Studies on Diagnosis of Foot and Mouth Disease by ELISA and Reverse Transcription Polymerase Chain Reaction in Bovines

Full text

International Journal of Livestock Research eISSN : 2277-1964 NAAS Score -5.36
Vol 9 (6) June ’19
Hosted@www.ijlr.org DOI 10.5455/ijlr.20190325112442
Page130
Page130
Original Research
Studies on Diagnosis of Foot and Mouth Disease by ELISA and Reverse
Transcription Polymerase Chain Reaction in Bovines
Arbind Singh1*, Mahesh Kumar2, Amit Kumar Verma1 and Snehal Nirwan3
1Livestock Farm Complex (Veterinary Medicine), College of Veterinary & Animal Sciences, SVPUA&T,
Modipuram, Meerut, Uttar Pradesh, INDIA
2Veterinary Medicine, College of Veterinary and Animal Sciences, GBPUA&T, Pantnagar, Uttarakhand,
INDIA
3Veterinary Officer, Animal Husbandry Department, Uttar Pradesh, INDIA
*Corresponding author: arbindsingh80279@gmail.com
Rec. Date:
Mar 25, 2019 11:24
Accept Date:
May 02, 2019 18:19
DOI
10.5455/ijlr.20190325112442
Abstract
Rapid and accurate identification of infected animals, those with either clinical or subclinical disease as
well as with persistent infection, is essential for maintaining an efficient control programme of Foot and
mouth disease. During the study period (2009-10), surveillance of Foot and mouth disease was conducted
in the villages/towns/dairy farms/gaushalas affected with Foot and mouth disease outbreaks in Uttar
Pradesh. A total of 25 tongue epithelia were collected from suspected cases of FMD and subjected to
indirect sandwich ELISA and Reverse Transcription-PCR assays for the diagnosis. Out of 25 vesicular
epithelium samples, 17 were found positive for the presence of FMD virus by ELISA (the overall type ability
= 68.00%). Out of 25 samples, amplicons could be amplified from 20 samples (12 serotype O and 8 serotype
A) using RT-PCR. However, serotype ‘C’ and ‘Asia-1’ could not be recovered from these samples. In the
scenario of overall distribution pattern of FMD virus types, serotype ‘O’ (60.00%) was the predominant
type, followed by serotype ‘A’ (40.00%).The findings indicate PCR assay as a simple, rapid, sensitive,
reliable, reproducible and an additional confirmatory method for the identification of FMDV that will aid
in surveillance, prevention and control of this pathogen.
Key words: Foot and Mouth Disease, RT-PCR, Sandwich ELISA, Tongue Epithelium, Uttar Pradesh
How to cite: Singh, A., Kumar, M., Verma, A., & Nirwan, S. (2019). Studies on Diagnosis of Foot and Mouth
Disease by ELISA and Reverse Transcription Polymerase Chain Reaction in Bovines. International Journal
of Livestock Research, 9(6), 130-135. doi: 10.5455/ijlr.20190325112442
Introduction
Foot and mouth disease virus (FMDV) has a worldwide distribution and is of major importance for the
animal industry in India (Chakraborty et al., 2014; Verma et al., 2012, 2017). The disease is particularly a
problem for countries where animals and meat contribute significantly to the national economy through
export markets. Foot and mouth disease (FMD) is enzootic in many parts of India (Singh et al., 2008;

International Journal of Livestock Research eISSN : 2277-1964 NAAS Score -5.36
Vol 9 (6) June ’19
Hosted@www.ijlr.org DOI 10.5455/ijlr.20190325112442
Page131
Page131
Verma et al., 2017). Therefore, rapid and accurate diagnosis of FMD is essential for the success of FMD
control programme (Verma et al., 2008). A suitable and reliable test must be able to detect FMDV
circulating in animal population, as well as a low number of viral particles. The reverse transcription
polymerase chain reaction (RT-PCR) has been shown to be a useful tool in the diagnosis of FMD
(Marquardt et al., 1995; Raies et al., 2009; Verma et al., 2010), as a part of the viral genome can be detected
with a very high sensitivity in less than 24 h in a wide range of samples (Meyer et al., 1991). The detection
of structural protein antigen of FMD by ELISA was shown to be rapid and simpler to perform (Ferris and
Dawson, 1988) and considered as the primary test for FMD diagnosis in the regionally located FMD
diagnostic laboratories in the country (Anon, 2010). In this study, RT-PCR was used for screening the
vesicular epithelium samples collected from cattle and buffaloes from some districts of Uttar Pradesh state
for the diagnosis of different serotypes of FMD virus.
Materials and Methods
Sample Collection
A total of 25 vesicular epithelia (tongue epithelium) samples were collected from 19 cattle and 6 buffaloes
showing clinical signs viz. vesicle formation on the mucous membranes of the tongue, interdigital spaces,
salivation, anorexia from different districts of Uttar Pradesh. These samples were preserved in 50%
phosphate buffered saline (PBS) glycerol, pH 7.4 till further test.
Sandwich ELISA Test
The samples were tested by indirect sandwich ELISA (Bhattacharya et al., 1996).
Reverse Transcription Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted from all the 25 samples (tongue epithelium) with the modification of the acid
guanidium phenol-chloroform methods (Callens et al.,1998). Reverse transcription (RT) was carried out
with 10 µl of RNA in 25µl of final reaction volume using MMLV reverse transcriptase and NK61 primer
GACATGTCCTCCTGCATCTG (Knowles and Samuel, 1998). The reaction mixture was incubated at
48oC for 1 h. Additional incubation at 95oC for 5 min. was done to inactivate the enzyme. The PCR
amplification of the entire VP1 genomic region from this cDNA was carried out using Hotstar PCR kit
(Qiagen) and 20 pmol of each forward primer (Table 1) and NK61 reverse primer (Knowles and Samuel,
1998) as per the recommendations of the supplier.

