- Access to this full-text is provided by Springer Nature.
- Learn more
Download available
Content available from Scientific Reports
This content is subject to copyright. Terms and conditions apply.
1
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
Dietary Sargassum fusiforme
improves memory and reduces
amyloid plaque load in an
Alzheimer’s disease mouse model
Jeroen Bogie1, Cindy Hoeks1, Melissa Schepers1,9, Assia Tiane1,9, Ann Cuypers2, Frank Leijten3,
Yupyn Chintapakorn4, Thiti Suttiyut4, Surachai Pornpakakul5, Dicky Struik6, Anja Kerksiek7,
Hong-Bing Liu8, Niels Hellings1, Pilar Martinez-Martinez9, Johan W. Jonker6, Ilse Dewachter1,
Eric Sijbrands
3, Jochen Walter10, Jerome Hendriks1, Albert Groen11, Bart Staels12,
Dieter Lütjohann7, Tim Vanmierlo
1,9 & Monique Mulder3
Activation of liver X receptors (LXRs) by synthetic agonists was found to improve cognition in
Alzheimer’s disease (AD) mice. However, these LXR agonists induce hypertriglyceridemia and hepatic
steatosis, hampering their use in the clinic. We hypothesized that phytosterols as LXR agonists enhance
cognition in AD without aecting plasma and hepatic triglycerides. Phytosterols previously reported
to activate LXRs were tested in a luciferase-based LXR reporter assay. Using this assay, we found that
phytosterols commonly present in a Western type diet in physiological concentrations do not activate
LXRs. However, a lipid extract of the 24(S)-Saringosterol-containing seaweed Sargassum fusiforme
did potently activate LXRβ. Dietary supplementation of crude Sargassum fusiforme or a Sargassum
fusiforme-derived lipid extract to AD mice signicantly improved short-term memory and reduced
hippocampal Aβ plaque load by 81%. Notably, none of the side eects typically induced by full synthetic
LXR agonists were observed. In contrast, administration of the synthetic LXRα activator, AZ876, did
not improve cognition and resulted in the accumulation of lipid droplets in the liver. Administration
of Sargassum fusiforme-derived 24(S)-Saringosterol to cultured neurons reduced the secretion of
Aβ42. Moreover, conditioned medium from 24(S)-Saringosterol-treated astrocytes added to microglia
increased phagocytosis of Aβ. Our data show that Sargassum fusiforme improves cognition and
alleviates AD pathology. This may be explained at least partly by 24(S)-Saringosterol-mediated LXRβ
activation.
1Department of Immunology and Biochemistry, Biomedical research institute, Hasselt University, Martelarenlaan 42,
3500, Hasselt, Belgium. 2Centre for Environmental Sciences, Hasselt University, Martelarenlaan 42, 3500, Hasselt,
Belgium. 3Department of Internal Medicine, Laboratory of Vascular Medicine, Erasmus University Medical Center,
Wytemaweg 80, 3015 CN, Rotterdam, The Netherlands. 4Center of Excellence in Environment and Plant Physiology,
Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok, 10330, Thailand. 5Department
of Chemistry, Faculty of Science, Chulalongkorn University, Bangkok, 10330, Thailand. 6Section of Molecular
Metabolism and Nutrition, Department of Pediatrics, University of Groningen, University Medical Center Groningen,
Hanzeplein 1, 9713 GZ, Groningen, The Netherlands. 7Institute for Clinical Chemistry and Clinical Pharmacology,
Sigmund-Freud-Str. 25, D-53127, Bonn, Germany. 8Key Laboratory of Marine Drugs, Ministry of Education, School
of Medicine and Pharmacy, Ocean University of China, Yushan Road 5, 266003, Qingdao, China. 9School for mental
health and neuroscience, Maastricht University, Universiteitssingel 50, 6229ER, Maastricht, The Netherlands.
10Department of Neurology, Molecular Cell Biology, University of Bonn, Sigmund-Freud-Str. 25, 53127, Bonn,
Germany. 11Department of Medical Biochemistry, Academic Medical Center, University of Amsterdam, Meibergdreef
9, 1105 AZ, Amsterdam, The Netherlands. 12University of Lille - EGID, Inserm, U1011, University Hospital CHU,
Institut Pasteur de Lille, F-59019, Lille, France. Jeroen Bogie, Cindy Hoeks, Tim Vanmierlo and Monique Mulder
contributed equally. Correspondence and requests for materials should be addressed to T.V. (email: tim.vanmierlo@
uhasselt.be)
Received: 1 August 2018
Accepted: 5 March 2019
Published: xx xx xxxx
OPEN
Content courtesy of Springer Nature, terms of use apply. Rights reserved
2
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
Alzheimer’s disease (AD) is a progressive neurological disorder characterized by an accumulation of extracellular
amyloid-β (Aβ), intracellular neurobrillary tangles, loss of synapses, neuroinammation, and by a gradual pro-
gression of memory loss1. Accumulating evidence suggests a role for a disturbed cholesterol turnover in the cen-
tral nervous system (CNS) in AD pathogenesis2–11. In line with this, stimulation of cholesterol turnover improves
disease outcome in animal models of AD2,12–18. Liver X receptors (LXR) are master regulators of cholesterol and
triglyceride turnover and suppress an inammatory transcriptional prole via trans-repression of NFκB signa-
ling19. erefore, LXRs are promising well-studied therapeutic targets for increasing cholesterol turnover and
decreasing neuroinammation in AD20–24. We and others have reported that synthetic pan LXR agonists improve
the cognitive phenotype in animal models of AD, decrease synaptic compensatory mechanisms, and stimulate
the proteolytic degradation of Aβ by microglia2,13,14,24–26. However, synthetic full LXR agonists systematically
cause adverse side eects, such as hypertriglyceridemia and hepatic steatosis, hampering their translation to the
clinic27–30.
Phytosterols are structurally similar to cholesterol. However, in contrast to cholesterol, they can cross the
blood-brain barrier (BBB) and accumulate in brain parenchyma11,31–33. Several of the more than 260 identied
phytosterols, such as β-sitosterol, fucosterol, stigmasterol, schottenol, 24(S)-Saringosterol, and spinasterol, have
been reported to activate LXRs in vitro34–39. Moreover, β-sitosterol and stigmasterol modulate AD pathology in
in vitro models for AD40–42. Phytosterols do not induce hypertriglyceridemia and hepatic steatosis, which may be
a consequence of their ABCG5/G8-mediated hepatic excretion into the bile11,43,44. e absence of unwanted side
eects renders phytosterols interesting therapeutic candidates for inducing LXR activation in the CNS.
We aim to identify phytosterols and phytosterol-containing extracts that activate LXRs in vitro, to test their
eect on memory performance and Aβ plaque pathology in an animal model of AD. We found that phytos-
terols typically present in a Western type diet or extracts from a range of Eastern plants hardly activate LXRα
Figure 1. A crude lipid extract of Sargassum fusiforme activates LXRβ. LXRα (a) and LXRβ (b) activation was
assessed with a luciferase-based reporter assay. CHME3 cells were stimulated for 18 hours with vehicle (striped
bar/dotted line), 1, 3, or 5 µg/μl Sargassum fusiforme or 1, 10 or 100 µg/μl of the specied plant extracts. No
dierence was found between groups (LXRα χ2(7) = 11.55, p = 0.1165, LXRβ χ2(7) = 7.689, p = 0.3608; all
datasets analysed using Kruskal-Wallis test). All results are displayed as fold change compared to vehicle control
(striped bar/dotted line). Bars represent mean ± SEM (n ≥ 3).
Content courtesy of Springer Nature, terms of use apply. Rights reserved
3
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
or LXRβ. In contrast, a lipid extract of the edible brown seaweed Sargassum fusiforme which contains large
amounts of 24(S)-Saringosterol potently activated LXRβ. In a mouse model for AD, dietary supplementation
with Sargassum fusiforme or its lipid extract not only increased the expression of LXR response genes in the CNS,
but also improved cognition without inducing hepatic steatosis. Improved memory performance in these mice
was paralleled by a strong reduction in CNS Aβ plaque load. In contrast, the selective LXRα agonist AZ876 did
not counteract cognitive decline in AD mice or reduce Aβ plaque load, and induced liver steatosis. ese ndings
indicate that Sargassum fusiforme is an attractive option for add-on treatments in the emerging eld of nutritional
neuroscience.
Results
Phytosterols present in a Western diet do not activate LXRs. First, we determined the capacity of
phytosterols typically present in a Western diet to activate LXRs. To dene cellular specicity in LXR activation in
vitro, cells derived from peripheral tissues (HEK293.T and COS7) and the CNS (CHME3, MO3.13, N2a/APPswe)
were tested. Physiologically relevant concentrations of stigmasterol, fucosterol, brassicasterol, β-sitosterol, or a
mix of phytosterols did not activate LXRα or LXRβ in any of the cell lines used (Fig.S2). An increased incubation
period promoted the capacity of the synthetic LXR agonist T0901317, but not of phytosterols, to activate LXRα
and LXRβ (Fig.S3a,b). Although cellular uptake of phytosterols and their capacity to activate nuclear receptors
improves when complexed to proteins45,46, pre-incubation of phytosterols with BSA did not signicantly increase
their ability to activate LXRα and LXRβ (Fig.S3c,d).
An extract of Sargassum fusiforme activates LXRβ in vitro. In addition to phytosterols present in
a Western diet, crude extracts of Eastern plants were screened for their capacity to activate LXRα or LXRβ.
Plants were chosen based on their application in Asian traditional medicine and their presence in an Eastern diet.
