Selection of high affinity aptamer-ligand for dexamethasone and its electrochemical biosensor

Abstract

A high specificity aptamer-ligand biorecognition and binding system to monitor of dexamethasone (DXN) was developed. The detection principle was based on a label-free electrochemical aptasensor. The selection of the aptamer was successfully performed by the systematic evolution of ligands through exponential enrichment technique (SELEX). From a random library of 1.08 × 1015 single-stranded DNA, an aptamer designated as DEX04 showed a highest affinity with a dissociation constant of 18.35 nM. It also showed a good conformational change when binding with DXN. In addition, the aptamer DEX04 did not show any cross-reactivity with other commonly used hormones. An impedimetric aptasensor for DXN was then developed by immobilizing DEX04 on a gold electrode. The binding upon to DXN was monitored by following the change in the charge transfer resistance (Rct) of the [Fe(CN)6]4−/3− redox couple. The aptasensor exhibited a linear range from 2.5 to 100 nM with a detection limit of 2.12 nM. When applied aptasensor to test in water samples, it showed good recovery percentages. The new DXN aptamer can be employed in other biosensing applications for food control and the diagnosis of some diseases in medicine as a cost-effective, sensitive and rapid detection method.

Full text

1
SCIENTIFIC REPORTS | (2019) 9:6600 | https://doi.org/10.1038/s41598-019-42671-3
www.nature.com/scientificreports
Selection of high anity aptamer-
ligand for dexamethasone and its
electrochemical biosensor
Somia Mehennaoui, Sujittra Poorahong, Gaston Contreras Jimenez & Mohamed Siaj
A high specicity aptamer-ligand biorecognition and binding system to monitor of dexamethasone
(DXN) was developed. The detection principle was based on a label-free electrochemical aptasensor.
The selection of the aptamer was successfully performed by the systematic evolution of ligands through
exponential enrichment technique (SELEX). From a random library of 1.08 × 10 15 single-stranded DNA,
an aptamer designated as DEX04 showed a highest anity with a dissociation constant of 18.35 nM. It
also showed a good conformational change when binding with DXN. In addition, the aptamer DEX04
did not show any cross-reactivity with other commonly used hormones. An impedimetric aptasensor
for DXN was then developed by immobilizing DEX04 on a gold electrode. The binding upon to DXN was
monitored by following the change in the charge transfer resistance (Rct) of the [Fe(CN)6]4−/3− redox
couple. The aptasensor exhibited a linear range from 2.5 to 100 nM with a detection limit of 2.12 nM.
When applied aptasensor to test in water samples, it showed good recovery percentages. The new DXN
aptamer can be employed in other biosensing applications for food control and the diagnosis of some
diseases in medicine as a cost-eective, sensitive and rapid detection method.
Dexamethasone (DXN) is a synthetic hormone belonging to the group of corticosteroids. It is mainly used as an
anti-inammatory, anti-allergic and immunosuppressive agent in many medical applications1. Oen, it was used
as a growth promoting agent to increase the body mass2. e residues of DXN in meat and other animal prod-
ucts i.e., milk can be harmful to humans and animals3,4. With high concentrations, DXN can aect the nervous,
endocrine and digestive systems of animals5. In addition, previous studies have shown that DXN can negatively
inuence fertility and ovarian function like chronic an ovulation and polycystic ovarian syndrome6–8. Based on
animal studied It is classied as 1B category (presumed human reproductive toxicant). e upper dose should not
more than 1,000 mg/kg by oral take9. erefore, accurate monitoring of the existence and the concentration of
DXN in environmental and clinical samples is very important. e concentrations of DXN in real samples were
found from sub nanomolar to micromolar range with dierent matrices1,10,11. us, the development of a rapid
and sensitive detection method for the identication of DXN is required.
Although, the immunological techniques, instrumental analytical approaches are generally costly,
time-consuming and require highly qualied personnel, making them unsuitable for eld applications12,13. To
overcome these limitations, several studies have been devoted to the development of new and simple detection
techniques. e biosensors have recently sparked considerable interest in a variety of biomedical and environ-
mental applications and have emerged as an interesting alternative to conventional analytical and immunological
assays. Recently, a photoelectrochemical immunosensor based on competitive strategy has been proposed for
the detection of DXN14. Despite, their ease to use and sensitive detection, immunosensors are subject to a major
challenge, precisely the use of antibodies as bioreceptor. Competitive immunoassays need additional steps and
rely on enzymes for antibodies labeling. Furthermore, antibodies that target similar molecules are usually sub-
ject to cross-reactivity and thus require special storage and handling conditions. For that, aptasensors appeared
as a good alternative to immunosensors because of their simple detection strategies15. Since their discovery in
199016,17, aptamers oered many advantages, including in-vitro selection even for small molecules18, viruses19 and
proteins20. ey are also relatively easy to synthesize and modulate at low cost, highly stable at dierent storage
conditions and transportation in ambient temperature.
