Content uploaded by Palayakotai R Raghavan
Author content
All content in this area was uploaded by Palayakotai R Raghavan on Mar 18, 2019
Content may be subject to copyright.
Volume 9 • Issue 2 • 1000446
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Open Access
Research Article
Journal of
Stem Cell Research & Therapy
J
o
u
r
n
a
l
o
f
S
t
e
m
C
e
l
l
R
e
s
e
a
r
c
h
&
T
h
e
r
a
p
y
ISSN: 2157-7633
Raghavan, J Stem Cell Res Ther 2019, 9:2
DOI: 10.4172/2157-7633.1000446
Abstract
Humans are keenly aware of their mortality. Given a limited time what we do with our life is a reflection of
knowledge of our mortality. In 2009 the Nobel prize in medicine to Jack W Szostak, Elizabeth Blackburn, Carol W
Greider for their work on Telomerase and scientific research exploded in this area. Telomere
protect chromosome ends the Telomerase enzyme maintains Teleomere length. This activity of Telomerase
is essential in aging and stem cells and achieving longer life spans.
Telomerase is expressed in 85% of human cancer cell lines, but its enzymatic activity is not detectable in most
human somatic cells which constitute the vast majority of the cells in the human body. There is a need for increased
telomerase activity in stem cells for use in the treatment of therapies where there is an active role for telomerase.
Umbilical Cord Blood (UCB) provides an attractive source of stem cells for research and therapeutic uses.
Work shown here characterizes the gene expression changes from Umbilical cord cells differentiate toward
telomerase on treatment with Metadichol®.
Metadichol® is a nanoemulsion of long-chain alcohols that is nontoxic. It is a mixture of long-chain alcohols
derived from food. The work presented here is about the effect of Metadichol® on Telomerase expression profile
in Umbilical cord cells. Our results using q-RT-PCR show increases of mRNA telomerase expression by Sixteen-
fold at one picogram but down-regulates expression at higher concentrations of 100 pg, 1 ng, 100 ng and one
microgram per ml concentration. Western blot studies showed expression of Telomerase protein which is slightly
higher than control at one picogram, i.e., Telomerase protein expression continues at replacement level. Since
it is devoid of toxic effects, it can be directly tested on humans and is in use today as an immune boosting
supplement. Metadichol® increases expression of Klotho an anti-aging gene expression in cancer cell lines by
Four to Ten-fold, and Klotho gene has been documented to inhibits the growth of cancer cells. Metadichol®
also inhibits TNF, ICAM1, CCL2, and BCAT1 which that is associated with proliferation in yeast and increased
metastatic potential in human cancers. It paves the way for safe clinical testing and research and study of
Telomerase biology and its use in humans.
The Quest for Immortality: Introducing Metadichol® a Novel Telomerase
Activator
Palayakotai R Raghavan*
Nanorx Inc., PO Box 131, Chappaqua, NY 10514, USA
*Corresponding author: Palayakotai R Raghavan, Nanorx Inc., PO Box 131,
Chappaqua, NY 10514, USA, Tel: 9146710224; E-mail: raghavan@nanorxinc.com
Received February 03, 2019; Accepted March 05, 2019; Published March 11,
2019
Citation: Raghavan PR (2019) The Quest for Immortality: Introducing Metadichol®
a Novel Telomerase Activator. Stem Cell Res Ther 9: 446. doi: 10.4172/2157-
7633.1000446
Copyright: © 2019 Raghavan PR. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and
source are credited.
Keywords: Telomerase; mRNA expression; h-TERT; VDR; Inverse
agonist; Metadichol; UBC; Stem cells; Nano-emulsion; Aging cancer;
Chronic diseases; Cell division
Introduction
A lot of research work has been ongoing to understand how
chromosomes are protected by telomeres and the enzyme telomerase
[1,2]. e human chromosome has a unique component at their ends
that provide stability called Telomere. Telomerase is a ribonucleic
reverse transcriptase needed for synthesizing telomeric DNA repeats at
the 3' ends of linear chromosomes. Telomerase enzyme complex consists
of two components known as TERC and TERT. TERC (h-TR) makes
the repeat sequence of DNA, i.e., TTAGGG and TERT that adds to the
ends of chromosomes. H-TR is ubiquitously expressed in embryonic
and somatic tissues, expression of hTERT is tightly regulated and is not
seen somatic cells and is the rate-limiting step in telomerase activity [3].
In the nucleus of human cells are 46 chromosomes, which carry our
genetic information derived from our ancestors. During cell division,
human telomeres lose about 80-100 base pairs in their telomeric
DNA aer each mitosis. Telomeres shorten as a cell divides, and once
telomeres reach a critically short length, there is cell apoptosis, or it
stops dividing and senesces [4-6].
At birth, humans do not have every cell our body needs. ere
is a need for new cells replacement regularly like skin cells and those
that line our intestines. Without Telomerase, cell division would not
be possible for cells to reproduce. Telomeres have a defensive role in
guarding key genetic material against being lost when cells divide. When
the cell divides, the ends are not copied, and the telomeres are a little
shorter, leading to a situation of short telomeres, and no cell division
occurs known as the Halyick limit [7-9]. Broken chromosomes result
in DNA damage. Unrepaired DNA ends will prevent any cell division
and can result in apoptosis [10].
