ArticlePDF Available

Synthesized Ceramide Induces Growth of Dermal Papilla Cells with Potential Contribution to Hair Growth

Authors:

Abstract and Figures

Background: The ceramide is known to play an important role in the formation of intracellular lipids, and play a crucial role as a barrier for skin and hair cuticle. Recent study has revealed that ceramide has potential effect on hair growth in a mouse model. However, the role of ceramide in human dermal papilla cells (hDPCs) known to play an important role in hair growth is not well understood yet. Objective: The goal of this study was to investigate the effect of synthetic ceramides (oleyl and stearyl ceramides) on hair growth using hDPCs. Methods: hDPCs were treated with synthesized ceramides. hDPCs viability was evaluated by MTT assay. The expression of hair growth related factors were investigated by western blot, real-time polymerase chain reaction and growth factor array. The expression of β-catenin was confirmed by immunofluorescence. Results: Treatment with ceramides increased the expression of proteins affecting cell proliferation such as Bcl-2, BAX, phosphorylated-ERK and Cyclin D1. Also, ceramides treatment were increased the expression of several growth factors, including epidermal growth factor family, and promote the expression of Wnt/β-catenin and BMP2/4 signaling. Conclusion: Our data suggest that synthetic ceramides stimulates hair growth by induction proliferation of hDPCs via modulation of Wnt/β-catenin and BMP2/4 signaling.
Content may be subject to copyright.
JH Oh, et al
164 Ann Dermatol
Received July 30, 2018, Revised October 16, 2018, Accepted for publication
October 23, 2018
Corresponding author: Hoon Kang, Department of Dermatology, St. Paul’s
Hospital, College of Medicine, The Catholic University of Korea, 180
Wangsan-ro, Dongdaemun-gu, Seoul 02259, Korea. Tel: 82-2-958-2143,
Fax: 82-2-969-8999, E-mail: johnkang@catholic.ac.kr
ORCID: https://orcid.org/0000-0002-9822-4760
T
his is an Open Access article distributed under the terms of the Creative
Commons Attribution Non-Commercial License (http://creativecommons.
org/licenses/by-nc/4.0) which permits unrestricted non-commercial use,
distribution, and reproduction in any medium, provided the original work
is properly cited.
Copyright © The Korean Dermatological Association and The Korean
Society for Investigative Dermatology
pISSN 1013-9087eISSN 2005-3894
Ann Dermatol Vol. 31, No. 2, 2019 https://doi.org/10.5021/ad.2019.31.2.164
ORIGINAL ARTICLE
Synthesized Ceramide Induces Growth of Dermal
Papilla Cells with Potential Contribution to Hair Growth
Jee Hye Oh, Kwan Ho Jeong, Jung Eun Kim, Hoon Kang
Department of Dermatology, St. Paul’s Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
Background: The ceramide is known to play an important
role in the formation of intracellular lipids, and play a crucial
role as a barrier for skin and hair cuticle. Recent study has re-
vealed that ceramide has potential effect on hair growth in a
mouse model. However, the role of ceramide in human der-
mal papilla cells (hDPCs) known to play an important role in
hair growth is not well understood yet. Objective: The goal
of this study was to investigate the effect of synthetic ceram-
ides (oleyl and stearyl ceramides) on hair growth using
hDPCs. Methods: hDPCs were treated with synthesized
ceramides. hDPCs viability was evaluated by MTT assay. The
expression of hair growth related factors were investigated
by western blot, real-time polymerase chain reaction and
growth factor array. The expression of β-catenin was con-
firmed by immunofluorescence. Results: Treatment with ce-
ramides increased the expression of proteins affecting cell
proliferation such as Bcl-2, BAX, phosphorylated-ERK and
Cyclin D1. Also, ceramides treatment were increased the ex-
pression of several growth factors, including epidermal
growth factor family, and promote the expression of Wnt/
β-catenin and BMP2/4 signaling. Conclusion: Our data sug-
gest that synthetic ceramides stimulates hair growth by in-
duction proliferation of hDPCs via modulation of Wnt/β
-catenin and BMP2/4 signaling. (Ann Dermatol 31(2) 164
174, 2019)
-Keywords-
Ceramide, Dermal papilla cell, Hair, Wnt signaling path-
way
INTRODUCTION
Hair aging is a complicated process involving various
factors. The study of hair aging is divided into two main
streams1. One is an intrinsic biological process at cellular
level that is directly linked to hair growth. For hair growth
and cycling, interaction between human dermal papilla
cells (hDPCs) and mesenchymal stem cells in hair follicles
and various growth factors are essential2. The other one is
an extrinsic process that happens outside the scalp1. Ex-
trinsic process is highly related to the cuticle layer. The
cuticle exists at the outermost part of the hair. It protects
the hair shaft from external mechanical stress. The cuticle
layer is damaged by external stress such as ultraviolet rays,
smoking, and malnutrition. It is known that when the cu-
ticle layer is damaged, aging process of the hair can be ini-
tiated easily3.
In terms of structure of hair cuticle which protects hair
from extrinsic stimuli, ceramide is the most important in-
tracellular lipid that constitutes the lipid layer of hair cu-
ticle along with fatty acid and cholesterol4. Ceramide is a
component of intercellular lipids that are present in hair
cuticles to protect and strengthen internal components of
hair. Moreover, ceramide is a crucial second signal mole-
cule that regulates various signaling pathways, including
cell cycle, cellular senescence, and apoptosis5.
