ArticlePDF Available

Abstract and Figures

Lager beer fermentations rely on specific polyploid hybrids between Saccharomyces cerevisiae and Saccharomyces eubayanus falling into the two groups of S. carlsbergensis/Saaz-type and S. pastorianus/Frohberg-type. These strains provide a terroir to lager beer as they have long traditional associations and local selection histories with specific breweries. Lager yeasts share, based on their common origin, several phenotypes. One of them is low transformability, hampering the gene function analyses required for proof-of-concept strain improvements. PCR-based gene targeting is a standard tool for manipulating S. cerevisiae and other ascomycetes. However, low transformability paired with the low efficiency of homologous recombination practically disable targeted gene function analyses in lager yeast strains. For genetic manipulations in lager yeasts, we employed a yeast transformation protocol based on lithium-acetate/PEG incubation combined with electroporation. We first introduced freely replicating CEN/ARS plasmids carrying ScRAD51 driven by a strong heterologous promoter into lager yeast. RAD51 overexpression in the Weihenstephan 34/70 lager yeast was necessary and sufficient in our hands for gene targeting using short-flanking homology regions of 50 bp added to a selection marker by PCR. We successfully targeted two independent loci, ScADE2/YOR128C and ScHSP104/YLL026W, and confirmed correct integration by diagnostic PCR. With these modifications, genetic alterations of lager yeasts can be achieved efficiently and the RAD51-containing episomal plasmid can be removed after successful strain construction.
Content may be subject to copyright.
microorganisms
Article
Overexpression of RAD51 Enables PCR-Based Gene
Targeting in Lager Yeast
Beatrice Bernardi 1,2, Yeseren Kayacan 2, Madina Akan 1,2 and Jürgen Wendland 1 ,2 ,*
1Department of Microbiology and Biochemistry, Hochschule Geisenheim University, von-Lade Strasse 1,
D-65366 Geisenheim, Germany
2Research Group of Microbiology (MICR)—Functional Yeast Genomics, Vrije Universiteit Brussel,
BE-1050 Brussels, Belgium
*Correspondence: juergen.wendland@hs-gm.de; Tel.: +49-6722-502-332
Received: 8 June 2019; Accepted: 3 July 2019; Published: 5 July 2019


Abstract:
Lager beer fermentations rely on specific polyploid hybrids between Saccharomyces
cerevisiae and Saccharomyces eubayanus falling into the two groups of S. carlsbergensis/Saaz-type and
S. pastorianus/Frohberg-type. These strains provide a terroir to lager beer as they have long traditional
associations and local selection histories with specific breweries. Lager yeasts share, based on their
common origin, several phenotypes. One of them is low transformability, hampering the gene function
analyses required for proof-of-concept strain improvements. PCR-based gene targeting is a standard
tool for manipulating S. cerevisiae and other ascomycetes. However, low transformability paired with
the low eciency of homologous recombination practically disable targeted gene function analyses
in lager yeast strains. For genetic manipulations in lager yeasts, we employed a yeast transformation
protocol based on lithium-acetate/PEG incubation combined with electroporation. We first introduced
freely replicating CEN/ARS plasmids carrying ScRAD51 driven by a strong heterologous promoter
into lager yeast. RAD51 overexpression in the Weihenstephan 34/70 lager yeast was necessary and
sucient in our hands for gene targeting using short-flanking homology regions of 50 bp added to
a selection marker by PCR. We successfully targeted two independent loci, ScADE2/YOR128C and
ScHSP104/YLL026W, and confirmed correct integration by diagnostic PCR. With these modifications,
genetic alterations of lager yeasts can be achieved eciently and the RAD51-containing episomal
plasmid can be removed after successful strain construction.
Keywords: homologous recombination; gene function analysis; hybrid yeast; fermentation
1. Introduction
Lager beer is the most popular alcoholic beverage worldwide. It is distinguished from
top-fermented ale beers by the use of dedicated bottom fermenting lager yeasts. Pure culture
lager yeasts were introduced in the late 19th century and the first lager yeast strain became known as
Saccharomyces carlsbergensis [
1
,
2
]. Lager yeasts are particularly suited for cold fermentations below
15
C, providing a specific and clean taste [
3
]. Lager yeast strains are hybrids of two Saccharomyces
species, namely S. cerevisiae and S. eubayanus [
4
8
]. The S. cerevisiae parent is related to ale yeasts
while the S. eubayanus parent has recently been isolated from South America and Asia [
9
,
10
]. The low
temperature fermentation capabilities of lager yeast hybrids may have originated from the parental
S. eubayanus mitochondrial DNA that is invariably present in today’s lager yeasts [11].
Genetic manipulations in lager yeast are hampered by the allopolyploid nature of these hybrids
but also by their low transformation and homologous recombination (HR) eciency [
12
]. This is
demonstrated by the very few reports on targeted gene alterations in lager yeast [
13
15
]. These
shortcomings of lager yeasts are in sharp contrast to the high eciency and ease with which S. cerevisiae
Microorganisms 2019,7, 192; doi:10.3390/microorganisms7070192 www.mdpi.com/journal/microorganisms
Microorganisms 2019,7, 192 2 of 12
can be manipulated [
16
]. A large array of modules for PCR-based gene targeting have been developed
for S. cerevisiae and the gene deletion collection was one of its outputs that spurred large scale
functional and synthetic genetic array analyses [
17
22
]. PCR-based gene targeting tools were also
developed for other ascomycetous fungi with ecient homologous recombination machineries,
including Ashbya gossypii, Candida albicans and Schizosaccharomyces pombe [2329].
Deletion of Ku70 or Ku80 of the non-homologous end joining (NHEJ) pathway has been shown to be
a very useful tool to improve gene targeting in a large variety of fungi, including e.g., Kluyveromyces lactis
and Yarrowia lipolytica [
30
32
]. The Ku70 deletion approach has been particularly successful in
filamentous ascomycetes in which non-homologous end joining is otherwise predominant, e.g.,
in Neurospora crassa or Zymoseptoria tritici [
33
,
34
]. However, in Cryptococcus neoformans it was found
that deletion of Ku70 also alters virulence, which then requires sexual crosses to reinstate wildtype
Ku70 in a mutant background [35].
An alternative to impairing NHEJ is improving HR eciency. Overexpression of RAD51,
coding for a protein involved in the recombinational repair of DNA-double strand breaks,
in S. cerevisiae
enhances gene repair, a feature conserved in human cells that can also be achieved by using RecA
from Escherichia coli [
36
38
]. We thought to employ the apparently highly conserved nature of
HR improvement upon RAD51 overexpression in lager yeast. Here we show that plasmid-based
overexpression of ScRAD51 under the control of a strong heterologous promoter, allows for simplified
targeted gene function analyses in lager yeast. This genetic improvement of lager yeast transformation
was combined with a lithium acetate/electroporation transformation protocol similar as has previously
been described for S. cerevisiae and S. pombe [
39
,
40
]. Together, these improvements should aid
proof-of-concept analyses in lager yeasts prior to embarking on laborious mutagenesis and selection
schemes for strains not genetically modified (non-GM) used in the production of fermented beverages.
Additionally, this provides a tool to investigate hybrid biology at the molecular level.
2. Material and Methods
2.1. Strains and Culture Conditions
Yeast strains, used and generated (see Table 1), were grown in YPD (1% yeast extract, 2% peptone,
2% glucose) at 30
C. Solid media were prepared by adding 2% agar and YPD plates were supplemented
with either hygromycin or G418/geneticin. For lager yeasts the antibiotic concentrations used were
100
µ
g/mL, while S. cerevisiae lab strains were selected at 200
µ
g/mL final concentration. Minimal
media lacking leucine contained 6.7 g/L yeast nitrogen base with NH
4
SO
4
and without amino acids
and 0.69 g/L completed synthetic medium leucine drop-out mixture. Plasmids were propagated
in Escherichia coli DH5alpha in 2xYT (1.6 % tryptone, 1 % yeast extract, 0.5 % NaCl) containing
100 µg/mL ampicillin.
Table 1. Strains used in this study.
Strain Number Feature/Genotype Source
B003 Saccharomyces cerevisiae BY4741 MATa
his31; leu20; met150; ura30Euroscarf
B237 Weihenstephan WS34/70 lager yeast Lab collection
B256 WS34/70; pRAD51 (HYG3, CEN6/ARSH4) This study
B257 WS34/70; pHYG3 (CEN6/ARSH4) This study
G001 WS34/70; pRAD51; ade2::YES1 This study
G002 WS34/70; pRAD51; hsp104::YES1 This study
2.2. Plasmid Design and Constructions
The plasmids used in this study are listed in Table 2. The primers required for plasmid constructions
or for PCR-based gene targeting are listed in Table 3. Plasmid DNAs were amplified in E. coli and
Microorganisms 2019,7, 192 3 of 12
prepared using a Plasmid Midi DNA Purification Kit (Genaxxon, Ulm, Germany). PCR fragments
were cloned into pGEM (Promega, Madison, USA). The ScRAD51/YER095W open reading frame was
amplified from BY4741 genomic DNA using primers 260 and 261 and the Arthroascus (=Saccharomycopsis)
schoenii TEF1 promoter was amplified from A. schoenii genomic DNA using primers 106 and 107,
and both were cloned into pGEM. To place LacZ under the control of the AsTEF1-promoter, AsTEF1p
was amplified form pGEM-AsTEF1p (E026) with primers 108/109, which added 45 bp of flanking
homology region to E025-pRS417-AgTEFp-LacZ (here LacZ is under the control of the Ashbya gossypii
TEF-promoter). The AgTEF-promoter was removed from E025 by restriction digestion with KpnI/XhoI,
and the vector and AsTEF1p were cotransformed into yeast to combine them via
in vivo
recombination,
yielding plasmid E065. All restriction enzymes were obtained from Thermo Fisher (Asse, Belgium).
