PresentationPDF Available

Evolutionary traits in Chikungunya virus untranslated regions

Authors:

Abstract

Chikungunya virus (CHIKV), a mosquito-borne alphavirus of the Togaviridae family, has recently emerged in the Americas from two originating continents, Asia and Africa. Historically, CHIKV circulated as at least four lineages worldwide with both enzootic and epidemic transmission cycles. To understand the recent re-emergence patterns, and the current status of the CHIKV spread, an updated phylogeny of the virus is needed. Here, we performed phylogenetic and comparative genomics screens of CHIKV genomes, taking advantage of the public availability of many recently sequenced isolates. Based on these new data and analyses, we derive a revised phylogeny from full open reading frame nucleotide sequences. Within this phylogeny, we propose the presence of several distinct lineages in Africa which were once considered a single lineage. In parallel, thermodynamic modeling of CHIKV untranslated regions (UTRs) reveals a cascade of evolutionarily conserved RNA structures, in particular in the 3' UTR. We provide evidence for the duplication of non-coding RNAs (ncRNAs) in recently emerged Carribean CHIKV isolates and propose the existence of lineage-specific duplicated ncRNAs in different CHIKV lineages.
Evolutionary traits in Chikungunya
virus untranslated regions
Michael T. Wolfinger
4th VDS Retreat, Mondsee!
26 June 2019
Research Group Bioinformatics and Computational Biology
& Department of Theoretical Chemistry
University of Vienna
!2
Chikungunya Virus (CHIKV)
Family Togaviridae / genus Alphavirus; mosquito-borne (Aedes spp.)
Single-stranded (+) sense RNA virus
“Chikungunya” (Makonde language): “Disease that bend up the joints”
Chikungunya fever: febrile illness, arthralgia, rash, rarely causes hemorrhagic complications
Enzootic in tropical and subtropical regions of Africa
First outbreak described 1952 in Tanzania
No vaccine available
Weaver and Forrester, Antivir. Res. (2015)
!3
Weaver and Forrester, Antivir. Res. (2015)
Alphavirus Genome Organization
Non-segmented, single-stranded, (+)-sense RNA genomes of 11-12kB length
Capped and polyadenylated
AV genomes appear to host cells as mRNA for immediate translation upon entry into the cytoplasm
Viralzone / ExPASy
!4
https://viralzone.expasy.org/
Part I: Phylogeography
!5
CHIKV Epidemic Spread
Frickmann et al., Viruses (2019)
!6
Viruses 2019,11, 550 2 of 8
often associated with temporary outbreak events [
9
], leading to temporally increased infection risks in
contrast to arbovirus infections such as dengue fever, with continuously increasing case numbers [
7
,
8
].
Viruses 2019, 11, x FOR PEER REVIEW 2 of 8
in contrast to arbovirus infections such as dengue fever, with continuously increasing case numbers
[7,8].
Figure 1. Countries or regions with chikungunya virus (CHIKV) endemicity and/or outbreaks
mentioned in this review in the order of appearance (black dots and numerals 1–11). 1. Réunion; 2.
Malay Archipelago; 3. Makonde/Tanzania; 4. Thailand; 5. Vietnam; 6. Southern Sudan; 7. Belize; 8.
Curaçao; 9. Saint Martin; 10. Puerto Rico; 11. Jamaica. Arrows with year dates indicate global spread
of CHIKV as described by Young, 2018 [7]. Map colorings show infestations of countries and areas
with relevant arthropod vectors according to Rezza and Weaver, 2019 [8]. Information on CHIKV
lineages were adapted from Weaver and Lecuit, 2015 [4]. Map template source: Petr Dlouhý,
Wikimedia Commons.
Accordingly, apart from the impact on local populations as well as on travelers, CHIKV also
poses a threat to soldiers or peace-keeping forces who are deployed in areas of endemicity and
exposed due to their professional outdoor activity. Up-to-date maps of areas of autochthonous
CHIKV transmission can be monitored at the Centers of Disease Control and Prevention [9].
Chikungunya fever disease is associated with elevated body temperature, rash, and severe, often
long-lasting polyarthralgia [10,11] with considerable impact on soldiers’ health and ability to fulfil
their duty on deployment. Persistent synovitis as described for a US soldier deployed to Central
America may occur [12]. In line with the symptoms, the term chikungunya” is derived from the term
“kungunyala” of the Makonde language, meaning “to become contorted” [1,13]. The early symptoms
of chikungunya fever are clinically indistinguishable from other febrile tropical virus infections such
as dengue fever [11]. This circumstance makes differential diagnosis rather challenging, since on-site
surveillance in the field on deployment requires sophisticated mobile diagnostic equipment or high-
level host nation support.
Certainly, CHIKV is not the only viral agent with potentially harmful effects on the health of
deployed soldiers. Basically, deployed soldiers are exposed to the same infection risks as civilian
travelers or deployed civilian health care workers, with transmission routes ranging from smear
infections, like in the case of viral gastroenteritis, to viral infections transmitted by stings, bites, or
droplets from arthropods or other animals or human-to-human infections including sexually
transmitted viral diseases [14,15]. Only a few viral infection risks associated with traveling or
deployments are vaccine preventable, such as the arthropod-borne yellow fever and Japan B
encephalitis, tick-borne encephalitis, as well as rabies or hepatitis A and B infections [16].