Extracts from Asparagus racemosus, Azadirachta indica, Cassia stula, Curcuma aromatica, Datura metel, Piper
retrofractum, Senna tora, and Terminalia chebula did not signicantly activate either LXRα or LXRβ in microglial
CHME3 cells (Fig.1). However, at a dose of 5 µg/ml an extract of Sargassum fusiforme containing the recently
identied LXRβ agonist 24(S)-Saringosterol34 signicantly activated LXRβ but not LXRα (Fig.1). Higher doses of
Sargassum fusiforme induced cell death (data not shown). As Sargassum fusiforme showed the highest capacity to
activate LXRβ, it was selected for further in vivo testing.
Dietary supplementation with Sargassum fusiforme results in 24(S)-Saringosterol accumula-
tion in the cerebellum and activation of LXR-response genes in AD mice. To assess in vivo eects
Figure 2. Dietary supplementation with Sargassum fusiforme activates LXRs in the brain. Gene expression
of Abcg1 (a), Scd1 (b), Srebp-1c (c), Abca1 (d), and ApoE (e) was measured in the brain of WT and
APPswePS1ΔE9 mice (AD) fed normal chow or chow supplemented with Sargassum fusiforme. Two-way
ANOVA revealed a diet eect for Abcg1 (F (1, 17) = 6.244, p = 0.0230)), and Scd1 (F (1, 15) = 7.673, p = 0.0143),
and a genotype eect for Srebp-1c (F (1, 16) = 8.446, p = 0.0103). Gene expression was normalized to Cyca and
Hmbs, and expressed as fold change compared to WT mice fed the control diet. Bars represent mean ± SEM
(n ≥ 5).
Content courtesy of Springer Nature, terms of use apply. Rights reserved
4
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
Figure 3. Dietary supplementation with Sargassum fusiforme reduces serum cholesterol, and increases 24(S)/
(R)-Saringosterol in serum and cerebellum. Concentrations of 24(S)/(R)-Saringosterol (a,b), cholesterol
(c,d), cholesterol precursors (e,f), cholesterol metabolites (g,h), and phytosterols (i,j) were determined in
serum and cerebellum samples of WT and APPswePS1ΔE9 mice (AD) fed either control chow or chow
supplemented with Sargassum fusiforme. 24(S)/(R)-Saringosterol concentration was aected by diet in CNS
(F(1, 31) = 438.8, p < 0.0001) and serum (F(1, 31) = 30.05, p < 0.0001) as determined by ANOVA, and
post-hoc Sidak’s test showed that this eect existed in both genotypes (WT CNS: p < 0.0001; WT serum:
p = 0.0005; AD CNS: p < 0.0001; AD serum: p = 0.0157). Cholesterol concentration in serum was aected
by diet (F(3, 31) = 80.59, p < 0.0001) for both genotypes (WT: p < 0.001; AD: p = 0.0002). Regarding the
cholesterol precursors, concentration of lanosterol was aected by diet in CNS (F(1, 32) = 6.463, p = 0.0161)
and serum (F(1, 31) = 38.28, p < 0.0001) of WT animals (CNS: p = 0.0265; serum: p = 0.0002) and AD animals
(serum: p = 0.0024). Concentration of lathosterol was aected by diet in CNS (F(1, 32) = 19.32, p = 0.0001)
and serum (F(1, 31) = 13.42, p = 0.0009) of WT animals (CNS: p = 0.0076; serum: p = 0.0474). Regarding
the cholesterol metabolites, concentration of 27-hydroxycholesterol (27OHC) was aected by diet in CNS
(F(1, 32) = 20.04, p = 0.0009) of WT animals (p = 0.0004). Concentration of 24(S)-hydroxycholesterol (24(S)
OHC) was aected by diet in CNS (F(1, 31) = 8.071, p = 0.0079) of WT animals (p = 0.0079). Regarding the
Content courtesy of Springer Nature, terms of use apply. Rights reserved
5
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
of Sargassum fusiforme APPswePS1ΔE9 mice were used as a model of AD47. ese mice begin to develop Aβ
plaques at 4 months of age and cognitive decline occurs from 6 months onwards48,49. From the age of 5 months
APPswePS1ΔE9 mice and WT littermates were fed either standard chow or chow supplemented with 50%
(w/w) dried crude Sargassum fusiforme. Ten weeks of Sargassum fusiforme dietary supplementation resulted in
LXR activation in the CNS, evidenced by a cerebral induction of LXR response genes (Abcg1, Scd1) (Fig.2a,b).
ApoE, Srebp-1c, and Abcg1 expression was not altered in animals treated with Sargassum fusiforme (Fig.2c–e).
Interestingly, 24(S)/(R)-Saringosterol was detectable in serum and in the cerebellum of animals that were fed
Sargassum fusiforme, but not in those fed normal chow (Fig.3a,b). As Sargassum fusiforme contains predomi-
nantly 24(S)-Saringosterol34, we postulate that this isoforms is the most abundant isoform present in animals fed
Sargassum fusiforme. Animals fed a diet supplemented with Sargassum fusiforme did not show dierences in total
cholesterol content in the cerebellum (Fig.3c), but showed a marked reduction in circulating cholesterol levels
compared to chow fed animals (Fig.3d). Levels of cholesterol precursors, cholesterol metabolites, and phytoster-
ols were decreased in serum and cerebellum of animals supplemented with Sargassum fusiforme (Fig.3e–j). On a
standard chow diet, WT mice displayed signicantly higher serum cholesterol levels than AD mice (Fig.3d), as
described previously10,50.
Sargassum fusiforme improves memory and reduced Aβ plaque load in AD mice. Next, we inves-
tigated the impact of dietary supplementation with crude Sargassum fusiforme on cognition and neuropathology
in APPswePS1ΔE9 mice. To assess the inuence of selective LXRα activation on cognition, animals were fed
with the synthetic selective LXRα agonist AZ876. e open eld test revealed no eect of genotype or diet on
general locomotor activity, and anxiety (Table1). Dietary supplementation with Sargassum fusiforme signicantly
improved object memory in APPswePS1ΔE9 mice in the object recognition task (ORT) at a 1 h but not a 24 h
inter-trial interval (Fig.4a,b). In contrast, selective LXRα activation did not impact object memory at either the
1 h or 24 h inter-trial interval. Sargassum fusiforme, but not AZ786, markedly decreased Aβ plaque load in the
cortex (70% decrease; Fig.4c,e) and hippocampus (81% decrease; Fig.4d,e) in APPswePS1ΔE9 mice. In con-
cordance, Sargassum fusiforme supplementation reduced Aβ40 protein and APP mRNA expression in the CNS
of AD animals (Fig.4f,h). Sargassum fusiforme did not signicantly reduce insoluble Aβ42 (Fig.4g). Reduced
Aβ plaque load was not associated with an increased expression of phagocytic receptors such as Axl and MerTK
(Fig.S4a,b)51. Yet, the reduced Aβ plaque load was associated with a reduced TREM2 expression, reecting the
expelled need for further Aβ clearance (Fig.S4c).
To determine whether the lipid moiety of Sargassum fusiforme was sucient to modulate the AD-related
pathology, a puried lipid extract of Sargassum fusiforme was administered daily by oral gavage to APPswePS1ΔE9
and WT littermates for 45 days. Working memory was signicantly improved in APPswePS1ΔE9 mice, resulting
in the prevention of the spatial working decit (Fig.5a,b). In line with these ndings, a signicant reduction in
insoluble Aβ42 was observed in the cortex (99% decrease; Fig.5c) and hippocampus (57% decrease; Fig.5d) of the
treated APPswePS1ΔE9 mice. Notably, treatment with the Sargassum fusiforme lipid extract resulted an increased
expression of ApoE in the CNS (Fig.5e–g), which indicates active LXR signaling.
Sargassum fusiforme feeding does not lead to liver steatosis. While synthetic LXR agonists are
well-known to induce liver steatosis in mice52, Sargassum fusiforme supplementation did not induce liver steatosis
in APPswePS1ΔE9 mice, as evidenced by the absence of lipid droplets within the liver of these animals (Fig.6a,b).
Supplementation with AZ876 resulted in a marked increase in lipid droplets in the liver (Fig.6a,b). Likewise,
while AZ876 increased circulating triglyceride levels, Sargassum fusiforme did not impact the level of triglycerides
(Fig.6c). Similar ndings were observed in WT mice fed chow supplemented with Sargassum fusiforme or AZ876
(data not shown). Sargassum fusiforme is known to contain relatively high levels of (in)organic arsenic that can
accumulate in the body53. Although relatively high levels of arsenic were measured in dried Sargassum fusiforme
(40.4 mg/kg), no arsenic accumulation was detectable in lung tissue of the animals that consumed Sargassum
fusiforme (Fig.6d).
24(S)-Saringosterol increases microglial Aβ clearance and reduces neuronal Aβ release. To
obtain insight into the mechanisms by which Sargassum fusiforme-derived 24(S)-Saringosterol impacts AD patho-
genesis we used well-established in vitro models that mimic AD-related pathological processes. Supplementation
of astrocytes with 24(S)-Saringosterol resulted in an increased ApoE secretion (Fig.7a,b). Furthermore, supple-
mentation of microglia with conditioned medium of 24(S)-Saringosterol-treated astrocytes promoted microglial
clearance of Aβ1−42 (Fig.7c). 24(S)-Saringosterol did not directly impact the capacity of microglia to internalize
Aβ1−42. (Fig.7d). Finally, 24(S)-Saringosterol was found to reduce the release of Aβ42 using neuronal N2a cells
overexpressing APP (Fig.7e).
plant sterols, concentration of sitosterol was aected by diet in CNS (F(1, 32) = 30.62, p < 0.0001) and serum
(F(1, 31) = 96.88, p < 0.0001) of WT animals (CNS: p = 0.0026; serum: p < 0.0001) and AD animals (CNS:
p = 0.0028; serum: p < 0.0001). Concentration of campesterol was aected by diet in CNS (F(1, 32) = 17.02,
p = 0.0002) and serum (F(1, 31) = 76.4, p < 0.0001) of WT animals (CNS: p = 0.0175; serum: p < 0.0001) and
AD animals (serum: p < 0.0001). Concentration of stigmasterol was aected by diet in serum (F(1, 31) = 99.89,
p < 0.0001) of WT animals (p < 0.0001) and AD animals (p < 0.0001). Bars represent mean ± SEM (n = 5).