All primers were obtained from Sigma Aldrich (Overijse, Belgium).
Table 2. Plasmids used in this study.
Strain Number Feature/Genotype Source
E008 pRS415 [41]
E025 pRS417-AgTEF1p-LacZ-GEN3 [42]
E026 pGEM-AsTEF1p This study
E054 pUC57-HYG3 GenScript
E065 pRS417-AsTEF1p-LacZ This study
E066 pYES1 This study
E068 pYES2 This study
E088 pGEM-YES1 This study
E120 pGEM-ScRAD51 This study
E150
pRS-AsTEF1p-ScRAD51-HYG3-GEN3
This study
E160
pRS-AsoTEF1p-ScRAD51-HYG3-LEU2
This study
Table 3. Primers used in this study.
Primer Number Primer Name Sequence 5030*
106 50-AsTEF1p GTCCAGAATAACATCAAATC
107 30-AsTEF1p CTATAAAAAATGTTAGTATGGAG
108 50-AsTEFp-pRS CGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTG
CTCGAGTCCAGAATAACATCAAATC
109 30-AsTEFp-lacZ CAATCTTTGGATCGTTTAAATAAGTTTGAATTTTTTCAGTCATGTTC
TATAAAAAATGTTAGTATGGAG
226 P3-pRS415-AsTEF1p
TGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATA
GGAAGCTTCGTACGCTGCAGGTCGGATCCCCCGGGGGCGCGCCGT
CCAGAATAACATCAAATC
227 P4-AsTEF1p-kanR GTTGGAGTTCAAACGTGGTCTGGAAACGTGAGTCTTTTCCTTACCC
TATAAAAAATGTTAGTATGGAG
228 P5-kan-ORF GGTAAGGAAAAGACTCACGTTTCCA
229 P6-kanR-pRS415 GGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCT
TCTGATATCATCGATGAATTCGAGCTCGTTTAAACATTGGTAATAG
230 P7-50-HYG3 CTGACTTTTGTCTTGTTATGGACTCCATACTAACATTTTTTATAGAA
AAAACCAGAATTGACTGCTACTTC
231 P8-30-HYG3 CTGATATCATCGATGAATTCGAGCTCGTTTAAACATTGGTAATAGG
ACCACCTTTGATTGTAAATAG
253 5-HYG3+AD GGCGCGCCAGATCTAGCCTCCTCAGAGAAAATTGCACAAAAAAA
AGGAAGCTTCGTACGCTGCAGGTC
254 3-HYG3+AD TTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGC
TGACCACCTTTGATTGTAAATAG
258 5-ScRAD51+AD CTGACTTTTGTCTTGTTATGGACTCCATACTAACATTTTTTATAGTC
TCAAGTTCAAGAACAACATATATCAG
259 3-ScRAD51+AD CTTTTTTTTGTGCAATTTTCTCTGAGGAGGCTAGATCTGGCGCGCCG
AAAAATACATATATTTCATGGGTGACAG
260 5-ScRAD51 TCTCAAGTTCAAGAACAACATATATCAG
261 3-ScRAD51 GAAAAATACATATATTTCATGGGTGACAG
344 S1-LEU2 GGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAG
TAAAGTGCAATTCTTTTTCC
345 S2-LEU2 CTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCG
GTCGAGGAGAACTTC
Microorganisms 2019,7, 192 4 of 12
Table 3. Cont.
Primer Number Primer Name Sequence 5030*
355 G2-YES1 GAATGAATCTACTGGTTTGG
356 G3-YES1 GTGTCGGTATCGCAGAC
369 S1-ADE2 CCTACTATAACATTCAAGAAAAACAAGAAAACCGGACAAAACAA
TCAAGTGTCCAGAATAACATCAAATC
371 S2-ADE2 TATATCATTTTATATTATTTGCTGTGCAAGTATATCAATAAACTTAT
ATATAATAAATTATTTTTATTGTTG
373 G1-ADE2 GACTCTTGTTGCAGGGCT
389 G4-ADE2 GTGATGCATTGAGCCGCC
390 S1-HSP104 TATATTACTGATTCTTGTTCGAAAGTTTTTAAAAATCACACTATATT
AAAGTCCAGAATAACATCAAATC
391 S2-HSP104 AACAAAGAAAAAAGAAATCAACTACACGTACCATAAAATATACA
GAATATTAATAAATTATTTTTATTGTTG
392 G1-HSP104 CCCGTATTCTAATAATGGACC
393 G4-HSP104 CAAACTTATGCAACCTGCCAG
* Underlined sequences correspond to restriction sites.
E150/pRAD51 (GEN3) was constructed by
in vivo
recombination of E065 vector backbone with
fragments carrying ScRAD51-ORF and HYG3 marker. To this end, E065 was linearized by digesting
with EcoRV/SacI, which removed most of the LacZ-ORF, and then the band was gel purified. Flanking
adaptor regions, to guide
in vivo
recombination, were added to ScRAD51-ORF and HYG3 marker
fragments using primers 258/259 and 253/254, respectively. Then BY4741 was transformed with the
two PCR products and the cut vector. In order to use a G418 resistance marker for PCR-based gene
targeting in lager yeast, the GEN3 marker in E150 was replaced by LEU2 in a PCR-based gene targeting
approach using BY4741 as a host. To this end, ScLEU2 was amplified from pRS415 with primer 344/345
by PCR and used for transformation, generating E160.
Novel synthetic marker genes YES1 and YES2 were also constructed using
in vivo
recombination in
S. cerevisiae using plasmid pRS415 as the vector backbone. YES1 and YES2 contain the AsTEF1-promoter
that controls kanamycin or hygromycin resistance gene-ORFs, respectively. For construction, pRS415
was linearized with SmaI, the AsTEF1p was amplified from E026 using primers 226/227, the kanR-ORF
was amplified with primers 228/229 and the hygR-ORF with primers 230/231 to add suitable adaptors
for homologous recombination. Vector, promoter and resistance gene ORFs were then cotransformed
in S. cerevisiae and the resulting transformants were selected on G418 or hygromycin, respectively.
All plasmids obtained by
in vivo
recombination in S. cerevisiae were verified and shuttled into E. coli for
propagation. A. schoenii promoters were used as heterologous promoters in lager yeast and S. cerevisiae.
HYG3 is a synthetic selectable marker that consists of the 694 bp A. schoenii PGK1 promoter,
the 1026 bp hygromycin resistance gene ORF and the Candida albicans URA3 terminator, which was
synthesized by GenScript (GenScript, Piscataway, NJ, USA). Promoter sequences were derived from
the A. schoenii CBS 7425 genome, which can be accessed via GenBank under accession JNFU00000000
CBS 7425 [43].
2.3. Yeast Transformation
For the transformation of S. cerevisiae, the lithium acetate/single strand DNA/polyethylene glycol
4000 protocol was used as described [
44
]. For lager yeast transformation, we adapted a protocol from
Thompson et al. [
39
]. WS34/70 was grown overnight to stationary phase in 50 mL YPD. Then the
culture was diluted to OD
600
=0.3 in 100 mL fresh YPD. Cells were harvested at mid-log growth with
OD
600
=0.7–0.8 (after approximately 3 h of incubation). The culture was centrifuged and washed
once with sterile water and resuspended in 25 mL of 0.1 M lithium acetate/10 mM dithiothreitol/10
mM TE solution (Tris HCl: EDTA =10:1) and incubated for 1 h at room temperature. The cells were
washed in 25 mL ice-cold distilled sterile water twice and once with 10 ml of ice-cold 1 M sorbitol,
then resuspended in 100
µ
L ice-cold sorbitol. A 100
µ
L aliquot of the cell suspension was used for
transformation. Transforming DNA (15
µ
L) was mixed with the cells, incubated for 5 min on ice and
electroporated with 1.8 kV in 0.2 cm cuvettes. Then, cells were resuspended in 1 ml cold sorbitol and
Microorganisms 2019,7, 192 5 of 12
transferred to a tube with 300
µ
L YPD. This suspension was incubated for 3 h at 30
C prior to plating
on selective plates that did not contain sorbitol.
