12KO for 4-
AP. Error bars show standard error of the mean.
(B) Average spontaneous EPSCs (5-50 pA) in ACSF and after addition of BIC show faster kinetics in
SPNs from KOs. Decay time and half-amplitude duration were significantly shorter in cells from KOs,
relative to WTs.
(C) Current responses of dissociated striatal neurons to AMPA application (100 µM) in the presence of
cyclothiazide (CTZ, 10 µM) to prevent receptor desensitization. Bar graphs show significant increases of
both peak AMPA current and AMPA current density in KOs (n = 24), relative to WTs (n = 12). Application
of the D2 dopamine receptor agonist, quinpirole (10 µM), reduced AMPA current to a similar degree in
cells from WTs (n = 9) and KOs (n = 19).
(D) Current responses to NMDA (100 µM) application. Average peak NMDA currents were not
significantly different between groups, whereas the current density was increased in cells from KOs
following normalization by cell capacitance (n = 15WT, 29KO). Application of the D2 dopamine receptor

28
agonist, quinpirole (10 µM), reduced NMDA current to a similar degree in cells from WTs (n = 6) and KOs
(n = 8). Statistical comparisons made by two-tailed Student’s t-test.
See also Tables S7-S8.

29
Figure 5. CDGI KO Mice Have Diminished Extracellular Dopamine and Loss of Striatal LTP
(A) In vivo microdialysis in the dorsal striatum showed reduced dopamine and DOPAC and a trend for
reduced HVA in KOs, relative to WTs. P values were calculated by Student’s unpaired, two-tailed t-tests
between average values. Error bars show standard error of the mean.
(B) Dopamine release in response to a single pulse (1p) or train stimuli (4 or 10 paired stimuli at 100 Hz)
was equivalent in KOs and controls. n = 14 slices for 1p, n = 8 slices for 4p and for 10p with slices taken
from 5 mice per genotype per experiment.
(C) Examples (left) and averages (right) of dopamine response to 1p.
(D) Paired-pulse stimulation showed equivalent depression of evoked dopamine release between
genotypes (P > 0.05, Student’s two-tailed t-test, n = 7 slices from each of 5 mice per genotype).
(E) With magnesium, high-frequency stimulation (HFS) induced striatal LTD in slices from both genotypes
(P < 0.001, one-way ANOVA followed by Bonferroni post-hoc test).
(F) With no added magnesium, HFS of corticostriatal synapses induced LTP in WTs (P < 0.001), but not
KOs (P > 0.05). Resting membrane potentials were −84mV (E) and −85 mV (F) for both genotypes.
Shown below are examples of neuronal EPSPs recorded immediately before (pre) and 20 min after (post)
HFS.
(G) WTs and KOs exhibited equivalent responses to low-frequency stimulation (LFS) for depotentiation (P
> 0.05).
(H) The M1 receptor antagonist pirenzepine (100 nM, 5 min preincubation) blocked LTP in WTs and had
no effect in KOs (P > 0.05 by two-tailed Student’s t-test for paired data).

30
Figure 6. Global CDGI Knockout Mice Fail to Show Normal Suppression of Drug Administration in
Response to M1 Acetylcholine Receptor Stimulation
(A) WT and KO mice exhibited dose-dependent self-administration of cocaine (dose, F(3,18)=6.67, P =
0.003 and F(3,18) = 6.76, P = 0.003, respectively). The M1AchR allosteric agonist VU0357017
suppressed self-administration of cocaine in WTs (left) but not in KOs (right; treatment, F(1,6)=9.52, P =
0.02; treatment-cocaine interaction, F(3,18) = 9.29, P = 0.0006). **P < 0.01, ***P < 0.001 vs. cocaine
alone with Bonferroni post-test.
(B) Examples of sessions from WT and KO mice showing each nose-poke (tick-marks) for self-
administration of cocaine (0.32 mg/kg/infusion), cocaine after VU0357017 treatment and saline after
extinction of cocaine delivery. The numbers in parenthesis correspond to the total number of reinforcers
earned in the session.

31
Table 1. Individuals with Deleterious Mutations in CDGI Show Symptoms Consistent with Basal Ganglia Dysfunction
Patients
family/
subject
Genetics
Sex
Age
Occupation
Medical
background
Treatments
Behavior
Movement disorders
Addictions
Cognition dysexecutive functions
1.1
Homozygous
G248W
F
61
Accountant
Hepatitis
Tuberculosis
High blood pressure
Perindopril
Insomnia
Anxiety
Chorea
Both upper limbs
0
Yes (short term and visuo spatial memory impairment,
planification)
Self-reported memory problems
1.2
Homozygous
G248W
M
59
Disability
HIV
Neuropathy
Anti-HIV
Insomnia
Ataxia
Tobacco,
Cannabis
Yes (short term and visuo spatial memory impairment)
Self-reported memory problems
1.3
Homozygous
G248W
M
55
Engineer
0
0
Insomnia
Anxiety
Self-reported fasciculations
Tobacco,
Alcohol,
Cannabis
Yes (deficit of working memory, cognitive flexibility, attention and
slowness)
2.1
Heterozygous
C296R
M
47
Engineer
0
0
Insomnia
Anxiety
Chorea
Upper right limb
Unknown
Yes (mild dysexecutive syndrome: lexical evocation,
perseverations, attention deficit, visuoperceptive dysfunction)
2.2
Heterozygous
E260*
F
46
Engineer
0
0
0
None
Unknown
No
2.3
Double trans-
heterozygous
C296R E260*
F
19
Student
0
0
0
Self-reported tremor
when tired
Unknown
Yes (mild dysexecutive syndrome: attention deficit, cognitive
flexibility)
Absence of memory impairment
3.1
Heterozygous
N67Lfs*2
M
50
Unemployed
Diabetes
Coronaropathy
0
Insomnia
None
Tobacco,
Alcohol
Refused cognitive exam
Illiterate
3.2
Heterozygous
N67Lfs*2
F
54
Farmer
Breast Cancer
0
Insomnia
Dystonia
Tobacco
Mild deficit in working memory
3.3
Homozygous
N67Lfs*2
F
23
0
0
0
Tiredness
Chorea both lower limbs
Tobacco,
Alcohol
Yes (deficit in working memory, programing, lexical fluency)
Illiterate
Of the 9 people examined, 6/9 complained of insomnia, 3/9 complained of anxiety, 7/9 exhibited a movement disorder, 5/6 self-reported use of addictive substances and 6/7 were identified to have dysexecutive symptoms.

32
STAR METHODS
METHOD DETAILS
Human Neurological Exams
All patients in this study were invited to come for consultation in the neurology
department by phone. The patients agreed and came to the consultation outside of any
hospitalization and on their own initiative. All patients signed a consent form accepting
that the results of their neurological examination be used for research purposes.
Subjects were given a cognitive evaluation (16-item free and cued recall, RL/RI-16,
Rey-Osterrieth figure recall, WAIS-III, trail making test, Stroop test and VOSP battery)
and were examined by clinicians (J-P. Azulay and C. Brefel-Courbon) specialized in
movement disorders.
Human Platelet Activation Assays
All the participants of this study signed a consent form for the examination of genetic
characteristics and the use of their samples for research purposes (AC-2017-2986 and
AC-2018-3105, authorization provided by the French Ministry of Education and
Research and the local Direction for Research and Innovation). This research is part of
the French reference center on hereditary platelet diseases coordinated by Prof. M. C.
Alessi.
Washed platelets were suspended in Tyrode’s buffer (138 mM NaCl, 2.7 mM KCl, 12
mM NaHCO3, 0.4 mM NaH2PO4, 1 mM MgCl2, 2 mM CaCl2, 5 mM Hepes, 3.5 mg/ml
HSA, and 5.5 mM glucose, pH 7.3) supplemented with 0.02 U/ml apyrase. Studies were

33
performed within 6 h after blood collection by placing platelet rich plasma in an
aggregometer cuvette at 37°C with stirring. ADP (5 and 10 µM; Sigma-Aldrich) and
TRAP-14 (5 and 10 µm; Polypeptide group) were added and light transmission was
recorded on an APACT 4004 optical aggregation system (Labor Bio- Medical
Technologies GmbH).
Rap1 activation was determined using a commercially available kit (Millipore) as
previously described (Canault et al., 2014). Briefly, washed platelets (3 x 108
platelets/ml) were stimulated for 1 min in non-stirring conditions with ADP (10 µM).
Reactions were stopped with ice-cold 2x Rap1 lysis buffer complemented with protease
inhibitor cocktail (Roche), and phosphatase inhibitors (NaF, 10 mM and Na3VO4, 1 mM;
Sigma-Aldrich). The cell lysates were incubated for 45 min with RalGDS-RBD beads to
pull-down Rap1-GTP. Washed pellets were solubilized in sample buffer prior western
blotting. Individual proteins were detected with a rabbit polyclonal antibody against
Rap1 (Millipore) and a secondary goat anti-rabbit HRP-coupled antibody (Bio-Rad
Laboratories). Proteins were detected by chemiluminescence. Total Rap1 levels were
detected from whole platelet lysates.
Mouse Maintenance
All experiments were approved by, and performed in strict accordance with, the
Massachusetts Institute of Technology (MIT) Committee on Animal Care, which is
accredited by AAALAC. Mice were group-housed and maintained under a standard
light/dark cycle with free access to food and water except during food-reinforced
learning and memory experiments, in which cases mice were single-housed. For the

34
cocaine self-administration assay (Figure 6) and the total biogenic amine and amino
acid data (Tables S4 and S5), CDGI knockouts and sibling controls were in a congenic
C57BL/6J genetic background. For the amphetamine-response experiments with
conditional, post-natal CDGI knockouts and sibling controls, mice were in a congenic
129S4 genetic background. For all other experiments, mice were in an isogenic 129S4
genetic background. Male and female mice were used for the cocaine self-
administration assay. For the remainder of the experiments, which were conducted prior
to the National Institute of Health policy for the inclusion of both sexes in
experimentation, male mice were used.
Generation of CalDAG-GEFI Knockout Mice
The CDGI targeting construct was based on a 6.2 kb SacI restriction fragment from the
129Sv/cJ7 mouse chromosome 19 BAC clone 7D23 (Guru et al., 1999) that was
subcloned into Bluescript II KS+ plasmid (Stratagene Inc.). One loxP site was ligated to
a HindIII site in intron 4 and a loxP-flanked fusion gene for hygromycin resistance and
thymidine kinase was ligated to an AflII site in intron 2. The targeting construct was
electroporated into J1 mouse embryonic stem (ES) cells (gift of Prof. Rudolf Jaenisch)
that were subsequently grown in hygromycin to select for integration. Resistant ES cell
clones were screened for homologous integration by polymerase chain reaction (PCR)
and Southern blotting. Clonal populations were transiently transfected with the Cre
recombinase vector Pog231 and gancylcovir was applied to select for loss of thymidine
kinase. PCR was used to identify deletion clones, two of which were injected into
blastocysts by the MIT Department of Comparative Medicine facility. Resulting chimeric