This narrative minireview concentrates on and summarizes experiences of international military
medical services with the epidemiology of chikungunya infections in deployed personnel and
Figure 1.
Countries or regions with chikungunya virus (CHIKV) endemicity and/or outbreaks mentioned
in this review in the order of appearance (black dots and numerals 1–11). 1. R
é
union; 2. Malay
Archipelago; 3. Makonde/Tanzania; 4. Thailand; 5. Vietnam; 6. Southern Sudan; 7. Belize; 8. Curaçao;
9. Saint Martin; 10. Puerto Rico; 11. Jamaica. Arrows with year dates indicate global spread of CHIKV
as described by Young, 2018 [
7
]. Map colorings show infestations of countries and areas with relevant
arthropod vectors according to Rezza and Weaver, 2019 [
8
]. Information on CHIKV lineages were
adapted from Weaver and Lecuit, 2015 [4]. Map template source: Petr Dlouh˛,WikimediaCommons.
Accordingly, apart from the impact on local populations as well as on travelers, CHIKV also poses
a threat to soldiers or peace-keeping forces who are deployed in areas of endemicity and exposed due
to their professional outdoor activity. Up-to-date maps of areas of autochthonous CHIKV transmission
can be monitored at the Centers of Disease Control and Prevention [
9
]. Chikungunya fever disease is
associated with elevated body temperature, rash, and severe, often long-lasting polyarthralgia [
10
,
11
]
with considerable impact on soldiers’ health and ability to fulfil their duty on deployment. Persistent
synovitis as described for a US soldier deployed to Central America may occur [
12
]. In line with
the symptoms, the term “chikungunya” is derived from the term “kungunyala” of the Makonde
language, meaning “to become contorted” [
1
,
13
]. The early symptoms of chikungunya fever are
clinically indistinguishable from other febrile tropical virus infections such as dengue fever [
11
]. This
circumstance makes dierential diagnosis rather challenging, since on-site surveillance in the field on
deployment requires sophisticated mobile diagnostic equipment or high-level host nation support.
Certainly, CHIKV is not the only viral agent with potentially harmful eects on the health of
deployed soldiers. Basically, deployed soldiers are exposed to the same infection risks as civilian
travelers or deployed civilian health care workers, with transmission routes ranging from smear
infections, like in the case of viral gastroenteritis, to viral infections transmitted by stings, bites, or
droplets from arthropods or other animals or human-to-human infections including sexually transmitted
viral diseases [
14
,
15
]. Only a few viral infection risks associated with traveling or deployments are
vaccine preventable, such as the arthropod-borne yellow fever and Japan B encephalitis, tick-borne
encephalitis, as well as rabies or hepatitis A and B infections [16].
This narrative minireview concentrates on and summarizes experiences of international military
medical services with the epidemiology of chikungunya infections in deployed personnel and preventive
approaches for the deployment situation. The literature review was based upon PubMed/Medline
Updated CHIKV Phylogeny
590 CHIKV genomes
iq-tree / SH-aLRT
!7
KY703952.1
KY703924.1
KY703926.1
KY703974.1
KY703891.1
KY703986.1
KY703982.1
KY703971.1
KY703907.1
KY703914.1
KY703892.1
KY703889.1
KY703995.1
KY703943.1
KY703944.1
KY703890.1
KY703965.1
KY703905.1
KY703988.1
KY703950.1
KY703997.1
KY703966.1
KY703933.1
KY703951.1
KY703923.1
KY703983.1
KY703987.1
KY703925.1
KY703990.1
KY703992.1
KY703975.1
KY703960.1
KY703999.1
KY703921.1
KY703968.1
KY703972.1
KY704002.1
KY703978.1
KY680375.1
KY703955.1
KY703948.1
KY703919.1
KY703959.1
KY703996.1
KY703935.1
KY703920.1
MF773560.1
KY680379.1
KY435459.1
KY435480.1
KY435456.1
KY435470.1
KY680399.1
KR559488.1
KR559475.1