2.4. Verification of Lager Yeast Transformants
The Weihenstephan strain WS34/70 was used for gene targeting experiments. Target genes were
derived from the S. cerevisiae parental subgenome. Sequences for verification primers (and also for the
S1 and S2 primers) were deduced from the genome sequence that is available at DDBJ/EMBL/GenBank
under the accession AZAA00000000. PCR-based gene targeting and diagnostic PCR were performed
as described [45].
3. Results
3.1. Design and Testing of Synthetic Marker and Reporter Genes
We were interested in developing novel synthetic marker and reporter genes for dual use in
non-conventional yeasts, including lager yeasts and S. cerevisiae. To this end, we tested heterologous
promoters derived from Arthroascus schoenii (Saccharomycopsis schoenii). Saccharomycopsis species are
non-conventional yeasts used in diverse brewing settings, e.g., to generate nuruk [
46
,
47
]. We recently
obtained several Saccharomycopsis genome sequences including that of A. schoenii [
43
]. Here we
fused the AsTEF1 promoter with the LacZ reporter gene derived from Streptococcus thermophilus [
48
].
Additionally, we generated a completely new synthetic marker gene based on the AsPGK1 promoter
controlling a hygromycin resistance gene ORF. Both genes were introduced into BY4741 on episomal
CEN6/ARSH4 plasmids (Figure 1). The functionality of both the synthetic marker and the reporter
were demonstrated
in vivo
in S. cerevisiae:HYG3 was functional as we obtained hygromycin-resistant
transformants that carried the plasmids, and the LacZ reporter was active as transformants were able
to convert colorless X-Gal into a blue dye (Figure 1B). This indicates that both A. schoenii promoters
derived from AsTEF1 and AsPGK1 were functional in the heterologous host S. cerevisiae and we thus
went on to employ these genes in lager yeast.
3.2. Transformation of Lager Yeast
Previous analyses already indicated that lager yeasts’ transformation eciency is drastically lower
than that of S. cerevisiae. In S. cerevisiae lithium acetate/ss DNA/PEG protocols are commonly used [
44
].
We compared this standard protocol with modified versions, which were developed to deal with
yeast strains that are non-responsive to standard lithium acetate or electroporation protocols [
39
,
40
].
Our modified protocol included parts of both protocols: a lithium acetate treatment (without DMSO)
and an electroporation step (Li-Ac/Ep). To allow time for the expression of the antibiotic resistance
genes used in this study, we incubated the cell suspensions after electroporation in an osmotically
stabilized medium before plating on selective plates. To compare both protocols, we employed a freely
replicating plasmid (E160) with HYG3 as the selectable marker.
In our hands, the lithium acetate/ss DNA/PEG protocol (with DMSO) yielded only a few
transformants per
µ
g of DNA, demonstrating the poor transformation eciency of lager yeast with
this method, even after lowering the temperature of the heat shock step at 40
C, which we tested as
lager yeasts are known to be temperature sensitive and do not grow at elevated temperatures above
34
C. The Li-Ac/Ep protocol, however, resulted in much higher transformation eciencies (1–2 orders
of magnitude, Figure 2).
Microorganisms 2019,7, 192 6 of 12
Microorganisms 2019, 7, x FOR PEER REVIEW 5 of 12
For the transformation of S. cerevisiae, the lithium acetate/single strand DNA/polyethylene glycol 124
4000 protocol was used as described [44]. For lager yeast transformation, we adapted a protocol from 125
Thompson et al. [39]. WS34/70 was grown overnight to stationary phase in 50 mL YPD. Then the 126
culture was diluted to OD600 = 0.3 in 100 mL fresh YPD. Cells were harvested at mid-log growth with 127
OD600 = 0.7–0.8 (after approximately 3 h of incubation). The culture was centrifuged and washed once 128
with sterile water and resuspended in 25 mL of 0.1 M lithium acetate/10 mM dithiothreitol/10 mM 129
TE solution (Tris HCl: EDTA = 10:1) and incubated for 1 h at room temperature. The cells were 130
washed in 25 mL ice-cold distilled sterile water twice and once with 10 ml of ice-cold 1 M sorbitol, 131
then resuspended in 100 µL ice-cold sorbitol. A 100 µL aliquot of the cell suspension was used for 132
transformation. Transforming DNA (15 µL) was mixed with the cells, incubated for 5 min on ice and 133
electroporated with 1.8 kV in 0.2 cm cuvettes. Then, cells were resuspended in 1 ml cold sorbitol and 134
transferred to a tube with 300 µL YPD. This suspension was incubated for 3 h at 30 °C prior to plating 135
on selective plates that did not contain sorbitol. 136
2.4. Verification of Lager Yeast Transformants 137
The Weihenstephan strain WS34/70 was used for gene targeting experiments. Target genes were 138
derived from the S. cerevisiae parental subgenome. Sequences for verification primers (and also for 139
the S1 and S2 primers) were deduced from the genome sequence that is available at 140
DDBJ/EMBL/GenBank under the accession AZAA00000000. PCR-based gene targeting and 141
diagnostic PCR were performed as described [45]. 142
3. Results 143
3.1. Design and Testing of Synthetic Marker and Reporter Genes 144
We were interested in developing novel synthetic marker and reporter genes for dual use in non-145
conventional yeasts, including lager yeasts and S. cerevisiae. To this end, we tested heterologous 146
promoters derived from Arthroascus schoenii (Saccharomycopsis schoenii). Saccharomycopsis species are 147
non-conventional yeasts used in diverse brewing settings, e.g., to generate nuruk [46,47]. We recently 148
obtained several Saccharomycopsis genome sequences including that of A. schoenii [43]. Here we fused 149
the AsTEF1 promoter with the LacZ reporter gene derived from Streptococcus thermophilus [48]. 150
Additionally, we generated a completely new synthetic marker gene based on the AsPGK1 promoter 151
controlling a hygromycin resistance gene ORF. Both genes were introduced into BY4741 on episomal 152
CEN6/ARSH4 plasmids (Figure 1). The functionality of both the synthetic marker and the reporter 153
were demonstrated in vivo in S. cerevisiae: HYG3 was functional as we obtained hygromycin-resistant 154
transformants that carried the plasmids, and the LacZ reporter was active as transformants were able 155
to convert colorless X-Gal into a blue dye (Figure 1B). This indicates that both A. schoenii promoters 156
derived from AsTEF1 and AsPGK1 were functional in the heterologous host S. cerevisiae and we thus 157
went on to employ these genes in lager yeast. 158
159
Figure 1.
Generating heterologous synthetic marker and reporter genes. (
A
) Linear maps of
pRS-AsTEF1p-LacZ and pRS-AsTEF1p-ScRAD51-HYG3 plasmids. (
B
) The AsTEF1p-LacZ reporter gene
and the HYG3 resistance marker were tested in Saccharomyces cerevisiae BY4741. The presence of an
active
β
-galactosidase was detected by adding X-Gal to the centre of the transformation plate (left panel,
circle indicates the area of X-Gal application). The presence and function of the HYG3 marker was
tested by transforming S. cerevisiae with pRS-AsTEF1p-ScRAD51-HYG3 and selecting the transformants
in the presence of 100 µg/mL of hygromycin (right).
Microorganisms 2019, 7, x FOR PEER REVIEW 6 of 12
Figure 1. Generating heterologous synthetic marker and reporter genes. (A) Linear maps of pRS-160
AsTEF1p-LacZ and pRS-AsTEF1p-ScRAD51-HYG3 plasmids. (B) The AsTEF1p-LacZ reporter gene 161
and the HYG3 resistance marker were tested in Saccharomyces cerevisiae BY4741. The presence of an 162
active β-galactosidase was detected by adding X-Gal to the centre of the transformation plate (left 163
panel, circle indicates the area of X-Gal application). The presence and function of the HYG3 marker 164
was tested by transforming S. cerevisiae with pRS-AsTEF1p-ScRAD51-HYG3 and selecting the 165
transformants in the presence of 100 µg/mL of hygromycin (right). 166
3.2. Transformation of Lager Yeast 167
Previous analyses already indicated that lager yeasts’ transformation efficiency is drastically 168
lower than that of S. cerevisiae. In S. cerevisiae lithium acetate/ss DNA/PEG protocols are commonly 169
used [44]. We compared this standard protocol with modified versions, which were developed to 170
deal with yeast strains that are non-responsive to standard lithium acetate or electroporation 171
protocols [39,40]. Our modified protocol included parts of both protocols: a lithium acetate treatment 172
(without DMSO) and an electroporation step (Li-Ac/Ep). To allow time for the expression of the 173
antibiotic resistance genes used in this study, we incubated the cell suspensions after electroporation 174
in an osmotically stabilized medium before plating on selective plates. To compare both protocols, 175
we employed a freely replicating plasmid (E160) with HYG3 as the selectable marker. 176
In our hands, the lithium acetate/ss DNA/PEG protocol (with DMSO) yielded only a few 177
transformants per µg of DNA, demonstrating the poor transformation efficiency of lager yeast with 178
this method, even after lowering the temperature of the heat shock step at 40 °C, which we tested as 179
lager yeasts are known to be temperature sensitive and do not grow at elevated temperatures above 180
34 °C. The Li-Ac/Ep protocol, however, resulted in much higher transformation efficiencies (1–2 181
orders of magnitude, Figure 2). 182
183
Figure 2. Comparison of two transformation methods in the Weihenstephan lager yeast strain WS 34/70. 184
(A,C) A lithium-acetate/single strand DNA/polyethylene glycol (Li-Ac/ssDNA/PEG) and (B,D) a 185
LiAc/PEG incubation combined with electroporation (Li-Ac/Ep) were used with two different 186
antibiotic concentrations for the selection of transformants. The transformation of WS 34/70 with a 187
Figure 2.