International Journal of Livestock Research eISSN : 2277-1964 NAAS Score -5.36
Vol 9 (6) June ’19
Hosted@www.ijlr.org DOI 10.5455/ijlr.20190325112442
Page132
Page132
Table 1: Primers used for amplification of FMDV
S. No
Primer
Primer Sequence (5’-3’)
Sense
Gene
Product Length (bp)
Serotype
1
NK-61 (Reverse)
GACATGTCCTCCTGCATCTG
-ve
2B
2
ARS-4 (Forward)
ACCAACCTCCTTGATGTGGCT
+ve
1C
1301
O
3
A-1C562 (Forward)
TACCAAATTACACACGGGAA
+ve
1C
863-866
A
4
As1-1C505 (Forward)
TACACTGCTTCTGACGTGGC
+ve
1C
908-914
Asia-1
The thermal cycling condition employed for PCR amplification are shown in Table 2.
Table 2: Optimum PCR conditions for each primer sets
Serotype
Primer pair
No. of Cycles
Denaturation (94oC)
Annealing
Extension (72oC)
O
ARS4/NK61
40
1 min
45 sec at 600C
2 min
A
A-1C562/NK61
40
1 min
1 min at 550C
2 min
Asia-1
As1-1C505/NK61
40
1 min
1 min at 550C
1.5 min
The PCR products (5 µl sample) were run on 1% agarose gel containing ethidium bromide and the DNA
bands were visualized using a UV transilluminator.
Results and Discussion
Foot and mouth disease virus (FMDV) is the economically most important veterinary pathogen due to its
highly infectious and contagious nature, ability to cause persistent infections and long term effects on the
condition and productivity of the many animal species. Countries which have this disease have many trade
restrictions placed upon them (Shanafelt and Perrings, 2018). FMD is endemic in India and occurs in all
parts of country throughout the year. Rapid and accurate laboratory detection of FMDV plays a critical role
in the implementation of control measures to eradicate FMD. In the present study, out of 25 vesicular
epithelium samples (tongue epitheliums) collected from suspected cases of FMD, 17 were found positive
for the presence of FMD virus by indirect sandwich ELISA. Several researchers from different countries
have reported that sandwich ELISA is a good test in terms of sensitivity as well as specificity for serotyping
of FMD virus (Alonso et al., 1992; Chomczynski et al., 1987; Mann et al., 1998; Ouldridge et al., 1987;
Prasad et al., 1992; Verma et al., 2008). In the present study, the overall typeability was 68.00% using
sandwich ELISA. The percentage was found comparable to international standards. The possible reasons
for non-typing of virus from remaining samples may be either samples were not collected at the proper time
of clinical manifestation of disease or were not suitably preserved (Pattnaik et al., 1990). All the 25 tongue
epithelium samples were also processed by reverse transcription (RT) using random hexanucleotide primer,
followed by the polymerase chain reaction (PCR) (Fig. 1).