Previous studies have shown that ceramide has an antago-
nistic effects for cell growth and cell survival6. However,
recently it has been reported that ceramide can affect hair
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 165
Fig. 1. Effects of ceramides on viability of human dermal
papilla cells (hDPCs). (A) Scheme of ceramide’s synthesis
process. (B) Chemical structures of synthetic ceramides (oleyl
and stearyl ceramide). (C) The effect of ceramides on hDPC
s
viability was determined by MTT assay. hDPCs were cultured
for 24 hours. After starvation, these cultured hDPCs were
treated with three kinds of ceramides for 72 hours. Stearyl Cer:
stearyl ceramide, Oleyl Cer: oleyl ceramide. *p0.05 com-
pared with C8-ceramide treatment group, **p0.01 com-
p
ared with
g
rou
p
treated with C8-ceramide (
p
ositive control).
loss prevention and hair growth enhancement7. In partic-
ular, ceramide synthase 4 (CerS4) plays an important role
in the maintenance of epidermal stem cell homeostasis
and regulation of the hair cycle by regulating Wnt signal
and BMP signal8. Although ceramide can affect Wnt/BMP
balance in vivo8, the effect of ceramide on growth path-
way such as Wnt/BMP balance in vitro has not been con-
firmed.
Therefore, the objective of this study was to investigate the
effect of ceramide on hDPCs at cellular level. To inves-
tigate the effect of existing natural C8-ceramide (N-octa-
noyl sphingosine) and ceramide-like synthetic compound
on hair growth, we evaluated the hair growth pathway in-
cluding Wnt/β-catenin and BMP signaling changes after
stimulation with ceramide. Three types of ceramide were
used in this experiment: C8-ceramide and two newly syn-
thetic ceramides (oleyl and stearyl ceramide). These newly
synthesized ceramides are different from C8-ceramide in
that they have higher solubility through double bonds and
carbon chain length.
MATERIALS AND METHODS
Ceramide material preparation
C8-ceramide was purchased from Cayman Chemical (Ann
Arbor, MI, USA). Oleyl ceramide was synthesized by re-
acting one equivalent of 2-dodecenyl succinic anhydride
and oleyl amine in methylene chloride at room temper-
ature (RT) for 30 minutes. The reaction mixture was then
extracted with ethanol and water and recrystallized to a
pale yellow paste, with a purity of 95% and a yield of 98%.
Structure of the compound was confirmed by 1H-NMR
and LC-MSMS spectrometer. 1H-NMR spectra were record-
ed on a ZEOL 400 MHz FT-NMR spectrometer in CDCl3.
LC-MSMS spectra were recorded on a Shiseido HTS HPLC
system and an AB SCIEX API 3200 triple quadruple mass
spectrometer. LC-MSMS separations module with electro-
spray ionization was carried out in positive ion mode.
Stearyl ceramide was synthesized in the same manner using
stearyl amine (Fig. 1A). All ceramides were dissolved in eth-
anol to obtain concentration of 1 mM and store at 20oC.
JH Oh, et al
166 Ann Dermatol
Table 1. List of primers and real-time polymerase chain reaction conditions
Species Primer name Forward Reverse
Human β-catenin TTTAAGCCTCTCGGTCTGTG CAAATACCCTCAGGGGAACA
Wnt3 CCTCAAGGACAAGTACGACA GGCACCTTGAAGTAGGTGTA
Wnt5a AATTCTGGCTCCACTTGTTG CAATTACAACCTGGGCGAAG
Wnt7a TCTGTAACAAGATCCCAGGC CATTGCGGAACTGAAACTGA
AP1 TGTCCGAGAACTAAAGCCAA AAAAGTCCAACGTTCCGTTC
Lef1 CAGTGACGAGCACTTTTCTC CGTGATGGGATATACAGGCT
Axin2 CAGTGGATGCTGGAGAGTGA TGCCAGTTTCTTTGGCTCTT
BMP2 CAGGTCCTTTGACCAGAGTT CCATGGTCGACCTTTAGGAG
BMP4 ATTCCCGTCCAAGCTATCTC CTACGGAATGGCTCCATAGG
GAPDH GAAGGTGAAGGTCGGAGTCAA GCTCCTGGAAGATGGTGATG
β-catenin: beta-catenin, Wnt3: wingless type MMTV integration site family, member 3, Wnt5a: wingless type MMTV integration site
family, member 5A, Wnt7a: wingless type MMTV integration site family, member 7a, AP1: activator protein 1, Lef1: lymphoid
enhancer-binding factor-1, Axin2: axin-related protein 2, BMP2: bone morphogenetic protein 2, BMP4: bone morphogenetic protein
4, GAPDH: glyceraldehydes 3-phosphate dehydrogenase.
Cell culture
hDPCs were purchased and cultured in Follicle Dermal
papilla cell growth medium (PromoCell GmbH, Heidelberg,
Germany) supplemented with 10% fetal bovine serum
and 1% penicillin and placed in an incubator at 37oC with
5% CO2.
Cell viability assay (MTT assay)
The viability of hDPCs was evaluated by 3-[4,5-dime-
thylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT)
assay. Briefly, hDPCs were seeded into 24-well plates at
density of 1.0×104 cell per well. After 48h of incubation
for hDPCs to reach confluency, three kinds of ceramides
(C8-ceramide, oleyl, and stearyl ceramides) at various con-
centrations of 10 μM, 100 μM, 500 μM, 1,000 μM and
5,000 μM were used for treatment for 24 hours, 48 hours,
and 72 hours under 1% penicillin conditions. After in-
cubation, 100 μl of MTT solution was added to each well
and the hDPCs were then incubated at 37oC for 4 hours.
After the medium was aspirated, 400 μl DMSO was add-
ed to each well. The absorbance of the plate was meas-
ured at wavelength of 540 nm using an ELISA plate reader.