35
mice were crossed to C57BL/6 to test for germline transmission by coat color and
transmitting males were crossed to 129S4 mice to establish the mutation in a
background isogenic with the J1 ES cells. Phenotypic analyses were always performed
on sibling progeny from pure 129S4 heterozygous mutant intercross matings.
Constitutive CDGI knockout mice were genotyped by PCR with the following three
oligonucleotide primers: 5’–aacagttcccaggctagagatagagagttcctcc–3’, 5’–
accagactctaggccagaacctacc–3’, and 5’–agtgtgctgtggtgaaatgcagccattcc–3’. Wildtype
mice yielded a 208 base pair product with the first two primers while the knockout
yielded a 286 base pair product with the second two primers. Conditional CDGI floxed
mice were genotyped by PCR with the two primers 5’–
TCTCAGCTAGTCCATTTCCCAACTAGCGAGTTGC–3’ and
5’–AACAGTTCCCAGGCTAGAGATAGAGAGTTCCTCC–3’ to yield a 650 bp product
from the floxed allele and a 594 bp product from the wildtype allele.
Reverse Transcriptase Polymerase Chain Reaction
Mouse brain RNA was prepared using the RNAeasy kit (Qiagen). RT-PCR was
performed using the ThermoScript RT-PCR kit (Invitrogen) with two primers flanking the
sites where loxP was inserted:
5’–TAATACGACTCACTATAGGGAGGCTGAGCTGGTTCAAGTG–3’ and 5’–
ATTTAGGTGACACTATAGAACTGCCGCTTCCACTTGTAGG–3’.
Western Blotting

36
For mouse striatal and cortical tissue, mice were deeply anesthetized with pentobarbital
(150 mg/kg by intraperitoneal injection), and tissue was dissected on a cold plate prior
to freezing in liquid nitrogen and storage at −80°C. For dog platelets, blood was taken
from two control dogs and one Basset Hound confirmed to be a homozygous mutant for
the 3-basepair deletion. Washed platelets were prepared by Dr. James Catalfamo in
Ithaca, NY, stored at −80°C and shipped to MIT for Western blotting. Frozen samples
from mice or dogs were homogenized in ice-cold modified RIPA buffer (50 mM Tris pH
8.0, 150 mM NaCl, 1% Triton X-100, 0.1% sodium dodecyl sulfate, 1%
NaDeoxycholate) with Complete protease inhibitor cocktail (Roche) and centrifuged at
16,000 X g for 10 min to pellet insoluble material. Protein concentration of supernatants
was determined by bicinchoninic acid assays (Thermo Fisher Scientific). Proteins were
resolved by SDS-PAGE and transferred to PVDF membrane (Millipore) by
electroblotting. Blots were incubated overnight, at 4°C, with antibodies diluted in TBST
[10 mM Tris-HCl (ph 8.0), 150 mM NaCl, 0.05% Tween 20)] and 5% bovine serum
albumin. Blots were subsequently washed in TBST and incubated with horseradish
peroxidase-coupled secondary antibodies (Vector Laboratories) prior to
immunodetection with Western Lightening (PerkinElmer Inc.) according to the
manufacturer’s instructions. Blots were subsequently incubated with anti-β-tubulin (Cell
Signaling Technology) to control for protein loading. Antibodies were obtained from the
following companies: total GluR1 receptor (Calbiochem), total ERK1/2, phospho-
ERK1/2, total JNK, phospho-JNK, total P38, phospho P38, total DARPP-32 and
phospho-DARPP-32 (Cell Signaling Biotechnologies); GluR2 receptor, phosphor-
Ser831 GluR1 receptor, mGluR1 receptor, mGluR5 receptor, M1-type muscarinic

37
receptor, D1-type and D2-type dopamine receptor (Chemicon); phosphor-Ser845 GluR1
receptor (Novus Biologicals); Rap1, Rap2, CalDAG-GEFII/RasGRP2 (Santa Cruz
Biotechnologies); phosphor-CREB (Rockland Immunochemicals); PSD95 (Upstate
Biotechnologies).
Immunolabeling
Mouse brain sections were prepared for immunolabeling as previously described
(Crittenden, 2017). The sections were incubated with rabbit polyclonal CDGI antiserum
(Crittenden et al., 2004) for approximately 12 h at 4°C and processed either for
immunohistochemistry with ABC amplification (Vector Labs) and DAB detection with
nickel enhancement or, in conjunction with mouse anti-CalDAG-GEFII antiserum (SC-
8430, Santa Cruz Biotechnology), for immunofluorescence with secondary antibodies
coupled to ALEXA 564 and ALEXA488 (Invitrogen Corp.). Fluorescent labeling of D1
and D2 dopamine receptor-expressing neurons was detected with an EGFP filter set in
sections from Drd1a-EGFP and Drd2-EGFP BAC transgenic mice (Gong et al., 2003).
Sections were mounted and coverslipped with Eukitt (Electron Microscopy Sciences),
following immunohistochemistry, or with Vectashield media (Vector Laboratories),
following immunofluorescence. The sections were viewed with Olympus BX61 and
SZX7 microscopes fitted with an Olympus DP70 camera.
Exon microarray
Striatal tissue was collected in parallel in three different experiments from age-matched
male CDGI knockout mice and sibling controls. After dissection, samples were frozen

38
on dry ice and then homogenized in Trizol (Sigma-Aldrich) and total RNA was prepared
according to manufacturer’s instructions and previously described methods (Cantuti-
Castelvetri et al., 2005). Equivalent amounts of RNA from each sample were pooled
according to genotype (n = 4 of each genotype pooled for two experiments and n = 3 of
each genotype pooled for one experiment) and given to the MIT BioMicro center to
prepare cDNA for hybridization to the Affymetrix GeneChip Mouse Exon 1.0 ST. The
MIT Bioinformatics core facility used Affymetrix Expression Console software to
summarize and normalize data from the chips.
Measurements of Total and Extracellular Striatal Dopamine, DOPAC and HVA
For microdialysis, guide cannulae were implanted in the striatum using stereotaxic
surgery. After at least one week for surgery recovery, the microdialysis probe (CMA/7
probe 1mm, CMA Microdialysis, Sweden) was lowered into the guide cannula and
microdialysates were collected on ice in perchloric acid (0.5 M) at 20-min intervals at a
rate of 1.5 μl/min. Samples collected for the first hour were discarded and subsequently
collected samples were immediately frozen and kept at –80ºC until HPLC analysis.
For measurements of dopamine, DOPAC and HVA to assess COMT activity, mice
were decapitated 50 min after saline or amphetamine injection and the striata were
dissected on ice and kept at –80ºC until shipment to the laboratory of Prof. Tim Maher
(Massachusetts College of Pharmacy and Health Sciences) for high performance liquid
chromatography (HPLC).
For HPLC analysis, microdialysates were injected unmodified and striatal tissues
were homogenized in 0.2 M perchloric acid, 0.2 mM disodium EDTA and 0.2 mM

39
ascorbic acid. Samples were assayed for DOPAC, dopamine and HVA by HPLC with
the potential set at +300 mV with respect to a palladium-hydrogen reference electrode.
Measurements of Striatal Amino Acids and Biogenic Amines
For measurements of total amino acids and biogenic amines, male mice between 4 and
5 months of age (n = 11WT/7KO) were sacrificed by cervical dislocation, and striatal
tissue was dissected and frozen on dry ice for shipment to the Vanderbilt
Neurochemistry core for HPLC measurements.
Dopamine Receptor Autoradiography
D1- and D2-type dopamine receptor autoradiography was performed as described in
Unterwald et al. (Unterwald et al., 1994; Unterwald et al., 2001) D3 receptor
autoradiography was carried out according to the method described by Guitart-Masip et
al. (Guitart-Masip et al., 2006). Mouse brains were stored at –80ºC prior to dissection.
Mouse brains were mounted on cryostat chucks using embedding matrix, cut on a
Reichert and Jung 2800 Frigocut N into 16 µm coronal sections based on the Paxinos
and Franklin mouse brain atlas (Paxinos, 2001), thaw-mounted onto Fisher superfrost
glass slides, air-dried on ice and stored desiccated at –30◦C until assayed. Slide-
mounted sections were preincubated in buffer containing 50 mM Tris HCl, 120 mM
NaCl, 5 mM KCl, 2 mM CaCl2 and 1 mM MgCl2, pH 7.4, at room temperature for 30
min. Following preincubation, sections were incubated for 45 min at room temperature
in the same Tris-salt buffer in the presence of 1 µM mianserin and 5nM 3H-SCH23390,
without and with 10 µM fluphenazine to measure, respectively, total and nonspecific

40
binding for the D1-type dopamine receptor. For D2-type receptor autoradiography,
slides were incubated in the preincubation buffer with 0.001% ascorbic acid, 1 µM
mianserin and 5 nM 3H-raclopride without and with 10 µM (+)butaclamol to measure
total and nonspecific binding, respectively. For D3 receptor binding, slides were
incubated in the preincubation buffer in the presence of 0.001% ascorbic acid, 5 nM 3H-
PD128907 without and with 1 µM (+)butaclamol to measure total and nonspecific
binding respectively. After incubation, slides were washed twice in the Tris-salt buffer on
ice for 5 min/wash followed by rinse in ice-cold distilled water. Sections were dried
under a cold air stream and allowed to sit overnight at room temperature. Slides for
dopamine receptor autoradiography and tritium standards (Amersham) were exposed to
tritium-sensitive film for 7 weeks (D1 receptor), 13 weeks (D2 receptor) or 23 weeks (D3
receptor). Receptor densities were determined by measuring the optical densities of
brain regions of interest and comparing them to the standard curve generated by the
tritium standards exposed to the same sheet of film (MCID System, Imaging Research
Inc., Cambridge, UK). Differences in mean receptor density values between genotypes
were analyzed by an unpaired two-tailed Students t-test.
Measurements of Serum Amphetamine
For serum amphetamine measurements, blood was collected into serum separation
tubes (Starstedt AG & Co.) by retro-orbital bleeds from mice under isofluorane
anesthesia, 50 min after their first amphetamine injection. Amphetamine measurements
were performed at NMS Labs (Willow Grove, PA) using liquid chromatography followed
by mass spectrometry (LC/MS/MS). Serum aliquots of 50 or 100 µl were diluted to 200