KY703956.1
KY703898.1
KY680352.1
KY680361.1
KY680398.1
KY680384.1
KY703922.1
KY703908.1
KY680389.1
KR559476.1
KY703928.1
KY703909.1
KY703918.1
KY703901.1
KY703984.1
KY703947.1
KY680359.1
KT192707.1
KY680363.1
KY680355.1
KY703970.1
KY703994.1
KY703934.1
KY703899.1
KR559484.1
KR046232.1
KY703903.1
KY703902.1
KY703897.1
KY703927.1
KR559472.1
KY415985.1
KY415982.1
KY415978.1
KY415981.1
KY415979.1
KY415980.1
KY415983.1
KX702402.1
KY415984.1
KR559478.1
KX702401.1
KY680402.1
KY680356.1
KY680372.1
KY704001.1
KY435471.1
KY680382.1
KY435461.1
KY680386.1
KY680413.1
MG967666.1
KY680405.1
KY435455.1
KY703993.1
KY703940.1
KY703991.1
KY703894.1
KY703893.1
KY703976.1
KY703958.1
KY703937.1
KY703900.1
KY703973.1
KY703946.1
KY703954.1
KY703915.1
KY703938.1
KY703989.1
KY703979.1
KY703957.1
KY703942.1
KY703916.1
KY703985.1
KY703931.1
KY703888.1
KY680367.1
KR046230.1
KY703930.1
KY703895.1
KY703911.1
KY703980.1
KY703998.1
KY703967.1
KR559471.1
KR046229.1
KY680393.1
KY703917.1
KY703910.1
KY703962.1
KY703896.1
KR559481.1
KY703961.1
KY703936.1
KY703977.1
KY703913.1
MG921596.1
KY703945.1
KP851709.1
KY703906.1
KY680366.1
KY435476.1
KY680347.1
KY703904.1
KR046231.1
KY680364.1
KX262994.1
KY680373.1
KY680388.1
KY435472.1
KY435469.1
KY435475.1
KY435454.1
KY704000.1
KY703932.1
KY703963.1
KY703969.1
KY703949.1
KY680370.1
KX262992.1
KP164572.1
KY435458.1
KR046228.1
KY435474.1
KY575573.1
KR559492.1
KY435481.1
KR559473.1
KY435483.1
KY435484.1
KR559494.1
KR559495.1
KR559485.1
KY435482.1
KY435462.1
KR559497.1
KR559491.1
KX496989.1
KY435465.1
KY435464.1
KY435477.1
KY680396.1
KY435473.1
KY435460.1
KY680376.1
KX262991.1
KY680407.1
KR559489.1
KP164567.1
KY435479.1
KY435457.1
KY435468.1
KR046227.1
KP851710.1
KY435467.1
KY435485.1
KY435478.1
KR559490.1
KR046234.1
KR046233.1
KR559496.1
KY435463.1
KY435486.1
KJ451624.1
KT327165.1
KT327166.1
KT327163.1
KT327164.1
KT327167.1
MG208125.1
KY680412.1
KY680368.1
KY272969.1
KY680397.1
KY272962.1
KY680414.1
KY680411.1
KY680362.1
KY680377.1
MF001512.1
KP164571.1
KY680378.1
KY680395.1
KY272963.1
KY680351.1
KU355832.1
KY680349.1
KY272970.1
KY272968.1
MF001519.1
MF001509.1
KY272965.1
KY435466.1
KY680403.1
KY680409.1
KR559482.1
KR559480.1
MF001506.1
KY680350.1
KY680348.1
MF001508.1
KY680380.1
MF001516.1
MF001518.1
KR264950.1
KR264949.1
KY575572.1
KY680404.1
KY680381.1
MF001517.1
KY680394.1
MF001514.1
KY680410.1
KR559486.1
KR559479.1
KY680390.1
KY680354.1
KY272967.1
MF001515.1
MF001505.1
KY680400.1
KY575566.1
MF001507.1
KY680387.1
KY680374.1
MF001510.1
KY680357.1
KY680358.1
KY680360.1
KY575569.1
KY680369.1
MF001513.1
KY272966.1
KY272961.1
KY575565.1
MF001511.1
KY680391.1
KY680353.1
KY680408.1
KY680385.1
KY680401.1
KR559470.1
KY680406.1
KR559477.1
KR559498.1
KY680383.1
KY680371.1
KY272964.1
KY680392.1
KR264951.1
KR559474.1
KR559487.1
KR559483.1
MF773564.1
MF773563.1
KJ689453.1
KJ689452.1
KJ451623.1
KJ451622.1
MF773559.1
KR559493.1
MF773562.1
KT308162.1
KT308159.1
KT308160.1
KC488650.1
KF318729.1
KT308163.1
KT308161.1
MF773561.1
FJ807897.1
MF773565.1
KM923920.1
KM923917.1
KM923919.1
KM923918.1
KX168429.1
EU703761.1
EU703759.1
EU703760.1
KX097988.1
KX097982.1
KY883764.1
KM673291.1
MG664851.1
HM045790.1
HM045800.1
HM045791.1
HM045797.1
HM045802.1
HM045796.1
HM045787.1
KX262987.1
KX262988.1
HM045789.1
HM045808.1
HM045814.1
EF452493.1
HM045810.1
HM045803.1
EF027140.1
HM045813.1
HM045788.1
EF027141.1
MF076575.1
MF076573.1
MF076574.1
MF076572.1
JQ861257.1
JQ861255.1
JQ861258.1
JQ861253.1
JQ861256.1
JQ861254.1
MF076570.1
MF076569.1
MF076568.1
MF076577.1
MF076576.1
MF076571.1
JQ861260.1
JQ861259.1
KJ579186.1
KJ579184.1
KJ579185.1
KJ579187.1
GU301779.1
KT324224.1
FJ445430.1
KT324228.1
FJ445431.1
KX009167.1
KX009171.1
MF773567.1
KX262997.1
GU301781.1
MF773569.1
KC862329.1
FJ445463.1
FJ445433.1
FJ445432.1
FJ445445.1
KT324225.1
FJ445502.1
FJ445443.1
FJ445484.1
HQ846359.1
HQ846358.1