Real time polymerase chain reaction
RNA was isolated from cultured hDPCs using TRIZOL re-
agent (Invitrogen, Carlsbad, CA, USA) and cDNA synthe-
sis was performed using a cDNA synthesis kit (Takara,
Shiga, Japan) according to the manufacturer’s instructions.
The cDNA was used for real-time polymerase chain re-
action (PCR) which was carried out with SYBR Green (Bio-
Rad, Hercules, CA, USA). Sequences of primers used in
real-time PCR are listed in Table 1.
Western blot analysis
The protocol for western blot analysis was described in a
previous report9. Briefly, protein lysates from hDPCs were
prepared using radio immunoprecipitation assay cell lysis
buffer containing protease inhibitor cocktail. The cell ly-
sate was collected by scraping after removed cell debris
from lysed cells. Protein concentration was determined us-
ing a Bradford assay. Proteins were separated by 10%
SDS-polyacrylamide gel electrophoresis and blotted onto
polyvinylidene fluoride membrane. The membrane was
blocked with 5% BSA/TBST reagent for 1 hour at RT. It
was then incubated with primary antibodies against total
ERK, total Akt, phosphorylated-ERK, Akt, and GSK3β,
Cyclin-D1, β-catenin (Cell Signaling Technology, Beverly,
MA, USA), Bcl-2, BAX, and β-actin (Santa Cruz Biotech-
nology Inc., Dallas, TX, USA) overnight at 4oC on a rotary
shaker. The blotted membrane was then visualized with
an AI600 Bio-Image analysis system (GE Healthcare Life
Science, Chicago, IL, USA).
Growth factor array
Synthetic ceramides were screened for their effects on the
expression of growth factors by using Human Growth
Factor Antibody Array G1 (RayBiotech Inc., Norcross, GA,
USA) in accordance with the manufacturer’s protocol.
Immunofluorescence staining
Cultured hDPCs were seeded on 4-well chamber slides at
density of 5×103 cells per well (SPL Life Science, Po-
cheon, Korea). After starvation, hDPCs were treated with
C8-ceramide, oleyl, and stearyl ceramides at concentra-
tion of 1,000 μM for 24 hours. After aspirating the me-
dium, cells were rinsed with 1X PBS three times for 5 mi-
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 167
nutes each time. Then hDPCs were fixed with 4% paraf-
ormaldehyde for 15 minutes and permeabilized with 0.1%
Triton X-100 for 10 minutes. After washing with 1X PBS,
cells were blocked with 1% BSA in 1X PBS for 1 hour at
RT on a shaker. They were incubated with anti-rabbit β-
catenin (Cell Signaling Technology) primary antibody di-
luted at 1:100 in blocking buffer and incubated at 4oC
overnight. On the next day, they were incubated with
Alexa Fluor 488 labeled goat anti-rabbit secondary anti-
body (Invitrogen) diluted at 1:200 in PBST at RT for 1 hour
in the dark. These stained cells were mounted with moun-
ting medium containing DAPI to counterstain nuclei. Cells
were then observed with a fluorescence microscope
(Axiovert 200; Zeiss, Oberkochen, Germany).
Statistical analysis
All statistical data analyses were carried out using Graphpad
Prism 5 Software. One-way analysis of variance (ANOVA)
was used to evaluate significant difference at p0.05.
RESULTS
Viability of hDPCs after treatment with ceramides
To investigate the effect of synthetic ceramides (Fig. 1B)
on viability of hDPCs, we performed MTT assay. Firstly,
optical concentrations of oleyl and stearyl ceramides and
C8-ceramide as a positive control were determined. hDPCs
were treated with various concentrations (0 μM, 10 μM,
100 μM, 500 μM, 1,000 μM, and 5,000 μM) of oleyl
and stearyl ceramides, and C8-ceramide for 72 hours.
Results showed that oleyl and stearyl ceramides inhibited
cell viability at 5,000 μM (Fig. 1C). However, viability of
hDPCs was increased after treatment with C8-ceramide
(110%), oleyl ceramide (109%), and stearyl ceramide
(102%) at 1,000 μM. Based on these results, 1,000 μM
was chosen as the proper concentration of ceramides for
further experiments.
Ceramides regulates Bcl-2/BAX and ERK/Cyclin-D1 in
hDPCs
We examined expression levels of Bcl-2 and BAX known
as apoptosis regulator genes by western blot analysis.
Results showed that Bcl-2 expression was significantly en-
hanced by treatment with ceramides compare to that in
the control group. However, treatment with ceramides
showed no significant effect on BAX expression (Fig. 2A).
When the ratio of Bcl-2 to BAX was compared, there was
no significant difference between C8-ceramide treatment
group and the control group. However, in groups treated
with the two newly synthesized ceramides, the ratio of
Bcl-2 to BAX was increased 1.22-fold in the group treated
with oleyl ceramide and 1.53-fold in the group treated
with stearyl ceramide. Such increases were statistically sig-
nificant.
ERK is also an important factor involved in cell survival
and proliferation10,11. We examined the effect of ceram-
ides on phosphorylated-ERK in order to determine if our
synthetic ceramides could affect mitogen-activated protein
kinase (MAPK) signaling involved in the growth of hDPCs.
Protein expression level of phosphorylated-ERK was in-
creased following treatment with ceramides (Fig. 2B).
PD98059, an ERK inhibitor, is known to regulate the pro-
liferation of hDPCs. hDPCs were pretreated with ERK in-
hibitor PD98059 (10 μM) for 1 hour and then incubated
with ceramides for 24 hours.