erefore, in this work we report a high anity aptamer against DXN. e SELEX approach was employed for
aptamer selection from a random library of 1.08 × 1015 single-stranded DNA. Herein we present the rst report
Department of Chemistry, Université du Québec  Montréal, Montréal, Québec, H3C 3P8, Canada. Correspondence
and requests for materials should be addressed to M.S. (email: siaj.mohamed@uqam.ca)
Received: 5 June 2018
Accepted: 2 April 2019
Published: xx xx xxxx
OPEN
Content courtesy of Springer Nature, terms of use apply. Rights reserved

2
SCIENTIFIC REPORTS | (2019) 9:6600 | https://doi.org/10.1038/s41598-019-42671-3
www.nature.com/scientificreports
www.nature.com/scientificreports/
for selected aptamer for DXN detection with the highest anity and good characterization results. In addition,
the selected aptamer was integrated into a novel and simple label-free impedimetric platform based on gold
electrodes. is novel aptasensor oers simple, low cost and highly stable detection method that can be used by
unqualied personnel replacing currently sophisticated immunoassays and analytical methods.
Results and Discussion
In vitro selection of DNA aptamers for DXN. Screening several aptamers that recognize DXN with a
high anity and specicity from a vast random library consisting of 1.08 × 1015 dierent ssDNA is a challenging
task. To the best of our knowledge, no other aptamer-based biosensors were developed for the detection of DXN.
In order to generate anity complexes, the ssDNA pools were rst incubated with DXN sepharose 6β beads.
e process was carried out through 19 cycles of selection. Each SELEX round was controlled by measuring the
percentage of eluted ssDNA (bound ssDNA) with respect to the initial concentration of the ssDNA quantied
by uorescence. As illustrated in Fig.1, a low recovery percentage of ssDNA was observed in the rst ve cycles.
is may be due to the low concentration of the used analytes or due to a low specically bound aptamer to the
DXN. erefore, a negative selection (NS) was carried out using blank sepharose 6β beads in order to eliminate
the non-specically bound aptamers from the beads matrix. Hence, a signicant increase in the recovery was
detected in the next selection cycles. ese also conrmed the important role of the counter or negative selection.
In order to improve the selection accuracy and only keep the most specic DNA for free DXN, a second negative
selection was performed before the tenth cycle. It was observed that a high amount of ssDNA was retained onto
the blank beads, and a low amount of ssDNA, which expected to be a high specic binding to the analyte was
obtained. In addition, a considerable rise in the ssDNA recovery was found in the next cycle, which indicates the
specicity of this washed ssDNA for DXN. In order to retain the best anity aptamers, therefore, aer the 12th
cycle, the concentration of analyte was reduced. is makes the 13th cycle shows low recovery. At the 19th cycle,
aer reaching a plateau with a signicant enrichment of DXN binding DNA, the ssDNA pool was cloned and
sequenced.
Characterization of selected aptamers. Ten positive white colonies were obtained aer cloning pro-
cesses. Among them only six colonies were obtained well-dened sequence. A signicant consensus region of
nucleotides was observed between the sequences belonging to the same group or family. ese can be aligned into
three families (A, B and C) as shown in Table1 and all sequences were then characterized.
Aer sequencing, the anity binding by uorescence assay was determined. e binding curves of all aptam-
ers are shown in Fig.2A. e dissociation constant values were then calculated using nonlinear regression. Only
Figure 1. Selection of DXN aptamers; ssDNA recovery from each SELEX cycle and the resulting enrichment
plateau. Negative selection (NS) performed by using blank beads.
Family Name Aptamer structure 5′ to 3′KD (nM)
ADEX01 ACACCCCACGTAGTGTCACAGCACGCTTATAGTAAGTGAAGTGACGGGTTGCTGATGTG 15.71
DEX03 ACGCGTAGGGATGTGTAAGGTCTGTACACCTCGGTTTACTCTATGCTTCGCATATTGTCG 72.83
BDEX04 ACACGACGAGGGACGAGGAGTACTTGCCAACGATAACGTCGTTGGATCTGTCTGTGCCC 18.35
DEX10 GGACAGCTGGCCGCGAAGCGAGACACGTATAAGGTACTATACGGCTGGCATATGTATCTG 715
CDEX05 ACAGGCTTGGATTAGTGTATCCAACTAGTATCGTGTATACTAGGCCCTTGCTACCCTGTG NB
DEX06 ACACACGAAACACAAGCAGTGAGACTGCCTACGTCCGTAGTTGTGTTGAGTTTGCTCTCC NB
Table 1. Selected aptamer sequences against DXN.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

3
SCIENTIFIC REPORTS | (2019) 9:6600 | https://doi.org/10.1038/s41598-019-42671-3
www.nature.com/scientificreports
www.nature.com/scientificreports/
four aptamers provided a good anity to DXN in a low nanomolar level with KD ranging from 15 to 715 nM
(Table1). is is suggesting a strong anity binding between aptamer and DXN occurred. Whereas the two
aptamers, i.e., DEX05 and DEX06 did not exhibit binding against DXN. e four aptamers which provided the
anity binding to DXN were then studied the conformation changes in the structure before and aer binding to
DXN by circular dichroism (CD) spectroscopy. From our results, DEX04 shows the most signicant change in
ellipticity as shown in Fig.2B. In contrast, the other three aptamers; DEX01, DEX03 and DEX10, did not show a
signicant ellipticity change as shown in Fig.S1. In detail, the CD spectrum of the free DEX04 aptamer has a pos-
itive peak at 271 nm and a negative peak at 244.5 nm (Black line), which is a duplex type characteristic. Following
the binding and biorecognition of the DEX04 aptamer to DXN, a signicant change of ellipticity at 271 nm and
245.5 nm was observed (red line). is indicates the folding of the aptamer into other conformations following
its contact with the molecule of DXN, which contains chiral atoms and could divert polarized light circularly.