Somatic cells are the majority of the cells in the human body and are
devoid of any telomerase activity unlike that of stem cells [11]. Older
cells have very short telomeres, and this can lead to cancer and other
age-related diseases [12-15]. Drugs that increase telomerase activity
within stem cells for disease treatment, as well as anti-aging therapies,
are what it is needed today.
Some of the factors that cause Telomere shortening are shown in
Citation: Raghavan PR (2019) The Quest for Immortality: Introducing Metadichol® a Novel Telomerase Activator. Stem Cell Res Ther 9: 446. doi:
10.4172/2157-7633.1000446
Page 2 of 9
Volume 9 • Issue 2 • 1000446
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Table 1. In addition to cancer, telomeres are involved in many
diseases, and these are shown in Table 2. Failure to repair restore
telomere damage of hyper telomerase activity are the causes of
many diseases and overcoming these hurdles could result in novel
therapies. Long telomeres have a large number of protective
proteins. Critically short telomeres have few protective proteins
available. There has research that suggests that Telomerase causes
cancer as it is active in 85% of cancer cells. However, other research
suggests that the median increase in telomere length from diagnosis
to remission is an overall powerful predictor of survival. Several
SNP'S have been identified with longer Telomeres, and the same
SNP's has been shown to correlate with cancer. Telomeres play diverse
roles in different cancers, and short telomeres may be risk factors for
the tumors [16-19].
Many dietary compounds have been shown to regulate
telomerase activity [20]. Telomerase inhibitors derived from food
like retinoic acid, 1, 25(OH)2 Vitamin D3 polyphenols, fatty acids,
tocotrienol, and sulforaphane have been shown to inhibit telomerase.
Kasiappan et al. [21] provided evidence that 100 nm of 1, 25(OH)2
Vitamin D3 treatment led to telomerase inhibition. A green tea
extract, EGCG suppresses tumor size and shortens telomere length.
On the other hand, Genistein and Amadori-PE induce telomerase
activity in Cancer cells [22]. Geron, a biopharmaceutical Company is
developing Imetelstat® [23] a telomerase inhibitor against
hematologic myeloid malignancies like Myelodysplastic Syndrome
(MDS). A commercially available telomerase activator in use today is
TA-65® [24]. It is a dietary extract derived from traditional Chinese
medicine. It has shown improvements in biomarkers of aging,
like cardiovascular, metabolic, bone, and inflammatory markers,
without significant signs of toxicity [25-27]. Most of these dietary
components work in doses varying from hundreds of mg to grams.
Human Mesenchymal Stem Cells (hMSCs) display
multipoint properties in differentiation and are useful in cell and
gene therapy. Zimmermann et al. [28] showed that telomerase
activity is not detectable in human mesenchymal stem cells. This
has been confirmed by Karimi et al. [29] who detected no telomerase
activity in UCB-MSCs from several passages. One can introduce h-
TERT into telomerase inactive cells to restore telomerase activity and
potentially increase cellular lifespan. Liang and their co-workers have
suggested UC-MSCs could be immortalized by transduction with a
lentiviral vector carrying hTERT into hepatocyte-like cells [30].
The transfected hUCMSCs cells overexpressed the h-TERT gene
and up-regulated their telomerase activity. Ramunas
et al. [31] were able to show that transient delivery of TERT mRNA
comprising modied nucleotides increased telomerase activity,
telomere length, and proliferative capacity without immortalizing cells.
Modulating telomerase enzymatic activity and telomere
maintenance in vivo is essential both for our understanding of telomere
biology and telomerase dysfunction in disease pathogenesis. e work
presented will show that Metadichol® could be useful in overcoming the
problems facing Telomerase researchers.
Materials and Methods
Gene regulation of telomerase in Umbilical Cord Blood-
Mesenchymal Stem cells (UCB-MSCs) treated with
Metadichol
All work was outsourced and carried out by Skanda Labs Pvt. Ltd.,
Bangalore, India.
Cell line: Umbilical Cord Blood-Mesenchymal Stem cells (UCB-
MSCs) sourced from Lonza, USA was used for the study. RNase free
(ermo Fisher, cat #AM2694), TRIzol (Sigma, cat #T9424 200 ml),
DEPC (ermo Fisher, cat #RO581), chloroform (Sigma, cat #C7559),
isopropanol (SRL 67-63-0), DEPC treated water (ermo Fisher,
cat #RO581) was used. All the consumables were treated with DEPC
water and autoclaved. Human Wharton’s Jelly Mesenchymal Stem cells
(UCB-MSCs) isolated from Wharton’s Jelly of human umbilical cords
(HiMEDIA cat #21736) cultured in Dulbecco’s Modied Eagle Medium
(DMEM from HiMEDIA cat #1782) supplemented with 10% Fetal
Bovine Serum (HiMEDIA cat #15500). Cells were maintained at 37°C
with 5% CO2 supplement. e cells were conventionally subcultured
and counted using Hemocytometer. 1 × 106 cells were grown in P35
dish for 24 hours Cells were treated with varying concentrations of test
sample Metadichol (1 pg/ml, 100 pg/ml, 1 ng/ml and 100 ng/ml) and
incubated for 24 hrs for RNA isolation and 48 hrs for protein isolation.
Fresh media was used as a control.