Treatment of PD98059 reduced the overall activation of
ERK compared to the untreated group. In Fig. 2C, phos-
phorylated-ERK expression was abolished in the PD98059
treated group compared to the untreated group. Also, we
tested whether the ceramides affected phosphorylation
tendency to aggravate. As a results, in the ceramide-treat-
ed group, the expression of phosphorylated-ERK was sup-
pressed compared with Fig. 2B, but the expression was in-
creased as compared with the control group.
Our results revealed that the expression level of Cyclin-D1
was increased after treatment with C8-ceramide, oleyl, and
stearyl ceramide (Fig. 2D). These results indicate that our
synthetic ceramides could regulate proliferation of hDPCs
by regulating Bcl-2/BAX ratio and ERK/Cyclin-D1.
Ceramide treatment upregulates growth factors i ncluding
epidermal growth factor family
Growth factors were assessed using growth factor mem-
brane microarray (RayBiotech Inc.) according to the manu-
facturer’s instructions. As shown in Fig. 3A, treatment with
oleyl and stearyl ceramides increased growth factors levels
overall. Epidermal growth factor (EGF) family members
such as amphiregulin (AR), EGF, EGF receptor (EGFR), and
insulin-like growth factor 1 (IGF-1) are known to stimulate
nuclear translocation of β-catenin.
We confirmed that the IGF-1, EGF and EGFR expressions
were increased in response to ceramides-treatment (Fig.
3B). AR expression was decreased by C8-cer treatment,
but oleyl and stearyl ceramide-treatment increased AR
expression.
Ceramides activates β-catenin pathway in hDPCs
We focused on the β-catenin pathway involved in hair
growth. The level of phosphorylated-Akt was significantly
increased by treatment with ceramides compared to that
in the control group (Fig. 4A). Our results also showed
that oleyl and stearyl ceramides had a reversal effect on
JH Oh, et al
168 Ann Dermatol
Fig. 2. Ceramide increases expression levels of Bcl-2/BAX and ERK/Cyclin-D1. (A) Expression levels of various factors known to affect
proliferation were examined by western blot. Bcl-2 expression in groups treated with oleyl and stearyl ceramides was increased compare
to those of the control group and C8-ceramide group. (BD) Phosphorylated-ERK was normalized relative to total ERK. Cyclin-D1
was normalized relative to β-actin. Western blot results showed upregulated levels of Cyclin-D1 and phosphorylated ERK after treatment
with ceramides compare to the control group. Results are expressed as mean±standard deviation. C8-Cer: C8-ceramide, Stearyl Cer:
stearyl ceramide, Oleyl Cer: oleyl ceramide. *p<0.05 compared with the control, **p<0.01 compared with the control, ***p<0.001
compared with the control.
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 169
Fig. 3. (A) Ceramides upregulate growth factor protein levels. Human growth factor antibody array was used to detect growth factor
expression in human dermal papilla cells (hDPCs). (B) Ceramide treatment significantly increased the expression of growth factors
in hDPCs. Results are expressed as mean±standard deviation. C8-Cer: C8-ceramide, Stearyl Cer: stearyl ceramide, Oleyl Cer: oleyl
ceramide, AR: amphiregulin, IGF-1: insulin-like growth factor 1, EGF: epidermal growth factor, EGFR: receptor.. *p0.05 compared
with the control, **p0.01 compared with the control.
LY294002, an Akt inhibitor. They induced a decrease in
phosphorylation of Akt (Fig. 4A). Our results showed that
protein expression level of phosphorylated-GSK3β was
increased by treatment with ceramides including C8-cera-
mide, oleyl, and stearyl ceramides (Fig. 4B).
Western blot results showed that β-catenin expression
was increased in groups treated with ceramides compared
to that in the control group (Fig. 4B). Additionally, our im-
munofluorescent staining results confirmed the expression
of β-catenin in the nucleus. Interestingly, the expression
of β-catenin in the nucleus was very weak in the control
group untreated with ceramides whereas the expression of
β-catenin in the nucleus was significantly increased in
groups treated with synthetic ceramides. In particular, its
expression in the nuclei and cytoplasm in groups treated
with synthetic ceramides (oleyl and stearyl ceramides) was
significantly increased compared to that in the control
group (Fig. 4C). These results suggest that our synthetic ce-
ramides could induce β-catenin expression.
Wnt/β-catenin and BMP signaling in hDPCs
Wnt signaling is known as the master regulator of hair
JH Oh, et al
170 Ann Dermatol
Fig. 4. Effects of ceramide treatment on B-catenin pathway. Phosphorylation of Akt/GSK3β and β-catenin expression was determined
by western blot. Graph was schematized data of western blot band. (A, B) Phosphorylation of Akt/GSK3β and β-catenin expression
was increased by ceramide treatment compare to those in the control. (C) β-catenin expression in the nucleus of human dermal
papilla cells was determined by immunofluorescence staining. Oleyl and stearyl ceramides significantly increased β-catenin expression
in nuclei compare to C8-ceramide treatment or control. DAPI (blue) was used to counterstain nuclei (×100). Results are expressed
as mean±standard deviation. C8-Cer: C8-ceramide, Stearyl Cer: stearyl ceramide, Oleyl Cer: oleyl ceramide. *p<0.05 compared with
the control.
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 171
Fig. 5. Ceramides upregulate expression of Wnt
/
β
-catenin
targets but downregulate expression of BMP target. Expression
levels of target genes were determined using real-tim
e
polymerase chain reaction. (A) Wnt target genes: Wnt3,
Wnt5a, Wnt7a, Wnt10b; (B) β-catenin target genes: β
-
catenin, AP-1, Lef-1, Axin2; and (C) BMP target genes: BMP2,
BMP4. Results are expressed as mean±standard deviation.