KF151175.1
KF151174.1
KF590565.1
KF590567.1
GU908223.1
KF590566.1
KF590564.1
KT324226.1
KX009168.1
HQ846357.1
HQ846356.1
JX088705.1
KX009170.1
GU199353.1
GU199352.1
KT324227.1
KP164869.1
GU301780.1
MF773568.1
KX009169.1
FJ807899.1
GQ428213.1
KT336782.1
KT336781.1
GQ428214.1
GQ428212.1
FJ000069.1
KX262989.1
KP003811.1
EU244823.1
KX262993.1
KP003810.1
FJ513657.1
GU013530.1
FJ513629.1
FJ513628.1
GU013528.1
FJ513679.1
FJ513637.1
GU013529.1
FJ513635.1
HM045801.1
GU199350.1
GU189061.1
FJ445428.1
HM045799.1
GQ428211.1
MF774616.1
MF774615.1
MF774617.1
MF774619.1
MF774618.1
MF740874.1
MF774613.1
MF773566.1
MG049915.1
KY057363.1
KY751908.1
KX619426.1
MG925665.1
MF499120.1
MG137428.1
KT336780.1
KT336779.1
KT336778.1
JQ065890.1
MG664850.1
JQ065891.1
KJ679578.1
JQ065892.1
KX619423.1
KX619422.1
KX619425.1
KX619424.1
KX881784.1
JN558836.1
JN558835.1
JN558834.1
GQ428210.1
FJ513654.1
FJ513645.1
FJ513673.1
FJ445426.1
FJ513632.1
KY575570.1
GU199351.1
FJ513675.1
FJ000067.1
KT336777.1
FJ807898.1
EU372006.1
GQ428215.1
EF027134.1
KJ941050.1
HM045794.1
KY575568.1
KY575567.1
FJ000068.1
FJ000062.1
FJ000064.1
FJ000063.1
FJ445427.1
KC614648.1
JF274082.1
EU564335.1
FJ807896.1
FJ445511.1
FJ445510.1
FJ000065.1
FJ000066.1
EF027137.1
EF210157.1
EF027138.1
EF027136.1
EF027135.1
KY575571.1
KP003808.1
KP003807.1
KP003809.1
EU037962.1
EU564334.1
EF012359.1
KT449801.1
DQ443544.1
KP702297.1
KF283986.1
MG649985.1
MG649973.1
MG649971.1
MG649974.1
MG649972.1
MG649984.1
MG649983.1
MG649981.1
KY124329.1
MG649982.1
MG649978.1
MG649977.1
MG649976.1
MG649970.1
MG649975.1
KY124328.1
MG649980.1
MG649979.1
KY055011.1
KY704952.1
KY704942.1
KU940225.1
KP164569.1
KP164568.1
KP164570.1
MG000876.1
KY704955.1
MG000875.1
KY704954.1
KX228391.1
HM045823.1
KY575574.1
HM045784.1
HM045812.1
EF027139.1
KY038947.1
HM045793.1
KY038946.1
HM045822.1
KP003813.1
KP003812.1
KX262996.1
KJ679577.1
HM045821.1
HM045806.1
HM045811.1
HM045805.1
HM045792.1
HM045809.1
HM045819.1
HM045818.1
HM045820.1
HM045817.1
KX262995.1
AY72 67 32. 1
KX262986.1
HM045786.1
HM045804.1
HM045816.1
HM045785.1
HM045815.1
North
South
Central
Americas
Caribbean
East
Middle
South
West
East
South
South-East
West
Europe
Oceania
Asia Other
Africa
Phylogenetic Tree Leaves
Middle African /
South American Lineage
Middle African /
South American Lineage -
Middle African only
African/Asian Lineages
American Lineage
Asian Urban Lineage
Western African Lineage
Indian Ocean Lineage
Eastern African Lineage
CHIKV Phylogeography AUL
!8
CHIKV Phylogeography ECSA-IOL
!9
CHIKV Phylogeography ECSA-MASA
!10
Part II: Conserved ncRNAs
!11
Conserved RNAs in Viral 3’UTR: ZIKV
!12
5'3'
ΨDB
SL1 SL2 DB 3'-SL
EXCURSION
Conserved RNAs in Viral 3’UTR: ZIKV
!13
5'3'
ΨDB
SL1 SL2 DB 3'-SL
Accumulation of short flavivirus RNA (sfRNA) upon infection
Stable decay intermediates produced by partial exoribonuclease degradation
Xrn1 is efficiently stalled at conserved xrRNA structures
EXCURSION
Conserved RNAs in Viral 3’UTR
!14
Accumulation of short flavivirus RNA (sfRNA) upon infection
Stable decay intermediates produced by partial exoribonuclease degradation
Xrn1 is efficiently stalled at conserved xrRNA structures
5'3'
3'
5'3'
CDS
SL1 SL2 DB1 DB2 3'-SL
SLA SLB
EXCURSION
Conserved RNAs in Viral 3’UTR
!15
Accumulation of short flavivirus RNA (sfRNA) upon infection
Stable decay intermediates produced by partial exoribonuclease degradation
Xrn1 is efficiently stalled at conserved xrRNA structures
5'3'
3'
5'3'
CDS
SL1 SL2 DB1 DB2 3'-SL
SLA SLB
sfRNA mediates!
pathogenicity !
EXCURSION
Conserved RNAs in Viral 3’UTR
!16
Accumulation of short flavivirus RNA (sfRNA) upon infection
Stable decay intermediates produced by partial exoribonuclease degradation
Xrn1 is efficiently stalled at conserved xrRNA structures
5'3'
3'
5'3'
CDS
SL1 SL2 DB1 DB2 3'-SL
SLA SLB
sfRNA mediates!
pathogenicity !
