Content uploaded by Beatrice Bernardi
Author content
All content in this area was uploaded by Beatrice Bernardi on Jul 08, 2019
Content may be subject to copyright.
Available via license: CC BY
Content may be subject to copyright.
microorganisms
Article
Overexpression of RAD51 Enables PCR-Based Gene
Targeting in Lager Yeast
Beatrice Bernardi 1,2, Yeseren Kayacan 2, Madina Akan 1,2 and Jürgen Wendland 1 ,2 ,*
1Department of Microbiology and Biochemistry, Hochschule Geisenheim University, von-Lade Strasse 1,
D-65366 Geisenheim, Germany
2Research Group of Microbiology (MICR)—Functional Yeast Genomics, Vrije Universiteit Brussel,
BE-1050 Brussels, Belgium
*Correspondence: juergen.wendland@hs-gm.de; Tel.: +49-6722-502-332
Received: 8 June 2019; Accepted: 3 July 2019; Published: 5 July 2019
Abstract:
Lager beer fermentations rely on specific polyploid hybrids between Saccharomyces
cerevisiae and Saccharomyces eubayanus falling into the two groups of S. carlsbergensis/Saaz-type and
S. pastorianus/Frohberg-type. These strains provide a terroir to lager beer as they have long traditional
associations and local selection histories with specific breweries. Lager yeasts share, based on their
common origin, several phenotypes. One of them is low transformability, hampering the gene function
analyses required for proof-of-concept strain improvements. PCR-based gene targeting is a standard
tool for manipulating S. cerevisiae and other ascomycetes. However, low transformability paired with
the low efficiency of homologous recombination practically disable targeted gene function analyses
in lager yeast strains. For genetic manipulations in lager yeasts, we employed a yeast transformation
protocol based on lithium-acetate/PEG incubation combined with electroporation. We first introduced
freely replicating CEN/ARS plasmids carrying ScRAD51 driven by a strong heterologous promoter
into lager yeast. RAD51 overexpression in the Weihenstephan 34/70 lager yeast was necessary and
sufficient in our hands for gene targeting using short-flanking homology regions of 50 bp added to
a selection marker by PCR. We successfully targeted two independent loci, ScADE2/YOR128C and
ScHSP104/YLL026W, and confirmed correct integration by diagnostic PCR. With these modifications,
genetic alterations of lager yeasts can be achieved efficiently and the RAD51-containing episomal
plasmid can be removed after successful strain construction.
Keywords: homologous recombination; gene function analysis; hybrid yeast; fermentation
1. Introduction
Lager beer is the most popular alcoholic beverage worldwide. It is distinguished from
top-fermented ale beers by the use of dedicated bottom fermenting lager yeasts. Pure culture
lager yeasts were introduced in the late 19th century and the first lager yeast strain became known as
Saccharomyces carlsbergensis [
1
,
2
]. Lager yeasts are particularly suited for cold fermentations below
15
◦
C, providing a specific and clean taste [
3
]. Lager yeast strains are hybrids of two Saccharomyces
species, namely S. cerevisiae and S. eubayanus [
4
–
8
]. The S. cerevisiae parent is related to ale yeasts
while the S. eubayanus parent has recently been isolated from South America and Asia [
9
,
10
]. The low
temperature fermentation capabilities of lager yeast hybrids may have originated from the parental
S. eubayanus mitochondrial DNA that is invariably present in today’s lager yeasts [11].
Genetic manipulations in lager yeast are hampered by the allopolyploid nature of these hybrids
but also by their low transformation and homologous recombination (HR) efficiency [
12
]. This is
demonstrated by the very few reports on targeted gene alterations in lager yeast [
13
–
15
]. These
shortcomings of lager yeasts are in sharp contrast to the high efficiency and ease with which S. cerevisiae
Microorganisms 2019,7, 192; doi:10.3390/microorganisms7070192 www.mdpi.com/journal/microorganisms
Microorganisms 2019,7, 192 2 of 12
can be manipulated [
16
]. A large array of modules for PCR-based gene targeting have been developed
for S. cerevisiae and the gene deletion collection was one of its outputs that spurred large scale
functional and synthetic genetic array analyses [
17
–
22
]. PCR-based gene targeting tools were also
developed for other ascomycetous fungi with efficient homologous recombination machineries,
including Ashbya gossypii, Candida albicans and Schizosaccharomyces pombe [23–29].
Deletion of Ku70 or Ku80 of the non-homologous end joining (NHEJ) pathway has been shown to be
a very useful tool to improve gene targeting in a large variety of fungi, including e.g., Kluyveromyces lactis
and Yarrowia lipolytica [
30
–
32
]. The Ku70 deletion approach has been particularly successful in
filamentous ascomycetes in which non-homologous end joining is otherwise predominant, e.g.,
in Neurospora crassa or Zymoseptoria tritici [
33
,
34
]. However, in Cryptococcus neoformans it was found
that deletion of Ku70 also alters virulence, which then requires sexual crosses to reinstate wildtype
Ku70 in a mutant background [35].
An alternative to impairing NHEJ is improving HR efficiency. Overexpression of RAD51,
coding for a protein involved in the recombinational repair of DNA-double strand breaks,
in S. cerevisiae
enhances gene repair, a feature conserved in human cells that can also be achieved by using RecA
from Escherichia coli [
36
–
38
]. We thought to employ the apparently highly conserved nature of
HR improvement upon RAD51 overexpression in lager yeast. Here we show that plasmid-based
overexpression of ScRAD51 under the control of a strong heterologous promoter, allows for simplified
targeted gene function analyses in lager yeast. This genetic improvement of lager yeast transformation
was combined with a lithium acetate/electroporation transformation protocol similar as has previously
been described for S. cerevisiae and S. pombe [
39
,
40
]. Together, these improvements should aid
proof-of-concept analyses in lager yeasts prior to embarking on laborious mutagenesis and selection
schemes for strains not genetically modified (non-GM) used in the production of fermented beverages.
Additionally, this provides a tool to investigate hybrid biology at the molecular level.
2. Material and Methods
2.1. Strains and Culture Conditions
Yeast strains, used and generated (see Table 1), were grown in YPD (1% yeast extract, 2% peptone,
2% glucose) at 30
◦
C. Solid media were prepared by adding 2% agar and YPD plates were supplemented
with either hygromycin or G418/geneticin. For lager yeasts the antibiotic concentrations used were
100
µ
g/mL, while S. cerevisiae lab strains were selected at 200
µ
g/mL final concentration. Minimal
media lacking leucine contained 6.7 g/L yeast nitrogen base with NH
4
SO
4
and without amino acids
and 0.69 g/L completed synthetic medium leucine drop-out mixture. Plasmids were propagated
in Escherichia coli DH5alpha in 2xYT (1.6 % tryptone, 1 % yeast extract, 0.5 % NaCl) containing
100 µg/mL ampicillin.