C8-Cer: C8-ceramide, Stearyl Cer: stearyl ceramide, Oleyl Cer:
oleyl ceramide. *p0.05 compared with the control, **p0.01,
***p0.001 compared with the control, #p0.05 compare
d
with the group treated with C8-ceramide.
growth and hair cycle while β-catenin is a key tran-
scription factor activated by Wnt signaling12. BMP signal-
ing is known to regulate stem cell activation during hair
regeneration13. To determine whether our synthetic ce-
ramides might affect Wnt/β-catenin and BMP signaling,
we conducted real-time PCR analysis. As shown in Fig. 5,
treatment with stearyl ceramide increased Wnt signaling
such as mRNA expression level of wnt3a (2.1-fold), wnt5a
(1.8-fold), and wnt10b (6.1-fold) (Fig. 5A). Treatment with
stearyl ceramide also significantly increased β-catenin
signaling, including mRNA expression level of β-catenin
(5.5-fold), AP-1 (3.2-fold), Lef-1 (3.8-fold), and Axin2 (2.2-
fold) compared to the control group (Fig. 5B). Moreover,
treatment with oleyl ceramide increased mRNA expres-
sion level of wnt3a, wnt5a, and wnt7a (Fig. 5A), as well as
β-catenin, AP-1, Lef-1, and Axin compared to the control
group (Fig. 5B).
The mRNA expression of BMP2 and BMP4, which are
known as BMP target gene, were downregulated by oleyl
ceramide treatment. Stearyl ceramide treatment also in-
duced a decrease in BMP4 expression (Fig. 5C). Our data
support that our synthetic ceramides could regulate Wnt/
β-catenin pathway by inhibiting BMP target genes.
DISCUSSION
Ceramide is central component of cellular membrane. It is
a key player in many signaling pathways involved in cell
cycle arrest and differentiation14. Previous studies about
effects of ceramide on hair have focused on developing
cosmetics to protect hair shaft15. However, recent studies
have suggested that ceramide promotes hair lengthening,
leading to increased anagen follicles in mice and human
organ culture system7. These results indicate that ceramide
might not only play a role as hair shaft protector, but also
act as hair growth stimulator. Consistent with previous
studies, our results showed that the two newly synthesized
ceramides could stimulate hair growth at cellular levels.
In the present study, we demonstrated that synthetic ce-
ramides could increase proliferation of hDPCs accom-
panied by increased Bcl-2/BAX and phosphorylated-ERK/
Cyclin-D1 expression levels. We also observed that expres-
sion levels of β-catenin stimulated genes such as phos-
phorylated-Akt/GSK3β and AR/EGF/EGFR/IGF-1 were in-
creased after treatment with ceramides. In addition, oleyl
and stearyl ceramides could upregulate the expression of
Wnt/β-catenin signaling and downregulate BMP2 and
JH Oh, et al
172 Ann Dermatol
BMP4 (BMP2/4) expression. Taken together, our results sug-
gest that synthetic ceramides have hair growth stimulating
potentials.
Studies about hair growth have shown that the prolifera-
tion of hDPCs is accompanied by increased duration of
anagen phase16. Hair follicle size is determined by the vol-
ume of hDPCs while hDPCs volume depends on the num-
ber of cells17. Hence, we evaluated the effect of synthetic
ceramides on hDPCs proliferation. hDPCs were treated
with various concentrations of ceramides. Our results con-
firmed that synthetic ceramides at 1,000 μM could in-
crease viability of hDPCs. These results indicate that these
synthetic ceramides might contribute to the proliferation
of hDPCs.
Apoptosis is mainly processed through the intrinsic death
pathway18. The most important regulators of apoptosis pro-
cess are members of the Bcl-2 gene family. Bcl-2 protein is
known to possess anti-apoptotic ability to obstruct a varie-
ty of apoptotic signals. BAX protein is another member of
the Bcl-2 family. It plays a pro-apoptotic role by stimulat-
ing apoptosis function, unlike Bcl-2 protein19. It has been
reported that cellular Bcl-2/BAX ratio represents regulation
of cell survival20. Also, Bcl-2/BAX ratio was considered im-
portant in the hair cycle. It is known that the expression of
Bcl-2 is dependent on the cycling of hair follicle, and apo-
ptosis is the central program of the hair cycle21. Our re-
sults revealed that BAX expression did not change while
Bcl-2 expression was significantly increased in groups
treated with synthetic ceramides. Bcl-2/BAX ratio was in-
creased in oleyl or stearyl ceramide treated group com-
pared to that in the control group.
Ceramide activation may either activate or inhibit the
MAPK pathway depending on the cell type22. MAPK sig-
nal is known to regulate various cellular responses such as
cellular proliferation, cell differentiation, development, and
apoptosis23. ERK is known as one of MAPK signaling path-
ways involved in cell survival and growth10. Also, ERK path-
way was known stimulate hDPCs proliferation24. Cyclin-
D1 is also a key protein that promotes cell cycle (G1-S
phase) progression. An increase in cyclin-D1 expression is
required for cell proliferation to occur25.
In this study, we examined the effect of synthetic ceram-
ides on phosphorylation of ERK and Cycin-D1 expression.
Results showed that treatment with oleyl and stearyl ce-
ramides increased phosphorylation of ERK and induced
expression of Cyclin-D1 protein. Previous studies have
shown that high concentration of ceramide in cells in-
duces apoptosis6. However, our results showed Bcl-2/BAX
ratio and ERK/Cyclin-D1 levels were increased by treat-
ment with our synthetic ceramides. Although the under-
lying apoptotic effect of ceramide on hDPCs is not fully
understood yet, our results show that synthetic ceramides
may stimulate proliferation of hDPCs by regulating Bcl-2/
BAX ratio and ERK/Cyclin-D1 pathway.