en the specicity of DNX aptamer, cross-reactivity assays with progesterone (P4), norethisterone (NET)
and estradiol (E2) hormones which are DXN’s analogs and can present in the same environmental samples was
studied. As shown in Figs2C and S3, the DEX04 indicates the highest selectivity to DXN against P4, NET and
E2 hormones. Anti-DXN aptamers have been further investigated by studying their secondary structures. As
depicted in Fig.S3, all aptamer sequences exhibited formation of characteristics of stem-loop shape. ose struc-
tures showed good binding anity with DXN as conrmed the presence of correspondences and dierences.
Structural similarities are observed which is consistent with aptamer recognition of the target conformation.
From all characterization results, DXN 04 provided the best performance, in terms of good KD, specicity and
change in conformation. Hence, it was chosen for further biosensor applications.
Electrochemical Aptasensor of DXN Detection. For the DXN aptasensor, the DEX04 aptamer
sequence (5′-ACA CGA CGA GGG ACG AGG AGT ACT TGC CAA CGA TAA CGT CGT TGG ATC TGT
CTG TGC CC-3′), which revealed a signicant conformation change in the CD measurement and provided a
low KD value of 18.35 nM by uorescence, was employed. Figure3 demonstrates the dierent steps to fabricate
the DXN aptasensor. First, the disulde-modied aptamer (HOC6-S-S-C6-DEX04) was immobilized on a gold
surface by self-assembly and the free gold surfaces were blocked using MCH in order to minimize the nonspecic
adsorption of the aptamers and ensure that the aptamer binds only from the sulde side. Atomic force micros-
copy (AFM) was used to characterize the morphology of the gold electrodes surface before and aer the aptamer
immobilization (Fig.4). A comparison between the AFM images of bare and modied electrode shows clearly the
aptamer immobilization. e formation of a complete aptamer monolayer on top of the gold electrode induces
a signicant decrease in the roughness of the electrode. Before the aptamer immobilization, the bare gold elec-
trode showed a roughness value of 7 nm compared to 4 nm the chemisorbed DEX on the electrode surface. In
addition, the resulting modied electrodes have been characterized by X-ray photoelectron spectroscopy (XPS)
and Attenuated total reection-Fourier transform infrared (ATR-FTIR). Compared to bare gold electrode, the
high-resolution XPS spectra of sulfur (S) for modied electrodes showed a S 2p peak at 162.4 eV. is peak is
attributed to a Au-S bond indicating that the chemical graing of the thiol-modied aptamer to the gold surface
was successful21 (Fig.S4). However, from the ATR-FTIR data we can conclude that we have the ssDNA attached
to the electrode surface22,23 (Fig.S5). All the steps of the fabrication of the aptasensor were controlled by EIS and
CV measurements. As shown in Fig.5A, the characteristic ferricyanide redox peaks resulting from the bare gold
electrodes declined gradually aer being exposed to MCH, free DEX04 aptamer and DEX04 bound to DXN. As
anticipated, the bare gold electrode showed a quasi-reversible voltammogram of the ferricyanide redox couple
with a peak separation ΔEp of 120 mV (black curve). Aer modication with MCH (red curve), the electrochem-
ical reaction is blocked on Au electrode surface, which leads to an increase in the peak separation and a substan-
tial decrease in the peak current. Once the Au electrode incubated with the aptamer and followed by MCH (blue
curve), a higher degree of decreasing in the electron transfer charge between the redox couple and the electrode
Figure 2. (A) Binding saturation curve of all aptamers with DXN beads determined by the uorescence assay,
by plotting the concentration of the complex formed by the binding between ssDNA aptamer and DXN analyte
([ssDNA−DXN]) as a function of unbound ssDNA concentration. (B) Circular dichroism spectra of 3 μM of
the DEX04 before (Black line) and aer recognition of 3 μM DXN (Red line). (C) Cross-reactivity study of the
DEX04 aptamer to progesterone (P4), norethisterone (NET) and 17β-estradiol (E2).
Content courtesy of Springer Nature, terms of use apply. Rights reserved

4
SCIENTIFIC REPORTS | (2019) 9:6600 | https://doi.org/10.1038/s41598-019-42671-3
www.nature.com/scientificreports
www.nature.com/scientificreports/
were observed compared to Au electrode modied with MCH only. is could be aected by the generation of
a negatively charged DNA that rejects the [Fe(CN)6]4−/3− anions and retards the interfacial kinetics of the redox
couple at the Au interface. us, this is indicating the successful attachment of the aptamer on the gold surface.