Table 1. Strains used in this study.
Strain Number Feature/Genotype Source
B003 Saccharomyces cerevisiae BY4741 MATa
his3∆1; leu2∆0; met15∆0; ura3∆0Euroscarf
B237 Weihenstephan WS34/70 lager yeast Lab collection
B256 WS34/70; pRAD51 (HYG3, CEN6/ARSH4) This study
B257 WS34/70; pHYG3 (CEN6/ARSH4) This study
G001 WS34/70; pRAD51; ade2::YES1 This study
G002 WS34/70; pRAD51; hsp104::YES1 This study
2.2. Plasmid Design and Constructions
The plasmids used in this study are listed in Table 2. The primers required for plasmid constructions
or for PCR-based gene targeting are listed in Table 3. Plasmid DNAs were amplified in E. coli and
Microorganisms 2019,7, 192 3 of 12
prepared using a Plasmid Midi DNA Purification Kit (Genaxxon, Ulm, Germany). PCR fragments
were cloned into pGEM (Promega, Madison, USA). The ScRAD51/YER095W open reading frame was
amplified from BY4741 genomic DNA using primers 260 and 261 and the Arthroascus (=Saccharomycopsis)
schoenii TEF1 promoter was amplified from A. schoenii genomic DNA using primers 106 and 107,
and both were cloned into pGEM. To place LacZ under the control of the AsTEF1-promoter, AsTEF1p
was amplified form pGEM-AsTEF1p (E026) with primers 108/109, which added 45 bp of flanking
homology region to E025-pRS417-AgTEFp-LacZ (here LacZ is under the control of the Ashbya gossypii
TEF-promoter). The AgTEF-promoter was removed from E025 by restriction digestion with KpnI/XhoI,
and the vector and AsTEF1p were cotransformed into yeast to combine them via
in vivo
recombination,
yielding plasmid E065. All restriction enzymes were obtained from Thermo Fisher (Asse, Belgium).
All primers were obtained from Sigma Aldrich (Overijse, Belgium).
Table 2. Plasmids used in this study.
Strain Number Feature/Genotype Source
E008 pRS415 [41]
E025 pRS417-AgTEF1p-LacZ-GEN3 [42]
E026 pGEM-AsTEF1p This study
E054 pUC57-HYG3 GenScript
E065 pRS417-AsTEF1p-LacZ This study
E066 pYES1 This study
E068 pYES2 This study
E088 pGEM-YES1 This study
E120 pGEM-ScRAD51 This study
E150
pRS-AsTEF1p-ScRAD51-HYG3-GEN3
This study
E160
pRS-AsoTEF1p-ScRAD51-HYG3-LEU2
This study
Table 3. Primers used in this study.
Primer Number Primer Name Sequence 50→30*
106 50-AsTEF1p GTCCAGAATAACATCAAATC
107 30-AsTEF1p CTATAAAAAATGTTAGTATGGAG
108 50-AsTEFp-pRS CGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTG
CTCGAGTCCAGAATAACATCAAATC
109 30-AsTEFp-lacZ CAATCTTTGGATCGTTTAAATAAGTTTGAATTTTTTCAGTCATGTTC
TATAAAAAATGTTAGTATGGAG
226 P3-pRS415-AsTEF1p
TGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATA
GGAAGCTTCGTACGCTGCAGGTCGGATCCCCCGGGGGCGCGCCGT
CCAGAATAACATCAAATC
227 P4-AsTEF1p-kanR GTTGGAGTTCAAACGTGGTCTGGAAACGTGAGTCTTTTCCTTACCC
TATAAAAAATGTTAGTATGGAG
228 P5-kan-ORF GGTAAGGAAAAGACTCACGTTTCCA
229 P6-kanR-pRS415 GGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCT
TCTGATATCATCGATGAATTCGAGCTCGTTTAAACATTGGTAATAG
230 P7-50-HYG3 CTGACTTTTGTCTTGTTATGGACTCCATACTAACATTTTTTATAGAA
AAAACCAGAATTGACTGCTACTTC
231 P8-30-HYG3 CTGATATCATCGATGAATTCGAGCTCGTTTAAACATTGGTAATAGG
ACCACCTTTGATTGTAAATAG
253 5-HYG3+AD GGCGCGCCAGATCTAGCCTCCTCAGAGAAAATTGCACAAAAAAA
AGGAAGCTTCGTACGCTGCAGGTC
254 3-HYG3+AD TTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGC
TGACCACCTTTGATTGTAAATAG
258 5-ScRAD51+AD CTGACTTTTGTCTTGTTATGGACTCCATACTAACATTTTTTATAGTC
TCAAGTTCAAGAACAACATATATCAG
259 3-ScRAD51+AD CTTTTTTTTGTGCAATTTTCTCTGAGGAGGCTAGATCTGGCGCGCCG
AAAAATACATATATTTCATGGGTGACAG
260 5-ScRAD51 TCTCAAGTTCAAGAACAACATATATCAG
261 3-ScRAD51 GAAAAATACATATATTTCATGGGTGACAG
344 S1-LEU2 GGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAG
TAAAGTGCAATTCTTTTTCC
345 S2-LEU2 CTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCG
GTCGAGGAGAACTTC
Microorganisms 2019,7, 192 4 of 12
Table 3. Cont.
Primer Number Primer Name Sequence 50→30*
355 G2-YES1 GAATGAATCTACTGGTTTGG
356 G3-YES1 GTGTCGGTATCGCAGAC
369 S1-ADE2 CCTACTATAACATTCAAGAAAAACAAGAAAACCGGACAAAACAA
TCAAGTGTCCAGAATAACATCAAATC
371 S2-ADE2 TATATCATTTTATATTATTTGCTGTGCAAGTATATCAATAAACTTAT
ATATAATAAATTATTTTTATTGTTG
373 G1-ADE2 GACTCTTGTTGCAGGGCT
389 G4-ADE2 GTGATGCATTGAGCCGCC
390 S1-HSP104 TATATTACTGATTCTTGTTCGAAAGTTTTTAAAAATCACACTATATT
AAAGTCCAGAATAACATCAAATC
391 S2-HSP104 AACAAAGAAAAAAGAAATCAACTACACGTACCATAAAATATACA
GAATATTAATAAATTATTTTTATTGTTG
392 G1-HSP104 CCCGTATTCTAATAATGGACC
393 G4-HSP104 CAAACTTATGCAACCTGCCAG
* Underlined sequences correspond to restriction sites.