Abbreviations:7aOHC 7a-hydroxycholesterol.
Content courtesy of Springer Nature, terms of use apply. Rights reserved
6
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
Discussion
Our data show that dietary supplementation with the brown seaweed Sargassum fusiforme improves cognitive
function and reduces Aβ load in APPswePS1ΔE9 mice without inducing liver steatosis. Our data further sug-
gest the involvement of the stereospecic oxyphytosterol 24(S)-Saringosterol, a selective LXRβ activator, in the
observed eects on cognition and Aβ plaque load. Considering that selective LXRα activation did not improve
cognitive decline or Aβ plaque deposition in APPswePS1ΔE9 mice, our ndings suggest that natural and possibly
also synthetic LXRβ agonists are attractive options for the treatment of neurodegenerative disorders such as AD.
Phytosterols, which can cross the blood-brain barrier, have been reported to activate LXRs without inducing
hypertriglyceridemia and hepatic steatosis, rendering them potentially suitable candidates for treatment of neu-
rodegenerative disorders11. Yet, in contrast with reported data on LXR activation by phytosterols common in a
Western diet34–39, we observed very little if any eect of stigmasterol, brassicasterol, β-sitosterol, fucosterol, or a
commercial mix of phytosterols, on activation of LXRα and LXRβ in vitro. e discrepancy between our data and
the literature may be explained by dierences in the experimental design, such as phytosterol concentration, incu-
bation time, and cell type and assay used to measure LXR activation. For instance, we used a cell-based luciferase
reporter assay and CNS-derived cell lines, as well as HEK293.T and COS-7 cells, to dene LXR activation and
cellular specicity in LXR activation, while other studies used cell-free assays38. Furthermore, we used phytosterol
concentrations in a physiological range that can be reached through dietary supplementation (1–25 µM), whereas
other studies used concentrations far exceeding this physiological range up to 200 µM36. Of note, compared to
synthetic LXR agonists, the reported ability of phytosterols commonly present in a Western diet to activate LXRs
is relatively limited34–39. In line with this, no alterations were observed in the expression of LXR-response genes
in the brain of ABCG5-knockout mice despite high cerebral levels of common phytosterols26. In summary, our
data indicate that phytosterols present in a Western type diet do not activate LXRs at concentrations that can be
reached through dietary supplementation11.
Out of the tested extracts of Asian plants, the extract of Sargassum fusiforme most potently activated LXRβ
in vitro. This is in line with the recently reported LXRβ-activating effects of Sargassum fusiforme-derived
24(S)-Saringosterol34. In Sargassum fusiforme–fed animals, 24(S)-Saringosterol was detected in the cere-
bellum in concentrations equal to common oxysterols, suggesting a good CNS bioavailability. The amount
of 24(S)-Saringosterol detected in the CNS was comparable to previously reported concentrations of other
dietary phytosterols in the CNS26,32,33. With respect to these findings, we found that cerebral expression of
LXR-response genes was upregulated in animals fed Sargassum fusiforme-enriched chow, further supporting the
ability of Sargassum fusiforme to activate LXRβ. e route of entry of 24(S)-Saringosterol to the CNS remains
unclear. Further research is warranted to dene the role of ApoE and SR-B1 in facilitating the transport of
24(S)-Saringosterol into the CNS11,32. Moreover, since 24(S)-Saringosterol is oxydated plant sterol, we hypoth-
esize that 24(S)-Saringosterol can enter the CNS via transcellular diusion, comparable to other oxidized cho-
lesterol derivatives such as 24(S)-Hydroxycholesterol54. Interestingly, in contrast to 24(S)-Saringosterol, all plant
sterol concentrations decreased in serum and CNS upon feeding Sargassum fusiforme. It can be hypothesized that
24(S)-Saringosterol activates intestinal and hepatic Abcg5/g8 transporters and thereby drives the enterohepatic
secretion of plant sterols, thereby lowering circulating levels of sterols55. e latter hypothesis is in line with the
strong reduction in circulating cholesterol levels we found in this study.
Our data indicate that the LXRα selective agonist AZ876 does not signicantly counteract cognitive decline
or reduce Aβ plaque load in APPswePS1ΔE9 mice. However, no active LXR signaling was found in the CNS of
AZ876 treated animals, which suggest poor CNS bioavailability of AZ876 and consequently does not allow us to
conclude that LXRα activation does not impact AD pathology. On the other hand, while both LXRα and LXRβ
are expressed in the murine CNS, expression of LXRβ is 15-fold higher compared to LXRα56,57. Hence, the relative
contribution of LXRα activation upon full-LXR agonist treatment is therefore expected to be limited. e latter
studies may suggest that the benecial impact of pan-LXR agonists on cognitive decline in AD models likely relies
on LXRβ activation.
Synthetic LXR agonists that reduce AD pathology and improve cognitive performance induce hypertriglycer-
idemia and liver steatosis2,13,14,24,25,27–30. Sargassum fusiforme supplementation counteracted cognitive decline of
APPswePS1ΔE9 transgenic mice without inducing hepatic steatosis. is may be explained by selective hepatic
LXRβ activation, since animals fed AZ786 (2 mg/kg body weight) displayed a marked increase of liver lipid drop-
lets, indicative of liver steatosis. Alternatively, the presence of other protective compounds present in Sargassum
fusiforme such as fucosterol may prevent hepatic steatosis11. is is supported by the observation that activation
of LXRβ by synthetic agonists was also reported to induce plasma and hepatic hypertriglyceridemia58.
Genotype Diet TIZ
centre (s) TIZ walls and
corners (s) DM (m) N
WT Control 29.5 ± 7.7 570 ± 7.7 36.1 ± 1.6 12
AD Control 29.4 ± 4.2 569.6 ± 4.3 39.0 ± 1.9 13
WT S. fusiforme 30.9 ± 3.4 564.9 ± 4.3 42.0 ± 1.9 9
AD S. fusiforme 33.5 ± 4.1 564.9 ± 5.2 47.6 ± 2.0 7
WT AZ876 28.3 ± 4.3 569.2 ± 4.9 37.3 ± 2.4 11
AD AZ876 31.7 ± 6.4 567.2 ± 6.4 39.9 ± 2.7 13
Table 1. Genotype and diet do not impact general locomotor activity or anxiety levels. Results of open eld test.
Values are displayed as mean ± SEM. Abbreviations: TIZ, time in zone; DM, distance moved.
Content courtesy of Springer Nature, terms of use apply. Rights reserved
7
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
Figure 4. Dietary supplementation with Sargassum fusiforme reduces cognitive decline and Aβ plaque
load in APPswePS1ΔE9 mice. (a,b) Cognitive functioning was determined using the object recognition
task. e interval between rst and second trial was set at 1 hour (1 h ITI) or 24 hours (24 h ITI). D2 value is
calculated as the ratio between exploration time spent at the new object and the familiar object in the second
trial, with d2 value > 0 indicating intact object memory. At 1 h ITI the object memory was found to be intact
in WT animals on control diet (t(9) = 4.71, p = 0.0011, one sample t-test), in WT animals on Sargassum
fusiforme-supplemented diet (t(9) = 2.166, p = 0.0585, one sample t-test), and in AD animals on Sargassum
fusiforme-supplemented diet (t(8) = 2.77, p = 0.0243, one sample t-test). Bars represent mean ± SEM from
two independent experiments (n ≥ 9 per treatment). (c–e) Aβ plaque load was quantied in cortex (d) and
hippocampus (e) of APPswePS1ΔE9 mice using immunohistochemistry (n ≥ 5 per treatment). Aβ load is
calculated as percentage of surface coverage, and was found to be decreased in AD animals fed Sargassum
fusiforme-enriched chow in cortex (F (3, 24) = 25.79, p < 0.0001, ANOVA; Tukey’s post-hoc for diet eect in
AD genotype: p = 0.0005) and hippocampus (F (3, 24) = 32.13, p < 0.0001, ANOVA; Tukey’s post-hoc for diet
Content courtesy of Springer Nature, terms of use apply. Rights reserved
8
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
We show that dietary supplementation with crude or lipid extract of Sargassum fusiforme reduces Aβ load in
AD mice. Our in vitro data indicate that factors released by 24(S)-Saringosterol-treated astrocytes promote micro-
glial clearance of Aβ1–42. Within the brain, astrocytes are the major source of the LXR response gene Apoe. ApoE
is well-known to increase microglial clearance of Aβ59, possibly via inhibiting cellular uptake of Aβ60. Of interest,
24(S)-Saringosterol and a lipid extract of Sargassum fusiforme increased ApoE protein expression in astrocytes
and the CNS respectively, which suggests a role for ApoE in the observed increase in microglial Aβ clearance. In
addition, we provide evidence that 24(S)-Saringosterol decreases the release of Aβ by neurons in vitro. Together,
these ndings indicate that 24(S)-Saringosterol impacts both the clearance and generation of Aβ42. ese ndings
are of particular interest, as benecial eects of LXR agonists on cognition are not necessarily accompanied by a
reduced Aβ plaque load14,41. Recently, it has been reported that other constituents of Sargassum fusiforme, such as
fucosterol, fucoidan, and fucoxantin improve learning and memory deciencies in pharmacological models for
cognitive impairment61–63. Although synergism among constituents of Sargassum fusiforme is likely, future studies
should determine whether 24(S)-Saringosterol is sucient to improve cognitive performance and AD pathology.
Although relatively high levels of arsenic were measured in extracts of Sargassum fusiforme, no arsenic was
detectable in lung tissue, which generally represents a major reservoir for this element64. Arsenic present in
Sargassum fusiforme may therefore be rapidly excreted, degraded or absorbed in low amounts in the intestine.