Hair growth involves various transcription factors. EGF
family members are known to stimulate nuclear trans-
location of β-catenin and upregulate the expression of
Wnt10b and β-catenin levels. Especially, IGF-1 is known
as an important effect on hair growth and extended the an-
agen phase generally26. The Wnt/β-catenin signaling path-
way is known as a master regulator for hair growth and
hair follicle morphogenesis12. We investigated Akt/β-cate-
nin signaling pathway to elucidate the molecular mecha-
nism involved in the effect of ceramides relate to β-cat-
enin activation. To activate β-catenin translocation into
nucleus, activation of Akt is needed. Akt is involved in sig-
nal transduction pathways such as inflammatory mediator,
glycogen metabolism, and proliferation apoptosis27. Acti-
vation of Akt results in phosphorylation of several sub-
strates such as GSK-3β. GSK-3β is an active enzyme
negatively regulated by Wnt pathway and Akt-induced
phosphorylation. In the Wnt pathway, GSK-3β phosphor-
ylation and inactivation will lead to the accumulation and
nuclear translocation of β-catenin28. Activated β-catenin
induces Wnt signaling activation. Therefore, β-catenin is
an essential molecule in Wnt signaling. As shown in Fig.
4, ceramides-treatment increased phosphorylated GSK3β
via activation of Akt. Finally, β-catenin expression in the
nucleus was increased by ceramide-treatment. Our find-
ings are consistent with results of Kwack et al.16 reporting
that minoxidil can increase phosphorylation levels of Akt/
GSK3β and β-catenin expression.
The balance between Wnt/β-catenin pathway and BMP
pathway is important for hair growth cycling29. Axin2 and
Lef-1 are directed target genes of the β-catenin pathway.
Axin2 plays a role in regulating β-catenin level. Cytoplasmic
protein is activated when Axin2 binds to β-catenin. Lef-1
is known as the binding site for β-catenin to accelerate
directional differentiation of hair follicle stem cells30. Wnt3a
and Wnt7a are inductive signals to maintain hDPCs in an
anagen state31. Wnt5a is a key target gene of Shh in hair
follicle morphogenesis32. Wnt10b, also known as hair fol-
licle’s growth stimulator, promotes hair follicle regrowth
by upregulating Wnt/β-catenin signaling pathway related
factors including Axin2 and Lef-133. Previous studies have
also reported that Wnt10b/β-catenin signaling causes re-
generation of hair follicles and proliferation of hair matrix
cells33,34. As shown in Fig. 5, treatment with synthetic ce-
ramides upregulated expression of β-catenin target genes
such as Lef-1, AP-1, and Axin2. Especially, Wnt10b and β-
catenin expression levels were significantly increased by
treatment with stearyl ceramide. These findings indicate
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 173
that treatment with synthetic ceramides has potential to af-
fect hair growth.
BMP signaling can promote telogen. It has been reported
that inhibition of BMP signaling induces Wnt signaling
and initiates hair growth early13. BMP2/4 activation can
elaborately regulate the development of hair follicle bulge
stem cell activation and growth during hair cycle35. As
shown in Fig. 5, treatment with oleyl ceramide downregu-
lated expression levels of BMP target genes (BMP2/4).
These results suggest that downregulating BMP2/4 expres-
sion could help hair growth via early activation of Wnt
signaling.
In conclusion, our study demonstrated that synthetic ce-
ramides had positive effects on hair cell proliferation by
regulating Bcl-2/BAX and ERK/Cyclin-D1 in hDPCs. More-
over, synthetic ceramides have potential to stimulate hair
growth via Wnt/β-catenin and BMP2/4 signaling in hDPCs.
Our results provide novel information that synthetic ce-
ramides such as oleyl and stearyl ceramides might have
potential to help hair growth via cell proliferation by regu-
lating gene expression in hDPCs. Although these findings
are just laboratory results, our results explained the possi-
bility of stimulating hair growth by treatment with cera-
mide. Furthermore, our synthetic ceramides might be used
as new therapeutic agents to promote hair growth.
ACKNOWLEDGMENT
This research was supported by the Ministry of Trade,
Industry & Energy (MOTIE), Korea Institute for Advance-
ment of Technology (KIAT) through the Encouragement
Program for The Industries of Economic Cooperation Re-
gion (R0005754).
CONFLICTS OF INTEREST
The authors have nothing to disclose.
ORCID
Jee Hye Oh, https://orcid.org/0000-0002-7971-9936
Kwan Ho Jeong, https://orcid.org/0000-0002-3631-0866
Jung Eun Kim, https://orcid.org/0000-0003-1670-0995
Hoon Kang, https://orcid.org/0000-0002-9822-4760
REFERENCES
1. Trüeb RM. Oxidative stress in ageing of hair. Int J Trich-
ology 2009;1:6-14.
2. Andl T, Reddy ST, Gaddapara T, Millar SE. WNT signals are
required for the initiation of hair follicle development. Dev
Cell 2002;2:643-653.
3. Takahashi T, Mamada A, Breakspear S, Itou T, Tanji N.
Age-dependent changes in damage processes of hair cuti-
cle. J Cosmet Dermatol 2015;14:2-8.
4. Lee WS, Oh TH, Chun SH, Jeon SY, Lee EY, Lee S, et al.
Integral lipid in human hair follicle. J Investig Dermatol
Symp Proc 2005;10:234-237.