E150/pRAD51 (GEN3) was constructed by
in vivo
recombination of E065 vector backbone with
fragments carrying ScRAD51-ORF and HYG3 marker. To this end, E065 was linearized by digesting
with EcoRV/SacI, which removed most of the LacZ-ORF, and then the band was gel purified. Flanking
adaptor regions, to guide
in vivo
recombination, were added to ScRAD51-ORF and HYG3 marker
fragments using primers 258/259 and 253/254, respectively. Then BY4741 was transformed with the
two PCR products and the cut vector. In order to use a G418 resistance marker for PCR-based gene
targeting in lager yeast, the GEN3 marker in E150 was replaced by LEU2 in a PCR-based gene targeting
approach using BY4741 as a host. To this end, ScLEU2 was amplified from pRS415 with primer 344/345
by PCR and used for transformation, generating E160.
Novel synthetic marker genes YES1 and YES2 were also constructed using
in vivo
recombination in
S. cerevisiae using plasmid pRS415 as the vector backbone. YES1 and YES2 contain the AsTEF1-promoter
that controls kanamycin or hygromycin resistance gene-ORFs, respectively. For construction, pRS415
was linearized with SmaI, the AsTEF1p was amplified from E026 using primers 226/227, the kanR-ORF
was amplified with primers 228/229 and the hygR-ORF with primers 230/231 to add suitable adaptors
for homologous recombination. Vector, promoter and resistance gene ORFs were then cotransformed
in S. cerevisiae and the resulting transformants were selected on G418 or hygromycin, respectively.
All plasmids obtained by
in vivo
recombination in S. cerevisiae were verified and shuttled into E. coli for
propagation. A. schoenii promoters were used as heterologous promoters in lager yeast and S. cerevisiae.
HYG3 is a synthetic selectable marker that consists of the 694 bp A. schoenii PGK1 promoter,
the 1026 bp hygromycin resistance gene ORF and the Candida albicans URA3 terminator, which was
synthesized by GenScript (GenScript, Piscataway, NJ, USA). Promoter sequences were derived from
the A. schoenii CBS 7425 genome, which can be accessed via GenBank under accession JNFU00000000
CBS 7425 [43].
2.3. Yeast Transformation
For the transformation of S. cerevisiae, the lithium acetate/single strand DNA/polyethylene glycol
4000 protocol was used as described [
44
]. For lager yeast transformation, we adapted a protocol from
Thompson et al. [
39
]. WS34/70 was grown overnight to stationary phase in 50 mL YPD. Then the
culture was diluted to OD
600
=0.3 in 100 mL fresh YPD. Cells were harvested at mid-log growth with
OD
600
=0.7–0.8 (after approximately 3 h of incubation). The culture was centrifuged and washed
once with sterile water and resuspended in 25 mL of 0.1 M lithium acetate/10 mM dithiothreitol/10
mM TE solution (Tris HCl: EDTA =10:1) and incubated for 1 h at room temperature. The cells were
washed in 25 mL ice-cold distilled sterile water twice and once with 10 ml of ice-cold 1 M sorbitol,
then resuspended in 100
µ
L ice-cold sorbitol. A 100
µ
L aliquot of the cell suspension was used for
transformation. Transforming DNA (15
µ
L) was mixed with the cells, incubated for 5 min on ice and
electroporated with 1.8 kV in 0.2 cm cuvettes. Then, cells were resuspended in 1 ml cold sorbitol and
Microorganisms 2019,7, 192 5 of 12
transferred to a tube with 300
µ
L YPD. This suspension was incubated for 3 h at 30
◦
C prior to plating
on selective plates that did not contain sorbitol.
2.4. Verification of Lager Yeast Transformants
The Weihenstephan strain WS34/70 was used for gene targeting experiments. Target genes were
derived from the S. cerevisiae parental subgenome. Sequences for verification primers (and also for the
S1 and S2 primers) were deduced from the genome sequence that is available at DDBJ/EMBL/GenBank
under the accession AZAA00000000. PCR-based gene targeting and diagnostic PCR were performed
as described [45].
3. Results
3.1. Design and Testing of Synthetic Marker and Reporter Genes
We were interested in developing novel synthetic marker and reporter genes for dual use in
non-conventional yeasts, including lager yeasts and S. cerevisiae. To this end, we tested heterologous
promoters derived from Arthroascus schoenii (Saccharomycopsis schoenii). Saccharomycopsis species are
non-conventional yeasts used in diverse brewing settings, e.g., to generate nuruk [
46
,
47
]. We recently
obtained several Saccharomycopsis genome sequences including that of A. schoenii [
43
]. Here we
fused the AsTEF1 promoter with the LacZ reporter gene derived from Streptococcus thermophilus [
48
].
Additionally, we generated a completely new synthetic marker gene based on the AsPGK1 promoter
controlling a hygromycin resistance gene ORF. Both genes were introduced into BY4741 on episomal
CEN6/ARSH4 plasmids (Figure 1). The functionality of both the synthetic marker and the reporter
were demonstrated
in vivo
in S. cerevisiae:HYG3 was functional as we obtained hygromycin-resistant
transformants that carried the plasmids, and the LacZ reporter was active as transformants were able
to convert colorless X-Gal into a blue dye (Figure 1B). This indicates that both A. schoenii promoters
derived from AsTEF1 and AsPGK1 were functional in the heterologous host S. cerevisiae and we thus
went on to employ these genes in lager yeast.
3.2. Transformation of Lager Yeast
Previous analyses already indicated that lager yeasts’ transformation efficiency is drastically lower
than that of S. cerevisiae. In S. cerevisiae lithium acetate/ss DNA/PEG protocols are commonly used [
44
].
We compared this standard protocol with modified versions, which were developed to deal with
yeast strains that are non-responsive to standard lithium acetate or electroporation protocols [
39
,
40
].
Our modified protocol included parts of both protocols: a lithium acetate treatment (without DMSO)
and an electroporation step (Li-Ac/Ep). To allow time for the expression of the antibiotic resistance
genes used in this study, we incubated the cell suspensions after electroporation in an osmotically
stabilized medium before plating on selective plates. To compare both protocols, we employed a freely
replicating plasmid (E160) with HYG3 as the selectable marker.
In our hands, the lithium acetate/ss DNA/PEG protocol (with DMSO) yielded only a few
transformants per
µ
g of DNA, demonstrating the poor transformation efficiency of lager yeast with
this method, even after lowering the temperature of the heat shock step at 40
◦
C, which we tested as
lager yeasts are known to be temperature sensitive and do not grow at elevated temperatures above
34
◦
C. The Li-Ac/Ep protocol, however, resulted in much higher transformation efficiencies (1–2 orders
of magnitude, Figure 2).