In summary, our data indicate that phytosterols present in a Western type diet do not activate LXRs at con-
centrations that can be reached through dietary supplementation. However, a crude lipid extract of the edible
seaweed Sargassum fusiforme did selectively activate LXRβ in vitro. Here, we show for the rst time that dietary
supplementation with Sargassum fusiforme signicantly improves memory performance and reduces Aβ plaque
load in a well-established AD model. e accumulation of the natural LXRβ agonist 24(S)-Saringosterol in the
CNS suggests its involvement in the neuroprotective impact of Sargassum fusiforme. Collectively, our ndings
point to 24(S)-Saringosterol-containing Sargassum fusiforme as being a novel candidate for dietary supplementa-
tion to prevent or modulate neurodegenerative disorders such as Alzheimer’s disease.
Materials and Methods
Preparation of plant extracts. Indigenous Asian plants (Asparagus racemosus, Azadirachta indica, Cassia
stula, Curcuma aromatica, Datura metel, Piper retrofractum, Sargassum fusiforme, Senna tora, and Terminalia
chebula), were selected based on their use in Asian traditional medicine as cognition enhancers. Extracts from
all plants, with exception of Sargassum fusiforme, were prepared by the maceration method. All plants were dried
in a hot air oven at 50 °C. e dried samples were nely powdered and soaked in 95% ethanol overnight at room
temperature and ltered with Whatman lter paper No. 3 (Sigma-Aldrich, Bornem, Belgium). ree consecutive
ltrates were pooled and evaporated in a vacuum rotary evaporator at 40 °C. e crude lipid fraction of Sargassum
fusiforme was extracted using an adaptation of the Folch method65. Briey, Sargassum fusiforme was harvested
by hand in early spring, washed in sea water, boiled for three hours and dried in a hot air oven. Next, dried
Sargassum fusiforme (Clearspring Ltd, London, UK) was soaked overnight at room temperature in a 2:1 (v/v)
chloroform and methanol (both VWR, Leuven, Belgium) mixture. e chloroform/methanol extract was evap-
orated under a N2 stream and the remaining lipid fraction was dissolved in ethanol. Using gas chromatography/
mass spectrometry, 24(S)-Saringosterol content of dried Sargassum fusiforme was determined to be 69.4 ng/mg.
Cell culture. Immortalized human embryonic kidney cells (HEK293.T), human microglia (CHME3; a kind
gi from prof. dr. M. Tardieu, Universite Paris-Sud, France66), human oligodendrocytes (MO3.13), mouse neu-
roblastoma expressing APPswe (N2a/APPswe; a kind gi from prof. dr. T.W. Kim, Colombia University, USA67),
and monkey kidney cells (COS7) were used for in vitro experiments. All cell lines were cultured in DMEM
(Sigma-Aldrich) containing 10% heat-inactivated FCS (Invitrogen, Merelbeke, Belgium) and 100 U penicil-
lin/100 µg streptomycin/ml (Invitrogen), at 37 °C/5% CO2. For phytosterol treatment, cells were incubated for
18 hours in culture medium without FCS containing the Eastern plants extracts, brassicasterol (Sigma-Aldrich),
β-sitosterol, (Sigma-Aldrich), fucosterol (Sigma-Aldrich), stigmasterol (analytic conrmed purity of 99,9%), phy-
tosterol mix (containing 60% β-sitosterol, 25% campesterol, and 15% stigmasterol; kindly provided by Ingmar
Wester Raisio, Finland), T0901317 (Cayman Chemicals, Huissen, the Netherlands), ethanol (VWR), or DMSO
(Sigma-Aldrich).
Luciferase-based nuclear receptor reporter assay. To determine the ability of plant extracts and
phytosterols to bind LXRα and LXRβ, a luciferase-based reporter assay was performed using the ONE-GloTM
Luciferase Assay System kit (Promega, Leiden, the Netherlands), according to manufacturer’s instructions. Cell
lines were transfected with bacterial plasmid constructs expressing luciferase under control of the promotor region
of the ligand-binding domain for LXRα or LXRβ68. Cells were grown to 50–60% conuency in 60 mm plates,
transfected with 1.8 μg of plasmid DNA including 0.2 μg pGAL4hLXRα or pGAL4hLXRβ, 1 μg pG5-TK-GL3, and
0.6 μg of pCMV-β-galactosidase, using JetPEI (Polyplus-transfection SA, Illkirch, France) as transfection reagent.
Following treatment, cells were lysed in lysis buer (25 mM Glycyl-Glycine, 15 mM MgSO4, 4 mM EGTA, and
1x Triton; all from Sigma). To correct for transfection ecacy, β-galactosidase activity was measured using lysate
diluted 1:10 in B-gal buer, consisting of 20% 2-Nitrophenyl β-D-galactopyranoside (ONGP; Sigma) and 80%
eect in AD genotype: p < 0.0001). Representative IHC staining of all groups is shown (e). (f,g) Sargassum
fusiforme treated APPswePS1ΔE9 mice show a signicant decrease in Aβ40 ((f); U = 6, nctrl = 11, nextract = 5,
p = 0.0133, Mann-Whitney) but not Aβ42 levels (g). (h) Sargassum fusiforme treated APPswePS1ΔE9 mice show
a signicant decrease in the mRNA expression of APP (U = 0, nctrl = 8, nextract = 4, p = 0.0040, Mann-Whitney).
Content courtesy of Springer Nature, terms of use apply. Rights reserved
9
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
(v/v) Buer Z (0.1 M Na2HPO4, 10 mM KCl, 1 mM MgSO4, and 3.4 µl/ml β-mercaptoethanol; all from Sigma).
Luminescence and absorbance (410 nM) was measured using the FLUOstar Optima (BMG Labtech, Ortenberg,
Germany).
Animals and diet. Male APPswePS1ΔE9 mice (Radboud University Medical Center, Nijmegen47) were
backcrossed with female C57Bl6/J mice (Harlan Netherlands B.V., Horst, The Netherlands) to obtain male
APPswePS1ΔE9 and wild-type (WT) littermates. Animals were housed in a conventional animal facility at
Hasselt University. Two series of animal experiments were conducted, the rst using dietary supplementation of
dried Sargassum fusiforme, and the second using gavage of a lipid extract of Sargassum fusiforme. A timeline of
the animal experiments is depicted in Supplemental Fig.1.
For the rst series, experimental diets consisted of either powdered standard chow (Teklad 2018; Harlan
Netherlands B.V.) or chow supplemented with 50% (w/w) pulverized dried Sargassum fusiforme (Clearspring
Ltd, London, UK) or the synthetic LXRα agonist AZ876 (2 mg/kg body weight, kindly provided by AstraZeneca,
Mölndal, Sweden69). e amount of 24(S)-Saringosterol used was 69.4 ng/mg dried Sargassum fusiforme. Based
on an estimated intake of 7 g dry food/day, the amount of daily 24(S)-Saringosterol corresponds to 242 µg/
day. Animals were divided into three groups and received either the Sargassum fusiforme containing diet
(APPswePS1ΔE9 n = 13; C57Bl6/J n = 10), AZ876 containing diet (APPswePS1ΔE9 n = 14; C57Bl6/J n = 13), or
the control diet (APPswePS1ΔE9 n = 13; C57Bl6/J n = 12) from 5 until 7.5 months of age.
e second batch of animals was divided into two groups and received either the Sargassum fusiforme-derived
lipid extract (APPswePS1ΔE9 n = 9; C57Bl6/J n = 8), or the vehicle (APPswePS1ΔE9 n = 11; C57Bl6/J n = 12)
from 6 until 7.5 months of age. Lipids of Sargassum fusiforme were extracted using the Folch-method65. Briey,
dried Sargassum fusiforme was pulverized and soaked in a 2:1 (v/v) chloroform:methanol (VWR, Leuven,
Figure 5. Dietary supplementation with a lipid extract of Sargassum fusiforme reduces cognitive decline and
Aβ plaque load in APPswePS1ΔE9 mice. (a,b) A Sargassum fusiforme lipid extract was administered by gavage
to determine the impact of Sargassum fusiforme-derived lipids on working memory in the spatial alteration
Y maze. All mice showed an intact working memory at baseline ((a), spatial alteration > 50% (chance level);
WT control p = 0.0002; WT Sargassum fusiforme p = 0.0008; AD control p < 0.0001, AD Sargassum fusiforme
p = 0.0006, one-sample t-test). Upon six weeks of daily treatment (b), the untreated AD group displayed an
impaired working memory (p = 0.085) while wild type mice and Sargassum fusiforme extract-treated mice
retained their working memory (WT control p < 0.0001, WT Sargassum fusiforme p = 0.0018, AD Sargassum
fusiforme p = 0.0008, one-sample t-test). (c,d) e extract-treated APPswePS1ΔE9 mice show a signicant
decrease in formic acid-extracted insoluble Aβ42 levels in the cortex ((c); U = 0, nctrl = 8, nextract = 8, p = 0.0045,
Mann-Whitney) and in the hippocampus ((d); U = 3; nctrl = 7, nextract = 5, p = 0.0177, Mann-Whitney). (e–g)
Mice treated with a lipid extract of Sargassum fusiforme show an increased mRNA (e) expression of ApoE in
their CNS (F (1, 18) = 4.885, p = 0.0403, two-way ANOVA), although the increase in protein expression (f,g)
does not reach signicance. Data are shown as mean ± SEM.
Content courtesy of Springer Nature, terms of use apply. Rights reserved
10
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
Belgium) mixture for 16 hours at room temperature. Next, the mixture was sonicated (10 min), ltered, and
subsequently evaporated by heating the extract until 60 °C. e remaining extract was washed in ethanol, son-
icated (10 min), and evaporated. Finally, the extract was dissolved in corn oil (Vita D’or, the Netherlands) as
vehicle and sonicated prior to in vivo supplementation. Using gas chromatography/mass spectrometry, 24(S)/
(R)-Saringosterol content was measured to be 332 mg/dl (7,744 mM). e extract was administered by daily gav-
age (200 µl/25 g body weight) for a period of 45 days, corresponding to a daily lipid intake of 3.5 g seaweed/day
(664 µg 24(S)/(R)-Saringosterol/day). In a previous study we dened that Sargassum fusiforme contains predom-
inantly 24(S)-Saringosterol34. Hence, we expect that this isoforms is the most abundant isoform present in our
in vivo experiments.