Sample preparation and RNA isolation
Total RNA from UCB-MSCs cells was extracted using TRIzol
Reagent (Sigma) as per manufacturer’s instruction. Cells were washed
twice with PBS and centrifuged at 425x g for 5 min. To the cell pellet,
1 ml of TRIzol (per p35 dish) added in 1.5 ml microcentrifuge tube
and vortexes. Samples were allowed to stand for 5 minutes at room
temperature. To the reaction mixture, 0.2 ml of chloroform is added
and vigorously mixed for 15 seconds. e tube was allowed to stand at
room temperature for 5 minutes, centrifuged the resulting mixture at
10621x g for 15 min at 4°C. e upper aqueous phase is transferred to a
new sterile microcentrifuge tube and treated with 0.5 ml of isopropanol.
e resultant mixture is mixed gently by inverting the contents ve
times and incubated at room temperature for 5 minutes. Samples
were centrifuged at 10621x g for 10 min at 4°C. e supernatant was
discarded, and the RNA pellet washed by adding 1 ml of 70% ethanol.
e sample was mixed gently by inverting a few times, centrifuged for
5 min at 20817 at 4°C. e supernatant was discarded by inverting the
tube on a clean tissue paper. Later, the pellet was dried by incubating in
a dry bath for 5 min at 55°C. e pellet was then resuspended in 25 µl
of DEPC treated water.
RT-PCR
A semi-quantitative reverse transcriptase polymerase chain reaction
(RT-PCR) was carried out using a Techno Prime system to determine
the levels of telomerase and β-Actin mRNA expressions. e cDNA
Obesity Oxidized LDL
Coronary heart disease Smoking Decreased Nitric oxide levels
Diabetes, Myocardial infraction Oxidative stress Mitochondrial DNA damage
Insulin resistance Homocysteine Lack of estrogen
Table 1: Factors that can shorten telomeres.
Cardiovascular Cell and tissue Transplants
Cancer AIDS
Alzheimers Progeria
Osteoarthiritis Dyskeratosis Congenita
Rheumatoid Arthritis Idiopathic Pulmonary Fibrosis
Osteoporosis Down Syndrome
General Immunity Liver Cirrhosis
Skin aging Muscular Distrophy
Mascular Degeneration COPD
Table 2: Diseases caused by telomeres shortening.
Citation: Raghavan PR (2019) The Quest for Immortality: Introducing Metadichol® a Novel Telomerase Activator. Stem Cell Res Ther 9: 446. doi:
10.4172/2157-7633.1000446
Page 3 of 9
Volume 9 • Issue 2 • 1000446
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
was synthesized from 2 μg of RNA using the Verso cDNA synthesis
kit (ermo Fischer Scientic) with oligo dT primer according to the
manufacturer's instructions. e reaction volume was set to 20 μl, and
cDNA synthesis was performed at 42°C for 60 min, followed by RT
inactivation at 85°C for 5 min (Table 3).
Polymerase Chain Reaction (PCR)
e PCR mixture (nal volume of 20 µL) contained 1 µL of
cDNA, 10 µL of Red Taq Master Mix 2x (Amplicon) and 1 µM of each
complementary primer specic for Telomerase and β-Actin (internal
control) sequence. e samples were denatured at 94°C for 5 min
and amplied using 35 cycles of 94°C for 30 sec, and for Telomerase
annealing temperature was set to 49°C and for β-Actin the annealing
temperature was set to 55°C for 30 sec and elongation at 72°C for 1
min followed by a nal elongation at 72°C for 10 min. e optimal
numbers of cycles have been selected for amplication of these genes
experimentally so that amplications were in the exponential range and
have not reached a plateau. Instrument CFX96 real-time PCR, Bio-Rad
used for qPCR. 10 µL of the nal amplication product was run on a
2% ethidium-stained agarose gel and photographed. Quantication of
the results was by measuring the optical density of the bands, using the
computerized imaging program Image J. e values were normalized to
β-Actin intensity levels.
Isolation of protein
e cells, post-harvesting, were washed twice using 1XPBS. e cell
pellets suspended in 500 µl of RIPA buer with 1X Protease Inhibitor
(Sigma; P-8340). e cells were incubated for 30 mins by gentle mixing
every 5mins. Post incubation, the cells were centrifuged at 10621x g for
12-15 minutes. e protein lysates in the supernatant were transferred
to fresh sterile tubes and stored in -20°C until further use.
Western blot and SDS-PAGE procedure
A 140 µg protein sample from each cell lysate was mixed with 5X
loading dye and heated for 6 min at 98°C (Figure 1). Protein samples
were loaded and separated on 12% SDS-PAGE gel using Mini protean
Tetra cell (Bio-Rad). Methanol activated 0.2 µM PVDF membrane was
pre-wet in transfer buer for 10 min at RT. Protein transfer was done for
10 min in Turbo Transblot (Bio-Rad) apparatus. Blot was blocked in 5%
BSA+TBST for 1 hr at RT. Blot was incubated with 10 Ab (SAB4502945,
Sigma Aldrich) at dilution: 1:1000 for overnight at 40°C on a shaker.
Washed three times with TBST for 5 min at RT. Blot was incubated with
20 Ab (Goat-anti-Rabbit HRP- IgG; Ab6721) at dilution 1:1000 for 1 hr
at RT. Washed three times with TBST for 5 min at RT. Blot was rinsed
with ECL reagent (two-component systems) for 1 min in the dark and
image was captured with 40-sec exposure in Chemidoc MP imaging
system (Bio-Rad) (Figure 2).
Results
e internal control β-Actin was used to normalize the gene
expression. Results showed that the cells at the lowest concentration of
1 pg/ml showed 2.11 fold up-regulation compared to the highest treated
concentration of 1 µg/ml with 1.18 folds (Table 4).
e eect of sample Metadichol on the expression of
Telomerase (TERT)
Figure 3 shows the semi-quantitative relative gene expression which
one picogram is 2.11 and decreasing with increasing concentrations.