Microorganisms 2019,7, 192 6 of 12
Microorganisms 2019, 7, x FOR PEER REVIEW 5 of 12
For the transformation of S. cerevisiae, the lithium acetate/single strand DNA/polyethylene glycol 124
4000 protocol was used as described [44]. For lager yeast transformation, we adapted a protocol from 125
Thompson et al. [39]. WS34/70 was grown overnight to stationary phase in 50 mL YPD. Then the 126
culture was diluted to OD600 = 0.3 in 100 mL fresh YPD. Cells were harvested at mid-log growth with 127
OD600 = 0.7–0.8 (after approximately 3 h of incubation). The culture was centrifuged and washed once 128
with sterile water and resuspended in 25 mL of 0.1 M lithium acetate/10 mM dithiothreitol/10 mM 129
TE solution (Tris HCl: EDTA = 10:1) and incubated for 1 h at room temperature. The cells were 130
washed in 25 mL ice-cold distilled sterile water twice and once with 10 ml of ice-cold 1 M sorbitol, 131
then resuspended in 100 µL ice-cold sorbitol. A 100 µL aliquot of the cell suspension was used for 132
transformation. Transforming DNA (15 µL) was mixed with the cells, incubated for 5 min on ice and 133
electroporated with 1.8 kV in 0.2 cm cuvettes. Then, cells were resuspended in 1 ml cold sorbitol and 134
transferred to a tube with 300 µL YPD. This suspension was incubated for 3 h at 30 °C prior to plating 135
on selective plates that did not contain sorbitol. 136
2.4. Verification of Lager Yeast Transformants 137
The Weihenstephan strain WS34/70 was used for gene targeting experiments. Target genes were 138
derived from the S. cerevisiae parental subgenome. Sequences for verification primers (and also for 139
the S1 and S2 primers) were deduced from the genome sequence that is available at 140
DDBJ/EMBL/GenBank under the accession AZAA00000000. PCR-based gene targeting and 141
diagnostic PCR were performed as described [45]. 142
3. Results 143
3.1. Design and Testing of Synthetic Marker and Reporter Genes 144
We were interested in developing novel synthetic marker and reporter genes for dual use in non-145
conventional yeasts, including lager yeasts and S. cerevisiae. To this end, we tested heterologous 146
promoters derived from Arthroascus schoenii (Saccharomycopsis schoenii). Saccharomycopsis species are 147
non-conventional yeasts used in diverse brewing settings, e.g., to generate nuruk [46,47]. We recently 148
obtained several Saccharomycopsis genome sequences including that of A. schoenii [43]. Here we fused 149
the AsTEF1 promoter with the LacZ reporter gene derived from Streptococcus thermophilus [48]. 150
Additionally, we generated a completely new synthetic marker gene based on the AsPGK1 promoter 151
controlling a hygromycin resistance gene ORF. Both genes were introduced into BY4741 on episomal 152
CEN6/ARSH4 plasmids (Figure 1). The functionality of both the synthetic marker and the reporter 153
were demonstrated in vivo in S. cerevisiae: HYG3 was functional as we obtained hygromycin-resistant 154
transformants that carried the plasmids, and the LacZ reporter was active as transformants were able 155
to convert colorless X-Gal into a blue dye (Figure 1B). This indicates that both A. schoenii promoters 156
derived from AsTEF1 and AsPGK1 were functional in the heterologous host S. cerevisiae and we thus 157
went on to employ these genes in lager yeast. 158
159
Figure 1.
Generating heterologous synthetic marker and reporter genes. (
A
) Linear maps of
pRS-AsTEF1p-LacZ and pRS-AsTEF1p-ScRAD51-HYG3 plasmids. (
B
) The AsTEF1p-LacZ reporter gene
and the HYG3 resistance marker were tested in Saccharomyces cerevisiae BY4741. The presence of an
active
β
-galactosidase was detected by adding X-Gal to the centre of the transformation plate (left panel,
circle indicates the area of X-Gal application). The presence and function of the HYG3 marker was
tested by transforming S. cerevisiae with pRS-AsTEF1p-ScRAD51-HYG3 and selecting the transformants
in the presence of 100 µg/mL of hygromycin (right).
Microorganisms 2019, 7, x FOR PEER REVIEW 6 of 12
Figure 1. Generating heterologous synthetic marker and reporter genes. (A) Linear maps of pRS-160
AsTEF1p-LacZ and pRS-AsTEF1p-ScRAD51-HYG3 plasmids. (B) The AsTEF1p-LacZ reporter gene 161
and the HYG3 resistance marker were tested in Saccharomyces cerevisiae BY4741. The presence of an 162
active β-galactosidase was detected by adding X-Gal to the centre of the transformation plate (left 163
panel, circle indicates the area of X-Gal application). The presence and function of the HYG3 marker 164
was tested by transforming S. cerevisiae with pRS-AsTEF1p-ScRAD51-HYG3 and selecting the 165
transformants in the presence of 100 µg/mL of hygromycin (right). 166
3.2. Transformation of Lager Yeast 167
Previous analyses already indicated that lager yeasts’ transformation efficiency is drastically 168
lower than that of S. cerevisiae. In S. cerevisiae lithium acetate/ss DNA/PEG protocols are commonly 169
used [44]. We compared this standard protocol with modified versions, which were developed to 170
deal with yeast strains that are non-responsive to standard lithium acetate or electroporation 171
protocols [39,40]. Our modified protocol included parts of both protocols: a lithium acetate treatment 172
(without DMSO) and an electroporation step (Li-Ac/Ep). To allow time for the expression of the 173
antibiotic resistance genes used in this study, we incubated the cell suspensions after electroporation 174
in an osmotically stabilized medium before plating on selective plates. To compare both protocols, 175
we employed a freely replicating plasmid (E160) with HYG3 as the selectable marker. 176
In our hands, the lithium acetate/ss DNA/PEG protocol (with DMSO) yielded only a few 177
transformants per µg of DNA, demonstrating the poor transformation efficiency of lager yeast with 178
this method, even after lowering the temperature of the heat shock step at 40 °C, which we tested as 179
lager yeasts are known to be temperature sensitive and do not grow at elevated temperatures above 180
34 °C. The Li-Ac/Ep protocol, however, resulted in much higher transformation efficiencies (1–2 181
orders of magnitude, Figure 2). 182
183
Figure 2. Comparison of two transformation methods in the Weihenstephan lager yeast strain WS 34/70. 184
(A,C) A lithium-acetate/single strand DNA/polyethylene glycol (Li-Ac/ssDNA/PEG) and (B,D) a 185
LiAc/PEG incubation combined with electroporation (Li-Ac/Ep) were used with two different 186
antibiotic concentrations for the selection of transformants. The transformation of WS 34/70 with a 187
Figure 2.
Comparison of two transformation methods in the Weihenstephan lager yeast strain WS
34/70. (
A
,
C
) A lithium-acetate/single strand DNA/polyethylene glycol (Li-Ac/ssDNA/PEG) and
(
B
,
D
) a LiAc/PEG incubation combined with electroporation (Li-Ac/Ep) were used with two different
antibiotic concentrations for the selection of transformants. The transformation of WS 34/70 with a
freely replicative plasmid carrying a hygromycin resistance marker (pRS-AsTEF1p-ScRAD51-HYG3)
yielded few transformants when using the Li-ac/ssDNA/PEG method (
A
,
C
). By contrast, the Li-Ac/Ep
method together with antibiotic selection at 100
µ
g/mL final concentration (
D
), resulted in a higher
transformation efficiency compared to the other combinations (A–C).