International Journal of Livestock Research eISSN : 2277-1964 NAAS Score -5.36
Vol 9 (6) June ’19
Hosted@www.ijlr.org DOI 10.5455/ijlr.20190325112442
Page133
Page133
Fig. 1: Agarose gel electrophoresis of 1301 bp and 865 bp PCR products amplified from FMDV
( M1: DNA marker 1 kb; L 1: Positive sample (Type O); L 2-L4: Negative sample; L 3: Negative sample;
L 4: Negative control; L 5: Positive sample (Type A, UPl); L 6: Positive sample (Type A, Brl); L 7:
Negative sample; L 8: Positive sample (Type A); L 9: Negative control; M2: DNA marker 100 bp)
Out of 25 samples, amplicons could be amplified from 20 samples (12 serotype O and 8 serotype A) using
RT-PCR. However, serotype ‘C’ and ‘Asia-1’ could not be recovered from these samples. In the scenario
of overall distribution pattern of FMD virus types, serotype ‘O’ (60.00%) was the predominant type,
followed by serotype ‘A’ (40.00%), (Table 3).
Table 3: Distribution results of FMD virus types by RT-PCR
S. No.
Species
Total Samples
Virus Recovered
FMDV Seroypes
O
A
C
Asia-1
1
Cattle
19
16
10
6
-
-
2
Buffaloes
6
4
2
2
-
-
3
Total
25
20 (80.00)
12 (60.00)
8 (40.00)
-
-
Comparison of sandwich ELISA based typing and RT-PCR result revealed that 17 samples positive for
FMDV by Sandwich ELISA were also positive with RT-PCR and amplicons of 1301 and 864 bp could be
amplified. The known positive control RNA extract of FMDV also yielded similar amplicons. However 3
specimens negative in sandwich ELISA test were found to be positive in RT-PCR.It indicates that the RT-
PCR is more sensitive than and sandwich ELISA test (Donn et al., 1996; Reid et al., 1999; Alexandersen
et al., 2000; Paprocka and Kesy, 2001; Paprocka et al., 2002; Clavijo et al., 2003; King et al., 2006; Verma
et al., 2010, 2012). The higher sensitivity of RT-PCR may be because of its ability to detect very small
number of virus as well as detection of RNA of non-viable FMD virus. The detection of viral genome,
rather than live virus or viral proteins, has the advantage that viable virus or intact viral antigen is not
required. Where subclinical infection is suspected or when samples are collected before the appearance of
clinical sign (Marquardt et al.,1995) or after the resolution of clinical disease or when processing saliva or

International Journal of Livestock Research eISSN : 2277-1964 NAAS Score -5.36
Vol 9 (6) June ’19
Hosted@www.ijlr.org DOI 10.5455/ijlr.20190325112442
Page134
Page134
swabs, an enhanced RT-PCR technique (Callens and DeClercq, 1997) produces a detection system as
sensitive and considerably more rapid than multiple passages on tissue culture. Moreover, it saves time and
labour, as it takes only approximately 5-6h.to identify the presence of FMD virus compared to 10-16h.
taken by the sandwich ELISA. These findings indicate PCR assay as a simple, rapid, sensitive, reliable,
reproducible and an additional confirmatory method for the identification of FMDV that will aid in
surveillance, prevention and control of this pathogen.
Conclusion
The results of this study provided the valuable data regarding the occurrence of FMD in bovines from Uttar
Pradesh, India. The findings further indicated PCR assay as a simple, rapid, sensitive, reliable, reproducible
and an additional confirmatory method for the identification of FMDV. Such outcomes proves to be very
useful for accurate diagnosis of FMD and therefore, strengthens the strategies for prevention and control of
this disease.
Acknowledgement
The authors are thankful to the FMD Virus Typing Laboratory IVRI, Mukteshwar, Dean College of
Veterinary and Animal Sciences and Vice-Chancellor, G. B. Pant University of Agriculture and
Technology, Pantnagar and Regional Research Centre, AICRP on FMD, DUVASU, Mathura for the
necessary help and the facilities provided during the study.
References
1. Alexandersen, S., Forsyth, M. A., Reid, S. M. and Belsham, G. J. (2000). Development of RT-PCR
(Oligonucleotide probing) enzyme linked immunosorbent assays for diagnosis and preliminary typing
of foot-and-mouth disease: A new system using simple and aqueous-phase hybridization. J. Clin.
Microbiol. 38: 4604-4613.
2. Anon. (2010). Annual Reports. Project Directorate on Foot and Mouth Disease. Mukteswar: 263138
Nainital (Uttaranchal) Available from: http://www.icar.org.in/files/pdfmd-vacancy-t3-2010.pdf.
3. Callens M. and DeClercq K. (1997). Differentiation of the seven serotypes of FMDV by RT-PCR.
Journal of Virological Methods. 67: 35-44.
4. Callens M., De Clercq, K., Gruia, M. and Danes, M. (1998). Subclinical FMD infection in contact
sheep: detection of FMDV by RT-PCR-ELISA and transmission of the virus to sentinel pigs. Vet.
Quarterly. 20(2): 37-40.
5. Chakraborty, S., Kumar, N., Dhama, K., Verma, A.K., Tiwari, R., Kumar, A., Kapoor, S. and Singh,
S.V. (2014). Foot and mouth disease, an economically important disease of animals. Adv. Anim. Vet.
Sci. 2(2S): 1-18.
6. Clavijo, A., Viera-Pereira, P. J. and Bergmann, I. (2003). Use of the reverse transcription polymerase
chain reaction (RT-PCR) for the rapid diagnosis of foot-and-mouth disease in South America. Vet. Res.
Commun. 27: 63-71.
7. Donn, A., Martin, L. A. and Donaldson, A. I. (1996). A method using the PCR for the demonstration
of chronic infection of foot-and-mouth disease in experimentally infected cattle. Societa Italiana Di
Buiatria. 1: 805-808.