Figure 4 shows q-RT-PCR where the TERT expression in the cells
treated with 1 pg/ml is increased 16.68 fold increase compared to
control (Tables 5 and 6). Whereas, in the cells treated with higher
concentrations, the expression was found to be gradually down-
regulated. is is seen clearly in the Log scale plot in Figures 5-7 and
Table 7.
e cells treated with various concentrations of test sample
Metadichol® and the results suggest that the relative expression of
telomerase was found to be 1.05 fold at 1 pg/ml treatment compared to
control whereas, the cells treated with other concentrations have shown
no expression (Figure 6).
Gene Primer pair Sequence Tm Product size (bp)
Β-actin FP TCCTCCTGAGCGCAAGTACTCT 62.1 153
RP GCTCAGTAACAGTCCGCCTAGAA 62.4
Telomerase (TERT) FP GGGAGGTCAGGTGTCCATTG 55.88 142
RP TGCTCTCGGGATAGTCACCA 53.83
Table 3: Primer details for β-actin and Telomerase.
Figure 1: Amplication of the β-actin gene in UCB-MSCs. Figure 2: Amplication of the Telomerase gene in UCB-MSCs.
Citation: Raghavan PR (2019) The Quest for Immortality: Introducing Metadichol® a Novel Telomerase Activator. Stem Cell Res Ther 9: 446. doi:
10.4172/2157-7633.1000446
Page 4 of 9
Volume 9 • Issue 2 • 1000446
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Samples
Band intensity of PCR amplicon of
genes Normalized Relative gene
expression
β-actin Telomerase
Control 18938.05 8150.83 0.43 1.00
1 pg 20880.71 18999.86 0.91 2.11
100 pg 22188.10 16936.35 0.76 1.77
1 ng 21099.88 14985.93 0.71 1.65
100 ng 19137.88 11295.45 0.59 1.37
1 µg 18060.52 9162.23 0.51 1.18
Table 4: Relative expression of Telomerase gene in UCB-MSCs treated with
different concentrations of Metadichol.
1.00
2.11
1.77 1.65
1.37 1.18
0.00
0.55
1.10
1.65
2.20
2.75
Control 1pg 100pg 1ng 100ng 1µg
Fold stimulation
Treatment Concentrations
Telomerase gene experssion in UCB-MSCs Treated with sample
Figure 3: Semi-quantitative relative expression of Telomerase gene in UCB-
MSCs cells treated with different concentrations of Metadichol.
1.000
16.679
0.004 0.001 0.000 0.000
0.0
4.5
9.0
13.5
18.0
123456
Fold change
Treatment Concentrations
Figure 4: Q-RT PCR; Relative gene expression of TERT in UCB-MSCs cells.
0.00
1.22
-2.36 -3.02
-5.22
-12.26
-13.00
-9.40
-5.80
-2.20
1.40
5.00
Control 1pg 100pg 1ng 100ng 1ug
Log fold change
Treatment groups
Figure 5: Q-RT-PCR; Fold change of Telomerase in Metadichol treated UCB-
MSCs cell lines.
Figure 6: Amplication of β-actin prole.
Sample Conc. Relative Telomerase gene expression
Fold change Cq Value
Metadichol
Control 1.000 36.52
1 pg 16.68 26.07
100 pg 0.00 38.85
1 ng 0.00 42.89
100 ng 0.00 50.24
1 µg 0.00 72.54
Fluor Target Treatment CqCq Mean Cq Std. Dev.
SYBR Telomerase
Control 37.55 36.52 1.457
35.49
1 pg 27.31 26.07 1.754
24.83
100 pg 40.29 38.85 2.036
37.41
1 ng 42.32 42.89 0.806
43.46
100 ng 50.5 50.24 0.368
49.98
1 ug 74.01 72.54 2.079
71.07
SYBR Actin
Control 26.99 26.77 0.311
26.55
1 pg 18.57 20.38 2.560
22.19
100 pg 21.14 21.26 0.170
21.38
1 ng 23.67 23.1 0.806
22.53
100 ng 23.05 23.15 0.141
23.25
1ug 19.84 22.06 3.140
Table 6: Data of Cq values and fold change of Telomerase old change in real-time
PCR in USB-MSCs treated with different concentrations of Metadichol.
Table 5: Q-RT-PCR analysis of Telomerase in UCB cells at showing the fold
change and Cq value in USB-MSCs cells treated with different concentrations of
Metadichol.
Discussion
From the data, Figure 4, Metadichol® increases Telomerase
expression sixteen-fold at one picogram/ml. At higher
concentrations, there is hardly any expression. Figure 5 in log
format shows down-regulation at higher concentrations.
Citation: Raghavan PR (2019) The Quest for Immortality: Introducing Metadichol® a Novel Telomerase Activator. Stem Cell Res Ther 9: 446. doi:
10.4172/2157-7633.1000446
Page 5 of 9
Volume 9 • Issue 2 • 1000446
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
e western blot studies show post-translation that there is
Telomerase activity and expression of the protein is similar to that
seen in control, suggesting post-translational regulation of telomerase
activity is being maintained at replacement levels of cell division
(Figures 9-11).