EXCURSION
How to find them?
Conserved RNAs in Viral 3’UTR
!17
Accumulation of short flavivirus RNA (sfRNA) upon infection
Stable decay intermediates produced by partial exoribonuclease degradation
Xrn1 is efficiently stalled at conserved xrRNA structures
5'3'
3'
5'3'
CDS
SL1 SL2 DB1 DB2 3'-SL
SLA SLB
sfRNA mediates!
pathogenicity !
How to find them?
Article
Functional RNA Structures in the 30UTR of
Tick-Borne, Insect-Specific and No-Known-Vector
Flaviviruses
Roman Ochsenreiter 1, Ivo L. Hofacker 1,2 and Michael T. Wolfinger 1,2,*
1Department of Theoretical Chemistry, University of Vienna, Währingerstraße 17, 1090 Vienna, Austria;
romanoch@tbi.univie.ac.at (R.O.); ivo@tbi.univie.ac.at (I.L.H.)
2Research Group BCB, Faculty of Computer Science, University of Vienna, Währingerstraße 29,
1090 Vienna, Austria
*Correspondence: michael.wolfinger@univie.ac.at
Received: 1 March 2019; Accepted: 20 March 2019; Published: 24 March 2019
!"#!$%&'(!
!"#$%&'
Abstract:
Untranslated regions (UTRs) of flaviviruses contain a large number of RNA structural
elements involved in mediating the viral life cycle, including cyclisation, replication, and
encapsidation. Here we report on a comparative genomics approach to characterize evolutionarily
conserved RNAs in the 3
0
UTR of tick-borne, insect-specific and no-known-vector flaviviruses in silico.
Our data support the wide distribution of previously experimentally characterized exoribonuclease
resistant RNAs (xrRNAs) within tick-borne and no-known-vector flaviviruses and provide evidence
for the existence of a cascade of duplicated RNA structures within insect-specific flaviviruses.
On a broader scale, our findings indicate that viral 3
0
UTRs represent a flexible scaffold for evolution
to come up with novel xrRNAs.
Keywords: flavivirus; non-coding RNA; secondary structure
1. Introduction
Flaviviruses are small, single-stranded positive-sense RNA viruses that are typically transmitted
between arthropod vectors and vertebrate hosts. They are endemic in tropic and sub-tropic regions
and represent a global health threat, although humans are considered dead end hosts in many cases.
The genus Flavivirus within the Flaviviridae family comprises more than 70 species, which are
organized into four groups, each with a specific host association: Mosquito-borne flaviviruses (MBFVs)
and tick-borne flaviviruses (TBFVs) spread between vertebrate (mammals and birds) and invertebrate
(mosquitoes and ticks) hosts, whereas insect-specific flaviviruses (ISFVs) replicate specifically in
mosquitoes and no-known-vector flaviviruses (NKVs) have only been found in rodents and bats,
respectively. This natural host-range-based classification is in good agreement with sequence-based
phylogenetic clustering, mainly because all flaviviruses share a common genome organization [
1
].
Conversely, epidemiology, disease association [
2
] and transmission cycles [
3
] are fundamentally
different among different flavivirus groups.
Emerging and re-emerging MBFVs such as Dengue virus (DENV), Japanese encephalitis virus
(JEV), West Nile virus (WNV), Yellow fever virus (YFV) or Zika virus (ZIKV) are the causative agents
of large-scale outbreaks that result in millions of human and veterinary infections every year [
4
].
Likewise, tick-borne encephalitis virus (TBEV), Powassan virus (POWV) and other members of the
tick-borne serocomplex are neuropathogenic agents that cause a large number of infections every year,
resulting in a massive incidence increase since the 1970ies [
5
]. Consequently, much research effort has
gone into studying MBFV and TBFV biology, biochemistry and phylogeny [
6
]. The two remaining
groups, ISFVs and NKVs, however, have received limited attention in the research community, mainly
Viruses 2019,11, 298; doi:10.3390/v11030298 www.mdpi.com/journal/viruses
EXCURSION
https://doi.org/10.3390/v11030298
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
!18
RNA Covariation as Evolutionary Trait
((((((((...((((((((..............))))))))....))......((((......))))))))))
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
.........10........20........30........40........50........60........70..
C
C
A
C
G
G
C
C
C
A
A
G
C
G
A
A
C
A
G
A
C
G
G
U
G
A
U
G
C
GA_
A
CUGUUCGU
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
U
G
G
ftypes of pairs:
123456
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
!19
RNA Covariation as Evolutionary Trait
((((((((...((((((((..............))))))))....))......((((......))))))))))
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
.........10........20........30........40........50........60........70..
C
C
A
C
G
G
C
C
C
A
A
G
C
G
A
A
C
A
G
A
C
G
G
U
G
A
U
G
C
GA_
A
CUGUUCGU
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
U
G
G
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T.SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T.S L 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!20
RNA Covariation as Evolutionary Trait
((((((((...((((((((..............))))))))....))......((((......))))))))))
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
C
C
A
C
G
G
C
C
C
A
A
G
C
G
A
A
C
A
G
A
C
G
G
U
G
A
U
G
C
GA_
A
CUGUUCGU
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
U
G
G
U
G
C
G
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T.S L 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!21
RNA Covariation as Evolutionary Trait
C
C
A
C
G
G
C
C
C
A
A
A
C
C
A
A
C
A
A
A
_
_
_
_
G
A
C
G
C
GA_
_
_CCAUCGC
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
C
G
G
C
A
_
A
((((((((...((((((((..............))))))))....))......((((......))))))))))