One week prior to the start of the behavioral experiments all animals were housed individually. Animals were
kept at an inverse 12 h light/12 h dark cycle, and behavioral experiments were performed during the dark phase
of the cycle. Cognitive performance was scored blind. All animal procedures were performed in accordance with
institutional guidelines and approved by the ethical committee for animal experiments of Hasselt University.
Behavioral tasks. e object recognition task (ORT) was conducted aer 9 weeks of Sargassum fusiforme
supplementation when the mice were ~8 months old, as described previously70,71. In brief, all animals were habit-
uated to the arena over 2 days, in one trial of 4 min per day. In each habituation trial, two dierent objects were
placed symmetrically in the center of the arena, about 10 cm from the wall. Four dierent objects were available
and at the end of the habituation period each animal had encountered all four objects once. Aer one resting
day, the experiment started. During the rst trial (T1) two identical objects (samples) were placed in the arena.
Aer exploring the samples for 4 min, the animal was placed back in its home cage. Subsequently, aer a pre-
determined delay interval (1 or 24 hours), the second trial of 4 minutes (T2) was performed using one familiar
object from trial 1 and one new object. Exploration time for each object during T1 and T2 was recorded manually
using a personal computer. Sitting on the object or biting in the object was not considered exploratory behavior.
Discrimination index d2 in T2 (d2 = [(exploration time for the novel object) − (exploration time for the familiar
object)]/(total exploration time in T2)) was calculated as measure for object memory.
e Y-maze spontaneous alternation test72 was conducted at baseline and aer 6 weeks of extract treatment.
e maze used for the Y-maze spatial alteration task consisted of three arms of grey Perspec of equal length
(40 × 10 × 15 cm) (labeled A, B and C), separated at an angle of 120°. e animals were free to explore the maze
for 6 minutes. Aerwards, the working memory is calculated in order of percentage of alternations dened as:
(number of triads/(total number of entries −2)) * 100. e number of triads was recorded manually and was
dened as subsequently entering the three dierent arms, while entering an arm was dened as placing both hind
paws in that arm. Aer each trial, the maze was cleaned with 70% ethanol to prevent olfactory cues.
Figure 6. Sargassum fusiforme supplementation does not result in liver steatosis, elevated circulating
triglyceride levels, or arsenic accumulation in the lungs. (a) An ORO staining was performed to dene lipid
droplets in liver samples of APPswePS1ΔE9 mice fed normal chow or Sargassum fusiforme/AZ876-enriched
ch ow. ( b) Quantication of the ORO staining shown in (1) calculated as number of lipid droplets per mm2
of liver tissue. (c) AZ876 but not Sargassum fusiforme increases the circulating levels of triglycerides in and
APPswePS1ΔE9 mice (F (2, 31) = 4.056, p = 0.0272, ANOVA; Tukey’s post-hoc for diet eect: p = 0.0305). (d)
Arsenic was assesed in dried Sargassum fusiforme and lung samples of WT and APPswePS1ΔE9 mice (AD) fed
normal chow or chow supplemented with Sargassum fusiforme.
Content courtesy of Springer Nature, terms of use apply. Rights reserved
11
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
e open eld test (OF) was conducted as described previously73, aer 9.5 weeks of Sargassum fusiforme
treatment. In short, animals were placed in a square, Perspex box (50 cm × 50 cm × 30 cm), with an open top, grey
walls, and a white oor. Video tracking with a computerized system (Etho VisionTM, Noldus, Wageningen, e
Netherlands) was used to record and analyse movements and position of the animals, in order to determine time
in zone (TIZ) and distance moved (DM) over the 10-minute trial14.
Tissue sample preparation. Mice were anaesthetized with Nembutal (100 mg/kg i.p., CEVA Logistics,
Brussels, Belgium) prior to transcardial perfusion with Ringer’s solution. Blood was collected and centrifuged
for 10 min at 200 g to obtain serum, which was snap-frozen in liquid nitrogen. Liver samples were divided into
two parts and either directly snap-frozen or frozen in Tissue-Tek O.C.T embedding compound (Sakura Finetek,
Berchem, Belgium). Brains were divided into three parts prior to snap-freezing; the cerebellum and two hem-
ispheres. The right hemisphere was preserved for immunohistochemistry and frozen in Tissue-Tek O.C.T.
embedding compound. e rostral half of the le hemisphere was preserved for mRNA expression analyses with
quantitative PCR. e cerebellum was preserved for sterol analyses.
Aβ quantication. e right hemisphere of the crude Sargassum fusiforme-treated mice was cut in the coronal
plane with a Leica CM1900UV cryostat (Leica Microsystems, Wetzlar, Germany) to obtain 10 μm sections. Sections
were mounted on glass slides, air-dried overnight, and stored at room temperature until used. Aer blocking of
endogenous peroxidases by incubation for 30 min with 3% H2O2 in methanol, the sections were incubated for
30 min with blocking solution (5% bovine serum albumin in 1x TBS) followed by overnight 4 °C primary antibody
incubation in blocking solution (clone 3D6, Amyloid-β Antibody 1:8000). e sections were then incubated in
Figure 7. 24(S)-Saringosterol increases astrocytic ApoE production and microglial Aβ clearance and reduces
neuronal Aβ release in vitro. (a,b) Primary astrocytes were treated with 10 µM 24(S)-Saringosterol for 2
consecutive days and medium was collected 48 h aer the last treatment. Western Blot was used to measure
secreted ApoE in the cellular supernatant. 24(S)-Saringosterol increased ApoE secretion (t(5) = 2.531,
p = 0.0524, unpaired t-test). Representative WB bands are displayed in the gure. (c) Primary murine microglia
were examined for their capacity to internalize FAM-labeled Aβ1−42. Microglia were incubated for 1 h with
uorescently-labeled FAM-Aβ1−42 and 40% conditioned medium derived from astrocytes treated with vehicle
(ethanol) or 24(S)-Saringosterol (10 µM). Data are depicted as the percentage of cells that phagocytosed
FAM-Aβ1−42. 24(S)-Saringosterol increased microglial uptake of FAM-Aβ1−42 (t(14) = 2.218, p = 0.0436,
unpaired t-test). (d) To dene a direct eect on microglial uptake of Aβ1−42, primary murine microglia were
exposed to 24(S)-Saringosterol prior to dening FAM-labeled Aβ1−42 uptake. (e) N2aAPPswe cells were
stimulated with vehicle (ethanol) or 24(S)-Saringosterol (10 µM). ELISA was used to dene the release of Aβ42.
24(S)-Saringosterol decreased Aβ42 production (t(5) = 8.126, p = 0.0005, unpaired t-test).
Content courtesy of Springer Nature, terms of use apply. Rights reserved
12
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
biotinylated goat anti-human IgG (BA-3000, 1:1000, Vector Laboratories, Burlingame, CA), and the immunore-
activity was developed by the ABC avidin–biotin peroxidase KIT (PK-6100, Vector) for 1 hour, and 5 min with
diaminobenzidine (DAB, ImmPACT SK-4105, Vector). Between every other step, the slides were rinsed (3×) with
TBS/0.3% Triton-X 100. e sections were counterstained with haematoxylin for 30 seconds and coverslipped.
Digital images of the sections were obtained using a Leica DM 2000 LED microscope (Leica Microsystems, Diegem,
Belgium) equipped with hardware and soware from Leica Application suite soware (Leica Microsystems). e
Aβ plaque load was quantied in 3 sections per brain in 5 animals per group using Fiji ImageJ, by dening the pixel
intensity of Aβ plaques in the total cortical or hippocampal area at Bregma −1.5 to −2.5.
Next, le hippocampus and cortex were dissected from the brains of the Sargassum fusiforme extract-treated
APPswePS1ΔE9 mice and homogenated in a 2% SDS TBS-T buer. Aβ42 levels were quantied and related to
the protein content in the starting homogenate using an Aβ42 ELISA (Invitrogen, USA), according to the manu-
facturer’s instructions74. In brief, the homogenates were sonicated twice and mixture centrifuged to generate an
SDS-insoluble fraction (21000 g, 10 min). e SDS-insoluble pellet was sonicated twice in 70% formic acid (FA),
yielding the FA-extracted insoluble Aβ42 fraction.
Mouse neuroblastoma (N2a) cells, stably overexpressing APP, were cultured in high glucose DMEM medium
supplemented with 10%FCS and 100 U pen/100 µg strep/ml (37 °C, 5% CO2) Next, the cells were incubated for
24 h with ethanol (vehicle control) or 10 µM 24(S)-Saringosterol, puried from Sargassum fusiforme as described
earlier34. Aβ42 levels were detected in supernatant using an Aβ42 ELISA (Invitrogen, USA), according to the man-
ufacturer’s instructions.
Determination of astrocytic ApoE secretion. To generate 24(S)-Saringosterol-astrocyte conditioned
medium, mouse primary astrocytes were seeded in a 24-well plate with a density of 250000 cells/well. Next, astro-
cytes were treated with either 10 µM puried 24(S)-Saringosterol or ethanol for 2 consecutive days aer which
medium was replenished and collected 2 days aerwards. Next, ApoE secretion was determined using western
blot. Equal amounts of cellular supernatant (40 µl) were loaded and separated via electrophoresis through a 10%
sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE). Aerwards, proteins were transferred onto a PVDF
membrane (VWR, Belgium), and blots were blocked (5% non-fat dry milk TBS-Tween solution) for 1 h at room
temperature. Next, membranes were incubated with rabbit anti-ApoE primary antibody (ABBIOTEC, USA).