Metadichol® shows dual properties like increasing insulin and also
decreasing Insulin [32,33] and besides acts on key biomarkers as shown
in Figure 12 (red is inhibition or decrease, and green is an increase
in biomarker levels). All these biomarkers aect the expression of
Telomerase activity and expression.
Metadichol® and VDR
Metadichol is an inverse agonist of Vitamin D receptor (VDR).
Vitamin D3 (1,25 OH)D3) and its analogs inhibit h-TERT expression
Figure 7: Melt peak of β-actin.
Figure 8: Amplication of TERT prole.
Metadichol
(Conc.)
Band intensity proteins Normalised
0.88
Relative gene
expression
β-actin Telomerase
Control 19386.59 17149.7 0.93 1.00
1 pg/ml 24.00 18399.48 0.00 1.05
100 pg/ml 15812.68 0.00 0.00 0.00
1 ng/ml 18091.9 0.00 0.00 0.00
100 ng/ml 18601.63 0.00 0.00 0.00
Table 7: Relative gene expression of Telomerase protein in Metadichol treatment
in USB-MSCs.
Figure 9: Melt peak of TERT.
Figure 10: Western Blot images showing the presence of Telomerase protein
in control and 1 pg/mL Metadichol treatment in USB-MSCs cells.
1. 1.055
0. 0. 0.
0.00
0.30
0.60
0.90
1.20
Control 1pg/ml 100pg/ml 1ng/ml 100ng/ml
Fold Regulation of Protein
Expression
Sample Concentrations
Figure 11: Relative expression of Telomerase protein in Metadichol treatment
in USB-MSCs cells.
Figure 12: Metadichol® and Biomarkers.
and telomerase activity in leukemic cells [21]. Metadichol® binds to
VDR as an inverse agonist. It is not surprising that it has dierent
eects compared to that of the agonist Vit D3. Inverse agonists bind
to the same site as the natural agonist but have dierent eects [34].
Metadichol® is the only known VDR inverse agonist today.
Citation: Raghavan PR (2019) The Quest for Immortality: Introducing Metadichol® a Novel Telomerase Activator. Stem Cell Res Ther 9: 446. doi:
10.4172/2157-7633.1000446
Page 6 of 9
Volume 9 • Issue 2 • 1000446
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Consensus Path DB [35] a software program that integrates gene
interaction networks and generates the shortest interaction paths
between 2 genes. Metadichol binding to VDR leads to the expression
of MYC genes which in turn activates the Telomerase gene as shown
in Figure 13. This pathway has its roots in the work of Wang et al. [36]
who showed that that MYC activates Telomerase gene. Zviran et al. [37]
showed that Myc activity is indispensable for conducive IPS (induced
pluripotent stem cells) formation from somatic cells.
VDR is widely expressed in many tissues [38], including
hematopoietic progenitor cells and the culture of human CD34+
hematopoietic progenitor cells. Addition of 1,25-dihydroxy Vitamin
D3 (vitamin D3) induces massive monocyte recruitment in vitro
[39,40]. Vitamin D3 is needed for definitive hematopoiesis and suggests
potential therapeutic utility in HSPC expansion [41]. Metadichol® has
been shown earlierin ex vivo study to enriches CD34+ and also CD33+
cells using umbilical cord cells [42,43]. VD3 and analogs inhibit malignant
cells growing in the blood [44], brain [45] and other cancers as well [46].
Metadichol® and AhR and other cytokines
AHR inhibition leads to an expansion of human umbilical cord
blood-derived HSPCs when stimulated by cytokines. AHR inhibition
leads to ex vivo HSC expansion and could be useful for the clinical use
of HSC therapy [47,48]. Metadichol is an inverse agonist of AhR [49].
TNF alpha activates NF-KB, and this targets Telomerase by
modulating its nuclear translocation [50-52]. Telomere shortening
results from increased levels of cytokines PAI-1, ICAM-1, MCP-1
[53,54]. Moreover, Metadichol inhibits all these biomarkers. Elevated
PAI-1 levels are involved in many diseases including cancer and
lead to accelerated aging and cellular senescence. PAI-1 is a downstream
target of p53 in the induction of senescence [55]. Stem cell
dysfunctions are the result of a deficiency of Klotho that lead to
telomere shortening [56]. Metadichol increases klotho expression in
cancer cell lines [57]. Free radical production can lead to oxidative stress
and telomere shortening [58]. Also, antioxidants like ascorbic acid
can mitigate this. Vitamin C increasing intracellularly is the key to
the suppression of oxidative stress leading to telomere length
maintenance. Metadichol increases Ascorbic to levels far above what
can be achieved by oral Vitamin C supplementation. Metadichol
increases Glut-4 expression tenfold, and this can recycle oxidized
ascorbic acid [59]. In some cases increased telomerase activity is
correlated with upregulation of Telomerase (h-TERT) mRNA [60].
Metzger, et al. [61] have shown that hTERT mRNA expression but not
telomerase activity is associated with improved 5-year survival cancer
rates.
Also, BCAT1 (Branched-chain amino acid transaminase 1) is
associated with proliferation in yeast and increased metastatic potential
in human cancers, and it is also inhibited by Metadichol [62].
Using a gene enrichment analyzer program Topp Cluster [63] one
can generate the cluster of diseases that can be targeted by Metadichol
[64] and this is shown in Figure 14. This approach aimed at multiple
targets offers superior efficacy because to tackle diseases, multiple
receptors and pathway need to be impacted. The idea of one disease,
one gene, one target, and one drug is no longer a viable concept to
be pursued and the concept emerging is what is referred to as poly-
pharmacology [65-67], and Metadichol® is the first example of a new
class of molecules that prove the viability of this emerging concept.