5. Sasaki T, Hazeki K, Hazeki O, Ui M, Katada T. Permissive
effect of ceramide on growth factor-induced cell prolife-
ration. Biochem J 1995;311:829-834.
6. Venable ME, Lee JY, Smyth MJ, Bielawska A, Obeid LM.
Role of ceramide in cellular senescence. J Biol Chem 1995;
270:30701-30708.
7. Park BM, Bak SS, Shin KO, Kim M, Kim D, Jung SH, et al.
Promotion of hair growth by newly synthesized ceramide
mimetic compound. Biochem Biophys Res Commun 2017;
491:173-177.
8. Peters F, Vorhagen S, Brodesser S, Jakobshagen K, Brüning
JC, Niessen CM, et al. Ceramide synthase 4 regulates stem
cell homeostasis and hair follicle cycling. J Invest Dermatol
2015;135:1501-1509.
9. Jeong KH, Joo HJ, Kim JE, Park YM, Kang H. Effect of
mycophenolic acid on proliferation of dermal papilla cells
and induction of anagen hair follicles. Clin Exp Dermatol
2015;40:894-902.
10. Li W, Man XY, Li CM, Chen JQ, Zhou J, Cai SQ, et al.
VEGF induces proliferation of human hair follicle dermal
papilla cells through VEGFR-2-mediated activation of ERK.
Exp Cell Res 2012;318:1633-1640.
11. Han JH, Kwon OS, Chung JH, Cho KH, Eun HC, Kim KH.
Effect of minoxidil on proliferation and apoptosis in dermal
papilla cells of human hair follicle. J Dermatol Sci 2004;34:
91-98.
12. Rishikaysh P, Dev K, Diaz D, Qureshi WM, Filip S, Mokry
J. Signaling involved in hair follicle morphogenesis and
development. Int J Mol Sci 2014;15:1647-1670.
13. Zhang J, He XC, Tong WG, Johnson T, Wiedemann LM,
Mishina Y, et al. Bone morphogenetic protein signaling
inhibits hair follicle anagen induction by restricting epi-
thelial stem/progenitor cell activation and expansion. Stem
Cells 2006;24:2826-2839.
14. Uchida Y. Ceramide signaling in mammalian epidermis.
Biochim Biophys Acta 2014;1841:453-462.
15. Méndez S, Manich AM, Martí M, Parra JL, Coderch L. Da-
maged hair retrieval with ceramide-rich liposomes. J Cos-
met Sci 2011;62:565-577.
16. Kwack MH, Kang BM, Kim MK, Kim JC, Sung YK. Minoxidil
activates β-catenin pathway in human dermal papilla cells:
a possible explanation for its anagen prolongation effect. J
Dermatol Sci 2011;62:154-159.
17. Elliott K, Stephenson TJ, Messenger AG. Differences in hair
follicle dermal papilla volume are due to extracellular
matrix volume and cell number: implications for the control
of hair follicle size and androgen responses. J Invest Der-
matol 1999;113:873-877.
18. Elmore S. Apoptosis: a review of programmed cell death.
Toxicol Pathol 2007;35:495-516.
JH Oh, et al
174 Ann Dermatol
19. Lutter M, Perkins GA, Wang X. The pro-apoptotic Bcl-2
family member tBid localizes to mitochondrial contact sites.
BMC Cell Biol 2001;2:22.
20. Hanada M, Aimé-Sempé C, Sato T, Reed JC. Structure-
function analysis of Bcl-2 protein. Identification of con-
served domains important for homodimerization with Bcl-2
and heterodimerization with Bax. J Biol Chem 1995;270:
11962-11969.
21. Stenn KS, Lawrence L, Veis D, Korsmeyer S, Seiberg M.
Expression of the bcl-2 protooncogene in the cycling adult
mouse hair follicle. J Invest Dermatol 1994;103:107-111.
22. Mathias S, Peña LA, Kolesnick RN. Signal transduction of
stress via ceramide. Biochem J 1998;335:465-480.
23. Zhang W, Liu HT. MAPK signal pathways in the regulation
of cell proliferation in mammalian cells. Cell Res 2002;12:
9-18.
24. Joo HJ, Jeong KH, Kim JE, Kang H. Various wavelengths of
light-emitting diode light regulate the proliferation of human
dermal papilla cells and hair follicles via Wnt/β-catenin and
the extracellular signal-regulated kinase pathways. Ann
Dermatol 2017;29:747-754.
25. Yang K, Hitomi M, Stacey DW. Variations in cyclin D1
levels through the cell cycle determine the proliferative fate
of a cell. Cell Div 2006;1:32.
26. Ahn SY, Pi LQ, Hwang ST, Lee WS. Effect of IGF-I on hair
growth is related to the anti-apoptotic effect of IGF-I and
up-regulation of PDGF-A and PDGF-B. Ann Dermatol 2012;
24:26-31.
27. Liu P, Cheng H, Roberts TM, Zhao JJ. Targeting the phos-
phoinositide 3-kinase pathway in cancer. Nat Rev Drug
Discov 2009;8:627-644.
28. Monick MM, Carter AB, Robeff PK, Flaherty DM, Peterson
MW, Hunninghake GW. Lipopolysaccharide activates Akt
in human alveolar macrophages resulting in nuclear ac-
cumulation and transcriptional activity of beta-catenin. J
Immunol 2001;166:4713-4720.
29. Kandyba E, Leung Y, Chen YB, Widelitz R, Chuong CM,
Kobielak K. Competitive balance of intrabulge BMP/Wnt
signaling reveals a robust gene network ruling stem cell
homeostasis and cyclic activation. Proc Natl Acad Sci U S A
2013;110:1351-1356.