41
µl with human serum. The dilution was taken into consideration to calculate the final
concentrations. An internal standard (D5-Amphetamine) and 10% trichloroacetic acid
were added to each sample while mixing vigorously. Samples were centrifuged and 200
µl of supernatant from each sample was transferred to autosampler vials for analysis.
Samples were analyzed using a Waters Quattro Premier tandem mass spectrometer
instrument with electrospray ionization, and a Waters Acquity Ultra Performance LC
with an Acquity UPLC HSS T3.1, 2.1 x 50 mm, and 1.8-µm analytical column. Two ion
transitions were monitored for amphetamine and the internal standards to assure that
there were no interferences. Each analytical run was independently calibrated at
concentrations of 5.0, 10, 20, 50, 200, 500 and 1000 ng amphetamine/ml. Controls were
run at 30, 375 and 750 ng/ml. During method validation, this LC/MS/MS method had
between-run percent CV’s of 6.03, 3.02 and 4.72% at 5.0, 30 and 750 ng/ml,
respectively. Amphetamine eluted at approximately 3.5 minutes and the internal
standard co-eluted.
Open Field Behavior, Rotarod Balance and Fear Conditioning
Horizontal and vertical locomotor activity (distance traveled, rearing) for the evaluation
of open-field activity and fear-conditioning tasks was collected via the TruScan System
(activity boxes surrounded by 2 rings fitted with infrared sensors, Coulbourn Instrument,
Allentown, USA). The same system was used to measure ‘time spent in the margin’
(thigmotaxis) and ‘number of center entries’ for the assessment of anxiety-related
behaviors. For fear-conditioning procedures, mice received 5 tones paired with foot
shocks (1 per min) in box A after 2 min of free exploration (baseline A) on day 1. On the

42
morning of the following day, mice were placed in the same box without tone or foot
shock for 3 min. In the afternoon of the same day, mice were placed in box B
(contextually different) and the tone alone was delivered for 3 min after 2 min free
exploration of the new box (baseline B). Percent decrease in distance traveled versus
baseline in either box was calculated as a measure of association of foot shocks with
context or foot shocks with cue. To evaluate motor coordination, mice were placed
individually onto an elevated rod accelerating from 4 to 40 rpm over 10 min (Columbus
Instruments), and latency to fall was measured.
Home Cage Scan
Male wildtype and knockout brothers, 6-7 months of age were single-housed for >7
days prior to videoscanning. Lights were out 7 pm-7 am, and videotaping occurred from
6 pm to 6 am. Data were analyzed by user-trained CleverSys software as described
previously (Steele et al., 2007).
Social Interaction and Memory Test
According to the method described previously (Crawley, 2000), single-housed male
mice were placed individually into a large cage with bedding and two small metal wire
enclosures inside, and were allowed to acclimate for 20 min. The male was then
removed, and an ovariectomized female was placed into the small wire cage prior to
returning the male. The male was videotaped for 2 min prior to removal of the female
mouse. After 20 min, the same female was re-introduced for 2 min, and this procedure
was repeated four times in total prior to introducing a novel ovariectomized female.

43
Videotapes were scored, and the amount of time that the male had nose-contact with
the cage containing the female was plotted.
Olfactory Acuity Test
Wildtype and brother knockout male mice were co-housed and food-deprived by being
given access to food for only one hour per day, plus sucrose pellets sprinkled in their
home cage (BioServ). Mice were trained for two days by placing individually into a clean
cage in the morning and, in the afternoon, were given 15 sucrose pellets on top and
beneath the bedding. On the following test day, each mouse went through five trials in
which it was removed from the cage, a single pellet was buried, and measurements
were taken of the time for the mouse to find the pellet after reintroduction to the cage.
Marble Burying
Based on a method described previously (Thomas et al., 2009), male mice were placed
into a clean cage and given 30 min to habituate. The mouse was removed, and 9 clean
marbles were placed, evenly-spaced, on top of the bedding. The mouse was returned to
the cage and videotaped for 15 min. The number of marbles visible at the end was
reported as an average across trials. Mice were given three trials across three days.
Egocentric and Allocentric T-Maze Tasks
Training was done by an experimenter blinded to genotype, and mice were in mixed-
genotype groups. Egocentric T-maze training was conducted in an acrylic cross-shaped
maze with white floor and transparent walls. Different departure arms were used so that

44
mice learned to associate the rewarded arm with egocentric cues rather than distal
cues. Male mice, food restricted to reach 85% of their free-feeding weight, were given 3-
5 habituation sessions in which they were allowed to move freely in the 2 T-maze
configurations and to consume chocolate milk placed at the end of the goal arms. Mice
were rewarded with chocolate milk for turning in a consistent direction (left vs. right),
regardless of their start site and the spatial cues. The rewarded direction was randomly
assigned at the beginning of the training unless the mouse had developed a turning bias
during the habituation, in which case the opposite direction was baited with food-reward
for the training. Each mouse received 10 trials (5 trials from each of 2 start sites), with
an inter-trial interval of 30-120 sec, during each daily session for 10 days.
Allocentric T-maze training was conducted in a water maze filled with white dyed
water (21°C) into which a mouse was placed at the base of the T to begin the trial. The
trial was ended when the mouse touched both forepaws to the submerged escape
platform (correct choice) or reached the extremity of the other branch of the T (incorrect
choice). The platform was located at a constant position in the experimental room and
extra-maze visual cues were provided to instruct the mice of the platform location. Start
arms were varied to avert the use of egocentric cues. Percent correct choices and
latency to reach one extremity of the T (data not shown) were recorded. Each mouse
received 10 trials per day.
Step-Wheel Training
All procedures were approved and in accordance with guidelines for the conduct of
animal research of Osaka University. The investigator training the mice was blinded to

45
their genotypes. As previously described (Kitsukawa et al., 2011), mice were water-
restricted and habituated to run on a step-wheel with moveable pegs in order to reach a
water spout. Contact of the paw on the last (12th) rung was detected by a voltage
change. Mice were trained for 6 days with a regularly-spaced rung-pattern followed by 7
days of training with irregularly-spaced rung pattern 1, followed by 3 days of training
with irregularly-spaced rung pattern 2. The whiskers of all mice were then cut off, and
the mice were given 2 days in their home cage followed by re-testing for 8 days with
irregularly-spaced rung pattern 1. The variance of paw-touch to the 12th rung across
training was calculated (Nakamura et al., 2017).
Psychomotor Drug Treatments
Different groups of male mice (6-10 months old) were used for each drug treatment. All
experiments were conducted genotype-blind. Mice were habituated to injection for 3-5
days and placed in Truscan activity monitors for at least 20 min prior to drug injection.
Habituation was used for all drugs with the exception of the haloperidol- and
SCH23390-response experiments.
Amphetamine cocaine, SCH23390, SKF83959, SKF81297 and quinpirole were
dissolved in saline. SCH23390 and SKF83959 were dissolved in distilled water.
Apomorphine was dissolved in 0.1 % acetic acid in water. Haloperidol was dissolved in
1 drop of acetic acid prior to adjusting the volume to the appropriate concentration with
saline. All drugs were purchased from Sigma-Aldrich Corp. All drugs were prepared
fresh daily, administered at 10 ml/kg body weight and were injected intraperitoneally,
except for apomorphine, which was administered sub-cutaneously.

46
With high or repeated doses of amphetamine, mice show more confined stereotypy
and less distance traveled relative to acute or low-dose treatments. We therefore
measured both distance traveled and confined stereotypy in CDGI knockout and control
mice with repeated administration of low and high doses of amphetamine. For
sensitization, mice received daily drug injections for 7 days followed by 7 days of no
injection and then a final challenge injection on day 15 as previously described
(Crittenden et al., 2014). One exception to this schedule was the 10 mg/kg/day
amphetamine experiment in which a two-injection sensitization protocol was used
(Valjent et al., 2010).
Distance traveled was computed by infrared photobeam breaks, sampled at 0.5 sec.
Stereotypies were measured from 2 min videotapes made at 20 and 50 min post-
injection and rated with a keypad scoring system by a rater blinded to genotype as
previously described (Crittenden et al., 2014). The highest levels of confined stereotypy
occurred around 50 min post-injection for amphetamine. Significance for stereotypy
scores was computed by Wilcoxon rank sum test and for distance traveled data by a
random effects model. For Figure 2D, the sensitization of the knockouts was normalized
to that of wildtypes as follows: the absolute change in distance traveled between day 1
and challenge day for knockouts was divided by the absolute change from day 1 to
challenge day in wildtypes, and the ratio was then multiplied by 100 so that the percent
change for knockouts could be plotted relative to that for wildtypes. Calculations were
based on the peak-response periods videotaped to assess stereotypy, 50-55 min post-
injection for amphetamine. From day 1 to challenge day, WT mice showed the expected
increase in confined stereotypy and decrease in locomotion, indicating sensitization to

47
the drug. Knockout mice simply maintained their day 1 confined behaviors across all
treatment days.
Cocaine Intravenous Self-Administration
All procedures were approved by the McLean Hospital Institutional Animal Care and
Use Committee. Mice were trained and tested as previously described under an FR 1
schedule of reinforcement in daily 3h sessions, 5-6 days/week (Thomsen et al., 2010).
VU0357017 was synthesized at Vanderbilt University (Lebois et al., 2010), dissolved in
sterile water (made fresh daily) and administered subcutaneously at 5.6 mg/kg, 15 min
before the test session.
Corticostriatal Synaptic Plasticity
Experiments were approved and performed in strict accordance with the procedures put
forward by the Italian Health Ministry. Corticostriatal EPSPs were evoked by a
stimulating electrode placed in cortical regions close to the recording electrode.
Bicuculline (10 µM) was added to ~50% of the experiments to test for contamination of
the EPSPs by GABAA receptor-mediated depolarization. The addition of bicuculline did
not have an effect on EPSPs, thus data obtained with and without the drug were pooled.
For high-frequency stimulation (HFS), 3 stimulus trains were applied (3 sec duration,
100 Hz frequency, 20 sec intervals). HFS protocol was delivered in the presence of 1.2
mM external magnesium to optimize the appearance of LTD. For LTP induction,
magnesium was removed from the bathing solution.