Conclusion
Metadichol® at one picogram per ml leads to a sixteen-fold increase
in mRNA expression followed by an expression of the Telomerase
protein, no expression is seen with increased concentration. mRNA-
based therapies require a systemic application, safety, and sufficient
concentrations of the therapeutic protein, meaning high quantities of
mRNA expression and these are achieved by use of Metadichol.
The advantage that Metadichol has over other telomerase activators
is that it is safe and can be tested directly in humans. The present
goal being pursued in tissue engineering research is to overcome
organ failure by enriching cells with telomerase. This could lead to its
use in conditions where telomere attrition has well known medical
Figure 13: VDR receptor to TERT gene
pathway.
Citation: Raghavan PR (2019) The Quest for Immortality: Introducing Metadichol® a Novel Telomerase Activator. Stem Cell Res Ther 9: 446. doi:
10.4172/2157-7633.1000446
Page 7 of 9
Volume 9 • Issue 2 • 1000446
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
consequences. An approach in use today is a patient donates cells that
are enriched with Telomerase in culture. ese cells are then injected
back in the patient to correct the deciency. e limitation is the
lifespan of most cells, and this is more pronounced in cells from older
patients. is inability to proliferate can be overcome using Metadichol.
Results of ongoing work on a small subset of Patients who have been
using Metadichol for over ve years and the eect on Telomere lengths
will be reported in due course. Telomerase activation using Metadichol
could potentially lead to immortalizing human cells in vivo and mass
producing in vitro any human cell that can lead to an unlimited supply
of normal human cells.
Acknowledgment
Special thanks to Dr. Yogisha, and Mr. Purushotham of Skanda Labs,
Bangalore, India and Dr. Muller of Micro-Sphere, Switzerland for many helpful
discussions.
References
1. Blackburn EH, Greider CW, Szostak JW (2006) Telomeres and telomerase:
The path from maize, Tetrahymena and yeast to human cancer and aging. Nat
Med 12: 1133-1138. [PubMed]
2. Liu JP (1999) Studies of the molecular mechanisms in the regulation of
telomerase activity. FASEB J 13: 2091-2104. [PubMed]
3. Armanios M (2013) Telomeres and age-related disease: How telomere biology
informs clinical paradigms. J Clin Invest 123: 996-1002. [PubMed]
4. Blackburn EH, Epel ES, Lin J (2015) Human telomere biology: A contributory
and interactive factor in aging, disease risks, and protection. Science 350:
1193-1198. [PubMed]
5. Zhang F, Cheng D, Wang S, Zhu J (2016) Human-specic regulation of the
telomerase reverse transcriptase gene. Genes 7: 30. [PubMed]
6. Shay JW, Wright WE (2007) Hallmarks of telomeres in aging research. J Pathol
211: 114-123. [PubMed]
7. Aubert G, Landsorp PM (2008) Telomeres and aging. Physiol Rev 88: 557-579.
[PubMed]
8. Shay JW, Wright WE (2000) Hayick, his limit, and cellular aging. Nat Rev Mol
Cell Biol 1: 72-76. [PubMed]
9. Feldser DM, Hackett JA, Greider CW (2003) Telomere dysfunction and the
initiation of genome instability. Nat Rev Cancer 3: 623-627. [PubMed]
10. Greider CW (1998) Telomerase activity, cell proliferation, and cancer. PNAS
95: 90-92.
11. Calado RT, Young NS (2009) Telomere diseases. N Engl J Med 361: 2353-
2365. [PubMed]
12. Carrero JJ, Stenvinkel P, Fellstrom B, Qureshi AR, Lamb K, et al. (2008)
Telomere attrition is associated with inammation, low fetuin-A levels and
high mortality in prevalent haemodialysis patients. J Intern Med 263: 302-312.
[PubMed]
13. Fitzpatrick AL, Kronmal RA, Gardner JP, Psaty BM, Jenny NS, et al. (2007)
Leukocyte telomere length and cardiovascular disease in the cardiovascular
health study. Am J Epidemiol 165: 14-21. [PubMed]
Figure 14: Gene cluster and disease network.
Citation: Raghavan PR (2019) The Quest for Immortality: Introducing Metadichol® a Novel Telomerase Activator. Stem Cell Res Ther 9: 446. doi:
10.4172/2157-7633.1000446
Page 8 of 9
Volume 9 • Issue 2 • 1000446
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
14. Edo MD, Andrés V (2005) Aging, telomeres, and atherosclerosis. Cardiovascular
Research 66: 213-221.
15. Minamino T, Komuro I (2007) Vascular cell senescence: Contribution to
atherosclerosis. Circ Res 100: 15-26. [PubMed]
16. Shay JW, Wright WE (2006) Telomerase therapeutics for cancer: Challenges
and new directions. Nat Rev Drug Discov 5: 577-584. [PubMed]
17. Mirabello L, Yu K, Kraft P, De Vivo I, Hunter DJ, et al. (2010) The association
of telomere length and genetic variation in telomere biology genes. Hum Mutat
31: 1050-1058. [PubMed]
18. Zhu X (2016) The association between telomere length and cancer risk in
population studies. Sci Rep 6: 1-10.