Microorganisms 2019,7, 192 7 of 12
3.3. PCR-Based Gene Targeting is Enhanced by RAD51 Overexpression
Plasmid transformation is regularly far more efficient than integrative transformation. PCR-based
gene targeting approaches are convenient because in one PCR reaction short-flanking homology regions
can be added to a selection marker. We used standard S1 and S2 primers that added 50 bases of flanking
homology region. However, in our hands, we failed to obtain stable lager yeast transformants with these
PCR-based disruption cassettes, even when using the Li-Ac/Epo protocol (Figure 3A). After prolonged
incubation on selective plates (>2d) small colonies may appear. However, these colonies did not
continue to grow upon restreaking on new selective plates or in selective liquid media and represent
background growth (Figure 3B). In contrast, the transformation of a Weihenstephan lager yeast strain that
harbors a plasmid-encoded ScRAD51 expressed from a strong TEF promoter yielded a large number
of transformants on primary selective plates using disruption cassettes for ScHSP104 (Figure 3C).
A randomly selected set of colonies continued to grow upon restreaking and also grew well in liquid
YPD supplemented with hygromycin (Figure 3D and data not shown).
Microorganisms 2019, 7, x FOR PEER REVIEW 7 of 12
freely replicative plasmid carrying a hygromycin resistance marker (pRS-AsTEF1p-ScRAD51-HYG3) 188
yielded few transformants when using the Li-ac/ssDNA/PEG method (A,C). By contrast, the Li-Ac/Ep 189
method together with antibiotic selection at 100 µg/mL final concentration (D), resulted in a higher 190
transformation efficiency compared to the other combinations (A–C). 191
3.3. PCR-Based Gene Targeting is Enhanced by RAD51 Overexpression 192
Plasmid transformation is regularly far more efficient than integrative transformation. PCR-193
based gene targeting approaches are convenient because in one PCR reaction short-flanking 194
homology regions can be added to a selection marker. We used standard S1 and S2 primers that 195
added 50 bases of flanking homology region. However, in our hands, we failed to obtain stable lager 196
yeast transformants with these PCR-based disruption cassettes, even when using the Li-Ac/Epo 197
protocol (Figure 3A). After prolonged incubation on selective plates (>2d) small colonies may appear. 198
However, these colonies did not continue to grow upon restreaking on new selective plates or in 199
selective liquid media and represent background growth (Figure 3B). In contrast, the transformation 200
of a Weihenstephan lager yeast strain that harbors a plasmid-encoded ScRAD51 expressed from a 201
strong TEF promoter yielded a large number of transformants on primary selective plates using 202
disruption cassettes for ScHSP104 (Figure 3C). A randomly selected set of colonies continued to grow 203
upon restreaking and also grew well in liquid YPD supplemented with hygromycin (Figure 3D and 204
data not shown). 205
206
Figure 3. PCR-based gene targeting in lager yeast. The Weihenstephan strain WS34/70 carrying either 207
an empty vector (pHYG3; A) or a RAD51 plasmid (pRAD51, C) was transformed with disruption 208
cassettes containing the YES1 marker harboring 50 bp of flanking homology regions for targeting to 209
the ScHSP104 locus. We used a Li-Ac/Ep transformation protocol and selected transformants on YPD 210
Figure 3.
PCR-based gene targeting in lager yeast. The Weihenstephan strain WS34/70 carrying either
an empty vector (pHYG3;
A
) or a RAD51 plasmid (pRAD51,
C
) was transformed with disruption
cassettes containing the YES1 marker harboring 50 bp of flanking homology regions for targeting to
the ScHSP104 locus. We used a Li-Ac/Ep transformation protocol and selected transformants on YPD
plates supplemented with hygromycin and G418 (100
µ
g/mL final concentration each). Restreaking
of putative transformant colonies on new selective plates indicated stable transformants were only
obtained in the lager yeast strain overexpressing pRAD51 (B,D).
Verification of these transformants that grew upon restreaking and growth in liquid culture was
done by standard diagnostic PCR, amplifying the novel joints at the borders of marker integration [
45
].
This confirmed targeted gene disruption (Figure 4). Overall, between 60–75% of primary transformants
could be cultivated further in a liquid culture, and all for all of those diagnostic PCRs indicated
correct integration of the marker cassette at the target locus (n>20). However, we did not obtain any
Microorganisms 2019,7, 192 8 of 12
transformants in the same strain without the overexpression of ScRAD51, demonstrating the usefulness
of this approach. To verify that the marker integration and PCR-based gene targeting success was
not solely locus dependent, we targeted a second gene, ScADE2, in the same manner. Transformation
efficiencies were found to be similar for both loci and diagnostic PCR was successfully employed for
the verification of the deletion of an ADE2 allele (Figure 4C).
Microorganisms 2019, 7, x FOR PEER REVIEW 8 of 12
plates supplemented with hygromycin and G418 (100 µg/mL final concentration each). Restreaking 211
of putative transformant colonies on new selective plates indicated stable transformants were only 212
obtained in the lager yeast strain overexpressing pRAD51 (B,D). 213
Verification of these transformants that grew upon restreaking and growth in liquid culture was 214
done by standard diagnostic PCR, amplifying the novel joints at the borders of marker integration 215
[45]. This confirmed targeted gene disruption (Figure 4). Overall, between 60%–75% of primary 216
transformants could be cultivated further in a liquid culture, and all for all of those diagnostic PCRs 217
indicated correct integration of the marker cassette at the target locus (n > 20). However, we did not 218
obtain any transformants in the same strain without the overexpression of ScRAD51, demonstrating 219
the usefulness of this approach. To verify that the marker integration and PCR-based gene targeting 220
success was not solely locus dependent, we targeted a second gene, ScADE2, in the same manner. 221
Transformation efficiencies were found to be similar for both loci and diagnostic PCR was 222
successfully employed for the verification of the deletion of an ADE2 allele (Figure 4C). 223
224
Figure 4. Diagnostic PCR for verification of correct marker integration. (A) Schematic presentation of 225
PCR-based gene targeting of YES1 amplified with gene specific S1/S2-primers adding 50 bp of target 226
homology region (orange bars) to ScHSP104 or ScADE2, respectively. Diagnostic G1/G2 and G3/G4 227
primers were used for verification of the correct insertion of YES1 and removal of the Sc HSP104 (B) 228
and Sc ADE2 locus (C) ORFs. 229
4. Discussion 230
Lager yeasts are the workhorses of the beer industry. Detailed strain characterizations and 231
molecular genetics-assisted yeast breeding, however, are hampered by the lack of proof-of-concept 232
technologies. A major obstacle in lager yeast research is the surprisingly inefficient gene targeting in 233
lager yeast. Thus, there are only a few reports of the successful molecular genetic manipulation of 234
lager yeast relying on HR [13–15]. There are other issues beyond the mere technical difficulties. 235
Primarily, these are complicated by the hybrid nature of lager yeast. Lager yeasts are allopolyploid 236
hybrids between S. cerevisiae and S. eubayanus parents [9]. Group I/Saaz strains are triploid, while 237
Group II/Frohberg strains, to which Weihenstephan 34/70 belongs, are tetraploid [2]. Additionally, 238
aneuploidies could further change allele frequencies, complicating gene knockout experiments. 239
Secondly, due to the hybrid nature, sporulation is severely crippled due to failure to proceed through 240
meiotic divisions, resulting in hybrid sterility, which is more pronounced in triploid Group I strains 241
than in tetraploid Group II strains [49,50]. Thirdly, even though lager yeasts are the workhorses of 242
Figure 4.