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.13 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T.S L 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!22
RNA Covariation as Evolutionary Trait
C
C
A
C
G
G
C
C
C
A
A
G
C
C
A
U
G
A
G
A
_
G
_
U
G
A
U
G
U
GA_
A
CUCAUGGC
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
U
G
G
C
G
C
G
((((((((...((((((((..............))))))))....))......((((......))))))))))
ALFV.09 CCACGGCCCGGGCCAUGAGU-GAUGAUGUUA-ACUCAUGGC-GAAGGACUAGAGGUUAGAGGAGACCCCGUGG 70
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.13 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T.S L 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!23
RNA Covariation as Evolutionary Trait
C
C
A
C
G
G
C
C
C
A
A
G
C
C
A
U
G
A
G
G
_
G
G
U
G
A
U
G
C
GA_
A
CUCAUGGC
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
C
G
G
C
G
U
A
C
G
((((((((...((((((((..............))))))))....))......((((......))))))))))
MVEV.08 CCGCAGCCCGGGCCGGGAGGAGGUGAUGCGA-AC-CCCGGC-GAAGGACUAGAGGUUAGAGGAGACCCUGCGG 70
ALFV.09 CCACGGCCCGGGCCAUGAGU-GAUGAUGUUA-ACUCAUGGC-GAAGGACUAGAGGUUAGAGGAGACCCCGUGG 70
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.13 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T.S L 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!24
RNA Covariation as Evolutionary Trait
C
C
G
C
G
G
C
C
C
A
A
G
C
C
A
U
G
A
G
G
_
G
G
U
G
A
U
G
U
GA_
A
CCCAUGGC
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
C
G
G
C
G
C
A
C
G
((((((((...((((((((..............))))))))....))......((((......))))))))))
WNV.07 ACGCGGCCCAAAUCCUGGUGA-U-GGUGUUA-UGCCAGGGUGGAAGGACUAGAGGUUAGAGGAGACCCCGCGU 70
MVEV.08 CCGCAGCCCGGGCCGGGAGGAGGUGAUGCGA-AC-CCCGGC-GAAGGACUAGAGGUUAGAGGAGACCCUGCGG 70
ALFV.09 CCACGGCCCGGGCCAUGAGU-GAUGAUGUUA-ACUCAUGGC-GAAGGACUAGAGGUUAGAGGAGACCCCGUGG 70
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.13 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T. SL 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!25
RNA Covariation as Evolutionary Trait
C
C
A
C
G
G
C
C
C
A
A
A
C
C
A
U
G
A
G
G
_
_
G
_
G
A
U
G
C
GA_
A
CCCAUGGC
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
C
G
G
C
A
C
A
C
G
((((((((...((((((((..............))))))))....))......((((......))))))))))
JEV.06 CCACGGCCCAAACCUCAUCUA-G-GAUGCAAUAGAUGAGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
WNV.07 ACGCGGCCCAAAUCCUGGUGA-U-GGUGUUA-UGCCAGGGUGGAAGGACUAGAGGUUAGAGGAGACCCCGCGU 70
MVEV.08 CCGCAGCCCGGGCCGGGAGGAGGUGAUGCGA-AC-CCCGGC-GAAGGACUAGAGGUUAGAGGAGACCCUGCGG 70
ALFV.09 CCACGGCCCGGGCCAUGAGU-GAUGAUGUUA-ACUCAUGGC-GAAGGACUAGAGGUUAGAGGAGACCCCGUGG 70
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.13 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T. SL 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!26
RNA Covariation as Evolutionary Trait
C
C
A
C
G
G
C
C
C
A
A
G
C
C
A
U
G
A
G
G
A
_
G
_
G
A
U
G
C
GA_
A
CCCAUGGC
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
U
G
G
C
G
C
A
C
G
((((((((...((((((((..............))))))))....))......((((......))))))))))
JEV.05 CCACGGCCCAAGUCUCGUCCA-G-GAUGCAAUGGACGAGAUGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
JEV.06 CCACGGCCCAAACCUCAUCUA-G-GAUGCAAUAGAUGAGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
WNV.07 ACGCGGCCCAAAUCCUGGUGA-U-GGUGUUA-UGCCAGGGUGGAAGGACUAGAGGUUAGAGGAGACCCCGCGU 70
MVEV.08 CCGCAGCCCGGGCCGGGAGGAGGUGAUGCGA-AC-CCCGGC-GAAGGACUAGAGGUUAGAGGAGACCCUGCGG 70
ALFV.09 CCACGGCCCGGGCCAUGAGU-GAUGAUGUUA-ACUCAUGGC-GAAGGACUAGAGGUUAGAGGAGACCCCGUGG 70
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.13 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T. SL 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!27
RNA Covariation as Evolutionary Trait
C
C
A
C
G
G
C
C
C
A
A
G
C
C
A
U
G
A
G
G
A
_
G
_
G
A
U
G
C
GA_
A
CACAUGGC
G
GAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
U
G
G
C
G
A
A
C
G
((((((((...((((((((..............))))))))....))......((((......))))))))))