Comparison of two transformation methods in the Weihenstephan lager yeast strain WS
34/70. (
A
,
C
) A lithium-acetate/single strand DNA/polyethylene glycol (Li-Ac/ssDNA/PEG) and
(
B
,
D
) a LiAc/PEG incubation combined with electroporation (Li-Ac/Ep) were used with two dierent
antibiotic concentrations for the selection of transformants. The transformation of WS 34/70 with a
freely replicative plasmid carrying a hygromycin resistance marker (pRS-AsTEF1p-ScRAD51-HYG3)
yielded few transformants when using the Li-ac/ssDNA/PEG method (
A
,
C
). By contrast, the Li-Ac/Ep
method together with antibiotic selection at 100
µ
g/mL final concentration (
D
), resulted in a higher
transformation eciency compared to the other combinations (AC).
Microorganisms 2019,7, 192 7 of 12
3.3. PCR-Based Gene Targeting is Enhanced by RAD51 Overexpression
Plasmid transformation is regularly far more ecient than integrative transformation. PCR-based
gene targeting approaches are convenient because in one PCR reaction short-flanking homology regions
can be added to a selection marker. We used standard S1 and S2 primers that added 50 bases of flanking
homology region. However, in our hands, we failed to obtain stable lager yeast transformants with these
PCR-based disruption cassettes, even when using the Li-Ac/Epo protocol (Figure 3A). After prolonged
incubation on selective plates (>2d) small colonies may appear. However, these colonies did not
continue to grow upon restreaking on new selective plates or in selective liquid media and represent
background growth (Figure 3B). In contrast, the transformation of a Weihenstephan lager yeast strain that
harbors a plasmid-encoded ScRAD51 expressed from a strong TEF promoter yielded a large number
of transformants on primary selective plates using disruption cassettes for ScHSP104 (Figure 3C).
A randomly selected set of colonies continued to grow upon restreaking and also grew well in liquid
YPD supplemented with hygromycin (Figure 3D and data not shown).
Figure 3.
PCR-based gene targeting in lager yeast. The Weihenstephan strain WS34/70 carrying either
an empty vector (pHYG3;
A
) or a RAD51 plasmid (pRAD51,
C
) was transformed with disruption
cassettes containing the YES1 marker harboring 50 bp of flanking homology regions for targeting to
the ScHSP104 locus. We used a Li-Ac/Ep transformation protocol and selected transformants on YPD
plates supplemented with hygromycin and G418 (100
µ
g/mL final concentration each). Restreaking
of putative transformant colonies on new selective plates indicated stable transformants were only
obtained in the lager yeast strain overexpressing pRAD51 (B,D).
Verification of these transformants that grew upon restreaking and growth in liquid culture was
done by standard diagnostic PCR, amplifying the novel joints at the borders of marker integration [
45
].
This confirmed targeted gene disruption (Figure 4). Overall, between 60–75% of primary transformants
could be cultivated further in a liquid culture, and all for all of those diagnostic PCRs indicated
correct integration of the marker cassette at the target locus (n>20). However, we did not obtain any
Microorganisms 2019,7, 192 8 of 12
transformants in the same strain without the overexpression of ScRAD51, demonstrating the usefulness
of this approach. To verify that the marker integration and PCR-based gene targeting success was
not solely locus dependent, we targeted a second gene, ScADE2, in the same manner. Transformation
eciencies were found to be similar for both loci and diagnostic PCR was successfully employed for
the verification of the deletion of an ADE2 allele (Figure 4C).
Microorganisms 2019, 7, x FOR PEER REVIEW 8 of 12
plates supplemented with hygromycin and G418 (100 µg/mL final concentration each). Restreaking 211
of putative transformant colonies on new selective plates indicated stable transformants were only 212
obtained in the lager yeast strain overexpressing pRAD51 (B,D). 213
Verification of these transformants that grew upon restreaking and growth in liquid culture was 214
done by standard diagnostic PCR, amplifying the novel joints at the borders of marker integration 215
[45]. This confirmed targeted gene disruption (Figure 4). Overall, between 60%–75% of primary 216
transformants could be cultivated further in a liquid culture, and all for all of those diagnostic PCRs 217
indicated correct integration of the marker cassette at the target locus (n > 20). However, we did not 218
obtain any transformants in the same strain without the overexpression of ScRAD51, demonstrating 219
the usefulness of this approach. To verify that the marker integration and PCR-based gene targeting 220
success was not solely locus dependent, we targeted a second gene, ScADE2, in the same manner. 221
Transformation efficiencies were found to be similar for both loci and diagnostic PCR was 222
successfully employed for the verification of the deletion of an ADE2 allele (Figure 4C). 223
224
Figure 4. Diagnostic PCR for verification of correct marker integration. (A) Schematic presentation of 225
PCR-based gene targeting of YES1 amplified with gene specific S1/S2-primers adding 50 bp of target 226
homology region (orange bars) to ScHSP104 or ScADE2, respectively. Diagnostic G1/G2 and G3/G4 227
primers were used for verification of the correct insertion of YES1 and removal of the Sc HSP104 (B) 228
and Sc ADE2 locus (C) ORFs. 229
4. Discussion 230
Lager yeasts are the workhorses of the beer industry. Detailed strain characterizations and 231
molecular genetics-assisted yeast breeding, however, are hampered by the lack of proof-of-concept 232
technologies. A major obstacle in lager yeast research is the surprisingly inefficient gene targeting in 233
lager yeast. Thus, there are only a few reports of the successful molecular genetic manipulation of 234
lager yeast relying on HR [13–15]. There are other issues beyond the mere technical difficulties. 235
Primarily, these are complicated by the hybrid nature of lager yeast. Lager yeasts are allopolyploid 236
hybrids between S. cerevisiae and S. eubayanus parents [9]. Group I/Saaz strains are triploid, while 237
Group II/Frohberg strains, to which Weihenstephan 34/70 belongs, are tetraploid [2]. Additionally, 238
aneuploidies could further change allele frequencies, complicating gene knockout experiments. 239
Secondly, due to the hybrid nature, sporulation is severely crippled due to failure to proceed through 240
meiotic divisions, resulting in hybrid sterility, which is more pronounced in triploid Group I strains 241
than in tetraploid Group II strains [49,50]. Thirdly, even though lager yeasts are the workhorses of 242
Figure 4.
Diagnostic PCR for verification of correct marker integration. (
A
) Schematic presentation of
PCR-based gene targeting of YES1 amplified with gene specific S1/S2-primers adding 50 bp of target
homology region (orange bars) to ScHSP104 or ScADE2, respectively. Diagnostic G1/G2 and G3/G4
primers were used for verification of the correct insertion of YES1 and removal of the Sc HSP104 (
B
)
and Sc ADE2 locus (C) ORFs.
4. Discussion
Lager yeasts are the workhorses of the beer industry. Detailed strain characterizations and
molecular genetics-assisted yeast breeding, however, are hampered by the lack of proof-of-concept
technologies. A major obstacle in lager yeast research is the surprisingly inecient gene targeting in
lager yeast. Thus, there are only a few reports of the successful molecular genetic manipulation of lager
yeast relying on HR [
13
15
]. There are other issues beyond the mere technical diculties. Primarily,
these are complicated by the hybrid nature of lager yeast. Lager yeasts are allopolyploid hybrids
between S. cerevisiae and S. eubayanus parents [
9
]. Group I/Saaz strains are triploid, while Group
II/Frohberg strains, to which Weihenstephan 34/70 belongs, are tetraploid [
2
]. Additionally, aneuploidies
could further change allele frequencies, complicating gene knockout experiments. Secondly, due to the
hybrid nature, sporulation is severely crippled due to failure to proceed through meiotic divisions,
resulting in hybrid sterility, which is more pronounced in triploid Group I strains than in tetraploid
Group II strains [
49
,
50
]. Thirdly, even though lager yeasts are the workhorses of the beer industry, there
is a reluctance to employ genetically modified yeast strains, a notion that has rather been strengthened
over recent years.
In addition to their industrial importance, lager yeast hybrids present excellent model systems to
study hybrid biology, including hybrid vigor, hybrid sterility, adaptive evolution and the analysis of
hybrid protein complexes [
51
,
52
]. Major advances in hybrid yeast breeding resolved the F1-sterility
problem represented in lager yeast [53].