Diagnostic PCR for verification of correct marker integration. (
A
) Schematic presentation of
PCR-based gene targeting of YES1 amplified with gene specific S1/S2-primers adding 50 bp of target
homology region (orange bars) to ScHSP104 or ScADE2, respectively. Diagnostic G1/G2 and G3/G4
primers were used for verification of the correct insertion of YES1 and removal of the Sc HSP104 (
B
)
and Sc ADE2 locus (C) ORFs.
4. Discussion
Lager yeasts are the workhorses of the beer industry. Detailed strain characterizations and
molecular genetics-assisted yeast breeding, however, are hampered by the lack of proof-of-concept
technologies. A major obstacle in lager yeast research is the surprisingly inefficient gene targeting in
lager yeast. Thus, there are only a few reports of the successful molecular genetic manipulation of lager
yeast relying on HR [
13
–
15
]. There are other issues beyond the mere technical difficulties. Primarily,
these are complicated by the hybrid nature of lager yeast. Lager yeasts are allopolyploid hybrids
between S. cerevisiae and S. eubayanus parents [
9
]. Group I/Saaz strains are triploid, while Group
II/Frohberg strains, to which Weihenstephan 34/70 belongs, are tetraploid [
2
]. Additionally, aneuploidies
could further change allele frequencies, complicating gene knockout experiments. Secondly, due to the
hybrid nature, sporulation is severely crippled due to failure to proceed through meiotic divisions,
resulting in hybrid sterility, which is more pronounced in triploid Group I strains than in tetraploid
Group II strains [
49
,
50
]. Thirdly, even though lager yeasts are the workhorses of the beer industry, there
is a reluctance to employ genetically modified yeast strains, a notion that has rather been strengthened
over recent years.
In addition to their industrial importance, lager yeast hybrids present excellent model systems to
study hybrid biology, including hybrid vigor, hybrid sterility, adaptive evolution and the analysis of
hybrid protein complexes [
51
,
52
]. Major advances in hybrid yeast breeding resolved the F1-sterility
problem represented in lager yeast [53].
Microorganisms 2019,7, 192 9 of 12
Our study indicates that RAD51 overexpression in lager yeast opens the tool-box for all genetic
manipulation previously only available in S. cerevisiae. Although transformation efficiencies in lager
yeasts are far lower than in S. cerevisiae, rational strain design based on targeted gene replacements has
become feasible. We have successfully employed this strategy already to other loci, suggesting that
potential locus dependent variations in gene targeting are not inhibitory to successful gene targeting.
Furthermore, by selecting specific homology regions, even closely related alleles of the S. cerevisiae
and S. eubayanus parental genomes can be distinguished. The overexpression of RAD51 has been
shown to improve HR in other systems, so it may also be advantageous in other non-conventional
yeasts in which molecular genetic studies are hampered by the preferential ectopic integration of gene
targeting cassettes.
Two additional advances to improve HR in resilient strains in recent years include the use of Ku70
mutant strains and the establishment of CRISPR/Cas9 methodologies [
12
]. Deletion of Ku70 inactivates
the NHEJ pathway, thus favouring HR and targeted gene alterations [
33
]. However,
in S. cerevisiae
,
the deletion of Ku70 has been shown to generate defects in telomere maintenance and cell cycle
regulation [
54
,
55
]. Thus, this may not be favorable in lager yeast as breeding efforts to restore a
wildtype Ku70 status after genetic engineering are also quite laborious.
Recent reports established CRISPR/Cas9 in lager yeast, making this a promising tool for strain
engineering [
12
,
56
]. CRISPR/Cas9 will be particularly useful for simultaneous alterations of multiple
alleles in a single step, even more so when the number of alleles may vary due to aneuploidies. In a
recent report, simultaneous single and double deletions of SeATF1 and SeATF2 were performed in lager
yeast, demonstrating the power of this tool [
12
]. It will be interesting to see if a combined approach,
overexpressing RAD51 and the use of CRISPR/Cas9, will further improve gene replacement efficiencies.
Author Contributions:
The authors of this paper contributed in the following way: Conceptualization, J.W. and
B.B.; methodology, B.B., Y.K., M.A. and J.W.; validation, B.B., Y.K. and M.A.; investigation, B.B., Y.K., M.A., and J.W.;
data curation, B.B. and Y.K.; writing—original draft preparation, B.B. and J.W.; writing—review and editing, B.B.,
Y.K., M.A. and J.W.
Funding:
This research was supported by the European Union Marie Skłodowska-Curie Actions Innovative
Training Network Aromagenesis (764364) (https://www.aromagenesis.eu/).
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Hansen, E.C. Grundlagen zur Systematik der Saccharomyceten. Zentralbl. Bakteriol. II Natur.
1904
,12,
529–538.
2.
Walther, A.; Hesselbart, A.; Wendland, J. Genome sequence of Saccharomyces carlsbergensis, the world’s
first pure culture lager yeast. G3 Genes Genomes Genet. 2014,4, 783–793. [CrossRef] [PubMed]
3. Wendland, J. Lager yeast comes of age. Eukaryot. Cell 2014,13, 1256–1265. [CrossRef] [PubMed]
4.
Baker, E.; Wang, B.; Bellora, N.; Peris, D.; Hulfachor, A.B.; Koshalek, J.A.; Adams, M.; Libkind, D.;
Hittinger, C.T. The Genome Sequence of Saccharomyces eubayanus and the Domestication of Lager-Brewing
Yeasts. Mol. Biol. Evol. 2015,32, 2818–2831. [CrossRef] [PubMed]
5.
Gibson, B.; Liti, G. Saccharomyces pastorianus: Genomic insights inspiring innovation for industry. Yeast
2015,32, 17–27. [CrossRef] [PubMed]
6.
Okuno, M.; Kajitani, R.; Ryusui, R.; Morimoto, H.; Kodama, Y.; Itoh, T. Next-generation sequencing analysis
of lager brewing yeast strains reveals the evolutionary history of interspecies hybridization. DNA Res.