48
Single Cell Electrophysiological Recordings
All experimental procedures were performed in accordance with the United States
Public Health Service Guide for Care and Use of Laboratory Animals and were
approved by the Institutional Animal Care and Use Committee at the University of
California, Los Angeles (UCLA).
Cells in slices or taken after acute enzymatic dissociation were obtained from 7
wildtype and 10 knockout male mice at 46 and 89 days old (average 68 ± 6 and 68 ± 3
in wildtype and knockout mice, respectively). Whole-cell patch clamp recordings from
medium spiny neurons (presumed SPNs) were obtained using standard methods
(Cepeda et al., 1998). Cells were identified by somatic size, basic membrane properties
(input resistance, membrane capacitance, and time constant), and by addition of
biocytin (0.2%) to the internal solution.
Cells in slices or examined after acute enzymatic dissociation were studied using a
40x water immersion lens. The microscope (Olympus BX50WI) was equipped with
Nomarski optics and infrared videomicroscopy. The patch pipette (3-5 MΩ) contained
the following solution (in mM): Cs-methanesulfonate 130, CsCl 10, NaCl 4, MgCl2 1,
MgATP 5, EGTA 5, HEPES 10, GTP 0.5, phosphocreatine 10, leupeptin 0.1 and
biocytin (0.2%) (pH 7.25-7.3, osmolality 280-290 mOsm).
Spontaneous postsynaptic currents were recorded in standard ACSF composed of
the following (in mM): 130 NaCl, 26 NaHCO3, 3 KCl, 2 MgCl2, 1.25 NaHPO4, 2 CaCl2,
and 10 glucose, pH 7.4 (osmolality, 300 mOsm). Bicuculline (10 µM) was added to
abolish the contribution of spontaneous currents mediated by activation of GABAA
receptors. Cells were held at −70 mV to minimize the contribution of GABAA receptors

49
and that of voltage-gated conductances. 4-aminopyridine (4-AP, 100 µM), a K+ channel
blocker that increases neurotransmitter release, was also applied to the bath after
bicuculline blockade to compare EPSC frequencies in cells from wildtype and knockout
mice. After characterizing the basic membrane properties of a neuron, spontaneous
postsynaptic currents (PSCs) were recorded for variable periods of time (usually 3-6
min). The membrane current was filtered at 1 kHz and digitized at 200 µsec by Clampex
(Foster City, CA). Spontaneous PSCs were analyzed off-line using the Mini Analysis
Program (Jaejin Software, Leonia, NJ). The threshold amplitude for the detection of an
event was adjusted above root mean square noise level (generally ~5 pA). This
software was used to calculate PSCs frequency, amplitude for each synaptic event, and
to construct amplitude-frequency histograms. Frequencies were expressed as number
of events per second (in Hz). PSCs kinetic analysis used the Mini Analysis Program.
Events with peak amplitudes between 10 and 50 pA were grouped, aligned by half-rise
time, and normalized by peak amplitude. Events with complex peaks were eliminated. In
each cell, all events between 10 and 50 pA were averaged to obtain rise times, decay
times, and half-amplitude durations. First- and second-order exponential curves were
fitted with a maximum of 5000 iterations, and standard deviations between first- and
second-order fits were compared.
Some slices also were used for acute dissociation of neurons. After at least 1 hr of
incubation in the oxygenated ACSF, the dorsal striatum was dissected from the coronal
slices with the aid of a dissecting microscope. Each striatal slice was placed in an
oxygenated cell-stir chamber (Wheaton, Millville, NJ) and enzymatically treated for 20
min with papain (0.5 mg/ml, Calbiochem) at 35°C in a N- [2-hydroxyethyl] piperazine-N-

50
[2-ethanesulfonic acid] (HEPES)-buffered Hank’s balanced salts solution (HBSS, Sigma
Chemical) supplemented with (in mM) 1 pyruvic acid, 0.005 glutathione, 0.1 NG-nitro-L-
arginine, and 1 kynurenic acid (pH 7.4, 300-310 mOsm). After enzymatic digestion, the
tissue was rinsed several times with a low Ca2+ HEPES-buffered Na-isethionate solution
containing (in mM) 140 Na isethionate, 2 KCl, 2MgCl2, 0.1 CaCl2, 23 glucose, and 15
HEPES (pH 7.4, 300-310 mOsm). Striatal slices were then mechanically dissociated
with a series of graded fire-polished Pasteur pipettes. The cell suspension was then
plated into a 35-mm nunclon petri dish mounted on the stage of an upright fixed-stage
microscope (Zeiss Axioscope, Thornwood, NY) containing a HEPES-buffered salt
solution [in mM: 140 NaCl, 23 glucose, 15 HEPES, 2 KCl, 2 MgCl2, and 1 mM CaCl2
(pH 7.4, 300-310 mOsm)].
Standard whole-cell patch clamp techniques were used to obtain voltage clamp
recordings. Electrodes (2.5-3.5 MΩ) were pulled from Corning 8250 glass (A-M
Systems, Carlsborg, WA) and heat polished prior to use. The internal solution consisted
of (in mM) 175 N-methyl-D-glucamine (NMDG), 40 HEPES, 2 MgCl2, 10 ethylene glycol-
bis (β-aminoethyl ether)-N, N, N’, N’-tetraacetic acid (EGTA), 12 phosphocreatine, 2 Na2
ATP, 0.2 Na2 GTP, and 0.1 leupeptin (pH 7.25, 265-270 mOsm). The external solution
consisted of (in mM) 135 NaCl, 20 CsCl, 3 BaCl2, 2 CaCl2, 10 glucose, 10 HEPES, and
0.0003 tetrodotoxin (TTX) (pH 7.4, 300-310 mOsm). Recordings were obtained with an
Axon Instruments 200A patch clamp amplifier and controlled by a computer running
pClamp (v. 8.01) with a DigiData 1200 series interface (Axon Instruments, Foster City,
CA). Data were collected from neurons that had access resistances below 20 MΩ. After
whole-cell configuration was reached, series resistance was compensated (70-90%)

51
and periodically monitored. All recordings were made from medium-sized neurons. After
obtaining basic membrane properties, NMDA and AMPA (alone or in the presence of
cyclothiazide, CTZ 10 µM) were applied for 3 sec duration every 10 sec through a
pressure-driven fast perfusion system using an array of application capillaries placed a
few hundred micrometers from the cell. To study the modulation of NMDA and AMPA
currents, a dopamine D2 receptor agonist, quinpirole (10 µM), was used. A DC drive
system controlled by a SF-77B perfusion system (Warner Instruments, Hamden, CT)
synchronized by pClamp changed solutions by altering the position of the capillary
array. Values for peak currents and peak current densities were calculated for all
neurons. Current density was obtained by dividing currents by cell capacitance to
normalize values with respect to the size of the cell.
Passive membrane properties of cells in slices or dissociated cells were determined
in voltage clamp mode by applying a depolarizing step voltage command (10 mV) and
using the membrane test function integrated in the pClamp8 software (Axon
Instruments, Foster City, CA). This function reports membrane capacitance (in pF),
input resistance (in MΩ or GΩ) and time constant (in µsec or msec). Differences in
mean current densities at various voltage commands were assessed with a two-way
analysis of variance with one repeated measure followed by multiple comparisons using
Bonferroni t-tests. Student t-tests alone were used when only two group means were
compared.
Fast-Scan Cyclic Voltammetry

52
All voltammetric experiments were approved and performed in strict accordance with
the Institute of Comparative Medicine Laboratory Animal Resources at Columbia
University.
Striatal dopamine release was studied in two to five month old male knockout and
wildtype mice. Recordings were obtained from the striatum in the first three most rostral
coronal slices (300 µm). Three sites in the dorsal striatal region of each slice were
measured and averaged. Slices were allowed to recover for 1.5 hr in a holding chamber
in oxygenated ACSF at room temperature, and then were placed in a recording
chamber and superfused (1 ml/min) with ACSF (in mM: NaCl 125, KCl 2.5, NaHCO3 26,
CaCl2 2.4, MgSO4 1.3, KH2PO4 0.3, glucose 10) at 36°C.
As described previously (Zhang and Sulzer, 2003), disk carbon fiber electrodes of 5
µm diameter with a freshly cut surface were placed into the dorsal striatum about 50 µm
into the slice. For cyclic voltammetry, a triangular voltage wave (−400 to +900 mV at
280 V/s versus Ag/AgCl) was applied to the electrode every 100 ms. Current was
recorded with an Axopatch 200B amplifier (Axon Instrument), with a low-pass Bessel
Filter setting at 10 kHz, digitized at 25 kHz (ITC-18 board, Instrutech Corporation).
Triangular wave generation and data acquisition were controlled by a PC running a
house-written IGOR program (WaveMetrics). Striatal slices were electrically stimulated
every 2 min with either a single pulse stimulation or a paired stimulus by an Iso-Flex
stimulus isolator triggered by a Master-8 pulse generator (A.M.P.I.) using a bipolar
stimulating electrode placed ~100 µm from the recording electrode. Background-
subtracted cyclic voltammograms served to identify the released substance. The

53
dopamine oxidation current was converted to concentration based upon a calibration of
5 µM dopamine in ACSF after the experiment.
Additive Random Effects Model for Distance Traveled Data
Distance-traveled data were analyzed by a state-space model (Kitagawa, 1996; Smith
et al., 2004). Activity monitor data for distance-traveled were chosen for 21 time-points
(−15 to 85 min in steps of 5 min) for all wildtype and CDGI knockout mice. Data from
five experiments were analyzed, with the numbers of mice in each group ranging from 8
to 12 mice.
We applied this method because we wished to make time-point by time-point
comparisons of the group changes in distance-traveled. Independent t-tests comparing
groups at each time-point indicated that there was likely to be an effect of genotype,
because there were many successive P-values that were less than 0.05. However, if
corrected for multiple comparisons using Bonferroni, many of these P-values were no
longer significant. This result was likely due to the fact that the Bonferroni correction
does not account for multiple consecutive P-values close to zero. Therefore, we turned
to a state-space model, which can accommodate point-by-point comparisons and can
also be fitted to nonlinear data with peaks at different times. This model assumes that
the changes in distance-traveled between time-points are smooth, with the level of
smoothing being estimated from the variability of the data. In addition, the model was
hierarchical: we estimated the group effects using a Bayesian random effects approach
that provided an estimate of the population mean for each group on a given day and