Microorganisms 2019,7, 192 9 of 12
Our study indicates that RAD51 overexpression in lager yeast opens the tool-box for all genetic
manipulation previously only available in S. cerevisiae. Although transformation eciencies in lager
yeasts are far lower than in S. cerevisiae, rational strain design based on targeted gene replacements has
become feasible. We have successfully employed this strategy already to other loci, suggesting that
potential locus dependent variations in gene targeting are not inhibitory to successful gene targeting.
Furthermore, by selecting specific homology regions, even closely related alleles of the S. cerevisiae
and S. eubayanus parental genomes can be distinguished. The overexpression of RAD51 has been
shown to improve HR in other systems, so it may also be advantageous in other non-conventional
yeasts in which molecular genetic studies are hampered by the preferential ectopic integration of gene
targeting cassettes.
Two additional advances to improve HR in resilient strains in recent years include the use of Ku70
mutant strains and the establishment of CRISPR/Cas9 methodologies [
12
]. Deletion of Ku70 inactivates
the NHEJ pathway, thus favouring HR and targeted gene alterations [
33
]. However,
in S. cerevisiae
,
the deletion of Ku70 has been shown to generate defects in telomere maintenance and cell cycle
regulation [
54
,
55
]. Thus, this may not be favorable in lager yeast as breeding eorts to restore a
wildtype Ku70 status after genetic engineering are also quite laborious.
Recent reports established CRISPR/Cas9 in lager yeast, making this a promising tool for strain
engineering [
12
,
56
]. CRISPR/Cas9 will be particularly useful for simultaneous alterations of multiple
alleles in a single step, even more so when the number of alleles may vary due to aneuploidies. In a
recent report, simultaneous single and double deletions of SeATF1 and SeATF2 were performed in lager
yeast, demonstrating the power of this tool [
12
]. It will be interesting to see if a combined approach,
overexpressing RAD51 and the use of CRISPR/Cas9, will further improve gene replacement eciencies.
Author Contributions:
The authors of this paper contributed in the following way: Conceptualization, J.W. and
B.B.; methodology, B.B., Y.K., M.A. and J.W.; validation, B.B., Y.K. and M.A.; investigation, B.B., Y.K., M.A., and J.W.;
data curation, B.B. and Y.K.; writing—original draft preparation, B.B. and J.W.; writing—review and editing, B.B.,
Y.K., M.A. and J.W.
Funding:
This research was supported by the European Union Marie Skłodowska-Curie Actions Innovative
Training Network Aromagenesis (764364) (https://www.aromagenesis.eu/).
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Hansen, E.C. Grundlagen zur Systematik der Saccharomyceten. Zentralbl. Bakteriol. II Natur.
1904
,12,
529–538.
2.
Walther, A.; Hesselbart, A.; Wendland, J. Genome sequence of Saccharomyces carlsbergensis, the world’s
first pure culture lager yeast. G3 Genes Genomes Genet. 2014,4, 783–793. [CrossRef] [PubMed]
3. Wendland, J. Lager yeast comes of age. Eukaryot. Cell 2014,13, 1256–1265. [CrossRef] [PubMed]
4.
Baker, E.; Wang, B.; Bellora, N.; Peris, D.; Hulfachor, A.B.; Koshalek, J.A.; Adams, M.; Libkind, D.;
Hittinger, C.T. The Genome Sequence of Saccharomyces eubayanus and the Domestication of Lager-Brewing
Yeasts. Mol. Biol. Evol. 2015,32, 2818–2831. [CrossRef] [PubMed]
5.
Gibson, B.; Liti, G. Saccharomyces pastorianus: Genomic insights inspiring innovation for industry. Yeast
2015,32, 17–27. [CrossRef] [PubMed]
6.
Okuno, M.; Kajitani, R.; Ryusui, R.; Morimoto, H.; Kodama, Y.; Itoh, T. Next-generation sequencing analysis
of lager brewing yeast strains reveals the evolutionary history of interspecies hybridization. DNA Res.
2016
,
23, 67–80. [CrossRef] [PubMed]
7.
Monerawela, C.; Bond, U. Brewing up a storm: The genomes of lager yeasts and how they evolved. Biotechnol.
Adv. 2017,35, 512–519. [CrossRef]
8.
Monerawela, C.; Bond, U. The hybrid genomes of Saccharomyces pastorianus: A current perspective. Yeast
2018,35, 39–50. [CrossRef]
9.
Libkind, D.; Hittinger, C.T.; Valerio, E.; Goncalves, C.; Dover, J.; Johnston, M.; Goncalves, P.; Sampaio, J.P.
Microbe domestication and the identification of the wild genetic stock of lager-brewing yeast. Proc. Natl.
Acad. Sci. USA 2011,108, 14539–14544. [CrossRef]
Microorganisms 2019,7, 192 10 of 12
10.
Bing, J.; Han, P.J.; Liu, W.Q.; Wang, Q.M.; Bai, F.Y. Evidence for a Far East Asian origin of lager beer yeast.
Curr. Biol. 2014,24, R380–R381. [CrossRef]
11.
Baker, E.P.; Peris, D.; Moriarty, R.V.; Li, X.C.; Fay, J.C.; Hittinger, C.T. Mitochondrial DNA and temperature
tolerance in lager yeasts. Sci. Adv. 2019,5, eaav1869. [CrossRef] [PubMed]
12.
Gorter de Vries, A.R.; de Groot, P.A.; van den Broek, M.; Daran, J.G. CRISPR-Cas9 mediated gene deletions
in lager yeast Saccharomyces pastorianus. Microb. Cell Fact. 2017,16, 222. [CrossRef] [PubMed]
13.
Duong, C.T.; Strack, L.; Futschik, M.; Katou, Y.; Nakao, Y.; Fujimura, T.; Shirahige, K.; Kodama, Y.; Nevoigt, E.
Identification of Sc-type ILV6 as a target to reduce diacetyl formation in lager brewers’ yeast. Metab. Eng.
2011,13, 638–647. [CrossRef] [PubMed]
14.
Murakami, N.; Miyoshi, S.; Yokoyama, R.; Hoshida, H.; Akada, R.; Ogata, T. Construction of a URA3 deletion
strain from the allotetraploid bottom-fermenting yeast Saccharomyces pastorianus. Yeast 2012,29, 155–165.
[CrossRef] [PubMed]
15.
Bolat, I.; Romagnoli, G.; Zhu, F.; Pronk, J.T.; Daran, J.M. Functional analysis and transcriptional regulation of
two orthologs of ARO10, encoding broad-substrate-specificity 2-oxo-acid decarboxylases, in the brewing
yeast Saccharomyces pastorianus CBS1483. FEMS Yeast Res 2013,13, 505–517. [CrossRef] [PubMed]
16.
Wendland, J. PCR-based methods facilitate targeted gene manipulations and cloning procedures. Curr. Genet.
2003,44, 115–123. [CrossRef] [PubMed]
17.
Wach, A.; Brachat, A.; Pohlmann, R.; Philippsen, P. New heterologous modules for classical or PCR-based
gene disruptions in Saccharomyces cerevisiae. Yeast 1994,10, 1793–1808. [CrossRef]
18.
Wach, A.; Brachat, A.; Alberti-Segui, C.; Rebischung, C.; Philippsen, P. Heterologous HIS3 marker and GFP
reporter modules for PCR-targeting in Saccharomyces cerevisiae. Yeast 1997,13, 1065–1075. [CrossRef]
19.
Giaever, G.; Chu, A.M.; Ni, L.; Connelly, C.; Riles, L.; Veronneau, S.; Dow, S.; Lucau-Danila, A.; Anderson, K.;
Andre, B.; et al. Functional profiling of the Saccharomyces cerevisiae genome. Nature
2002
,418, 387–391.
[CrossRef]
20.
Costanzo, M.; Baryshnikova, A.; Bellay, J.; Kim, Y.; Spear, E.D.; Sevier, C.S.; Ding, H.; Koh, J.L.; Toufighi, K.;
Mostafavi, S.; et al. The genetic landscape of a cell. Science 2010,327, 425–431. [CrossRef]
21.
Costanzo, M.; VanderSluis, B.; Koch, E.N.; Baryshnikova, A.; Pons, C.; Tan, G.; Wang, W.; Usaj, M.;
Hanchard, J.; Lee, S.D.; et al. A global genetic interaction network maps a wiring diagram of cellular function.
Science 2016,353, aaf1420. [CrossRef] [PubMed]
22.
Kuzmin, E.; VanderSluis, B.; Wang, W.; Tan, G.; Deshpande, R.; Chen, Y.; Usaj, M.; Balint, A.; Mattiazzi
Usaj, M.; van Leeuwen, J.; et al. Systematic analysis of complex genetic interactions. Science
2018
,360,
eaao1729. [CrossRef] [PubMed]
23.