2016
,
23, 67–80. [CrossRef] [PubMed]
7.
Monerawela, C.; Bond, U. Brewing up a storm: The genomes of lager yeasts and how they evolved. Biotechnol.
Adv. 2017,35, 512–519. [CrossRef]
8.
Monerawela, C.; Bond, U. The hybrid genomes of Saccharomyces pastorianus: A current perspective. Yeast
2018,35, 39–50. [CrossRef]
9.
Libkind, D.; Hittinger, C.T.; Valerio, E.; Goncalves, C.; Dover, J.; Johnston, M.; Goncalves, P.; Sampaio, J.P.
Microbe domestication and the identification of the wild genetic stock of lager-brewing yeast. Proc. Natl.
Acad. Sci. USA 2011,108, 14539–14544. [CrossRef]
Microorganisms 2019,7, 192 10 of 12
10.
Bing, J.; Han, P.J.; Liu, W.Q.; Wang, Q.M.; Bai, F.Y. Evidence for a Far East Asian origin of lager beer yeast.
Curr. Biol. 2014,24, R380–R381. [CrossRef]
11.
Baker, E.P.; Peris, D.; Moriarty, R.V.; Li, X.C.; Fay, J.C.; Hittinger, C.T. Mitochondrial DNA and temperature
tolerance in lager yeasts. Sci. Adv. 2019,5, eaav1869. [CrossRef] [PubMed]
12.
Gorter de Vries, A.R.; de Groot, P.A.; van den Broek, M.; Daran, J.G. CRISPR-Cas9 mediated gene deletions
in lager yeast Saccharomyces pastorianus. Microb. Cell Fact. 2017,16, 222. [CrossRef] [PubMed]
13.
Duong, C.T.; Strack, L.; Futschik, M.; Katou, Y.; Nakao, Y.; Fujimura, T.; Shirahige, K.; Kodama, Y.; Nevoigt, E.
Identification of Sc-type ILV6 as a target to reduce diacetyl formation in lager brewers’ yeast. Metab. Eng.
2011,13, 638–647. [CrossRef] [PubMed]
14.
Murakami, N.; Miyoshi, S.; Yokoyama, R.; Hoshida, H.; Akada, R.; Ogata, T. Construction of a URA3 deletion
strain from the allotetraploid bottom-fermenting yeast Saccharomyces pastorianus. Yeast 2012,29, 155–165.
[CrossRef] [PubMed]
15.
Bolat, I.; Romagnoli, G.; Zhu, F.; Pronk, J.T.; Daran, J.M. Functional analysis and transcriptional regulation of
two orthologs of ARO10, encoding broad-substrate-specificity 2-oxo-acid decarboxylases, in the brewing
yeast Saccharomyces pastorianus CBS1483. FEMS Yeast Res 2013,13, 505–517. [CrossRef] [PubMed]
16.
Wendland, J. PCR-based methods facilitate targeted gene manipulations and cloning procedures. Curr. Genet.
2003,44, 115–123. [CrossRef] [PubMed]
17.
Wach, A.; Brachat, A.; Pohlmann, R.; Philippsen, P. New heterologous modules for classical or PCR-based
gene disruptions in Saccharomyces cerevisiae. Yeast 1994,10, 1793–1808. [CrossRef]
18.
Wach, A.; Brachat, A.; Alberti-Segui, C.; Rebischung, C.; Philippsen, P. Heterologous HIS3 marker and GFP
reporter modules for PCR-targeting in Saccharomyces cerevisiae. Yeast 1997,13, 1065–1075. [CrossRef]
19.
Giaever, G.; Chu, A.M.; Ni, L.; Connelly, C.; Riles, L.; Veronneau, S.; Dow, S.; Lucau-Danila, A.; Anderson, K.;
Andre, B.; et al. Functional profiling of the Saccharomyces cerevisiae genome. Nature
2002
,418, 387–391.
[CrossRef]
20.
Costanzo, M.; Baryshnikova, A.; Bellay, J.; Kim, Y.; Spear, E.D.; Sevier, C.S.; Ding, H.; Koh, J.L.; Toufighi, K.;
Mostafavi, S.; et al. The genetic landscape of a cell. Science 2010,327, 425–431. [CrossRef]
21.
Costanzo, M.; VanderSluis, B.; Koch, E.N.; Baryshnikova, A.; Pons, C.; Tan, G.; Wang, W.; Usaj, M.;
Hanchard, J.; Lee, S.D.; et al. A global genetic interaction network maps a wiring diagram of cellular function.
Science 2016,353, aaf1420. [CrossRef] [PubMed]
22.
Kuzmin, E.; VanderSluis, B.; Wang, W.; Tan, G.; Deshpande, R.; Chen, Y.; Usaj, M.; Balint, A.; Mattiazzi
Usaj, M.; van Leeuwen, J.; et al. Systematic analysis of complex genetic interactions. Science
2018
,360,
eaao1729. [CrossRef] [PubMed]
23.
Bahler, J.; Wu, J.Q.; Longtine, M.S.; Shah, N.G.; McKenzie, A., 3rd; Steever, A.B.; Wach, A.;
Philippsen, P.; Pringle, J.R. Heterologous modules for efficient and versatile PCR-based gene targeting in
Schizosaccharomyces pombe. Yeast 1998,14, 943–951. [CrossRef]
24.
Gerami-Nejad, M.; Berman, J.; Gale, C.A. Cassettes for PCR-mediated construction of green, yellow, and cyan
fluorescent protein fusions in Candida albicans. Yeast 2001,18, 859–864. [CrossRef] [PubMed]
25.
Gerami-Nejad, M.; Hausauer, D.; McClellan, M.; Berman, J.; Gale, C. Cassettes for the PCR-mediated
construction of regulatable alleles in Candida albicans. Yeast 2004,21, 429–436. [CrossRef] [PubMed]
26.
Gerami-Nejad, M.; Dulmage, K.; Berman, J. Additional cassettes for epitope and fluorescent fusion proteins
in Candida albicans. Yeast 2009,26, 399–406. [CrossRef]
27.
Gola, S.; Martin, R.; Walther, A.; Dunkler, A.; Wendland, J. New modules for PCR-based gene targeting in
Candida albicans: Rapid and efficient gene targeting using 100 bp of flanking homology region. Yeast
2003
,
20, 1339–1347. [CrossRef]
28.
Wendland, J.; Ayad-Durieux, Y.; Knechtle, P.; Rebischung, C.; Philippsen, P. PCR-based gene targeting in the
filamentous fungus Ashbya gossypii. Gene 2000,242, 381–391. [CrossRef]
29.
Amelina, H.; Moiseeva, V.; Collopy, L.C.; Pearson, S.R.; Armstrong, C.A.; Tomita, K. Sequential and
counter-selectable cassettes for fission yeast. BMC Biotechnol. 2016,16, 76. [CrossRef]
30. Kooistra, R.; Hooykaas, P.J.; Steensma, H.Y. Efficient gene targeting in Kluyveromyces lactis. Yeast 2004,21,
781–792. [CrossRef]
Microorganisms 2019,7, 192 11 of 12
31.