54
with a given drug-dose combination. We then compared the population estimates using
Monte Carlo methods. The detailed description of these analyses is as follows.
State-Space Random Effects Analysis of Distance Traveled Data
On a given day (day1, day 7 or challenge) and for a given drug-dose combination, the
distance-traveled value at time
k
for mouse
j
from the wildtype group is
wt
jk
n
. The
corresponding data for the knockout mice is
ko
jk
n
.
We assume that all mice from each group have a common time-varying component
in their distance-traveled state,
k
x
, at trial
k
. For the wildtype group, this component
follows a random walk as follows:
1
wt wt wt
kk k
xx
ε
−
= +
where
wt
k
ε
is zero-mean Gaussian with variance
2
wt
ν
. Each mouse
j
’s
individual behavioral state is taken to be the same as
k
x
to within a constant
wt
j
β
where
the values wt
j
β
are drawn from a population normal distribution with mean
0
wt
β
and
variance 2
wt
σ
. Thus, the distance-traveled individual observations are related to the
behavioral state using
2
~( , )
wt wt
jk j k wt
nN x
βt
+
where
2
wt
t
is the group variance estimate and
2
0
~( , )
wt wt
j wt
N
β βσ
. We use an identical model formulation as above for the knockout mice
group.
We estimate the population distance-traveled curves for each group by specifying
the above Bayesian model in WinBugs (Lunn, 2000). This software estimates the
desired posterior distributions using Markov chain Monte Carlo (MCMC). We have used
a similar random effects state-space model for animal behavior (Breuer et al., 2005) and
the Bayesian estimation method for state-space models (Smith et al., 2009; Smith et al.,

55
2007) in previous reports. In order fully to describe the Bayesian model, we have to
specify initial conditions and prior distributions. Specifically, the state is assumed to start
at a fixed positive value of 10 (for identifiability, as it is added to a value which is also
estimated). Priors on βwt and βko are uniform on [−1000, 1500]. Priors on precisions are
inverse gamma with parameters 0.1 and 0.01 (code given below). Data analyzed with
this procedure are shown in Figures 2E and 2F.
We next compared population distributions based on their Monte Carlo samples
using the sampling algorithm described in Smith et al. (Smith et al., 2005). Figure S5a-d
shows comparison plots of population curves for 8 comparisons across groups and drug
treatments. In the bottom left plot of Figure S5a, the black line shows the level of
certainty that the wildtype population curve for day 1 is greater than the wildtype
population curve for the challenge day 1, i.e., the probability that a sample taken from
the day 1 wildtype population is bigger than a sample taken from the challenge day
wildtype population. Green asterisks denote locations at which we consider the
populations to be very significantly different based even on a Bonferroni corrected P-
value. Thus, we conclude that the distance-traveled by the wildtype population on day 1
is higher than that on challenge day during 20-35 min post-injection. But the distance-
traveled by the wildtype population on day 1 is significantly lower than the distance-
traveled on challenge day during the 5 min post-injection time period analyzed.
WinBugs Computer Code

56
Model{
for (t in 1:T) {
x1[t] ~ dnorm( mu1[t], tau1 ) ; #state for WT
x2[t] ~ dnorm( mu2[t], tau2 ) ; #state for KO
for (j1 in 1:J1) {
n1[j1, t] ~ dnorm(p1[j1, t], tau21 ) ; #obs for WT
p1[j1, t] <- beta1[j1] + x1[t];
}
for (j2 in 1:J2) {
n2[j2, t] ~ dnorm(p2[j2, t], tau22 ) ; #obs for KO
p2[j2, t] <- beta2[j2] + x2[t];
} }
mu1[1] <- 10 #Arbitrary start point for WT
mu2[1] <- 10 #Arbitrary start point for KO
for (j1 in 1:J1) { beta1[j1] ~ dnorm(beta01, taub1); } #random effects
for (j2 in 1:J2) { beta2[j2] ~ dnorm(beta02, taub2); }#random effects
for (t in 2:T) {
mu1[t] <- x1[t-1] #state-space WT
mu2[t] <- x2[t-1] #state-space KO
}
for (t in 1:T) {
pPop1[t] <- beta01+x1[t]; #population estimate WT
pPop2[t] <- beta02+x2[t]; #population estimate KO
}
#priors
tau1 ~ dgamma(.1, .01)
taub1 ~ dgamma(.1, .01)
tau21 ~ dgamma(.1, .01)
beta01 ~ dunif(-1000,1500)
tau2 ~ dgamma(.1, .01)
taub2 ~ dgamma(.1, .01)
tau22 ~ dgamma(.1, .01)
beta02 ~ dunif(-1000,1500)

57
Figure 1S. Generation of CDGI Knockout Mice, Related to Figure 1
(A) Diagram of the wildtype (WT) and knockout (KO) gene loci and the targeting construct used to
generate KO mice. Colored boxes represent translated exons, and white boxes represent untranslated
exons. Colors denote identified sequence domains. Triangles denote LoxP sites. Exons three and four
were floxed and deleted by Cre recombinase, either in embryonic stem cells transfected with Cre to
create a global knockout, or by crossing to mice with tissue-specific Cre expression to create a
conditional knockout. The deletion of exons three and four creates a frameshift mutation and premature
stop codon (UGA) in exon five.
(B) Southern blots of tail DNA from WT, heterozygous (HET) and global CDGI KO mice confirmed the
deletion in CDGI.
(C) RT-PCR from global CDGI KO and WT brain RNA demonstrated that the size of the CDGI transcript
in mutant mice was reduced as expected.
(D) CDGI protein (~69 kD) was detected in immunoblots of whole brain lysates from WTs and
heterozygotes but not in lysates from KOs.

58
(E) Immunoblots of striatal extracts from control mice carrying CDGIflox/flox and conditional KO mice
carrying CDGIflox/flox and D1-Cre YAC.
(F) Immunoblots show low levels of CDGI expression in neocortical extracts where both CDGI and D1-
Cre expression are low. Lower band is a β-tubulin loading control in E and F.
(G) CDGI KO mice showed loss of expression from CDGI exons 3 and 4, based on Affymetrix Exon 1.0
microarray data with striatal RNA samples, but no change in the non-deleted exons, and no
compensatory changes in expression of the paralog CalDAG-GEFII. n = 3WT/3KO.

59
Figure S2. Rap1 Activation Is Reduced in Platelets from Humans with Biallelic CDGI Mutations
Relative to Controls, Related to Figure 1
Platelets were activated with ADP (10 µm) for 1 min prior to stopping the reaction and lysing. Lysates
were used to prepare immunoblots for Rap1-GTP and total Rap1 and the values plotted on the bar graph
reflect the proportion of activated Rap1. P value was calculated by two-tailed Student’s t-tests for
unpaired samples. See Table S2 for exact values and additional data. Error bars show standard error of
the mean.

60
Figure S3. Global CDGI Knockout Mice Have Normal Gross Anatomy of the Brain and Baseline
Motor Behaviors, but Abnormal Motor Learning, Related to Figure 2

61
(A) Gross evaluation of transverse brain hemi-sections did not show differences between global knockout
(KO) and wildtype (WT) mice. Sections were stained for white matter (Loyez), cell bodies (Cresyl violet),
striosomal immunomarker (Mu-opioid receptor, MOR1), and immunomarkers for dopaminergic terminals
(tyrosine hydroxylase, TH and dopamine transporter, DAT).
(B) Autoradiograms of rostral and caudal transverse brain sections from global KOs and sibling WTs
incubated with tritiated SCH23390 (D1 receptor ligand) and raclopride (D2 receptor ligand) showed
equivalent levels of ligand binding between genotypes. See Table S5 for quantitative evaluation.
(C) Immunoblots of striatal lysates from WT and global KOs showed grossly equivalent levels of a wide
array of neuronal proteins and their phosphoprotein isoforms, as designated to the right of the blot.
Location of molecular weight markers is given in kilodaltons to the left of the blot. Bottom bands on each
blot show β-tubulin loading controls. Each lane of the blot represents lysates pooled from three mice, and
each experiment was performed and evaluated in triplicate.
(D) During a 24-hour homecage monitoring period, there were no differences between genotypes in the
proportion of total behavioral bouts or number of bouts for any of the automatically detected behaviors
(see Steele et al.(Steele et al., 2007) for details of the assay).
(E) Adult, age-matched global CDGI KO males and WT brothers had similar weights and total 24-hour
plain-chow consumption (P = 0.4 for weight and P = 0.8 for food consumed by two-tailed Student’s t-tests
for unpaired samples; n= 12W T, 9KO).
(F) KOs and WTs exhibit equivalent latencies to fall from an accelerating rotarod. P > 0.05 by two-tailed
Student’s t-test for unpaired samples. n = 9W T, 11KO.
(G) In open field tests, WTs and KOs exhibited equivalent distance traveled (first panel), percent time at
field margin (second panel), number of rearing events (third panel), and center entries (fourth panel)
during a 60 min period. P > 0.05 by two-tailed Student’s t-tests for all measures. n = 8WT, 10KO.
(H) The latency to retrieve a buried food pellet was not different between WTs and global KOs indicating
that olfactory function was not impaired by loss of CDGI. P = 0.9 by two-tailed Student’s t-test for
unpaired samples. n = 7WT, 4KO.
(I) In a tail-suspension test for learned helplessness (Crawley, 2000), the latency to stop struggling was
not different for WT and KO. P = 0.1 by two-tailed Student’s t-test for unpaired samples; n = 10W T, 7KO.
(J) In a 15 min marble-burying test for repetitive behavior(Thomas et al., 2009), the number of marbles
remaining unburied, out of 9 total, was equivalent for the two genotypes. P = 0.3 by two-tailed Student’s t-
tests for unpaired samples; n = 9WT, 8KO.
(K) In a test for social interaction and memory (Ferguson et al., 2000), WT and global KO male mice
sniffed the same female mouse for less time on repeated presentations (trials 1-4) and showed increased
interaction when a new female was presented (trial 5). Behavior was not significantly different between
genotypes. P > 0.19 for genotype comparison on each trial by two-tailed Student’s t-tests.
(L) Following the acquisition of the egocentric learning task (shown in Figure 2a), the rewarded arm was
switched to test reversal learning, for which WT and CDGI KO mice showed equivalent acquisition. *P <
0.05 on all days by unpaired, two-tailed Student’s t-test).
(M) CDGI KOs learned to navigate an allocentric, hippocampus-dependent, T-maze at the same rate as
sibling controls. Genotype effect: P = 0.588, genotype-by-session interaction effect: P = 0.713, session
effect: P < 0.001.
(N) In a context-dependent, fear conditioning task, WTs and KOs learned equivalently. Performance is
reflected by the reduction in distance traveled in a context paired with foot-shock relative to distance
traveled in the context prior to foot-shock. P = 0.572; n = 7WT, 7KO.
(O) WTs and KOs exhibited equivalent fear conditioning in a cued (amygdala-dependent) version of the
task as reflected by a similar drop in distance traveled when presented with a tone that was previously
paired with foot-shock. P = 0.712; n = 7WT, 7KO. Means + SEM are shown for E-O.
(P) Related to Figure 2b, the performance of individual mice is plotted on the step-wheel task. After
whisker-cutting, most CDGI KO mice have a higher variance than control mice for the timing of paw-
placement upon the pegs of the wheel.