Bahler, J.; Wu, J.Q.; Longtine, M.S.; Shah, N.G.; McKenzie, A., 3rd; Steever, A.B.; Wach, A.;
Philippsen, P.; Pringle, J.R. Heterologous modules for ecient and versatile PCR-based gene targeting in
Schizosaccharomyces pombe. Yeast 1998,14, 943–951. [CrossRef]
24.
Gerami-Nejad, M.; Berman, J.; Gale, C.A. Cassettes for PCR-mediated construction of green, yellow, and cyan
fluorescent protein fusions in Candida albicans. Yeast 2001,18, 859–864. [CrossRef] [PubMed]
25.
Gerami-Nejad, M.; Hausauer, D.; McClellan, M.; Berman, J.; Gale, C. Cassettes for the PCR-mediated
construction of regulatable alleles in Candida albicans. Yeast 2004,21, 429–436. [CrossRef] [PubMed]
26.
Gerami-Nejad, M.; Dulmage, K.; Berman, J. Additional cassettes for epitope and fluorescent fusion proteins
in Candida albicans. Yeast 2009,26, 399–406. [CrossRef]
27.
Gola, S.; Martin, R.; Walther, A.; Dunkler, A.; Wendland, J. New modules for PCR-based gene targeting in
Candida albicans: Rapid and ecient gene targeting using 100 bp of flanking homology region. Yeast
2003
,
20, 1339–1347. [CrossRef]
28.
Wendland, J.; Ayad-Durieux, Y.; Knechtle, P.; Rebischung, C.; Philippsen, P. PCR-based gene targeting in the
filamentous fungus Ashbya gossypii. Gene 2000,242, 381–391. [CrossRef]
29.
Amelina, H.; Moiseeva, V.; Collopy, L.C.; Pearson, S.R.; Armstrong, C.A.; Tomita, K. Sequential and
counter-selectable cassettes for fission yeast. BMC Biotechnol. 2016,16, 76. [CrossRef]
30. Kooistra, R.; Hooykaas, P.J.; Steensma, H.Y. Ecient gene targeting in Kluyveromyces lactis. Yeast 2004,21,
781–792. [CrossRef]
Microorganisms 2019,7, 192 11 of 12
31.
Wesolowski-Louvel, M. An ecient method to optimize Kluyveromyces lactis gene targeting. FEMS Yeast
Res. 2011,11, 509–513. [CrossRef] [PubMed]
32.
Kretzschmar, A.; Otto, C.; Holz, M.; Werner, S.; Hubner, L.; Barth, G. Increased homologous integration
frequency in Yarrowia lipolytica strains defective in non-homologous end-joining. Curr. Genet.
2013
,59,
63–72. [CrossRef] [PubMed]
33.
Ninomiya, Y.; Suzuki, K.; Ishii, C.; Inoue, H. Highly ecient gene replacements in Neurospora strains
deficient for nonhomologous end-joining. Proc. Natl. Acad. Sci. USA
2004
,101, 12248–12253. [CrossRef]
[PubMed]
34.
Sidhu, Y.S.; Cairns, T.C.; Chaudhari, Y.K.; Usher, J.; Talbot, N.J.; Studholme, D.J.; Csukai, M.; Haynes, K.
Exploitation of sulfonylurea resistance marker and non-homologous end joining mutants for functional
analysis in Zymoseptoria tritici. Fungal Genet. Biol. 2015,79, 102–109. [CrossRef] [PubMed]
35.
Arras, S.D.; Fraser, J.A. Chemical Inhibitors of Non-Homologous End Joining Increase Targeted Construct
Integration in Cryptococcus neoformans. PLoS ONE 2016,11, e0163049. [CrossRef] [PubMed]
36.
Yanez, R.J.; Porter, A.C. Gene targeting is enhanced in human cells overexpressing hRAD51. Gene Ther.
1999
,
6, 1282–1290. [CrossRef] [PubMed]
37.
Shcherbakova, O.G.; Lanzov, V.A.; Ogawa, H.; Filatov, M.V. Overexpression of bacterial RecA protein
stimulates homologous recombination in somatic mammalian cells. Mutat. Res.
2000
,459, 65–71. [CrossRef]
38.
Liu, L.; Maguire, K.K.; Kmiec, E.B. Genetic re-engineering of Saccharomyces cerevisiae RAD51 leads to a
significant increase in the frequency of gene repair
in vivo
.Nucleic Acids Res.
2004
,32, 2093–2101. [CrossRef]
39.
Thompson, J.R.; Register, E.; Curotto, J.; Kurtz, M.; Kelly, R. An improved protocol for the preparation of
yeast cells for transformation by electroporation. Yeast 1998,14, 565–571. [CrossRef]
40.
Suga, M.; Hatakeyama, T. High eciency transformation of Schizosaccharomyces pombe pretreated with
thiol compounds by electroporation. Yeast 2001,18, 1015–1021. [CrossRef]
41.
Sikorski, R.S.; Hieter, P. A system of shuttle vectors and yeast host strains designed for ecient manipulation
of DNA in Saccharomyces cerevisiae. Genetics 1989,122, 19–27. [PubMed]
42.
Dunkler, A.; Wendland, J. Use of MET3 promoters for regulated gene expression in Ashbya gossypii.
Curr. Genet. 2007,52, 1–10. [CrossRef] [PubMed]
43.
Junker, K.; Chailyan, A.; Hesselbart, A.; Forster, J.; Wendland, J. Multi-omics characterization of the
necrotrophic mycoparasite Saccharomycopsis schoenii. PLoS Pathog. 2019, in press. [CrossRef] [PubMed]
44.
Gietz, R.D.; Schiestl, R.H. High-eciency yeast transformation using the LiAc/SS carrier DNA/PEG method.
Nat. Protoc. 2007,2, 31–34. [CrossRef] [PubMed]
45.
Walther, A.; Wendland, J. PCR-based gene targeting in Candida albicans. Nat. Protoc.
2008
,3, 1414–1421.
[CrossRef] [PubMed]
46.
Carroll, E.; Trinh, T.N.; Son, H.; Lee, Y.W.; Seo, J.A. Comprehensive analysis of fungal diversity and enzyme
activity in nuruk, a Korean fermenting starter, for acquiring useful fungi. J. Microbiol.
2017
,55, 357–365.
[CrossRef] [PubMed]
47.
Farh, M.E.; Cho, Y.; Lim, J.Y.; Seo, J.A. A diversity study of Saccharomycopsis fibuligera in rice wine starter
nuruk, reveals the evolutionary process associated with its interspecies hybrid. J. Microbiol.
2017
,55, 337–343.
[CrossRef] [PubMed]
48.
Uhl, M.A.; Johnson, A.D. Development of Streptococcus thermophilus lacZ as a reporter gene for Candida
albicans. Microbiology 2001,147, 1189–1195. [CrossRef] [PubMed]
49. Greig, D. Reproductive isolation in Saccharomyces. Heredity 2009,102, 39–44. [CrossRef]
50.
Sipiczki, M. Yeast two- and three-species hybrids and high-sugar fermentation. Microb. Biotechnol.
2019
.
[CrossRef] [PubMed]
51.
Leducq, J.B.; Charron, G.; Diss, G.; Gagnon-Arsenault, I.; Dube, A.K.; Landry, C.R. Evidence for the robustness
of protein complexes to inter-species hybridization. PLoS Genet. 2012,8, e1003161. [CrossRef]
52.
Piatkowska, E.M.; Naseeb, S.; Knight, D.; Delneri, D. Chimeric protein complexes in hybrid species generate
novel phenotypes. PLoS Genet. 2013,9, e1003836. [CrossRef]
53.
Pfliegler, W.P.; Antunovics, Z.; Sipiczki, M. Double sterility barrier between Saccharomyces species and its
breakdown in allopolyploid hybrids by chromosome loss. FEMS Yeast Res 2012,12, 703–718. [CrossRef]
54.
Barnes, G.; Rio, D. DNA double-strand-break sensitivity, DNA replication, and cell cycle arrest phenotypes
of Ku-deficient Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 1997,94, 867–872. [CrossRef]
Microorganisms 2019,7, 192 12 of 12
55.
Polotnianka, R.M.; Li, J.; Lustig, A.J. The yeast Ku heterodimer is essential for protection of the telomere
against nucleolytic and recombinational activities. Curr. Biol. 1998,8, 831–834. [CrossRef]
56.
Mertens, S.; Gallone, B.; Steensels, J.; Herrera-Malaver, B.; Cortebeek, J.; Nolmans, R.; Saels, V.; Vyas, V.K.;
Verstrepen, K.J. Reducing phenolic o-flavors through CRISPR-based gene editing of the FDC1 gene in
Saccharomyces cerevisiae x Saccharomyces eubayanus hybrid lager beer yeasts. PLoS ONE
2019
,14, e0209124.
[CrossRef]
©
2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
... Although both methods yielded transformants, electroporation yielded more transformants. The specific electroporation protocol used, involved a sensitising step with lithium acetate [43]. We constructed selection cassettes containing the resistance markers for hygromycin (hph), geneticin (neoR), nourseothricin (clonNAT, natI), and zeocin (Sh Ble), commonly used for yeasts. ...