Moreover, the peak current reects an additional decrease of the electron-transfer rate aer incubation with
100 nM DXN (green curve), conrming the success of binding between DXN and the aptasensor.
Likewise, ESIs for each step of the electrode modifying in 10 mM [Fe(CN)6]4−/3− solution as probe redox
were recorded (Fig.5B). Impedance measurements were represented by Nyquist plots. ese plots consist of a
part forming semicircles at high frequencies corresponding to electron transfer and a straight line at very low
Figure 3. Impedimetric mechanism of aptasensor.
Figure 4. (A) AFM images of the bare electrode and (B) DEX04 aptamer-immobilized gold electrode.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

5
SCIENTIFIC REPORTS | (2019) 9:6600 | https://doi.org/10.1038/s41598-019-42671-3
www.nature.com/scientificreports
www.nature.com/scientificreports/
frequencies representing the diusion processes. e quantication of the semicircle diameter can be tted with
the Randles-modied equivalent circuit or the electron transfer resistance (Ret) of the modied electrode sur-
faces. e obtained ESIs data corroborate the preceding results obtained by CV. More specically, the EIS cor-
responding to the bare gold electrode presents a small semicircle diameter (black curve) indicating the rapid
electron transfer and diusion limiting processes on the bare gold electrode surface. Aer incubating with MCH,
a preventing of the electrochemical reaction occurred, an increase in the charge transfer resistance (Rct) was
noticed. Aer immersing the gold electrode in the disulde-modied aptamer and followed by MCH blocking,
a signicant increase in the diameter of the semicircle was observed indicating the increase in the Rct caused by
the assembly of a negatively charged disulde DNA which repels the [Fe(CN)6]4−/3− anions of the redox couple
on the electrode surface, which conrms the success of the self-assembly. We notice a signicant increase in Rct
(7810 ) aer incubating the aptasensor with 50 nM of DXN. is Rct change may be resulting from the con-
formation changes of the aptamer upon binding to DXN, which leads to more shielding of the Au surface and
more retardation for the [Fe(CN)6]4−/3− anions accessibility to the surface electrode. When DXN concentration
increased to 100 nM, a further small increase in Rct was observed. Both of CV and EIS results conrm that the
sensing interface is achieved successfully.
e incubation time is a crucial factor, which could aect the performance of the aptasensor in DXN recog-
nition. e incubation time was studied by incubating the DEX04 aptamer immobilized on Au electrode with
50 nM DXN at various duration. To evaluate the aptasensor’s response, we used the percentage change in the
Rct before and aer binding to DXN. As shown in Fig.6A, the aptasensor’s response increased by increasing the
incubation time from 10 to 100 min. A slight increase in the sensor’s response was also observed from 100 to
240 min, indicating the saturation of the aptamer modied electrode. Consequently, the aptasensor was incubated
for 120 min in all future experiments. e incubation time of our sensor is longer than the immunosensor maybe
because in immunosensor system the anti-dexamethasone is incubated on TiO2 nanoparticles14. ese nanopar-
ticles have a larger surface area than our gold base electrode. It supports the dexamethasone easily to excess to the
anti-dexamethasone bead.
e selectivity of the DXN aptasensor was studied in the presence of other hormone analogs to DXN. To
achieve this, 1 nM of DXN, P4, NET, E2, binding buer and their mixture were tested. Figure6B presents the bar
chart of the sensor’s response of (R0 − R)/R0, which demonstrates the high response obtained with the DXN and
the mixtures compared to the nonsignicant changes in the case of the other components introduced, thus indi-
cating the selectivity and the specicity of the developed aptasensor to DXN. e calibration curves of DXN were
then constructed by monitoring the sensor’s response (Fig.6C). en the calibration curves of DXN were then
constructed (Fig.6D). Compared with dierent detection methods (see Table2), the developed aptasensor exhib-
ited excellent analytical performance with a wide linear range of 2.5 to 100 nM and low detection limit at 2.12 nM,
calculated by IUPAC method24. e error bars represent the standard deviation SD of the three measurements.
Application of DXN aptasensor in real simples. To evaluate the performance of the developed aptasen-
sor for the detection of DXN in real samples, series of experiments have been carried out using tap water, drinking
fountain water and ultrapure water with three dierent concentrations of DXN varying from 0 nM, 50 nM and
100 nM. Table3 presents the results obtained for each sample. e negative water samples in binding buer did
not exhibit any signicant signal. Good percentages of recovery ranging from 81.5% to 103.2% were obtained
indicating no eect of interference from water components on the aptasensor’s detection mechanism. e relative
Figure 5. (A) Cyclic voltammograms and (B) impedance spectra (Nyquist plots) of 10 mM [Fe(CN)6]4−/3− in
PBS, pH 7.4, for bare Au electrode, Au/MCH, Au/MCH/DEX04 before and aer recognition to 50 nM and
100 nM DXN. e inset is the equivalent circuit used for the impedance data tting; Rs is the solution resistance
between working and reference electrodes, Zw is Warburg impedance; Cdl is the double layer capacitance and
Rct is the charge-transfer resistance.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

6
SCIENTIFIC REPORTS | (2019) 9:6600 | https://doi.org/10.1038/s41598-019-42671-3
www.nature.com/scientificreports
www.nature.com/scientificreports/
dierences are between 2.2% and 11.5%. ese shown an acceptable recovery rate in levels of ng/mL is between
40 and 120% and the RSD could be 30% to 45%24. us, it can be concluded that recoveries for all concentrations
of DXN in the studied samples are in the acceptable range. Finally, these results approved the actual application
and the possible use of the impedimetric aptasensor in environmental analysis.