19. Zhang C, Chen X, Li L, Zhou Y, Wang C, et al. (2015) The association between
telomere length and cancer prognosis: Evidence from a meta-analysis. PLoS
One 10: e0133174. [PubMed]
20. Eitsuka T, Nakagawa K, Kato S, Ito J, Otoki Y, et al. (2018) Modulation of
telomerase activity in cancer cells by dietary compounds: A review. Int J Mol
Sci 19: 478. [PubMed]
21. Kasiappan R, Shen Z, Tse AK, Jinwal U, Tang J, et al. (2012)
1,25-Dihydroxyvitamin D3 suppresses telomerase expression and human
cancer growth through microRNA-498. J Biol Chem 287: 41297-41309.
[PubMed]
22. Hiyama E, Hiyama K, Yokoyama T, Matsuura Y, Piatyszek MA, et al. (1995)
Correlating telomerase activity levels with human neuroblastoma outcomes.
Nat Med 1: 249-255. [PubMed]
23. Bruedigam C, Lane SW (2016) Telomerase in hematologic malignancies. Curr
Opin Hematol 23: 346-353. [PubMed]
24. Salvador L, Singaravelu G, Harley CB, Flom P, Suram A, et al. (2016) A natural
product telomerase activator lengthens telomeres in humans: A randomized,
double-blind, and placebo-controlled study. Rejuvenation Res 19: 478-494.
[PubMed]
25. Harley CB, Liu W, Blasco M, Vera E, Andrews WH, et al. (2011) A natural product
telomerase activator as part of a health maintenance program. Rejuvenation
Res 14: 45-56. [PubMed]
26. Harley CB, Liu W, Flom PL, Raffaele JM (2013) A natural product telomerase
activator as part of a health maintenance program: Metabolic and cardiovascular
response. Rejuvenation Res 16: 386-395. [PubMed]
27. Bernardes de Jesus B, Schneeberger K, Vera E, Tejera A, Harley CB, et al.
(2011) A telomerase activator TA-65 elongates short telomeres and increases
health span of adult/old mice without increasing cancer incidence. Aging Cell
10: 604-621. [PubMed]
28. Zimmermann S, Voss M, Kaiser S, Kapp U, Waller CF, et al. (2012) Lack of
telomerase activity in human mesenchymal stem cells. Leukemia 17: 1146-
1149. [PubMed]
29. Karimi T, Eslaminejad MB, Aminlari M, Shahverdi A, Bahmanpour S (2012)
Study of telomerase activity, proliferation and differentiation characteristics in
umbilical cord blood mesenchymal stem cells. IJVR 13: 176-185.
30. Liang XJ, Chen XJ, Yang DH, Huang SM, Sun GD, et al. (2012) Differentiation
of human umbilical cord mesenchymal stem cells into hepatocyte-like cells by
hTERT gene transfection in vitro. Cell Biol Int 36: 215-221. [PubMed]
31. Ramunas J, Yakubov E, Brady JJ, Corbel SY, Holbrook C, et al. (2015) Transient
delivery of modied mRNA encoding TERT rapidly extends telomeres in human
cells. FASEB J 29: 1930-1939. [PubMed]
32. Raghavan PR (2014) US patent 8.722,093.
33. Raghavan PR (2015) US patent 9,006,292.
34. Kenakin T (2004) Principles: Receptor theory in pharmacology. Trends
Pharmacol Sci 25: 186-192. [PubMed]
35. Kamburov A, Pentchev K, Galicka H, Wierling C, Lehrach H, et al. (2011)
ConsensusPathDB: Toward a complete picture of cell biology. Nucleic Acids
Res 39: 712-717. [PubMed]
36. Wang J, Xie LY, Allan S, Beach D, Hannon GJ (1998) Myc activates telomerase.
Genes Dev 12: 1769-1774. [PubMed]
37. Zviran A, Mor N, Rais Y, Gingold H, Peles S, et al. (2018) Deterministic somatic
cell reprogramming involves continuous transcriptional changes governed by
myc and epigenetic-driven modules. Cell Stem Cell 24: 328-341.
38. Reichel H, Koefer HP, Norman AW (1989) The role of the Vitamin D endocrine
system in health and disease. N Engl J Med 320: 980-991 [PubMed]
39. Cortes M, Chen MJ, Stachura DL, Liu SY, Kwan W, et al. (2016) Developmental
Vitamin D availability impacts hematopoietic stem cell production. Cell Rep 17:
458-468. [PubMed]
40. Kizaki M, Norman AW, Bishop JE, Lin CW, Karmakar A, et al. (1991)
1,25-Dihydroxyvitamin D3 receptor mRNA: expression in hematopoietic cells.
Blood 77: 1238-1247. [PubMed]
41. Gemelli C, Orlandi C, Zanocco Marani T, Martello A, Vignudelli T, et al. (2008)
The vitamin D3/HoxA10 pathway supports MafB function during the monocyte
differentiation of human CD34+ hematopoietic progenitors. J Immunol 181:
5660-5672. [PubMed]
42. Raghavan PR (2018) Metadichol® and CD34 expression in umbilical cord cells.
J Stem Cell Res Ther 8: 1-4.
43. Raghavan PR (2019) Metadichol® and CD33 expression in umbilical cord cells.
Stem Cell Res Ther 9: 443.