JEV.04 CCACGGCCCAAGCUUCGUCUA-G-GAUGCAAUAGACGAGGUGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
JEV.05 CCACGGCCCAAGUCUCGUCCA-G-GAUGCAAUGGACGAGAUGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
JEV.06 CCACGGCCCAAACCUCAUCUA-G-GAUGCAAUAGAUGAGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
WNV.07 ACGCGGCCCAAAUCCUGGUGA-U-GGUGUUA-UGCCAGGGUGGAAGGACUAGAGGUUAGAGGAGACCCCGCGU 70
MVEV.08 CCGCAGCCCGGGCCGGGAGGAGGUGAUGCGA-AC-CCCGGC-GAAGGACUAGAGGUUAGAGGAGACCCUGCGG 70
ALFV.09 CCACGGCCCGGGCCAUGAGU-GAUGAUGUUA-ACUCAUGGC-GAAGGACUAGAGGUUAGAGGAGACCCCGUGG 70
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.13 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T. SL 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!28
RNA Covariation as Evolutionary Trait
C
C
A
C
G
G
C
C
C
A
A
G
C
C
A
U
G
A
G
G
A
_
G
_
G
A
U
G
C
GA_
A
CACAUGGC
G
UAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
U
G
G
C
G
A
A
C
G
((((((((...((((((((..............))))))))....))......((((......))))))))))
APCV.03 CCGCGGCCCAACCAGUUCAGACU-GAUGCUA--UGAACUGGGUAAGGACUAGAGGUUAGAGGAGACCCCGCGG 70
JEV.04 CCACGGCCCAAGCUUCGUCUA-G-GAUGCAAUAGACGAGGUGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
JEV.05 CCACGGCCCAAGUCUCGUCCA-G-GAUGCAAUGGACGAGAUGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
JEV.06 CCACGGCCCAAACCUCAUCUA-G-GAUGCAAUAGAUGAGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
WNV.07 ACGCGGCCCAAAUCCUGGUGA-U-GGUGUUA-UGCCAGGGUGGAAGGACUAGAGGUUAGAGGAGACCCCGCGU 70
MVEV.08 CCGCAGCCCGGGCCGGGAGGAGGUGAUGCGA-AC-CCCGGC-GAAGGACUAGAGGUUAGAGGAGACCCUGCGG 70
ALFV.09 CCACGGCCCGGGCCAUGAGU-GAUGAUGUUA-ACUCAUGGC-GAAGGACUAGAGGUUAGAGGAGACCCCGUGG 70
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.13 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T. SL 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U
U
Y
Y
Y
Y
T.xrRNA2 SL6 Y-shaped (Y1) Flavi_CRE
T.xrRNA1
5' 3'
.((((..((((((((...........))))))))......))))....
SGEV|261-306 CCCCCC-GCACCAUGACAAGGCCGAACAUGGUGCACCAAAGGGGAG-G 46
TBEV|532-577 CCCCCU-GCAUCAUGAUAAGGCCGAACAUGGUGCAUGAAAGGGGAG-G 46
LIV|268-312 CCCCCC-GCCCCAUGACAAGGCCGAACAUGGAGCAUUAAAGG-GAG-G 45
LGTV|339-381 CCCCUU-GCGUCCAGAGAAGGCCGAACUGGGCGU---UAUAAGGAG-G 43
OHFV|179-222 CCCCCC-GCACCAUG-GAAGGCCAAACAUGGUGCAUG-AAGGGAAA-G 44
KFDV|164-204 CCAAAA-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
ALKV|165-205 CCAAAG-CCUCCCAGAGAAGGCCGAACUGGGAGGCC-----AUGAA-G 41
DTV|248-294 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCAUUCUAGAG 47
POWV|249-293 CCAAAAGGCCUCCUG-GAAGGCUCACCAGGAGUUAGGCCGUU-UAG-G 45
TYUV|341-386 CUUUC--CAUGAGAGGAGACGGUCAACUCUCAUGGAACAAGAAGACCG 46
NEGV|129-174 CCCCCCCUGGCCAGAAAAAGGGGGGGCAAACAGGCC--AGGGGUGAAG 46
KSIV|233-270 CUGAC---CAUCCCU-CAAGGCCGAGUGGGAUGC------GUAUGAAG 38
.........10........20........30........40.......
Seq. Conservation:
Tick-borne aviviruses
*
*
*
c
d f types of pairs:
123456
SL6
e(((((..((((((((((....)))))))).))...((((((((...........)))))))).........)).)))
POWV|291-361 AGGAG--CCCCCGAGCAUAA---CUCGGGAGGAGGGAGGAAGA-AAAUUGGCAAUCUUCCUCGGGAUUUUUCCGCCU 71
DTV|290-354 UAGAG--CCCCCGGGCAUAA---CUCGGGAGGAGGGGGGAAGA-CAAUUGGCAAUCUUCCCCGGGAUU------UUU 65
LGTV|377-449 GGAGG--CCCCCAGGGGGAAACCCCUGGGAGGAGGGAAGAGAG-AAAUUGGCAACUCUCUUCAGGAUAUUUCC-UCC 73
TBEV|573-645 GGAGG--CCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGAUUUUUCC-UCC 73
SGEV|300-372 GGGGAGGCCCCCGGAAGCACGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGA--UUUUU-CCU 73
LIV|306-378 AGGGAGGCCCCCGGAAGCAUGCUUCCGGGAGGAGGGAAGAGAG-AAAUUGGCAGCUCUCUUCAGGG--UUUUU-CCU 73
KSIV|264-335 UAUGAAGGCCCCUGGAG--AGAUCCAGG-AGGGGGGAGAGAGGAAAAUUGGCAGCCUCUCUCAGGAGAUUUC--CUC 72
.........10........20........30........40........50........60........70......