... The transformation of S. cerevisiae was done according to the lithium acetate/single strand DNA/polyethylene glycol 4000 protocol described by Gietz and Schiestl [57]. For transformation of H. uvarum DSM2768, an adaption of the protocols described by Thompson et al. [58] and Bernardi et al. [43] was used. H. uvarum DSM2768 was grown overnight in 5 mL YPD at 30 • C. ...
Article
Full-text available
Apiculate yeasts belonging to the genus Hanseniaspora are commonly isolated from viticultural settings and often dominate the initial stages of grape must fermentations. Although considered spoilage yeasts, they are now increasingly becoming the focus of research, with several whole-genome sequencing studies published in recent years. However, tools for their molecular genetic manipulation are still lacking. Here, we report the development of a tool for the genetic modification of Hanseniaspora uvarum. This was employed for the disruption of the HuATF1 gene, which encodes a putative alcohol acetyltransferase involved in acetate ester formation. We generated a synthetic marker gene consisting of the HuTEF1 promoter controlling a hygromycin resistance open reading frame (ORF). This new marker gene was used in disruption cassettes containing long-flanking (1000 bp) homology regions to the target locus. By increasing the antibiotic concentration, transformants were obtained in which both alleles of the putative HuATF1 gene were deleted in a diploid H. uvarum strain. Phenotypic characterisation including fermentation in Müller-Thurgau must showed that the null mutant produced significantly less acetate ester, particularly ethyl acetate. This study marks the first steps in the development of gene modification tools and paves the road for functional gene analyses of this yeast.
... Polymerase Chain Reaction (PCR) analysis has been proven having high accuracy and using in various purposes, including for disease diagnosis (Cherpillod et al 2016), forensic (Widodo at al 2018), genetic engineering (Bernardi et al 2019) and others. Before the PCR analysis, DNA must be separated from cells through DNA extraction. ...
Article
Full-text available
This study aimed to detect Escherichia coli directly without DNA extraction. The nucleus membrane and cell membranes of the Escherichia coli are composed of a phospholipid bilayer, damaged if heated at 950C. Pre-denaturation and denaturation of PCR were carried out at 950C. The two stages are thought to break down the Escherichia coli cells, so that the DNA that comes out of the cells can directly become a template in the PCR analysis. In this study, PCR analysis was carried out using Escherichia coli culture, Escherichia coli bacteria culture incubated at 950C, and Escherichia coli bacteria cultures incubated at 650C + on ice as templates. The results showed that PCR analysis using Escherichia coli culture directly and Escherichia coli culture incubated at 650C + on ice as templates produced very thin DNA bands with a size of 580 bp. while PCR analysis using Escherichia coli bacteria culture incubated at 950C as a template produced thick DNA bands with a size of 580 bp. This study's results are very useful for saving time and costs in the detection of Escherichia coli bacteria. The sample to be tested does not need DNA isolation as usual, but only needs to be incubated at 950C for 10 minutes.
... This seems contradictory but may be due to the polyploidy/aneuploidy of these strains. Overexpression of RAD51, which encodes a key role enzyme of the strand-invasion step or HR (see Figure 2), helped to improve this situation allowing genome edits of these strains [56]. The high in vivo recombination efficiency of S. cerevisiae is also used for in vivo cloning, which is advantageous over cloning via restriction endonucleases and ligation as it works seamlessly without the need to introduce foreign restriction sites to a sequence [57]. ...
Article
Full-text available
The fermentation industry is known to be very conservative, relying on traditional yeast management. Yet, in the modern fast-paced world, change comes about in facets such as climate change altering the quality and quantity of harvests, changes due to government regulations e.g., the use of pesticides or SO2, the need to become more sustainable, and of course by changes in consumer preferences. As a silent companion of the fermentation industry, the wine yeast Saccharomyces cerevisiae has followed mankind through millennia, changing from a Kulturfolger, into a domesticated species for the production of bread, beer, and wine and further on into a platform strain for the production of biofuels, enzymes, flavors, or pharmaceuticals. This success story is based on the ‘awesome power of yeast genetics’. Central to this is the very efficient homologous recombination (HR) machinery of S. cerevisiae that allows highly-specific genome edits. This microsurgery tool is so reliable that yeast has put a generally recognized as safe (GRAS) label onto itself and entrusted to itself the life-changing decision of mating type-switching. Later, yeast became its own genome editor, interpreted as domestication events, to adapt to harsh fermentation conditions. In biotechnology, yeast HR has been used with tremendous success over the last 40 years. Here we discuss several types of yeast genome edits then focus on HR and its inherent potential for evolving novel wine yeast strains and styles relevant for changing markets.
... We have recently engineered lager yeast strains overexpressing RAD51, which was sufficient to promote PCR-based gene targeting using shortflanking homology regions. This now paves the way for accelerated gene function analyses in this economically valuable hybrid yeast strains (Bernardi et al., 2019). ...
Article
Non-conventional yeasts (NCYs), i.e. all yeasts other than Saccharomyces cerevisiae, are emerging as novel production strains and gain more and more attention to exploit their unique properties. Yet, these yeasts can hardly compete against the advanced methodology and genetic tool kit available for exploiting and engineering S. cerevisiae. Currently, for many NCYs one has to start from scratch to initiate molecular genetic manipulations, which is often time consuming and not straight-forward. More so because utilization of S. cerevisiae tools based on short-flank mediated homologous recombination or plasmid biology are not readily applicable in NCYs. Here we present a script with discrete steps that will lead to the development of a basic and expandable molecular toolkit for ascomycetous NCYs and will allow genetic engineering of novel platform strains. For toolkit development the highly efficient in vivo recombination efficiency of S. cerevisiae is utilized in the generation and initial testing of tools. The basic toolkit includes promoters, reporter genes, selectable markers based on dominant antibiotic resistance genes and the generation of long-flanking homology disruption cassettes. The advantage of having pretested molecular tools that function in a heterologous host facilitate NCY strain manipulations. We demonstrate the usefulness of this script on Saccharomycopsis schoenii, a predator yeast with useful properties in fermentation and fungal biocontrol.
Article
Full-text available
Non-conventional yeasts, i.e., the vast biodiversity beyond already well-established model systems such as Saccharomyces cerevisiae, Candida albicans and Schizosaccharomyces pombe and a few others, are a huge and untapped resource of organisms. [...]
Article
Full-text available
Pathogenic yeasts and fungi are an increasing global healthcare burden, but discovery of novel antifungal agents is slow. The mycoparasitic yeast Saccharomycopsis schoenii was recently demonstrated to be able to kill the emerging multi-drug resistant yeast pathogen Candida auris. However, the molecular mechanisms involved in the predatory activity of S. schoenii have not been explored. To this end, we de novo sequenced, assembled and annotated a draft genome of S. schoenii. Using proteomics, we confirmed that Saccharomycopsis yeasts have reassigned the CTG codon and translate CTG into serine instead of leucine. Further, we confirmed an absence of all genes from the sulfate assimilation pathway in the genome of S. schoenii, and detected the expansion of several gene families, including aspartic proteases. Using Saccharomyces cerevisiae as a model prey cell, we honed in on the timing and nutritional conditions under which S. schoenii kills prey cells. We found that a general nutrition limitation, not a specific methionine deficiency, triggered predatory activity. Nevertheless, by means of genome-wide transcriptome analysis we observed dramatic responses to methionine deprivation, which were alleviated when S. cerevisiae was available as prey, and therefore postulate that S. schoenii acquired methionine from its prey cells. During predation, both proteomic and transcriptomic analyses revealed that S. schoenii highly upregulated and translated aspartic protease genes, probably used to break down prey cell walls. With these fundamental insights into the predatory behavior of S. schoenii, we open up for further exploitation of this yeast as a biocontrol yeast and/or source for novel antifungal agents.
Article
Full-text available
The dominating strains of most sugar‐based natural and industrial fermentations either belong to Saccharomyces cerevisiae and Saccharomyces uvarum or are their chimeric derivatives. Osmotolerance is an essential trait of these strains for industrial applications in which typically high concentrations of sugars are used. As the ability of the cells to cope with the hyperosmotic stress is under polygenic control, significant improvement can be expected from concerted modification of the activity of multiple genes or from creating new genomes harbouring positive alleles of strains of two or more species. In this review, the application of the methods of intergeneric and interspecies hybridization to fitness improvement of strains used under high‐sugar fermentation conditions is discussed. By protoplast fusion and heterospecific mating, hybrids can be obtained that outperform the parental strains in certain technological parameters including osmotolerance. Spontaneous postzygotic genome evolution during mitotic propagation (GARMi) and meiosis after the breakdown of the sterility barrier by loss of MAT heterozygosity (GARMe) can be exploited for further improvement. Both processes result in derivatives of chimeric genomes, some of which can be superior both to the parental strains and to the hybrid. Three‐species hybridization represents further perspectives.