Figure 6. (A) Eect of the DXN incubation time on aptasensor’s response for 50 nM DXN, (B) e cross
reactivity of the DXN aptasensor against binding buer (BB), 1 nM of DXN, P4, NET, E2 and their mixture, (C)
Examples of Nyquist plots measurements in 10 mM [Fe(CN)6]4−/3− of the aptasensor in dierent concentrations
of DXN analyte (0, 1, 10, 20, 30, 50, 75, 100, 150, 200 and 300 nM). (D) Calibration curve of the aptasensor
plotted with a regression coecient r2 = 0.99.
Method Linear dynamic
range LOD Applications/Comment Ref.
Label-free electrochemical aptasensor 2.5–100 nM 2.12 nM Applied to tab water and drinking
water, recovery = 81.5–103.2% is work
reverse-phase high-performance liquid
chromatography with diode array
detection Not report water = 6 ng/mL
Feed = 190 ng/g
Applied to water and feed
for meat-producing animals:
recovery = 99.4 ± 1.3%
Flumethasone was used as internal
standard
3
Electrochemical sensor based Fe3O4/
PANI–CuII microsphere 0.05 to 30 mM 3.0 nM Applied to human urine and serum
samples
Recovery = 97.0–102.0%
11
high-performance liquid chromatography
with diode array detection Not report 10 ng/mL Applied to human plasma with
recovery = 96.96% to 106.07% 27
Hanging mercury drop electrode 25.5–122.3 µM 7.6 µMApplied to drug sample;
recovery = 99.8–100% 28
square-wave adsorptive voltammetry 0.0498–0.61 µM2.54 nM Applied to eye drops, injectable, elixir;
recovery = 94.14–112.41% 29
Table 2. Figures of merits of comparable methods for determination of dexamethasone.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

7
SCIENTIFIC REPORTS | (2019) 9:6600 | https://doi.org/10.1038/s41598-019-42671-3
www.nature.com/scientificreports
www.nature.com/scientificreports/
Conclusion
In this work, we have selected, identied and characterized the rst aptamer with a high anity and specicity to
dexamethasone, a widely used hormone with low molecular weight (392.46 Da). e developed aptamer DEX04
presented a dissociation constant in the range of nanomolar range and demonstrated a signicant change in
its conformation before and aer DXN recognition as shown by circular dichroism spectroscopy. e DEX04
aptamer was then integrated to design a label-free impedance based aptasensor. e aptasensor had a low LOD
of 2.12 nM with a wide linear range of 2.5 nM to 100 nM and a good yield in the range of 81.5 to 103.2% as
demonstrated by the application performed on dierent water samples. Other applications for the selected DXN
aptasensor in meat, milk and some clinical samples will be studied in the future.
Experimental Section
Materials and reagents. e materials and reagents used for the selection, characterization of the aptamer
and the development of the DXN aptasensor are cited in the supplementary information section.
In Vitro Selection of DXN aptamers. The selection of aptamers was done through the SELEX pro-
cess in which DXN conjugated sepharose 6β beads were exposed to the ssDNA library. This study, a ran-
dom library containing 1.08 × 1015 oligonucleotides was designed. It is composed of a principal randomized
part of 60 nucleotides connected by two constant primer-hybridization sites at the 3′ and 5′ extremities
(5′-ATATCATATGCTCCAATT-N60-ATATTACACTTGCGATCT-3′). e primers were labeled with uores-
cein in order to determine the recovered ssDNA and hexaethylene glycol (HEGL) linker to inhibit the polymer-
ase prolongation. Five successive steps were accomplished for each aptamer selection and amplication cycle
as shown in Fig.S6. Specically, a 100 pmol ssDNA pool (1.794 nmol at the rst cycle), measured by UV spec-
trophotometer was pretreated by heating at 90 °C for 5 min followed by renatured at 4 °C for 10 min. en the
mixture was le at ambient temperature for 5 min before adding 50 μL for the rst cycle (100 μL for the second
round and beyond) of prewashed DXN sepharose 6β beads in 400 μL binding buer in a centrifuge lter tube.
e solution was then incubated for 2 hours at room temperature. Aer incubation, the beads were washed sev-
eral times with the binding buer until no ssDNA is detected by uorospectrometer (Nano Drop 3300, Fisher
Scientic, Canada). e ssDNA aptamers bound to DXN sepharose beads were then eluted 6 times with 250 µL
of elution buer and heated at 90 °C for 10 minutes. Each eluting time, the elution was measured by uorospec-
trometer until no DNA is detected. Eluted ssDNA was then concentrated and desalted by ultraltration using a
3 kDa cut o membrane.