International Journal of Livestock Research eISSN : 2277-1964 NAAS Score -5.36
Vol 9 (6) June ’19
Hosted@www.ijlr.org DOI 10.5455/ijlr.20190325112442
Page135
Page135
8. Ferris, NP and Dawson M (1988). Routine application of enzyme-linked immunosorbent assay in
comparison with complement fixation for the diagnosis of foot-and-mouth and swine vesicular
diseases. Vet Microbiol. 16(3):201-209.
9. King, D. P., Ferris, N. P., Shaw, A. P., Reid, S. M., Hutchings, G. H., Giuffre, A. C., Robida, J. M.,
Callahan, J. D., Nelson, W. and Beckham, T. R. (2006). Detection of foot-and-mouth disease virus:
Comparative diagnostic sensitivity of two independent real-time reverse transcription-polymerase
chain reaction assays. J. Vet. Diagn. Invest. 18: 93-97.
10. Knowles, N. J. and Samuel, A. R. (1998). RT-PCR and Sequencing Protocols for the Molecular
Epidemiology of Exotic Virus Diseases of Animals, OIE/FAO World Reference Laboratory for Foot
and Mouth disease.1-37.
11. Marquardt, O., Straub, O. C., Ahl, R. and Haas, B. (1995). Detection of foot and mouth disease virus
in nasal swabs of asymptomatic cattle by RT-PCR within 24h. J. Virol. Methods, 53: 255-261.
12. Paprocka, G. and Kesy, A. (2001). Detection of foot-and-mouth disease virus in biological material.
Medycyna Weterynaryjna. 57: 114-117.
13. Paprocka, G., Kesy, A., Niedbalski, W. and Fitzner, A. (2002). Detection and typing of foot-and-mouth
disease virus isolates. Medycyna Weterynaryjna. 58: 699-702.
14. Pattnaik, B., Rai, D. V. and Venkataramanan, R. (1990). Characterization of type O FMD virus isolates
recovered from outbreaks in India. Indian J. of Ani. Sc. 60(11): 1265-1270.
15. Raies, M., Verma, A.K., Yadav, S.K., Pal, B.C., Mahima and Jain, U. (2009) Genetic and antigenic
relationship between foot and mouth disease virus serotype Asia-1 isolate and vaccine strain, Onl J Vet
Res. 13 (2):114-119.
16. Reid, S. M., Hutchings, G. H., Ferris, N. P. and DeClercq, K. (1999). Diagnosis of foot-and-mouth
disease by RT-PCR: Evaluation of primers for serotypic characterization of viral RNA in clinical
samples. J. Virol. Methods. 83: 113-123.
17. Shanafelt, DW and Perrings C (2018). The Effect of the Post 2001 Reforms on FMD Risks of the
International Live Animal Trade. Ecohealth. 15(2): 327–337.
18. Singh, C. P., Verma, A.K., Pal, B. C. (2008). Prevalence of Protected animals against FMD in Uttar
Pradesh, India. The Haryana Veterinarian. 47: 107-109.
19. Verma, A. K., Mahima, Pal, B.C., Yadav, S.K., Kumar, A., Raies, M. (2010). Phylogenetic
relationships between foot-and-mouth disease virus serotype ‘A’ isolates and vaccine strains, Onl J Vet
Res. 14 (1):87-95.
20. Verma, A.K., Kumar, A., Mahima and Sahzad (2012). Epidemiology and diagnosis of foot and mouth
disease: a review. Indian Journal of Animal Sciences, 82 (6): 543-551.
21. Verma, A.K., Pal, B.C., Singh, C.P., Jain, U., Yadav, S.K. and Mahima. (2008). Studies of the
outbreaks of foot-and-mouth disease in Uttar Pradesh, India, between 2000 and 2006. Asian Journal of
Epidemiology, 1(2):40-46.
22. Verma, AK, Tripathi, A.K. and Neha (2017). Investigation of FMD Outbreak in District Bulandsahar,
Uttar Pradesh, India. International Journal of Livestock Research, 7(4): 113-119.