44. McCormick DL, Rao KV, Steele VE, Lubet RA, Kelloff GJ (1999)
Chemoprevention of rat prostate carcinogenesis by 9-cis-retinoic acid. Cancer
Res 59: 521-524. [PubMed]
45. Naveilhan P, Berger F, Haddad K, Barbot N, Benabid AL, et al. (1994) Induction
of glioma cell death by 1,25(OH)2
vitamin D3: towards an endocrine therapy of
brain tumors? J Neurosci Res 37: 271-277. [PubMed]
46. James SY, Mackay AG, Colston KW (1995) Vitamin D derivatives in combination
with 9-cis retinoic acid promote active cell death in breast cancer cells. J Mol
Endocrinol 14: 391-394. [PubMed]
47. Angelos MG, Ruh PN, Webber BR, Blum RH, Ryan CD, et al. (2017) Aryl
hydrocarbon receptor inhibition promotes hematolymphoid development from
human pluripotent stem cells. Blood 129: 3428-3439. [PubMed]
48. Wagner JE (2018) Single Cord Blood Units (CBU) Expanded with an Aryl
Hydrocarbon Receptor (AHR) antagonist, demonstrate uniform engraftment
and rapid hematopoietic recovery. Blood 129: 3428-3439.
49. Akiyama M, Hideshima T, Hayashi T, Tai YT, Mitsiades CS, et al. (2003) Nuclear
factor-kappaB p65 mediates tumor necrosis factor alpha-induced nuclear
translocation of telomerase reverse transcriptase protein. Cancer Res 63: 18-
21. [PubMed]
50. Raghavan PR (2017) Metadichol ®. A novel inverse agonist of Aryl Hydrocarbon
Receptor (AHR) and NRF2 inhibitor. J Cancer Sci Ther 9: 661-668.
51. Akiyama M, Hideshima T, Hayashi T, Tai YT, Mitsiades CS, et al. (2002)
Cytokines modulate telomerase activity in a human multiple myeloma cell line.
Cancer Res 62: 3876-3882. [PubMed]
52. Hideshima T, Chauhan D, Schlossman R, Richardson P, Anderson KC (2001)
The role of tumor necrosis factor in the pathophysiology of multiple human
myeloma: therapeutic applications. Oncogene 20: 4519-4527. [PubMed]
53. Vaughan DE, Rai R, Khan SS, Eren M, Ghosh AK (2017) Plasminogen activator
inhibitor-1 is a marker and a mediator of senescence. Arterioscler Thromb Vasc
Biol 37: 1446-1452. [PubMed]
54. Amsellem V, Gary-Bobo G, Marcos E, Maitre B, Chaar V, et al. (2011) Telomere
dysfunction causes sustained inammation in chronic obstructive pulmonary
disease. Am J Respir Crit Care Med 184: 1358-1366. [PubMed]
55. Kortlever RM, Higgins PJ, Bernards R (2006) Plasminogen activator inhibitor-1
is a critical downstream target of p53 in the induction of replicative senescence.
Nat Cell Biol 8: 877-884. [PubMed]
56. Ullah M, Sun Z (2018) Klotho deciency accelerates stem cells aging by
impairing telomerase activity. J Gerontol A Biol Sci Med Sci. [PubMed]
57. Raghavan PR (2018) Metadichol® a Novel Agonist of the anti-aging klotho
gene in cancer cell lines. J Cancer Sci Ther 10: 351-357.
58. Furumoto K, Inoue E, Nagao N, Hiyama E, Miwa N (1998) Age-dependent
telomere shortening is slowed down by enrichment of intracellular vitamin C via
suppression of oxidative stress. Life Sci 63: 935-948. [PubMed]
59. Raghavan PR (2018) Umbilical cord cells treatment with Metadichol® IRS
proteins and GLUT4 expression and implications for diabetes. Stem Cell Res
Ther 8: 1-9.
60. Cong YS, Wright WE, Shay JW (2002) Human telomerase and its regulation.
Microbiol Mol Biol Rev 66: 407-425. [PubMed]
Citation: Raghavan PR (2019) The Quest for Immortality: Introducing Metadichol® a Novel Telomerase Activator. Stem Cell Res Ther 9: 446. doi:
10.4172/2157-7633.1000446
Page 9 of 9
Volume 9 • Issue 2 • 1000446
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
61. Metzger R, Vallbohmer D, Müller-Tidow C, Higashi H, Bollschweiler E, et al.
(2009) Increased human telomerase reverse transcriptase (hTERT) mRNA
expression but not telomerase activity is related to survival in curatively
resected non-small cell lung cancer. Anticancer Res 29: 1157-1162. [PubMed]
62. Ananieva EA (2018) Branched-chain amino acid metabolism in cancer. Curr
Opin Clin Nutr Metab Care 21: 64-70. [PubMed]
63. Raghavan PR (2017) Improving longevity with Metadichol® by inhibiting BCAT-
1 Gene. J Aging Sci 5: 1.
64. Kaimal V, Bardes EE, Tabar SC, Jegga AG, Aronow BJ (2010) ToppCluster: A
multiple gene list feature analyzer for comparative enrichment clustering and
network-based dissection of biological systems. Nucleic Acids Res 38: 96-102.
[PubMed]
65. Raghavan PR (2018) A multi gene targeting approach to treating liver diseases
with Metadichol®. J Cytokine Biol 3: 1-7.
66. Bottegoni G, Favia AD, Recanatini M, Cavalli A (2012) The role of fragment-
based and computational methods in polypharmacology. Drug Discov Today
17: 23-34. [PubMed]
67. Hopkins AL (2008) Network pharmacology: The next paradigm in drug
discovery. Nat Chem Biol 4: 682-690. [PubMed]