e eluted DNA was amplied by Polymerase Chain Reaction (PCR). PCR products were concentrated by
Speed Vac and re-suspended in 50:50 v/v of water:formamide and later heated at 55 °C for 5 min. e uorescein
labeled DNA was then isolated from the double-stranded PCR product by loading into 12% denaturing poly-
acrylamide gel electrophoresis (PAGE). en it was eluted from the gel band through freeze thaw cycle. Eluted
ssDNA from in the TE buer (10 mM Tris pH 7.4, 1 mM EDTA) was concentrated by the ultraltration and then
quantied by UV to be used for the next selection round. During SELEX cycles, two negative selection rounds
were performed before the 6th and 10th cycles. is is carried out by incubating the DNA pool with blank sepha-
rose beads. In this counter selection step, washed ssDNA were collected and exposed to the same pre-treatment
mentioned previously.
Cloning and sequencing of selected DNA. e selected ssDNA from the latest SELEX round were
amplied by PCR using non-labeled primers. Aerwards, the DNA was cloned into pCR2.1-TOPO vector with
the TOPO TA Cloning Kit (Invitrogen) using the competent cells E. coli. e bacteria that contained the plasmids
were then cultured on petri dishes containing LB-agar medium enriched with 200 μL of ampicillin (20 mg/mL)
and 100 μL of IPTGX-GAL. Positive white clones which contain a single sequence of ssDNA inserted into their
plasmid were picked from petri dishes for subsequent cultivation in tubes containing liquid media. Aer incuba-
tion and growth, the ssDNA was amplied using the M13 forward and reverse primer sites within the vector and
puried by QIAquick PCR. Finally, the ssDNA selected by the SELEX process were analyzed and aligned using
the DIALIGN soware25. Analysis of the secondary structure of identied aptamers was performed using the
internet-free Mfold soware26.
Sample Spiked DXN
(nM) [Ret − R0]/
R0 (%) Recover y
(%) RSD
(%)
Tap water
0 7.1 ± 2.3 — 2.26
50 46.0 ± 2.5 103.29 6.93
100 73.6 ± 1.6 90.68 2.19
Drinking water
0 14.3 ± 4.7 — 4.67
50 38.3 ± 2.3 81.55 6.45
100 77.7 ± 8.2 96.19 11.57
Ultrapure water
0 10.6 ± 2.4 — 2.39
50 30.5 ± 3.3 88.03 8.13
100 76.5 ± 3.6 94.54 5.05
Table 3. Spike and Recovery Results from the application of DXN Aptasensor in real samples.
Content courtesy of Springer Nature, terms of use apply. Rights reserved

8
SCIENTIFIC REPORTS | (2019) 9:6600 | https://doi.org/10.1038/s41598-019-42671-3
www.nature.com/scientificreports
www.nature.com/scientificreports/
Determination of dissociation constant and cross-reactivity Study by uorescence assay. A
high anity binding between aptamers and DXN is a critical requirement for biosensing purposes. A binding
assay was determined by studying the dissociation constant (KD). e identied aptamer sequences were ampli-
ed by PCR and labeled with uorescein uorophore. ey were pretreated and then incubated in a 20 µL of DXN
beads and various concentrations of the aptamers, i.e., 50, 100, 200, 300 and 400 nM. Aer heating and cooling
treatment, the mixtures were washed and DNA was eluted. From each eluted DNA sequences, the uorescence
signal was quantied. A saturation curve was plotted and the KD values were respectively calculated using the
nonlinear regression method.
Cross-reactivity refers to the ability of a given aptamer to react with other analytes or hormones which have a
similar chemical structure to DXN, i.e., progesterone (P4), norethisterone (NET) and estradiol (E2). Aer ampli-
fying aptamers by PCR, a 150 nM of each aptamer was incubated with 20 µL P4 beads (a load capacity of 4.4
nmoL/mL) and 5 µL of the NET, E2 and DXN beads (loading capacity ligands of 6–14 μmoL/mL). e percentage
binding of each hormone with the aptamers was determined by measuring the elution DNA using NanoDrop
3300 uorospectrometer.
Circular Dichroism (CD) study. e conformational changes in the structure of the aptamer upon DXN
recognition were studied by circular dichroism spectroscopy. e spectrum of each sequence was analyzed before
and aer adding 3 μM of DXN into 3 μM of aptamer sequences. To obtain accurate results, we recorded and sub-
tracted the background signals of binding buer and 3 μM DXN from the CD spectra. e CD measurements
were performed using Jasco-810 spectropolarimeter. Each CD spectrum was collected from 200 to 320 nm wave-
lengths at 0.1 nm intervals and an accumulation of three scans at 20 nm/min, with a 1 nm bandwidth and a time
constant of 1 second.
Electrochemical detection of DXN. In this work, gold (Au) rod electrode was used as a basis surface for
modied of the aptamers. e immobilization is based on self-assembly of a disulde-aptamer on Au surface.