Aer washing the membranes with TBS-Tween, the blots were incubated with swine anti-rabbit HRP conju-
gated antibody (WAKO, Japan). Finally, membranes were washed in TBS and protein bands were detected using
PierceTM ECL Plus Western Blotting Substrated and ImageQuantTM LAS 4000 mini. ImageJ (http://imagej.nih.
gov/ij/) was used to quantify the protein bands.
Aβ phagocytosis assay. Primary murine cells were isolated and cultured as described previously75. In
short, mixed glial cultures were prepared from postnatal d0 mouse cerebral cortices of C57Bl6/J mice (Harlan
Netherlands B.V.) and cultured in high glucose DMEM medium supplemented with 10% FCS and 100 U
pen/100 µg strep/ml. Mixed glial cultures were used to generate microglia-enriched glial cultures by separating
the microglia from the astrocyte monolayer using orbital shaking followed by purication via dierential adhe-
sion to plastic aer 14 days in culture. Puried microglia were seeded on poly-L-lysine (5 µg/ml; Sigma-Aldrich)
coated 96-well plates with a density of 50000 cells/well. Primary microglia were cultured in high glucose DMEM
medium supplemented with 10% FCS, 100 U pen/100 µg strep/ml and 15% L929 conditioned medium.
Gene symbol Gene name Forward and reverse primer
Cyca Cyclin-A F: TGGGATTGTACCACAGCTCCA
R: CTCATGATGACTGCAGCAAACC
Hmbs Hydroxymethylbilane synthase F: GATGAAGCCATTGCTGAACTTG
R: GTCTCCTTGGGTATCCGATGTC
Abca1 ATP-binding cassette, sub-family A, member 1 F: CCCAGAGCAAAAAGCGACTC
R: GGTCATCATCACTTTGGTCCTTG
Abcg1 ATP-binding cassette, sub-family G, member 1 F: CAAGACCCTTT TGAAAGGGATCT
R: GCCAGAATATTCATGAGTGTGGAC
ApoE Apolipoprotein E F: CCTGAACCGCTTCTGGGATT
R: GCTCTTCCTGGACCTGGTCA
App Amyloid precursor protein F: CGA ACC CTA CGA AGA AGC CAC
R: GCT TTC TGG AAA TGG GCA TGT TC
Axl Axl receptor tyrosine kinase F: GGA ACC CAG GGA ATA TCA CAG G
R: AGT TCT AGG ATC TGT CCA TCT CG
Mertk Proto-oncogene tyrosine-protein kinase Mer F: TGC GTT TAA TCA CAC CAT TGG A
R: TGC CCC GAG CAA TTC CTT TC
Scd1 Stearoyl-CoA desaturase 1 F: TGCGATACACTCTGGTGCTCA
R: CTCAGAAGCCCAAAGCTCAGC
Srebp-1c Sterol regulatory element binding protein 1c F: GGAGCCATGGATTGCACATT
R: GCTTCCAGAGAGGAGCCCAG
Trem2 Triggering receptor expressed on myeloid cells 2 F: CTG GAA CCG TCA CCA TCA CTC
R: CGA AAC TCG ATG ACT CCT CGG
Table 2. Quantitative PCR primers. Nucleotide sequence of primers used for quantitative PCR. F denotes
forward primer, R denotes reverse primer.
Content courtesy of Springer Nature, terms of use apply. Rights reserved
13
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
The capacity of primary microglia to phagocytose FAM-labeled Aβ1−42 (Eurogentec, Seraing Belgium)
was assessed with a plate-based assay. Twenty hours after seeding the microglia, cells were treated with
24(S)-Saringosterol-astrocyte conditioned medium (40%) and FAM-labeled Aβ1−42 was added for 1 h at a nal
concentration of 500 nM. Next, medium was removed and 100 µl 0.2% trypan blue in PBS (pH 4.4) was added to
quench extracellular Aβ. Aer aspiration, uorescence was measured at 485/535 nm excitation/emission. Finally,
to normalize for cell number, 100 µl DAPI in PBS was added, incubated for 10 min and medium was aspirated.
Fluorescence was subsequently measured in a plate reader using 360 nm/465 nm excitation/emission wavelengths.
Sterol prole and triglyceride content determination. Sterol proles were determined in serum and
cerebellum. Preceding the analysis, samples were spun in a speed vacuum dryer (Savant AES 1000) at 12 mbar for
24 h to relate individual sterol concentrations to their dry weight. e sterols were extracted from the dried tissue
by placing them in a mixture of chloroform:methanol (2:1) for 24 h at 4 °C. Sterol levels were determined by gas
chromatography/mass spectrometry (GC/MS) as described previously32,76. Triglyceride contents of serum were
determined using the GOD-PAP method with enzymatic reagent kits according to manufacturer’s instructions
(DiaSys Diagnostic Systems, Holzheim, Germany).
Determination of arsenic concentration. Arsenic halogenide concentrations in lung tissues were ana-
lyzed using inductively coupled plasma-optical emission spectrometry (ICP–OES, Agilent Technologies, 700
Series, Belgium). Tissues were oven-dried and digested with 70–71% HNO3 in a heat block. Prior to analysis, lung
samples and dried Sargassum fusiforme were diluted 1:10 in 1% nitric acid. Concentrations were measured using
a standard calibration curve (NIST Spinach 1570a).
RNA isolation and RT-Q-PCR. Brain tissue was homogenized in Qiazol (Qiagen, Venlo, e Netherlands)
preceding RNA isolation, and total RNA was prepared using the RNeasy mini kit (Qiagen), according to man-
ufacturer’s instructions. RNA concentration and quality was determined with a NanoDrop spectrophotometer
(Isogen Life Science, IJsselstein, e Netherlands). RNA was reverse transcribed to cDNA using the qScriptTM
cDNA synthesis kit (Quanta Biosciences, Gaithersburg, USA). As previously described77,78, quantitative PCR was
subsequently conducted on a StepOnePlus detection system (Applied biosystems, Gaasbeek, Belgium). Relative
quantication of gene expression was performed using the comparative Ct method. Data were normalized to the
most stable reference genes (Cyca and Hmbs). Primers were chosen according to literature or designed using
Primer-Express (http://www.ncbi.nlm.nih.gov/tools/primer-blast), and details of primers used are shown in
Table2.
Experimental design and statistical analyses. All statistical analyses were performed using GraphPad
Prism 7TM and are reported as mean ± SEM. D’Agostino and Pearson omnibus normality test was used to test
normal distribution. Unless specied dierently, one-way ANOVA (post-hoc: Tukey) or two-tailed unpaired
Student t-test was used for normally distributed data sets. e Kruskal-Wallis (Dunns post hoc comparison) or
Mann–Whitney analysis was used for data sets assessed not to be normally distributed. e ORT discrimination
index d2 (compared to the 0) and spatial alteration Y-maze performance (compared to the 50% chance level) was
analyzed using the one-sample t-test. Animals that did not reach the minimum of 4 s exploration in T1 or T2 were
excluded from further analysis71,79. Data from RT-Q-PCR was analyzed using two-way ANOVA with treatment
and genotype as independent variables. In all data sets, extreme values were excluded by means of Dixon’s princi-
ples of exclusion of extreme values80,81. Signicance levels are denoted as follows: $p < 0.10 *p < 0.05, **p < 0.01,
***p < 0.001 or ****p < 0.0001.
Ethical approval. All animal procedures were performed in accordance with institutional guidelines and
approved by the ethical committee for animal experiments of Hasselt University.
Data Availability
e datasets used and/or analyzed during the current study are available from the corresponding author on rea-
sonable request.
References
1. Parihar, M. S. & Hemnani, T. Alzheimer’s disease pathogenesis and therapeutic interventions. Journal of clinical neuroscience: ocial
journal of the Neurosurgical Society of Australasia 11, 456–467, https://doi.org/10.1016/j.jocn.2003.12.007 (2004).
2. Jansen, D. et al. Cholesterol and synaptic compensatory mechanisms in Alzheimer’s disease mice brain during aging. Journal of
Alzheimer’s disease: JAD 31, 813–826, https://doi.org/10.3233/jad-2012-120298 (2012).
3. Jones, L. et al. Genetic evidence implicates the immune system and cholesterol metabolism in the aetiology of Alzheimer’s disease.
PloS one 5, e13950, https://doi.org/10.1371/journal.pone.0013950 (2010).
4. olsch, H. et al. Alterations of cholesterol precursor levels in Alzheimer’s disease. Biochim Biophys Acta 1801, 945–950, https://doi.
org/10.1016/j.bbalip.2010.03.001 (2010).
5. olsch, H. et al. Altered levels of plasma 24S- and 27-hydroxycholesterol in demented patients. Neurosci Lett 368, 303–308, https://
doi.org/10.1016/j.neulet.2004.07.031 (2004).
6. Mulder, M. Sterols in the central nervous system. Current opinion in clinical nutrition and metabolic care 12, 152–158, https://doi.
org/10.1097/MCO.0b013e32832182da (2009).
7. Popp, J. et al. Cholesterol metabolism is associated with soluble amyloid precursor protein production in Alzheimer’s disease. J
Neurochem 123, 310–316, https://doi.org/10.1111/j.1471-4159.2012.07893.x (2012).
8. Shobab, L. A., Hsiung, G. Y. & Feldman, H. H. Cholesterol in Alzheimer’s disease. e Lancet. Neurology 4, 841–852, https://doi.
org/10.1016/s1474-4422(05)70248-9 (2005).
9. Stefani, M. & Liguri, G. Cholesterol in Alzheimer’s disease: unresolved questions. Current Alzheimer research 6, 15–29 (2009).
Content courtesy of Springer Nature, terms of use apply. Rights reserved
14
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
10. Vanmierlo, T. et al. Alterations in brain cholesterol metabolism in the APPSLxPS1mut mouse, a model for Alzheimer’s disease.