62
Figure S4. CDGI Knockout Mice Treated with High-Dose Amphetamine Exhibited Significantly
Less Distance Traveled than Control Mice in Favor of Increased Stereotypy, but Showed
Equivalent Serum Amphetamine, Equivalent Total Striatal Dopamine and HVA, and Equivalent
Motoric Responses to Direct Dopamine Receptor Agonists and Antagonists, Related to Figure 2
(A and B) On day 1 of high-dose amphetamine treatment, the average length of each sniffing bout,
scored by videotape observation at 50-52 min post-injection, was higher in global CDGI knockout (KO)
mice relative to wildtype (WT) sibling controls (A) and in conditional CDGIflox/flox with D1-Cre YAC mice

63
relative to CDGIflox/flox sibling controls (B). n = 12KO, 12WT for 7 mg/kg, 8KO, 8WT for 14 mg/kg, and 8
conditional KO, 11 sibling controls for 7 mg/kg. Error bars show standard error of the mean.
(C-E) All behaviors that were scored by videotape, at 50-52 min post-injection, showing that both global
and conditional KO mice had a tendency for increased stereotypic behaviors (sniffing the wall, confined,
head bobbing) relative to the increased locomotor behaviors of their sibling controls.
(F) Saline-treated WT and global KO mice did not show differences in scored behavior.
(G and H) On day 1 of amphetamine treatment, global KO mice (G) and conditional KO CDGIflox/flox with
D1-Cre YAC mice (H) showed less distance traveled than WT or CDGIflox/flox sibling control mice in
response to high doses of amphetamine (14 for global KO and 7 mg/kg for CDGIflox/flox mice) on day 1 (top
plots), consistent with their increase in stereotypies. WTs showed reduced distance travelled on
challenge day (bottom plots) relative to day 1, consistent with stereotypy sensitization. KOs were already
in confined stereotypy on day 1 and did not show a significant reduction in distance traveled. Dotted lines
are raw data from each mouse; large open circles are population means; colored lines are random effects
estimates of the median with 90% confidence intervals. See significance plots in Figure S5.
(I and J) There were no significant differences in distance traveled data on saline injection day 3 (injection
at time = 0) between global CDGI KO and WT sibling controls (I) or between conditional CDGIflox/flox with
D1-Cre YAC mice and CDGIflox/flox sibling (J). See significance plots in Figure S5.
(K) Amphetamine levels were equivalent in serum collected from WTs and global CDGI KOs at 50 min
post-injection of amphetamine on day 1 (7 mg/kg). P > 0.9 by two-tailed Student’s t-test. (n = 5W T, 5KO).
(L) Total dopamine was measured in striatal homogenates that were collected at 50 min post-injection of
amphetamine or saline on challenge day. The challenge injection was given one week after the last
repeated saline or amphetamine (14 mg/kg) treatment (see STAR Methods). Dopamine levels were
equivalent in WTs and global CDGI KOs, indicating that there was not broad neurotoxicity to dopamine-
containing terminals. n = 4WT, 5KO for saline and n = 8W T, 6KO for amphetamine.
(M) COMT activity appeared to be equivalent at 50 min post-injection of saline or amphetamine in WTs
and global CDGI KOs, based on measurements of total HVA in tissue collected at 50 min post-injection of
amphetamine. n = 4 WT + saline, n = 7 WT + amphetamine, n = 5 KO + saline, n = 5 KO + amphetamine.
P = 0.1 for WT saline vs. amphetamine, P = 0.1 for KO saline vs. amphetamine by Student’s unpaired,
two-tailed t-tests.
(N) Distance traveled for separate groups of mice injected with dopamine receptor agonists and
antagonists injected at time 0 in the activity monitors. The combined D1/D2 receptor agonist apomorphine
(2.0 mg/kg, s.c.) induced slow locomotion in both WT and KO mice. Mice showed slow locomotor
responses to a combined injection of the D1 and D2 agonists SKF81297 (4.0 mg/kg, i.p) and quinpirole
(0.025 mg/kg, i.p), and to an injection of the atypical D1 agonist SKF83959 (0.4 mg/kg, i.p.). In mice that
were exposed to the activity monitor for the first time, exploratory locomotion was reduced relative to
saline-treated controls in both WT and KO mice that were injected with the D2 antagonist haloperidol (1.0
mg/kg, i.p), or the D1 antagonist SCH23390 (0.03 mg/kg, i.p), n = 8 global KO, 8WT for each experiment.

64
Figure S5. CDGI Knockout Mice Show Significantly Less Distance Traveled after Acute Treatment
with High-Dose, but Not Low-Dose, Amphetamine, Related to Figure 2
(A-D) Significance comparisons were made between genotypes on day 1 and challenge day and, to
measure sensitization, within genotypes on day 1 vs. challenge day. Plots show comparisons between
wildtype (WT) and knockout (KO) mice with 14 mg/kg (A), 7 mg/kg (B) or 2.5 mg/kg (C) amphetamine
treatment, and between conditional CDGIfl ox/flox with D1-Cre YAC mice relative to CDGIflox/flox sibling
controls with 7 mg/kg amphetamine treatment (D). Green asterisks indicate significant differences (P <
0.05) with Bonferroni corrected comparisons. When the Pr value (Y axes) approaches 0, the first data set
(indicated prior to “vs.” in the plot title) is greater than the second data set. For example, the upper left
plot of A shows that KOs travelled significantly less than WTs during the 3-50 min post-injection period
when stereotypies predominated. Data were analyzed using the state-space random effect model (see
STAR Methods).
(E and F) Significance plots (equivalent to those shown in A-D) for saline-injected KOs and WTs (E) and
for saline-injected conditional KOs and sibling controls (F).

65
Figure S6. Responses to a Slow Depolarizing Voltage Ramp Command in Cells from KOs and WTs
Are Similar, Related to Figure 5E-H
(A) Traces show inward (sodium and calcium) and outward (potassium) currents induced by a
depolarizing ramp voltage command from −80 to +50 mV in SPNs from WTs and CDGI KOs.
(B) The action potential discharge induced by depolarizing current steps (shown at bottom) was similar in
SPNs recorded from WT and KO mice. RMP: resting membrane potential; IR: input resistance, n = 8
global KO, 16WT.

66
Table S1. List of All Reported Mutations in CDGI Known So Far, All of Which Are Associated with
Defective Hemostasis, Related to Figure 1
Amino acid change
in protein sequence
Variant position in
coding DNA
Variant position in
DNA relative to NCBI
sequence
NM_001098670
Reference
p.N67Lfs*24
c.199_200delAA
386
9
p.R113*
c.337C>T
524
2
p.P125*
c.372 -3C>G
559-3
p.F181S
c.542T>C
729
9
p.Q236*
c.887G>A
893
8
p.G248W
c.742G>T
929
4
p.E260*
c.778G>T
965
9
p.Y289C
c.866A>G
1053
9
p.C296R
c.886T>C
1073
9
p.C296Y
c.706C>T
1074
8
p.G305D
c.914G>A
1101
9, 10
p.K309*
c.925A>T
1112
6
p.N330K
c.990C>AorG
1177
9
p.A345P
c.1033G>C
1220
9
p.L360del
c.1078_1080delCTG
1265
6
p.S381F
c.1142C>T
1329
7
p.R494Afs*54
c.1479_1480insG
1666
9
p.F497Sfs*22
c.1490delT
1677
9
fs: frameshift; *nonsense mutation that leads to downstream stop codon; del: amino acid deletion.

67
Supplementary Table 2. Platelet Aggregation Assays Show That the Individuals with CDGI Mutations Who Underwent Neurological Testing Show Severely Reduced Platelet Activation as Homozygotes but Not as
Heterozygotes, Related to Figure 1
Patients
Family/
subject
Genetics
Sex
Age
Aggregation
ADP maximal
intensity
(10-5 µM)
Aggregation
ADP velocity
(10-5 µM)
Aggregation
TRAP-6 maximal
intensity
(10-5 µM)
Aggregation
TRAP-6 velocity
(10-5 µM)
Rap1-GTP/total-Rap1
(a.u.) basal
Rap1-GTP/total-Rap1
(a.u.) ADP (10 µM)
Rap1-GTP/total-Rap1
(a.u.) TRAP-6 (10 µM)
Control 1
M
38
86-85
161-136
85-5
77-20
0.9
7.2
46.5
Control 2
F
55
88-90
182-164
87-10
158-35
0.8
19
4.6
Control 3
M
88-92
171-171
88-9
104-30
n.d
n.d
n.d
1.1
Homozygous
G248W
F
61
49-40
88-77
26-0
56-0
0.6
1.8
16
1.2
Homozygous
G248W
M
59
29-22
54-46
12-0
32-0
2.3
1.2
2.8
1.3
Homozygous
G248W
M
55
7-0
32-0
0-0
0-0
n.d
n.d
n.d
2.1
Heterozygous
C296R
M
47
83-60
159-123
93-8
174-30
0.8
10.6
5.4
2.2
Heterozygous
E260*
F
46
89-85
127-112
90-2
172-2
1.2
8.8
4.2
2.3
Double trans-
heterozygous
C296R E260*
F
19
32-13
64-37
78-1
55-3
0.3
0.6
2.7
3.1
Heterozygous
N67Lfs*2
M
50
Not possible patient under
antiplatelet therapy
Not possible patient under
antiplatelet therapy
3.2
Heterozygous
N67Lfs*2
F
54
84-82
135-119
90-1
212-10
0.6
0.1
1.4
3.3
Homozygous
N67Lfs*2
F
23
16-4
38-20
79-0
81-4
0.4
0.5
1.5

68
Table S3. Mouse Exon Array, Related to Figure 1
Provided as an Excel file.
Table S4. Mouse Total Striatal Amino Acid and Biogenic Amine Measurements, Related to Figure 1
Provided as an Excel file.
Table S5. Dopamine Receptor Ligand Binding, Related to Figure 1
3H-SCH23390 (D1)
3H-Raclopride (D2)
3H-PD128907 (D3)
WT
KO
P
WT
KO
P
WT
KO
P
DL
458 ± 54
526 ± 70
0.48
175 ± 6
155 ± 7
0.09
DM
455 ± 48
505 ± 69
0.59
138 ± 7
124 ± 6
0.18
VL
463 ± 48
527 ± 62
0.45
156 ± 8
141 ± 8
0.25
VM
412 ± 47
484 ± 62
0.40
117 ± 6
111 ± 5
0.50
All
442 ± 50
497 ± 64
0.54
141 ± 9
132 ± 6
0.41
35 ± 7
36 ± 2
0.85
NAc Core
352 ± 24
370 ± 47
0.78
65 ± 5
58 ± 6
0.39
NAc Shell
400 ± 16
403 ± 43
0.97
72 ± 5
67 ± 6
0.58
NAc All
375 ± 15
394 ± 50
0.80
69 ± 5
64 ± 6
0.63
26 ± 3
23 ± 3
0.56
Olf Tubercle
397 ± 25
384 ± 60
0.89
85 ± 7
75 ± 8
0.43
31 ± 5
29 ± 4
0.75
Wildtype (WT, n = 6) and CDGI knockout (KO, n = 8) values were not significantly different by two-tailed
Student’s t-test for unpaired samples. Means ± SEM are shown. DL: dorsolateral striatum, DM:
dorsomedial striatum, VL: ventrolateral striatum, VM: ventromedial striatum, NAc: Nucleus accumbens,
Olf: olfactory tubercle.