Before using Au electrodes (2.0 mm diameter) were cleaned and polished with 1, 0.3 and 0.05 µm alumina slurries
(Al2O3). e electrodes were then washed and sonicated for 2 min in ultrapure water and subsequently immersed
for 1 min in a piranha solution (3:1 mixture of concentrated H2SO4 and 30% H2O2), then washed again with
ultrapure water and sonicated for 2 min in 100% ethanol. e electrodes were then electrochemically treated
by cyclic voltammetry in 0.5 M of H2SO4 by cycling a potential of 0 to +1.6 V with the scan rate of 100 mV/s
for 15 scans. Aer washing with ultrapure water and dry with nitrogen, the electrodes were incubated in 1 μM
disulde-modied DEX04 aptamer (the best performance aptamer) in the binding buer for 24 hours at room
temperature. Aer that, the DEX04 aptamer-modied electrodes were cleaned with the binding buer to remove
any unbound aptamers. e electrodes were then immersed in a 1 µM 6-mercapto-1-hexanol (MCH) in 10 mM
phosphate buer saline, pH 7.4 for 30 min in order to block the remaining bare surfaces and to reduce the density
of the aptamer layers by the displacement of the aptamers non-specically adsorbed. At the end, the modied
electrodes were thoroughly washed with the binding buer and 1 M NaCl solution. For further uses, the modied
electrodes were stored in the binding buer at 4 °C.
For preliminary conditions of the detection, the aptamer-modied gold electrodes were incubated with 50 nM
and 100 nM of DXN for 100 min. Aer washing with binding buer to eliminate the unbound aptamers to DXN,
the electrodes were subjected directly to record cyclic voltamograms and impedance spectra. For the electro-
chemical measurements, they were carried out by using SP-300 potentiostat (Bio-Logic Science Instrument,
France) connected to a personal computer and driven by EC-Lab program. A frequency ranges from 100 kHz to
50 mHz using an alternative voltage with an amplitude of 10 mV, superimposed on a DC potential of 0.21 V (vs a
Ag/AgCl reference electrode) was programed. All measurements were carried out in 10 mM PBS buer, pH 7.4,
in the presence of 10 mM [Fe(CN)6]4−/3− as a redox couple.
References
1. Goyal, . N., Chatterjee, S. & ana, A. . S. Eect of cetyltrimethyl ammonium bromide on electrochemical determination of
dexamethasone. Electroanalysis 22, 2330–2338 (2010).
2. Wu, F. & Lv, J. Flow injection chemiluminescence detection and solvent extraction for human sin ointment dexamethasone acetate
absorption analysis and the reaction mechanism study. Ta lant a 72, 1811–1817 (2007).
3. eig, M., Mora, L., Navarro, J. L. & Toldrá, F. A chromatography method for the screening and confirmatory detection of
dexamethasone. Meat science 74, 676–680 (2006).
4. Cherlet, M., De Baere, S. & De Bacer, P. Quantitative determination of dexamethasone in bovine mil by liquid
chromatography–atmospheric pressure chemical ionization–tandem mass spectrometry. Journal of Chromatography B 805, 57–65
(2004).
5. Yang, X. et al. Eect of dexamethasone contamination in drining water on intestinal ora in mice. Nan fang yi ke da xue xue
bao = Journal of Southern Medical University 36, 238–243 (2016).
6. Huang, T.-J. & Li, P. S. Dexamethasone inhibits luteinizing hormone-induced synthesis of steroidogenic acute regulatory protein in
cultured rat preovulatory follicles. Biology of reproduction 64, 163–170 (2001).
7. Fonda, E. S., ampace, G. B. & raeling, . . e Eect of Adrenocorticotropin or Hydrocortisone on Serum Luteinizing
Hormone Concentrations aer Adrenalectomy and/or Ovariectomy in the Prepuberal Gilt. Endocrinology 114, 268–273, https://doi.
org/10.1210/endo-114-1-268 (1984).
8. osen, H., Jameel, M. L. & Baran, A. L. Dexamethasone suppresses gonadotropin-releasing hormone (GnH) secretion and has
direct pituitary eects in male rats: dierential regulation of GnH receptor and gonadotropin responses to GnH. Endocrinology
122, 2873–2880 (1988).
9. Netherlands, H. C. O. T. (ed. e Hague: Health Council of the Natherlands) (publication no. 2016/15, 2016).
10. Wang, Z. et al. Preparation of an anti-dexamethasone monoclonal antibody and its use in development of a colloidal gold
immunoassay. Food and Agricultural Immunology 28, 958–968, https://doi.org/10.1080/09540105.2017.1320360 (2017).
11. Fatahi, A., Malaooti, . & Shahlaei, M. Electrocatalytic oxidation and determination of dexamethasone at an Fe3O4/PANI–CuII
microsphere modied carbon ionic liquid electrode. RSC Advances 7, 11322–11330, https://doi.org/10.1039/C6A26125F (2017).