Wesolowski-Louvel, M. An efficient method to optimize Kluyveromyces lactis gene targeting. FEMS Yeast
Res. 2011,11, 509–513. [CrossRef] [PubMed]
32.
Kretzschmar, A.; Otto, C.; Holz, M.; Werner, S.; Hubner, L.; Barth, G. Increased homologous integration
frequency in Yarrowia lipolytica strains defective in non-homologous end-joining. Curr. Genet.
2013
,59,
63–72. [CrossRef] [PubMed]
33.
Ninomiya, Y.; Suzuki, K.; Ishii, C.; Inoue, H. Highly efficient gene replacements in Neurospora strains
deficient for nonhomologous end-joining. Proc. Natl. Acad. Sci. USA
2004
,101, 12248–12253. [CrossRef]
[PubMed]
34.
Sidhu, Y.S.; Cairns, T.C.; Chaudhari, Y.K.; Usher, J.; Talbot, N.J.; Studholme, D.J.; Csukai, M.; Haynes, K.
Exploitation of sulfonylurea resistance marker and non-homologous end joining mutants for functional
analysis in Zymoseptoria tritici. Fungal Genet. Biol. 2015,79, 102–109. [CrossRef] [PubMed]
35.
Arras, S.D.; Fraser, J.A. Chemical Inhibitors of Non-Homologous End Joining Increase Targeted Construct
Integration in Cryptococcus neoformans. PLoS ONE 2016,11, e0163049. [CrossRef] [PubMed]
36.
Yanez, R.J.; Porter, A.C. Gene targeting is enhanced in human cells overexpressing hRAD51. Gene Ther.
1999
,
6, 1282–1290. [CrossRef] [PubMed]
37.
Shcherbakova, O.G.; Lanzov, V.A.; Ogawa, H.; Filatov, M.V. Overexpression of bacterial RecA protein
stimulates homologous recombination in somatic mammalian cells. Mutat. Res.
2000
,459, 65–71. [CrossRef]
38.
Liu, L.; Maguire, K.K.; Kmiec, E.B. Genetic re-engineering of Saccharomyces cerevisiae RAD51 leads to a
significant increase in the frequency of gene repair
in vivo
.Nucleic Acids Res.
2004
,32, 2093–2101. [CrossRef]
39.
Thompson, J.R.; Register, E.; Curotto, J.; Kurtz, M.; Kelly, R. An improved protocol for the preparation of
yeast cells for transformation by electroporation. Yeast 1998,14, 565–571. [CrossRef]
40.
Suga, M.; Hatakeyama, T. High efficiency transformation of Schizosaccharomyces pombe pretreated with
thiol compounds by electroporation. Yeast 2001,18, 1015–1021. [CrossRef]
41.
Sikorski, R.S.; Hieter, P. A system of shuttle vectors and yeast host strains designed for efficient manipulation
of DNA in Saccharomyces cerevisiae. Genetics 1989,122, 19–27. [PubMed]
42.
Dunkler, A.; Wendland, J. Use of MET3 promoters for regulated gene expression in Ashbya gossypii.
Curr. Genet. 2007,52, 1–10. [CrossRef] [PubMed]
43.
Junker, K.; Chailyan, A.; Hesselbart, A.; Forster, J.; Wendland, J. Multi-omics characterization of the
necrotrophic mycoparasite Saccharomycopsis schoenii. PLoS Pathog. 2019, in press. [CrossRef] [PubMed]
44.
Gietz, R.D.; Schiestl, R.H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method.
Nat. Protoc. 2007,2, 31–34. [CrossRef] [PubMed]
45.
Walther, A.; Wendland, J. PCR-based gene targeting in Candida albicans. Nat. Protoc.
2008
,3, 1414–1421.
[CrossRef] [PubMed]
46.
Carroll, E.; Trinh, T.N.; Son, H.; Lee, Y.W.; Seo, J.A. Comprehensive analysis of fungal diversity and enzyme
activity in nuruk, a Korean fermenting starter, for acquiring useful fungi. J. Microbiol.
2017
,55, 357–365.
[CrossRef] [PubMed]
47.
Farh, M.E.; Cho, Y.; Lim, J.Y.; Seo, J.A. A diversity study of Saccharomycopsis fibuligera in rice wine starter
nuruk, reveals the evolutionary process associated with its interspecies hybrid. J. Microbiol.
2017
,55, 337–343.
[CrossRef] [PubMed]
48.
Uhl, M.A.; Johnson, A.D. Development of Streptococcus thermophilus lacZ as a reporter gene for Candida
albicans. Microbiology 2001,147, 1189–1195. [CrossRef] [PubMed]
49. Greig, D. Reproductive isolation in Saccharomyces. Heredity 2009,102, 39–44. [CrossRef]
50.
Sipiczki, M. Yeast two- and three-species hybrids and high-sugar fermentation. Microb. Biotechnol.
2019
.
[CrossRef] [PubMed]
51.
Leducq, J.B.; Charron, G.; Diss, G.; Gagnon-Arsenault, I.; Dube, A.K.; Landry, C.R. Evidence for the robustness
of protein complexes to inter-species hybridization. PLoS Genet. 2012,8, e1003161. [CrossRef]
52.
Piatkowska, E.M.; Naseeb, S.; Knight, D.; Delneri, D. Chimeric protein complexes in hybrid species generate
novel phenotypes. PLoS Genet. 2013,9, e1003836. [CrossRef]
53.
Pfliegler, W.P.; Antunovics, Z.; Sipiczki, M. Double sterility barrier between Saccharomyces species and its
breakdown in allopolyploid hybrids by chromosome loss. FEMS Yeast Res 2012,12, 703–718. [CrossRef]
54.
Barnes, G.; Rio, D. DNA double-strand-break sensitivity, DNA replication, and cell cycle arrest phenotypes
of Ku-deficient Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 1997,94, 867–872. [CrossRef]
Microorganisms 2019,7, 192 12 of 12
55.
Polotnianka, R.M.; Li, J.; Lustig, A.J. The yeast Ku heterodimer is essential for protection of the telomere
against nucleolytic and recombinational activities. Curr. Biol. 1998,8, 831–834. [CrossRef]
56.
Mertens, S.; Gallone, B.; Steensels, J.; Herrera-Malaver, B.; Cortebeek, J.; Nolmans, R.; Saels, V.; Vyas, V.K.;
Verstrepen, K.J. Reducing phenolic off-flavors through CRISPR-based gene editing of the FDC1 gene in
Saccharomyces cerevisiae x Saccharomyces eubayanus hybrid lager beer yeasts. PLoS ONE
2019
,14, e0209124.
[CrossRef]
©
2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