Seq. Conservation:
Y1
allowed pairs:
incompatible
pairs in column
0
1
2
A-U
U-A
G-C
C-G
G-U
U-G
!29
RNA Covariation as Evolutionary Trait
C
C
A
C
G
G
C
C
C
A
A
G
C
C
A
U
G
A
C
G
A
_
G
_
G
A
U
G
C
GA_
A
CCCAUGGU
G
UAA
GG
A
CUA
G
A
GGUUA
G
A
G
G
A
G
A
C
C
C
C
G
C
G
G
U
G
C
A
C
C
((((((((...((((((((..............))))))))....))......((((......))))))))))
KUNV.02 ACGCGGCCCUAGCUCUGGCAA--UGGUGUUA--ACCAGAGUGAAAGGACUAGAGGUUAGAGGAGACCCCGCGU 69
APCV.03 CCGCGGCCCAACCAGUUCAGACU-GAUGCUA--UGAACUGGGUAAGGACUAGAGGUUAGAGGAGACCCCGCGG 70
JEV.04 CCACGGCCCAAGCUUCGUCUA-G-GAUGCAAUAGACGAGGUGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
JEV.05 CCACGGCCCAAGUCUCGUCCA-G-GAUGCAAUGGACGAGAUGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
JEV.06 CCACGGCCCAAACCUCAUCUA-G-GAUGCAAUAGAUGAGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGUGG 71
WNV.07 ACGCGGCCCAAAUCCUGGUGA-U-GGUGUUA-UGCCAGGGUGGAAGGACUAGAGGUUAGAGGAGACCCCGCGU 70
MVEV.08 CCGCAGCCCGGGCCGGGAGGAGGUGAUGCGA-AC-CCCGGC-GAAGGACUAGAGGUUAGAGGAGACCCUGCGG 70
ALFV.09 CCACGGCCCGGGCCAUGAGU-GAUGAUGUUA-ACUCAUGGC-GAAGGACUAGAGGUUAGAGGAGACCCCGUGG 70
USUV.10 CCACGGCUCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
USUV.11 UCACGGCCCAAGCGAACAGACGGUGAUGCGA-ACUGUUCGUGGAAGGACUAGAGGUUAGAGGAGACCCCGUGG 72
SLEV.12 CGGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
SLEV.13 CAGCGGCCCAAACCAUGGAG----UGCGUGA---CCAUGGCGUAAGGACUAGAGGUUAGAGGAGACCCCGCUG 66
.........10........20........30........40........50........60........70..
High mutation rate in RNA viruses due to error-prone RdRP
For base pair (i,j): GC/CG/AU/UA/GU/UG
Consistent mutation: different standard combinations
Compensatory mutation: both positions are mutated
Presence of both strongly supports predicted base pair (i,j)
TYUV xrRNA-like T. x r R N A 2 T.S L6 Flavi_CRE
KAMV xrRNA-like
KFDV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
ALKV T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
NEGV T. x r R N A 1 T. S L 6 T. x r R N A 2
LIV T. x r R N A 1 T. x r R N A 2 T.S L6 T. x r R N A 2 Flavi_CRE
SGEV T. x r R N A 1 T. x r R N A 2 T. SL 6 T. x r R N A 2 Flavi_CRE
TBEV T. x r R N A 1 T. S L 6 T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
OHFV T. x r R N A 2 T. S L 6 xrRNA-like Flavi_CRE
LGTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
DTV T. x r R N A 1 T. x r R N A 2 T.S L6 xrRNA-like Flavi_CRE
POWV T. x r R N A 1 T. x r R N A2 T.S L 6 xrRNA-like Flavi_CRE
KSIV T. x r R N A 1 T. x r R N A 2 T. SL 6 xrRNA-like
~ 300 nt
b
a
G
R
Y
R
C
G
G
C
A
G
CAC
R
C
YY
R
G
Y
GA
CGGGAAR
U
G
G
U
C
G
C
U
C
C
C
G
A
C
G
Y
A
R
R
Y
Y
R
G
G
R
Y
R
Y
G
G
C
A
RC
R
C
R
C
AY
GR
GG
R
A
RGR
Y
G
C
C
C
R
R
R
Y
Y
Y
Y
CY
Y
C
R
A
AGG
Y
A
R
C
R
RRGG
G
C
G
G
Y
U
CUU
U
C
U
CCC
R
A
G
C
Y
C
Y
Y
A
G
A
C
A
C
AGA
U
A
G
U
C
U
R
AC
A
G
R
R
R
G
G
R
G
Y
U
Y
G
A
A
A
R
R
R
C
C
C
C
G
R
R
YY
GG
AGG
R
G
G
G
A
R
R
R
R
R
R
A
A
A
U
UGGC
A
R
Y
Y
Y
Y
Y
Y
U
CRGG
A
U
U