Content courtesy of Springer Nature, terms of use apply. Rights reserved

9
SCIENTIFIC REPORTS | (2019) 9:6600 | https://doi.org/10.1038/s41598-019-42671-3
www.nature.com/scientificreports
www.nature.com/scientificreports/
12. Dozmorov, I. & Miller, . A. In Vitro Production of Antigen-Specic T Cells from Unprimed Mice: ole of Dexamethasone and
Anti-IL-10 Antibodies. Cellular Immunolog y 178, 187–196, https://doi.org/10.1006/cimm.1997.1134 (1997).
13. van Mens, S. P. et al. Dexamethasone Treatment Has No Eect on the Formation of Pneumococcal Antibodies during Community-
Acquired Pneumonia. Clinical and Vaccine Immunology 19, 811–813, https://doi.org/10.1128/cvi.05697-11 (2012).
14. Wang, X. et al. A competitive photoelectrochemical immunosensor based on a CdS-induced signal amplication strategy for the
ultrasensitive detection of dexamethasone. Scientic reports 5,17945 (2015).
15. Sefah, . et al . Nucleic acid aptamers for biosensors and bio-analytical applications. Analyst 134, 1765–1775 (2009).
16. Ellington, A. D. & Szosta, J. W. In vitro selection of NA molecules that bind specic ligands. nature 346, 818 (1990).
17. Tuer, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: NA ligands to bacteriophage T4 DNA polymerase.
Science 249, 505–510 (1990).
18. Buna, D. H. & Stocley, P. G. Aptamers come of age-at last. Nature reviews. Microbiology 4, 588 (2006).
19. Li ang, H.-. et al. Selection of an aptamer against rabies virus: a new class of molecules with antiviral activity. Virus research 184,
7–13 (2014).
20. Maehashi, . et al. Label-free protein biosensor based on aptamer-modied carbon nanotube eld-eect transistors. Analytical
Chemistry 79, 782–787 (2007).
21. Vega-Figueroa, . et al. Aptamer-Based Impedimetric Assay of Arsenite in Water:Interfacial Properties and Performance. ACS
Omega 3, 1437–1444, https://doi.org/10.1021/acsomega.7b01710 (2018).
22. atsouras, I. et al. Transverse charge transport through DNA oligomers in large-area molecular junctions. Nanoscale 5, 9882–9887,
https://doi.org/10.1039/C3N03183G (2013).
23. Dmitri, Y. et al. Quantitative Analysis and Characterization of DNA Immobilized on Gold. J. Am. Chem. Soc. 125(17), 5219–5226,
https://doi.org/10.1021/ja029450c (2003).
24. Taverniers, I., De Loose, M. & Van Bocstaele, E. Trends in quality in the analytical laboratory. II. Analytical method validation and
quality assurance. TrAC Trends in Analytical Chemistry 23, 535–552 (2004).
25. Simossis, V., leinjung, J. & Heringa, J. Homology-extended sequence alignment. Nucleic Acids Research 33, 816–824 (2005).
26. Zuer, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic acids research 31, 3406–3415 (2003).
27. Song, Y. ., Par, J. S., im, J. . & im, C. . HPLC Determination of Dexamethasone in Human Plasma. Journal of Liquid
Chromatography & Related Technologies 27, 2293–2306, https://doi.org/10.1081/JLC-200025726 (2004).
28. Jeyaseelan, C. & Joshi, A. Trace determination of dexamethasone sodium phosphate in pharmaceutical formulations by dierential
pulse polarography. Analytical and Bioanalytical Chemistry 373, 772–776, https://doi.org/10.1007/s00216-002-1408-6 (2002).
29. Oliveira, T. M. B. F., ibeiro, F. W. P., Soares, J. E. S., de Lima-Neto, P. & Correia, A. N. Square-wave adsorptive voltammetry of
dexamethasone: edox mechanism, inetic properties, and electroanalytical determinations in multicomponent formulations.
Analytical Biochemistry 413, 148–156, https://doi.org/10.1016/j.ab.2011.02.033 (2011).
Acknowledgements
This work was supported through funding from the Natural Science and Engineering Research Council of
Canada (NSERC), the Canada Research Chairs program (CRC) and Canada Foundation for Innovation and Le
Fonds de Recherche du Quebec -Nature et Technologies (FQRNT).
Author Contributions
S.M., S.P. and M.S. conceived the idea of this work. S.M. designed and performed the experiments, analyzed the
data and wrote the manuscript. S.P. helps for the electrochemical measurements and the sensors conception.
G.C.J. was involved in all discussions during the project. All authors reviewed the manuscript.
Additional Information
Supplementary information accompanies this paper at https://doi.org/10.1038/s41598-019-42671-3.
Competing Interests: e authors declare no competing interests.
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and
institutional aliations.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International
License, which permits use, sharing, adaptation, distribution and reproduction in any medium or
format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre-
ative Commons license, and indicate if changes were made. e images or other third party material in this
article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the
material. If material is not included in the article’s Creative Commons license and your intended use is not per-
mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the
copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
© e Author(s) 2019
Content courtesy of Springer Nature, terms of use apply. Rights reserved

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com