69
Table S6. Neurological Responses Are Normal in Global CDGI Knockout Mice, Related to Figure 2.
Wildtype
(n = 7)
Knockout
(n = 9)
Range
Normal
response
Tremor
0
0
0-1
0
Stereotypy
0
0
0-1
0
Convulsions
0
0
0-1
0
Visual placing
3
3
0-5
3
Grip strength
2
2
0-3
2
Catalepsy
2
1
0-4
0
Wire maneuver
0
0
0-4
0
Flexion reflex
2
2
0-3
2
Turning
4
4
0-4
4
Falling
0
0
0-2
0
Age-matched males and wildtype sibling were scored according the SHIRPA protocol (Rogers et al.,
1997)

70
Table S7. Basic Membrane Properties of SPNs in Slices, Related to Figure 4
Cell capacitance
(pF)
Input resistance
(MΩ)
Time constant
(ms)
Wildtype (n = 17)
81 ± 3
75 ± 8
1.5 ± 0.1
Knockout (n = 24)
85 ± 4
71 ± 4
1.5 ± 0.1
P > 0.05 for inter-genotype comparisons by two-tailed Student’s t-test for unpaired samples. Means ±
standard errors are shown.

71
Table S8. Basic Membrane Properties of Acutely Dissociated Medium Spiny Striatal Neurons,
Related to Figure 4
Capacitance
(pF)
Input resistance
(GΩ)
Time constant
(μs)
Wildtype (n = 11)
14 ± 0.9
2.4 ± 0.3
171 ± 30
Knockout (n = 15)
13 ± 0.4
1.9 ± 0.2
149 ± 13
P > 0.05 for inter-genotype comparisons by two-tailed Student’s t-test for unpaired samples. Means and
standard errors are shown.

72
References
Aliane, V., Perez, S., Bohren, Y., Deniau, J.M., and Kemel, M.L. (2011). Key role of
striatal cholinergic interneurons in processes leading to arrest of motor stereotypies.
Brain 134, 110-118.
American Psychiatric Association, D.-V., ed. (2013). American Psychiatric Association:
Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition. (Washington, DC).
Bergmeier, W., Goerge, T., Wang, H.W., Crittenden, J.R., Baldwin, A.C., Cifuni, S.M.,
Housman, D.E., Graybiel, A.M., and Wagner, D.D. (2007). Mice lacking the signaling
molecule CalDAG-GEFI represent a model for leukocyte adhesion deficiency type III. J
Clin Invest 117, 1699-1707.
Boraud, T., Leblois, A., and Rougier, N.P. (2018). A natural history of skills. Prog
Neurobiol 171, 114-124.
Boudreaux, M.K., Catalfamo, J.L., and Klok, M. (2007). Calcium-diacylglycerol guanine
nucleotide exchange factor I gene mutations associated with loss of function in canine
platelets. Transl Res 150, 81-92.
Breuer, O., Lawhorn, C., Miller, T., Smith, D.M., and Brown, L.L. (2005). Functional
architecture of the mammalian striatum: mouse vascular and striosome organization
and their anatomic relationships. Neurosci Lett 385, 198-203.
Calabresi, P., Centonze, D., Gubellini, P., and Bernardi, G. (1999). Activation of M1-like
muscarinic receptors is required for the induction of corticostriatal LTP.
Neuropharmacology 38, 323-326.
Calabresi, P., Pisani, A., Mercuri, N.B., and Bernardi, G. (1992). Long-term Potentiation
in the Striatum is Unmasked by Removing the Voltage-dependent Magnesium Block of
NMDA Receptor Channels. Eur J Neurosci 4, 929-935.
Canales, J.J., and Graybiel, A.M. (2000). A measure of striatal function predicts motor
stereotypy. Nat Neurosci 3, 377-383.

73
Canault, M., Ghalloussi, D., Grosdidier, C., Guinier, M., Perret, C., Chelghoum, N.,
Germain, M., Raslova, H., Peiretti, F., Morange, P.E., et al. (2014). Human CalDAG-
GEFI gene (RASGRP2) mutation affects platelet function and causes severe bleeding. J
Exp Med 211, 1349-1362.
Cantuti-Castelvetri, I., Klucken, J., Ingelsson, M., Ramasamy, K., McLean, P.J., Frosch,
M.P., Hyman, B.T., and Standaert, D.G. (2005). Alpha-synuclein and chaperones in
dementia with Lewy bodies. J Neuropathol Exp Neurol 64, 1058-1066.
Capper-Loup, C., Canales, J.J., Kadaba, N., and Graybiel, A.M. (2002). Concurrent
activation of dopamine D1 and D2 receptors is required to evoke neural and behavioral
phenotypes of cocaine sensitization. J Neurosci 22, 6218-6227.
Centonze, D., Costa, C., Rossi, S., Prosperetti, C., Pisani, A., Usiello, A., Bernardi, G.,
Mercuri, N.B., and Calabresi, P. (2006). Chronic cocaine prevents depotentiation at
corticostriatal synapses. Biol Psychiatry 60, 436-443.
Cepeda, C., Colwell, C.S., Itri, J.N., Chandler, S.H., and Levine, M.S. (1998).
Dopaminergic modulation of NMDA-induced whole cell currents in neostriatal neurons in
slices: contribution of calcium conductances. J Neurophysiol 79, 82-94.
Crawley, J.N. (2000). What's wrong with my mouse? : behavioral phenotyping of
transgenic and knockout mice (New York: Wiley-Liss).
Crittenden, J.R., Bergmeier, W., Zhang, Y., Piffath, C.L., Liang, Y., Wagner, D.D.,
Housman, D.E., and Graybiel, A.M. (2004). CalDAG-GEFI integrates signaling for
platelet aggregation and thrombus formation. Nat Med 10, 982-986.
Crittenden, J.R., Cantuti-Castelvetri, I., Saka, E., Keller-McGandy, C.E., Hernandez,
L.F., Kett, L.R., Young, A.B., Standaert, D.G., and Graybiel, A.M. (2009). Dysregulation
of CalDAG-GEFI and CalDAG-GEFII predicts the severity of motor side-effects induced
by anti-parkinsonian therapy. Proc Natl Acad Sci U S A 106, 2892-2896.
Crittenden, J.R., Dunn, D.E., Merali, F.I., Woodman, B., Yim, M., Borkowska, A.E.,
Frosch, M.P., Bates, G.P., Housman, D.E., Lo, D.C., et al. (2010). CalDAG-GEFI down-

74
regulation in the striatum as a neuroprotective change in Huntington's disease. Hum Mol
Gen 19, 1756-1765.
Crittenden, J.R., and Graybiel, A.M. (2017). Disease-associated Changes in the
Striosome and Matrix Compartments of the Dorsal Striatum. In Handbook of Basal
Ganglia Structure and Function, Second Edition, H. Steiner, Tseng, K., ed. (Elsevier).
Crittenden, J.R., Lacey, C.J., Lee, T., Bowden, H.A., and Graybiel, A.M. (2014). Severe
drug-induced repetitive behaviors and striatal overexpression of VAChT in ChAT-ChR2-
EYFP BAC transgenic mice. Front Neural Circuits 8, 57.
Crittenden, J.R., Lacey, C.J., Weng, F.J., Garrison, C.E., Gibson, D.J., Lin, Y., and
Graybiel, A.M. (2017). Striatal Cholinergic Interneurons Modulate Spike-Timing in
Striosomes and Matrix by an Amphetamine-Sensitive Mechanism. Front Neuroanat 11,
20.
Crittenden, J.R., Yoshida, T., Davis, M. I., and Graybiel, A. M. (2017).
Immunofluorescence for free-floating brain sections. (protocols.io).
Dautan, D.H.-O., I.; Witten, I. B.: Deisseroth K.: Bolam, J. P.; Gerdjikov, T.; Mena-
Segovia, J. (2014). A Major External Source of Cholinergic Innervation of the Striatum
and Nucleus Accumbens Originates in the Brainstem. J Neurosci 34, 4509–4518.
Ferguson, J.N., Young, L.J., Hearn, E.F., Matzuk, M.M., Insel, T.R., and Winslow, J.T.
(2000). Social amnesia in mice lacking the oxytocin gene. Nat Genet 25, 284-288.
Ghandour, H., Cullere, X., Alvarez, A., Luscinskas, F.W., and Mayadas, T.N. (2007).
Essential role for Rap1 GTPase and its guanine exchange factor CalDAG-GEFI in LFA-
1 but not VLA-4 integrin mediated human T-cell adhesion. Blood 110, 3682-3690.
Gong, S., Zheng, C., Doughty, M.L., Losos, K., Didkovsky, N., Schambra, U.B., Nowak,
N.J., Joyner, A., Leblanc, G., Hatten, M.E., et al. (2003). A gene expression atlas of the
central nervous system based on bacterial artificial chromosomes. Nature 425, 917-925.