Article
Full-text available
A growing body of research suggests that the mitochondrial genome (mtDNA) is important for temperature adaptation. In the yeast genus Saccharomyces , species have diverged in temperature tolerance, driving their use in high- or low-temperature fermentations. Here, we experimentally test the role of mtDNA in temperature tolerance in synthetic and industrial hybrids ( Saccharomyces cerevisiae × Saccharomyces eubayanus or Saccharomyces pastorianus ), which cold-brew lager beer. We find that the relative temperature tolerances of hybrids correspond to the parent donating mtDNA, allowing us to modulate lager strain temperature preferences. The strong influence of mitotype on the temperature tolerance of otherwise identical hybrid strains provides support for the mitochondrial climactic adaptation hypothesis in yeasts and demonstrates how mitotype has influenced the world’s most commonly fermented beverage.
Article
Full-text available
Today’s beer market is challenged by a decreasing consumption of traditional beer styles and an increasing consumption of specialty beers. In particular, lager-type beers (pilsner), characterized by their refreshing and unique aroma and taste, yet very uniform, struggle with their sales. The development of novel variants of the common lager yeast, the interspecific hybrid Saccharomyces pastorianus, has been proposed as a possible solution to address the need of product diversification in lager beers. Previous efforts to generate new lager yeasts through hybridization of the ancestral parental species (S. cerevisiae and S. eubayanus) yielded strains with an aromatic profile distinct from the natural biodiversity. Unfortunately, next to the desired properties, these novel yeasts also inherited unwanted characteristics. Most notably is their phenolic off-flavor (POF) production, which hampers their direct application in the industrial production processes. Here, we describe a CRISPR-based gene editing strategy that allows the systematic and meticulous introduction of a natural occurring mutation in the FDC1 gene of genetically complex industrial S. cerevisiae strains, S. eubayanus yeasts and interspecific hybrids. The resulting cisgenic POF⁻ variants show great potential for industrial application and diversifying the current lager beer portfolio.
Article
Full-text available
Background The ease of use of CRISPR-Cas9 reprogramming, its high efficacy, and its multiplexing capabilities have brought this technology at the forefront of genome editing techniques. Saccharomyces pastorianus is an aneuploid interspecific hybrid of Saccharomyces cerevisiae and Saccharomyces eubayanus that has been domesticated for centuries and is used for the industrial fermentation of lager beer. For yet uncharacterised reasons, this hybrid yeast is far more resilient to genetic alteration than its ancestor S. cerevisiae. ResultsThis study reports a new CRISPR-Cas9 method for accurate gene deletion in S. pastorianus. This method combined the Streptococcus pyogenes cas9 gene expressed from either a chromosomal locus or from a mobile genetic element in combination with a plasmid-borne gRNA expression cassette. While the well-established gRNA expression system using the RNA polymerase III dependent SNR52 promoter failed, expression of a gRNA flanked with Hammerhead and Hepatitis Delta Virus ribozymes using the RNA polymerase II dependent TDH3 promoter successfully led to accurate deletion of all four alleles of the SeILV6 gene in strain CBS1483. Furthermore the expression of two ribozyme-flanked gRNAs separated by a 10-bp linker in a polycistronic array successfully led to the simultaneous deletion of SeATF1 and SeATF2, genes located on two separate chromosomes. The expression of this array resulted in the precise deletion of all five and four alleles mediated by homologous recombination in the strains CBS1483 and Weihenstephan 34/70 respectively, demonstrating the multiplexing abilities of this gRNA expression design. Conclusions These results firmly established that CRISPR-Cas9 significantly facilitates and accelerates genome editing in S. pastorianus.
Article
To systematically explore complex genetic interactions, we constructed ~200,000 yeast triple mutants and scored negative trigenic interactions. We selected double-mutant query genes across a broad spectrum of biological processes, spanning a range of quantitative features of the global digenic interaction network and tested for a genetic interaction with a third mutation. Trigenic interactions often occurred among functionally related genes, and essential genes were hubs on the trigenic network. Despite their functional enrichment, trigenic interactions tended to link genes in distant bioprocesses and displayed a weaker magnitude than digenic interactions. We estimate that the global trigenic interaction network is ~100 times as large as the global digenic network, highlighting the potential for complex genetic interactions to affect the biology of inheritance, including the genotype-to-phenotype relationship.
Article
Saccharomyces pastorianus is a recently evolved interspecies hybrid of Saccharomyces cerevisiae and Saccharomyces eubayanus used in the production of lager-type beers and has a long-standing history with the brewing industry. At least two distinct types of lager yeasts (Groups I and II) have been identified based on chromosome content and structure. One important feature of the genomes of lager yeasts is the presence of a set of hybrid chromosomes that emerged as a result of homeologous recombination events between the parental chromosomes. The unique genetic composition of the hybrid genomes of S. pastorianus affords interesting opportunities for evolution, adaptation and survival of the hybrids. The co-expression of S. eubayanus, S. cerevisiae and hybrid gene alleles, together with gene dosage effects resulting from the presence of multiple copies of individual genes, creates a complex algorithm for gene expression, cellular biochemistry and physiology. The recent availability of genome sequences for three Group I and ten Group II lager yeast strains provides an opportunity to decipher this complex algorithm and understand how it impacts on the final fermentation product, flavoursome beer.
Article
Nuruk is a fermenting starter that is involved in the production of alcoholic beverages, and has been used in South Korea for a very long time. To analyze the fungal diversity, we collected a total of 59 nuruk samples from several companies and persons in 2013 to 2014, and obtained 364 isolates. All of the single isolated fungi were identified, both morphologically and molecularly, based on the sequences of ribosomal RNA gene [18S, ITS1-5.8S-ITS2, and 26S (D1/D2 region)]. In 46 nuruk samples out of 59 (78%), Saccharomycopsis fibuligera, a dimorphic yeast, was most frequently isolated. Among the filamentous fungi, Aspergillus and Lichtheimia were found in more than 50% of the samples with lower colony forming unit (CFU/g of sample) than those of yeasts. The yeasts S. fibuligera and Wickerhamomyces anomalus were counted with maximum 1.3–1.8 × 10⁸ CFU/g. Among Mucorales fungi, Lichtheimia and Mucor were isolated in much higher numbers than Rhizopus and Rhizomucor. Overall, the home-made nuruks tend to contain more diverse filamentous fungi than the commercial nuruks. To acquire industrially useful filamentous fungi and yeasts, we analyzed the enzyme activities of α-amylase, glucoamylase and acid protease associated with brewing properties for 131 strains. Aspergillus oryzae and S. fibuligera had high α- and glucoamylase activities and most isolates of Lichtheimia ramosa had high acid protease activity. For further applications, 27 fungal strains were chosen based on isolation frequencies from nuruk, and the ability to produce useful enzyme.
Article
The amylolytic yeast Saccharomycopsis fibuligera is the predominant yeast in the starter product, nuruk, which is utilized for rice wine production in South Korea. Latest molecular studies explore a recently developed interspecific hybridization among stains of S. fibuligera with a unique genetic feature. However, the origin of the natural hybridization occurrence is still unclear. Thus, to respectively distinguish parental and hybrid strains, specific primer sets were applied on 141 yeast strains isolated from different nuruk samples fermented in different provinces. Sixty-seven strains were defined accordingly as parental species with genome A while 8 strains were defined as hybrid strains. Unexpectedly, another parental species with genome B could not be found among the strain pools yet. Furthermore, it was observed that hybrid strains are phenotypically different from A genome strains; asci containing tetrad ascospores were observed in A genome strains more frequent than in hybrid strains. Nevertheless, hybrid strains were slightly more thermotolerant than A genome strains. Interestingly, all hybrid strains were located only in Jeju province. Based on these sets of data, we speculated that the unique climate of Jeju province might play an evolutionary role in the interspecific hybridization between A genome strains, as well as the unculturable allopatric B genome strains.
Article
Yeasts used in the production of lager beers belong to the species Saccharomyces pastorianus, an interspecies hybrid of Saccharomyces cerevisiae and Saccharomyces eubayanus. The hybridisation event happened approximately 500–600 years ago and therefore S. pastorianus may be considered as a newly evolving species. The happenstance of the hybridisation event created a novel species, with unique genetic characteristics, ideal for the fermentation of sugars to produce flavoursome beer. Lager yeast strains retain the chromosomes of both parental species and also have sets of novel hybrid chromosomes that arose by recombination between the homeologous parental chromosomes. The lager yeasts are subdivided into two groups (I and II) based on the S. cerevisiae: S. eubayanus gene content and the types and numbers of hybrid chromosomes. Recently, whole genome sequences for several Group I and II lager yeasts and for many S. cerevisiae and S. eubayanus isolates have become available. Here we review the available genome data and discuss the likely origins of the parental species that gave rise to S. pastorianus. We review the compiled data on the composition of the lager yeast genomes and consider several evolutionary models to account for the emergence of the two distinct types of lager yeasts.