Journal of Alzheimer’s disease: JAD 19, 117–127, https://doi.org/10.3233/JAD-2010-1209 (2010).
11. Vanmierlo, T. et al. Plant sterols: friend or foe in CNS disorders? Progress in Lipid Research, https://doi.org/10.1016/j.
plipres.2015.01.003 (2015).
12. Fassbender, . et al. Simvastatin strongly reduces levels of Alzheimer’s disease beta -amyloid peptides Abeta 42 and Abeta 40 in vitro
and in vivo. Proc Natl Acad Sci USA 98, 5856–5861, https://doi.org/10.1073/pnas.081620098 (2001).
13. Jiang, Q. et al. ApoE Promotes the Proteolytic Degradation of Aβ. Neuron 58, 681–693, https://doi.org/10.1016/j.neuron.2008.04.010
(2008).
14. Vanmierlo, T. et al. Liver X receptor activation restores memory in aged AD mice without reducing amyloid. Neurobiology of aging
32, 1262–1272, https://doi.org/10.1016/j.neurobiolaging.2009.07.005 (2011).
15. Baez-Becerra, C. et al. eceptor Agonist GW3965 egulates Synaptic Function upon Amyloid Beta Exposure in Hippocampal
Neurons. Neurotoxicity research 33, 569–579, https://doi.org/10.1007/s12640-017-9845-3 (2018).
16. Lei, C. et al. Amelioration of amyloid beta-induced retinal inammatory responses by a LX agonist TO901317 is associated with
inhibition of the NF-appaB signaling and NLP3 inflammasome. Neuroscience 360, 48–60, https://doi.org/10.1016/j.
neuroscience.2017.07.053 (2017).
17. Stachel, S. J. et al. Identication and in Vivo Evaluation of Liver X eceptor beta-Selective Agonists for the Potential Treatment of
Alzheimer’s Disease. Journal of medicinal chemistry 59, 3489–3498, https://doi.org/10.1021/acs.jmedchem.6b00176 (2016).
18. Sandoval-Hernandez, A. G. et al. Liver X eceptor Agonist Modies the DNA Methylation Prole of Synapse and Neurogenesis-
elated Genes in the Triple Transgenic Mouse Model of Alzheimer’s Disease. Journal of molecular neuroscience: MN 58, 243–253,
https://doi.org/10.1007/s12031-015-0665-8 (2016).
19. Zelcer, N. & Tontonoz, P. Liver X receptors as integrators of metabolic and inflammatory signaling. The Journal of clinical
investigation 116, 607–614, https://doi.org/10.1172/jci27883 (2006).
20. Bensinger, S. J. & Tontonoz, P. Integration of metabolism and inammation by lipid-activated nuclear receptors. Nature 454,
470–477, https://doi.org/10.1038/nature07202 (2008).
21. Hong, C. & Tontonoz, P. Liver X receptors in lipid metabolism: opportunities for drug discovery. Nature reviews. Drug discovery 13,
433–444, https://doi.org/10.1038/nrd4280 (2014).
22. Nelissen, . et al. Liver X receptors regulate cholesterol homeostasis in oligodendrocytes. Journal of neuroscience research 90, 60–71,
https://doi.org/10.1002/jnr.22743 (2012).
23. Sodhi, . . & Singh, N. Liver X receptors: Emerging therapeutic targets for Alzheimer’s disease. Pharmacological Research 72,
45–51, https://doi.org/10.1016/j.phrs.2013.03.008 (2013).
24. Zelcer, N. et al. Attenuation of neuroinammation and Alzheimer’s disease pathology by liver x receptors. Proc Natl Acad Sci USA
104, 10601–10606, https://doi.org/10.1073/pnas.0701096104 (2007).
25. iddell, D. . et al. e LX agonist TO901317 selectively lowers hippocampal Aβ42 and improves memory in the Tg2576 mouse
model of Alzheimer’s disease. Molecular and Cellular Neuroscience 34, 621–628, https://doi.org/10.1016/j.mcn.2007.01.011 (2007).
26. Vanmierlo, T. et al. Cerebral accumulation of dietary derivable plant sterols does not interfere with memory and anxiety related
behavior in Abcg5−/− mice. Plant Foods Hum Nutr 66, 149–156, https://doi.org/10.1007/s11130-011-0219-3 (2011).
27. Greorst, A. et al. Stimulation of lipogenesis by pharmacological activation of the liver X receptor leads to production of large,
triglyceride-rich very low density lipoprotein particles. J Biol Chem 277, 34182–34190, https://doi.org/10.1074/jbc.M204887200 (2002).
28. im, G. H. et al. Hepatic TAP80 selectively regulates lipogenic activity of liver X receptor. e Journal of clinical investigation 125,
183–193, https://doi.org/10.1172/jci73615 (2015).
29. epa, J. J. et al. egulation of mouse sterol regulatory element-binding protein-1c gene (SEBP-1c) by oxysterol receptors, LXalpha
and LXbeta. Genes Dev 14, 2819–2830 (2000).
30. Schultz, J. . et al. ole of LXs in control of lipogenesis. Genes & Development 14, 2831–2838, https://doi.org/10.1101/gad.850400
(2000).
31. Frice, C. B. et al. Increased plant sterol and stanol levels in brain of Watanabe rabbits fed rapeseed oil derived plant sterol or stanol
esters. e British journal of nutrition 98, 890–899, https://doi.org/10.1017/s0007114507756532 (2007).
32. Jansen, P. J. et al. Dietary plant sterols accumulate in the brain. Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of
Lipids 1761, 445–453, https://doi.org/10.1016/j.bbalip.2006.03.015 (2006).
33. Vanmierlo, T. et al. Dietary intae of plant sterols stably increases plant sterol levels in the murine brain. J Lipid Res 53, 726–735,
https://doi.org/10.1194/jlr.M017244 (2012).
34. Chen, Z. et al. 24(S)-Saringosterol from edible marine seaweed Sargassum fusiforme is a novel selective LXbeta agonist. J Agric
Food Chem 62, 6130–6137, https://doi.org/10.1021/jf500083r (2014).
35. El harrassi, Y. et al. Biological activities of Schottenol and Spinasterol, two natural phytosterols present in argan oil and in cactus pear
seed oil, on murine miroglial BV2 cells. Biochem Biophys Res Commun 446, 798–804, https://doi.org/10.1016/j.bbrc.2014.02.074 (2014).
36. Hoang, M. H. et al. Fucosterol is a selective liver X receptor modulator that regulates the expression of ey genes in cholesterol
homeostasis in macrophages, hepatocytes, and intestinal cells. Journal of agricultural and food chemistry 60, 11567–11575, https://
doi.org/10.1021/jf3019084 (2012).
37. aneo, E. et al. Induction of intestinal ATP-binding cassette transporters by a phytosterol-derived liver X receptor agonist. J Biol
Chem 278, 36091–36098, https://doi.org/10.1074/jbc.M304153200 (2003).
38. Plat, J., Nichols, J. A. & Mensin, . P. Plant sterols and stanols: eects on mixed micellar composition and LX (target gene)
activation. Journal of Lipid Research 46, 2468–2476, https://doi.org/10.1194/jlr.M500272-JL200 (2005).
39. Yang, C. et al. Disruption of cholesterol homeostasis by plant sterols. e Journal of clinical investigation 114, 813–822, https://doi.
org/10.1172/jci22186 (2004).
40. Burg, V. . et al. Plant sterols the better cholesterol in Alzheimer’s disease? A mechanistical study. J Neurosci 33, 16072–16087,
https://doi.org/10.1523/jneurosci.1506-13.2013 (2013).
41. oivisto, H. et al. Special lipid-based diets alleviate cognitive decits in the APPswe/PS1dE9 transgenic mouse model of Alzheimer’s
disease independent of brain amyloid deposition. J Nutr Biochem 25, 157–169, https://doi.org/10.1016/j.jnutbio.2013.09.015 (2014).
42. Shi, C. et al. beta-sitosterol inhibits high cholesterol-induced platelet beta-amyloid release. J Bioenerg Biomembr 43, 691–697,
https://doi.org/10.1007/s10863-011-9383-2 (2011).
43. McDaniel, A. L. et al. Phytosterol feeding causes toxicity in ABCG5/G8 nocout mice. e American journal of pathology 182,
1131–1138, https://doi.org/10.1016/j.ajpath.2012.12.014 (2013).
44. Plat, J. et al. Protective role of plant sterol and stanol esters in liver inammation: insights from mice and humans. PloS one 9,
e110758, https://doi.org/10.1371/journal.pone.0110758 (2014).
45. Cheng, Z. Interaction of ergosterol with bovine serum albumin and human serum albumin by spectroscopic analysis. Molecular
biology reports 39, 9493–9508, https://doi.org/10.1007/s11033-012-1814-6 (2012).
46. Sudhamalla, B., Goara, M., Ahalawat, N., Amooru, D. G. & Subramanyam, . Molecular dynamics simulation and binding studies
of beta-sitosterol with human serum albumin and its biological relevance. e journal of physical chemistry. B 114, 9054–9062,
https://doi.org/10.1021/jp102730p (2010).
47. Janowsy, J. L. et al. Co-expression of multiple transgenes in mouse CNS: a comparison of strategies. Biomolecular Engineering 17,
157–165, https://doi.org/10.1016/S1389-0344(01)00067-3 (2001).
Content courtesy of Springer Nature, terms of use apply. Rights reserved
15
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
48. Garcia-Alloza, M. et al. Characterization of amyloid deposition in the APPswe/PS1dE9 mouse model of Alzheimer disease.
Neurobiology of Disease 24, 516–524, https://doi.org/10.1016/j.nbd.2006.08.017 (2006).