75
Graybiel, A.M. (2008). Habits, rituals, and the evaluative brain. Annu Rev Neurosci 31,
359-387.
Graybiel, A.M., and Ragsdale, C.W., Jr. (1978). Histochemically distinct compartments
in the striatum of human, monkeys, and cat demonstrated by acetylthiocholinesterase
staining. Proc Natl Acad Sci U S A 75, 5723-5726.
Guitart-Masip, M., Johansson, B., Fernandez-Teruel, A., Canete, T., Tobena, A.,
Terenius, L., and Gimenez-Llort, L. (2006). Divergent anatomical pattern of D1 and D3
binding and dopamine- and cyclic AMP-regulated phosphoprotein of 32 kDa mRNA
expression in the Roman rat strains: Implications for drug addiction. Neuroscience 142,
1231-1243.
Guo, F.F., Kumahara, E., and Saffen, D. (2001). A CalDAG-GEFI/Rap1/B-Raf cassette
couples M(1) muscarinic acetylcholine receptors to the activation of ERK1/2. J Biol
Chem 276, 25568-25581.
Guru, S.C., Crabtree, J.S., Brown, K.D., Dunn, K.J., Manickam, P., Prasad, N.B.,
Wangsa, D., Burns, A.L., Spiegel, A.M., Marx, S.J., et al. (1999). Isolation, genomic
organization, and expression analysis of Men1, the murine homolog of the MEN1 gene.
Mamm Genome 10, 592-596.
Hsu, Y., and Serpell, J.A. (2003). Development and validation of a questionnaire for
measuring behavior and temperament traits in pet dogs. J Am Vet Med Assoc 223,
1293-1300.
Janickova, H., Prado, V.F., Prado, M.A.M., El Mestikawy, S., and Bernard, V. (2017).
Vesicular acetylcholine transporter (VAChT) over-expression induces major
modifications of striatal cholinergic interneuron morphology and function. J Neurochem
142, 857-875.
Kawasaki, H., Springett, G.M., Toki, S., Canales, J.J., Harlan, P., Blumenstiel, J.P.,
Chen, E.J., Bany, I.A., Mochizuki, N., Ashbacher, A., et al. (1998). A Rap guanine

76
nucleotide exchange factor enriched highly in the basal ganglia. Proc Natl Acad Sci U S
A 95, 13278-13283.
Kincaid, A.E., and Wilson, C.J. (1996). Corticostriatal innervation of the patch and
matrix in the rat neostriatum. J Comp Neurol 374, 578-592.
Kitagawa, G.a.G., W. (1996). Smoothness priors analysis of time series (Springer).
Kitsukawa, T., Nagata, M., Yanagihara, D., Tomioka, R., Utsumi, H., Kubota, Y., Yagi,
T., Graybiel, A.M., and Yamamori, T. (2011). A novel instrumented multipeg running
wheel system, Step-Wheel, for monitoring and controlling complex sequential stepping
in mice. J Neurophysiol 106, 479-487.
Kreitzer, A.C., and Malenka, R.C. (2008). Striatal plasticity and basal ganglia circuit
function. Neuron 60, 543-554.
Kuczenski, R., and Segal, D.S. (1997). An escalating dose/multiple high-dose binge
pattern of amphetamine administration results in differential changes in the extracellular
dopamine response profiles in caudate-putamen and nucleus accumbens. J Neurosci
17, 4441-4447.
Kuczenski, R., and Segal, D.S. (2001). Caudate-putamen and nucleus accumbens
extracellular acetylcholine responses to methamphetamine binges. Brain Res 923, 32-
38.
Lebois, E.P., Bridges, T.M., Lewis, L.M., Dawson, E.S., Kane, A.S., Xiang, Z., Jadhav,
S.B., Yin, H., Kennedy, J.P., Meiler, J., et al. (2010). Discovery and characterization of
novel subtype-selective allosteric agonists for the investigation of M(1) receptor function
in the central nervous system. ACS Chem Neurosci 1, 104-121.
Lemberger, T., Parlato, R., Dassesse, D., Westphal, M., Casanova, E., Turiault, M.,
Tronche, F., Schiffmann, S.N., and Schutz, G. (2007). Expression of Cre recombinase
in dopaminoceptive neurons. BMC Neurosci 8, 4.

77
Lozano, M.L., Cook, A., Bastida, J.M., Paul, D.S., Iruin, G., Cid, A.R., Adan-Pedroso,
R., Ramon Gonzalez-Porras, J., Hernandez-Rivas, J.M., Fletcher, S.J., et al. (2016).
Novel mutations in RASGRP2, which encodes CalDAG-GEFI, abrogate Rap1
activation, causing platelet dysfunction. Blood 128, 1282-1289.
Lunn, D.J., Thomas, A., and Spiegelhalter, D. (2000). WinBUGS – A Bayesian
modelling framework: Concepts, structure, and extensibility. Stat Comput 10, 325-337.
Mallet, N., Micklem, B.R., Henny, P., Brown, M.T., Williams, C., Bolam, J.P., Nakamura,
K.C., and Magill, P.J. (2012). Dichotomous organization of the external globus pallidus.
Neuron 74, 1075-1086.
McCool, M.F., Patel, S., Talati, R., and Ragozzino, M.E. (2008). Differential involvement
of M1-type and M4-type muscarinic cholinergic receptors in the dorsomedial striatum in
task switching. Neurobiol Learn Mem 89, 114-124.
Moussa, R., Poucet, B., Amalric, M., and Sargolini, F. (2011). Contributions of dorsal
striatal subregions to spatial alternation behavior. Learn Mem 18, 444-451.
Nakamura, T., Nagata, M., Yagi, T., Graybiel, A.M., Yamamori, T., and Kitsukawa, T.
(2017). Learning new sequential stepping patterns requires striatal plasticity during the
earliest phase of acquisition. Eur J Neurosci 45, 901-911.
Niemz, J., Kliche, S., Pils, M.C., Morrison, E., Manns, A., Freund, C., Crittenden, J.R.,
Graybiel, A.M., Galla, M., Jansch, L., et al. (2017). The Guanine-Nucleotide Exchange
Factor Caldag Gefi Fine-Tunes Functional Properties of Regulatory T Cells. Eur J
Microbiol Immunol (Bp) 7, 112-126.
Packard, M.G., and McGaugh, J.L. (1996). Inactivation of hippocampus or caudate
nucleus with lidocaine differentially affects expression of place and response learning.
Neurobiol Learn Mem 65, 65-72.
Partridge, J.G., Tang, K.C., and Lovinger, D.M. (2000). Regional and postnatal
heterogeneity of activity-dependent long-term changes in synaptic efficacy in the dorsal
striatum. J Neurophysiol 84, 1422-1429.

78
Paxinos, G., Franklin, K. (2001). The mouse brain in stereotaxic coordinates (San
Diego: Academic Press).
Perez-Burgos, A., Prieto, G.A., Galarraga, E., and Bargas, J. (2010). CaV2.1 channels
are modulated by muscarinic M1 receptors through phosphoinositide hydrolysis in
neostriatal neurons. Neuroscience 165, 293-299.
Ragsdale, C.W., Jr., and Graybiel, A.M. (1990). A simple ordering of neocortical areas
established by the compartmental organization of their striatal projections. Proc Natl
Acad Sci U S A 87, 6196-6199.
Rogers, D.C., Fisher, E.M., Brown, S.D., Peters, J., Hunter, A.J., and Martin, J.E.
(1997). Behavioral and functional analysis of mouse phenotype: SHIRPA, a proposed
protocol for comprehensive phenotype assessment. Mamm Genome 8, 711-713.
Sevivas, T., Bastida, J.M., Paul, D.S., Caparros, E., Palma-Barqueros, V., Coucelo, M.,
Marques, D., Ferrer-Marin, F., Gonzalez-Porras, J.R., Vicente, V., et al. (2018).
Identification of two novel mutations in RASGRP2 affecting platelet CalDAG-GEFI
expression and function in patients with bleeding diathesis. Platelets 29, 192-195.
Shen, W., Flajolet, M., Greengard, P., and Surmeier, D.J. (2008). Dichotomous
dopaminergic control of striatal synaptic plasticity. Science 321, 848-851.
Shen, W., Tian, X., Day, M., Ulrich, S., Tkatch, T., Nathanson, N.M., and Surmeier, D.J.
(2007). Cholinergic modulation of Kir2 channels selectively elevates dendritic excitability
in striatopallidal neurons. Nat Neurosci 10, 1458-1466.
Smith, A.C., Frank, L.M., Wirth, S., Yanike, M., Hu, D., Kubota, Y., Graybiel, A.M.,
Suzuki, W.A., and Brown, E.N. (2004). Dynamic analysis of learning in behavioral
experiments. J Neurosci 24, 447-461.
Smith, A.C., Shah, S.A., Hudson, A.E., Purpura, K.P., Victor, J.D., Brown, E.N., and
Schiff, N.D. (2009). A Bayesian statistical analysis of behavioral facilitation associated
with deep brain stimulation. J Neurosci Methods 183, 267-276.

79
Smith, A.C., Stefani, M.R., Moghaddam, B., and Brown, E.N. (2005). Analysis and
design of behavioral experiments to characterize population learning. J Neurophysiol
93, 1776-1792.
Smith, A.C., Wirth, S., Suzuki, W.A., and Brown, E.N. (2007). Bayesian analysis of
interleaved learning and response bias in behavioral experiments. J Neurophysiol 97,
2516-2524.
Steele, A.D., Jackson, W.S., King, O.D., and Lindquist, S. (2007). The power of
automated high-resolution behavior analysis revealed by its application to mouse
models of Huntington's and prion diseases. Proc Natl Acad Sci U S A 104, 1983-1988.
Thomas, A., Burant, A., Bui, N., Graham, D., Yuva-Paylor, L.A., and Paylor, R. (2009).
Marble burying reflects a repetitive and perseverative behavior more than novelty-
induced anxiety. Psychopharmacology (Berl) 204, 361-373.
Thomsen, M., Conn, P.J., Lindsley, C., Wess, J., Boon, J.Y., Fulton, B.S., Fink-Jensen,
A., and Caine, S.B. (2010). Attenuation of cocaine's reinforcing and discriminative
stimulus effects via muscarinic M1 acetylcholine receptor stimulation. J Pharmacol Exp
Ther 332, 959-969.
Unterwald, E.M., Ho, A., Rubenfeld, J.M., and Kreek, M.J. (1994). Time course of the
development of behavioral sensitization and dopamine receptor up-regulation during
binge cocaine administration. J Pharmacol Exp Ther 270, 1387-1396.
Unterwald, E.M., Kreek, M.J., and Cuntapay, M. (2001). The frequency of cocaine
administration impacts cocaine-induced receptor alterations. Brain Res 900, 103-109.
Valjent, E., Bertran-Gonzalez, J., Aubier, B., Greengard, P., Herve, D., and Girault, J.A.
(2010). Mechanisms of locomotor sensitization to drugs of abuse in a two-injection
protocol. Neuropsychopharmacology 35, 401-415.
Westbury, S.K., Canault, M., Greene, D., Bermejo, E., Hanlon, K., Lambert, M.P., Millar,
C.M., Nurden, P., Obaji, S.G., Revel-Vilk, S., et al. (2017). Expanded repertoire of

80
RASGRP2 variants responsible for platelet dysfunction and severe bleeding. Blood 130,
1026-1030.
Zhang, H., and Sulzer, D. (2003). Glutamate spillover in the striatum depresses
dopaminergic transmission by activating group I metabotropic glutamate receptors. J
Neurosci 23, 10585-10592.