49. Mineviciene, . et al. Age-related decrease in stimulated glutamate release and vesicular glutamate transporters in APP/PS1
transgenic and wild-type mice. Journal of Neurochemistry 105, 584–594, https://doi.org/10.1111/j.1471-4159.2007.05147.x (2008).
50. Hooijmans, C. . et al. DHA and cholesterol containing diets inuence Alzheimer-lie pathology, cognition and cerebral vasculature
in APPswe/PS1dE9 mice. Neurobiology of disease 33, 482–498, https://doi.org/10.1016/j.nbd.2008.12.002 (2009).
51. Calabro, P., Gragnano, F. & Pirro, M. Cognitive Function in a andomized Trial of Evolocumab. e New England journal of
medicine 377, 1996–1997, https://doi.org/10.1056/NEJMc1712102 (2017).
52. Mashe, D. G., han, S. A., Sathyanarayan, A., Ploeger, J. M. & Franlin, M. P. Hepatic lipid droplet biology: Getting to the root of
fatty liver. Hepatology (Baltimore, Md.) 62, 964–967, https://doi.org/10.1002/hep.27839 (2015).
53. ose, M. et al. Arsenic in seaweed—Forms, concentration and dietary exposure. Food and Chemical Toxicology 45, 1263–1267,
https://doi.org/10.1016/j.fct.2007.01.007 (2007).
54. Bjorhem, I. et al. Correlation between serum levels of some cholesterol precursors and activity of HMG-CoA reductase in human
liver. Journal of lipid research 28, 1137–1143 (1987).
55. Jones, P. J. H. et al. Progress and perspectives in plant sterol and plant stanol research. Nutr Rev 76, 725–746, https://doi.org/10.1093/
nutrit/nuy032 (2018).
56. Annicotte, J. S., Schoonjans, . & Auwerx, J. Expression of the liver X receptor alpha and beta in embryonic and adult mice. Anat Rec
A Discov Mol Cell Evol Biol 277, 312–316, https://doi.org/10.1002/ar.a.20015 (2004).
57. Zhang, Y. et al. An NA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.
The Journal of neuroscience: the official journal of the Society for Neuroscience 34, 11929–11947, https://doi.org/10.1523/
JNEUOSCI.1860-14.2014 (2014).
58. irchgessner, T. G. et al. Benecial and Adverse Eects of an LX Agonist on Human Lipid and Lipoprotein Metabolism and
Circulating Neutrophils. Cell Metab 24, 223–233, https://doi.org/10.1016/j.cmet.2016.07.016 (2016).
59. ies, M. & Sastre, M. Mechanisms of Abeta Clearance and Degradation by Glial. Cells. Frontiers in aging neuroscience 8, 160, https://
doi.org/10.3389/fnagi.2016.00160 (2016).
60. Fu, Y. et al. Apolipoprotein E lipoprotein particles inhibit amyloid-beta uptae through cell surface heparan sulphate proteoglycan.
Molecular neurodegeneration 11, 37, https://doi.org/10.1186/s13024-016-0099-y (2016).
61. Alghazwi, M., Smid, S., Musgrave, I. & Zhang, W. In vitro studies of the neuroprotective activities of astaxanthin and fucoxanthin
against amyloid beta (Abeta1-42) toxicity and aggregation. Neurochem Int, https://doi.org/10.1016/j.neuint.2019.01.010 (2019).
62. Oh, J. H., Choi, J. S. & Nam, T. J. Fucosterol from an Edible Brown Alga Eclonia stolonifera Prevents Soluble Amyloid Beta-Induced
Cognitive Dysfunction in Aging ats. Mar Dr ugs 16, https://doi.org/10.3390/md16100368 (2018).
63. Hu, P. et al. Structural elucidation and protective role of a polysaccharide from Sargassum fusiforme on ameliorating learning and
memory deciencies in mice. Carbohydr Polym 139, 150–158, https://doi.org/10.1016/j.carbpol.2015.12.019 (2016).
64. enyon, E. M. et al. Tissue distribution and urinary excretion of inorganic arsenic and its methylated metabolites in C57BL6 mice
following subchronic exposure to arsenate in drining water. Toxicology and applied pharmacology 232, 448–455, https://doi.
org/10.1016/j.taap.2008.07.018 (2008).
65. Folch, J., Lees, M. & Sloane Stanley, G. H. A simple method for the isolation and purication of total lipides from animal tissues. J
Biol Chem 226, 497–509 (1957).
66. Cross, A. . & Woodroofe, M. N. Chemoines induce migration and changes in actin polymerization in adult rat brain microglia
and a human fetal microglial cell line in vitro. Journal of neuroscience research 55, 17–23, https://doi.org/10.1002/(sici)1097-
4547(19990101)55:1<17::aid-jnr3>3.0.co;2-j (1999).
67. Sun, Y., Yao, J., im, T. W. & Tall, A. . Expression of liver X receptor target genes decreases cellular amyloid beta peptide secretion.
J Biol Chem 278, 27688–27694, https://doi.org/10.1074/jbc.M300760200 (2003).
68. Bories, G. et al. Liver X receptor activation stimulates iron export in human alternative macrophages. Circulation research 113,
1196–1205, https://doi.org/10.1161/circresaha.113.301656 (2013).
69. van der Hoorn, J. et al. Low dose of the liver X receptor agonist, AZ876, reduces atherosclerosis in APOE*3Leiden mice without aecting
liver or plasma triglyceride levels. British journal of pharmacology 162, 1553–1563, https://doi.org/10.1111/j.1476-5381.2010.01168.x
(2011).
70. utten, . et al. e selective PDE5 inhibitor, sildenal, improves object memory in Swiss mice and increases cGMP levels in
hippocampal slices. Behavioural b rain research 164, 11–16, https://doi.org/10.1016/j.bbr.2005.04.021 (2005).
71. Si, A., van Nieuwehuyzen, P., Pricaerts, J. & Bloland, A. Performance of dierent mouse strains in an object recognition tas.
Behavioural brain research 147, 49–54 (2003).
72. Ohno, M. et al. BACE1 deciency rescues memory decits and cholinergic dysfunction in a mouse model of Alzheimer’s disease.
Neuron 41, 27–33 (2004).
73. Mulder, M. et al. Low-density lipoprotein receptor-nocout mice display impaired spatial memory associated with a decreased
synaptic density in the hippocampus. Neurobiology of Disease 16, 212–219, https://doi.org/10.1016/j.nbd.2004.01.015 (2004).
74. Steinerman, J. . et al. Distinct pools of beta-amyloid in Alzheimer disease-aected brain: a clinicopathologic study. Archives of
neurology 65, 906–912, https://doi.org/10.1001/archneur.65.7.906 (2008).
75. O’Meara, . W., yan, S. D., Colognato, H. & othary, . Derivation of enriched oligodendrocyte cultures and oligodendrocyte/
neuron myelinating co-cultures from post-natal murine tissues. Journal of visualized experiments: JoVE, https://doi.org/10.3791/3324
(2011).
76. Lütjohann, D. et al. Prole of cholesterol-related sterols in aged amyloid precursor protein transgenic mouse brain. Journal of Lipid
Research 43, 1078–1085, https://doi.org/10.1194/jlr.M200071-JL200 (2002).
77. Bogie, J. F. et al. Myelin alters the inflammatory phenotype of macrophages by activating PPAs. Acta neuropathologica
communications 1, 43, https://doi.org/10.1186/2051-5960-1-43 (2013).
78. Bogie, J. F. et al. Myelin-derived lipids modulate macrophage activity by liver X receptor activation. PLoS One 7, e44998, https://doi.
org/10.1371/journal.pone.0044998 (2012).
79. Aerman, S. et al. Object recognition testing: methodological considerations on exploration and discrimination measures.
Behavioural brain research 232, 335–347, https://doi.org/10.1016/j.bbr.2012.03.022 (2012).
80. Dixon, W. J. atios involving extreme values. Ann Math Stat 22, 68–78 (1959).
81. Dixon, W. J. Analysis of extreme values. Ann Math Stat 21, 488–506 (1959).
Acknowledgements
is work was supported by the Internationale Stichting Alzheimer Onderzoek (ISAO)/Alzheimer Nederland
(AN), Scientic Research–Flanders (FWO), Fondation Vaincre Alzheimer (LECMA), and Alzheimer Forschung
Initiative (AFI). e authors like to thank Joke Vanhoof for excellent technical assistance and AstraZeneca for
providing the AZ876 compound through the AstraZeneca Open Innovation program. We sincerely thank Patric
Delhanty for editing the paper and Kenneth Vanbrabant for performing the GC-MS analysis.
Content courtesy of Springer Nature, terms of use apply. Rights reserved
16
SCIENTIFIC REPORTS | (2019) 9:4908 | https://doi.org/10.1038/s41598-019-41399-4
www.nature.com/scientificreports
www.nature.com/scientificreports/
Author Contributions
J.B., C.H., M.S., A.T., A.C., F.L., D.S., A.K., P.M.M., J.W.J., I.D., S.P., D.L. and T.V. performed the experiments and
analyzed the data. J.B., C.H., T.V. and M.M. wrote the manuscript. Y.P., T.S., H.B.L. and B.S. provided experimental
materials. All authors revised the manuscript. J.B., C.H., N.H., J.W., P.M.M.,. E.S., J.W., J.H., A.G., B.S., D.L., T.V.
and M.M. participated in the design and coordination of the project.
Additional Information
Supplementary information accompanies this paper at https://doi.org/10.1038/s41598-019-41399-4.
Competing Interests: e authors declare no competing interests.
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and
institutional aliations.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International
License, which permits use, sharing, adaptation, distribution and reproduction in any medium or
format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre-
ative Commons license, and indicate if changes were made. e images or other third party material in this
article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the
material. If material is not included in the article’s Creative Commons license and your intended use is not per-
mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the
copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
© e Author(s) 2019
Content courtesy of Springer Nature, terms of use apply. Rights reserved
1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com
Available via license: CC BY
Content may be subject to copyright.