30. DasGupta R, Kaykas A, Moon RT, Perrimon N. Functional
genomic analysis of the Wnt-wingless signaling pathway.
Science 2005;308:826-833.
31. Kishimoto J, Burgeson RE, Morgan BA. Wnt signaling main-
tains the hair-inducing activity of the dermal papilla. Genes
Dev 2000;14:1181-1185.
32. Reddy S, Andl T, Bagasra A, Lu MM, Epstein DJ, Morrisey
EE, et al. Characterization of Wnt gene expression in
developing and postnatal hair follicles and identification of
Wnt5a as a target of Sonic hedgehog in hair follicle mor-
phogenesis. Mech Dev 2001;107:69-82.
33. Ouji Y, Yoshikawa M, Shiroi A, Ishizaka S. Promotion of
hair follicle development and trichogenesis by Wnt-10b in
cultured embryonic skin and in reconstituted skin. Biochem
Biophys Res Commun 2006;345:581-587.
34. Li YH, Zhang K, Ye JX, Lian XH, Yang T. Wnt10b promotes
growth of hair follicles via a canonical Wnt signalling
pathway. Clin Exp Dermatol 2011;36:534-540.
35. Plikus MV, Mayer JA, de la Cruz D, Baker RE, Maini PK,
Maxson R, et al. Cyclic dermal BMP signalling regulates
stem cell activation during hair regeneration. Nature 2008;
451:340-344.
... Moreover, the IHC results showed that CGE topical treatment increased β-catenin expression in HF tissue compared to the Veh group. Previous studies elaborated on the crosstalk between β-catenin and Akt/ERK1/2 pathways, and their involvement in hair growth promotion [42][43][44], and β-catenin expression is promoted by pGSK3β-pAKT-pERK signaling in hDPCs [45]. A previous study reported that β-catenin regulates SHH expression, and the deletion of β-catenin inhibited SHH expression and inhibited anagen induction [39]. ...
Article
Full-text available
To investigate the CGE on hair growth and to explore the mechanism that is involved in the acceleration of anagen induction, we investigated the effects of CGE studied on cell proliferation and molecular mechanism in human hair dermal papilla cells (hDPCs) and keratinocytes (HaCaT cells). Additionally, hair growth evaluation was carried out following topical treatment of the dorsal skin of telogen C57BL/6 mice with CGE for 14 days. As result, CGE increased cell viability and ALP activity in hDPCs. Moreover, CGE increased the expression of catenin beta 1 (CTNNB1), ALP, sex-determining region Y-box 2 (SOX2), insulin-like growth factor 1 (IGF1), and vascular endothelial growth factor A (VEGFA) genes in hDPCs. CGE increased the expression of proteins such as ALP, β-catenin, and phosphorylation of glycogen synthase kinase 3β (pGSK3β), and protein kinase B (pAKT) in hDPCs. Furthermore, CGE induced the proliferation of HaCaT cells and up-regulated AKT-ERK-GSKβ-β-catenin signaling in HaCaT cells. Additionally, the anagen induction effects of CGE were confirmed on the telogen-anagen transition mice model. these findings demonstrated that CGE promoted the entering the growth phase of hair follicle via activation of β-catenin signaling pathways in vivo. Thus, this study suggests that CGE might be a potential therapeutic reagent for hair growth.
... SHH has been found to regulate the angiogenic growth factor such as VEGF. BMP2, BMP4 activation is known to elaborately regulate the development of HF bulge stem cell activation and growth during the hair cycle [45]. hHMSCs secrete several growth factors such as VEGF, and FGF, which lead to escalated cell proliferation, regeneration and promote the migration of cells. ...
Article
Full-text available
Mesenchymal stem cell therapy (MSCT) has been shown to be a new therapeutic option for treating alopecia areata (AA). Outer root sheath cells (ORSCs) play key roles in maintaining the hair follicle structure and supporting the bulge area. In human ORSCs (hORSCs), the mechanism for this process has not been extensively studied. In this study, we aimed to examine the influence of human hematopoietic mesenchymal stem cells (hHMSCs) in the hORSCs in vitro model of AA and determine the mechanisms controlling efficacy. Interferon-gamma (IFN-γ) pretreatment was used to induce an in vitro model of AA in hORSCs. The effect of MSCT on the viability and migration of hORSCs was examined using co-cultures, the MTT assay, and migration assays. We investigated the expression of molecules related to the Wnt/β-catenin pathway, JAK/STAT pathway, and growth factors in hHMSC-treated hORSCs by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analyses. hHMSCs increased hORSC viability and migration when they were co-cultured. hHMSCs reverted IFN-γ-induced expression—including NLRP3, ASC, caspase-1, CXCL-9 through 11, IL-1β, and IL-15—and upregulated several growth factors and hair stem cell markers. hHMSCs activated several molecules in the Wnt/β-catenin signaling pathway, such as in the Wnt families, β-catenin, phosphorylated GSK-3β and cyclin D1, and suppressed the expression of DKK1 induced by IFN-γ in hORSCs. hHMSCs suppressed the phosphorylation of JAK1 to 3, STAT1, and STAT3 compared to the controls and IFN-γ-pretreated hORSCs. These results demonstrate that hHMSCs increased hORSC viability and migration in the in vitro AA model. Additionally, MSCT definitely stimulated anagen survival and hair growth in an HF organ culture model. MSCT appeared to be associated with the Wnt/β-catenin and JAK/STAT pathways in hORSCs.
Preprint
Hepatocellular carcinoma (HCC) is largely associated with aberrant activation of Wnt/β-catenin signaling. Nevertheless, how membrane lipid composition is altered in HCC cells with abnormal Wnt signaling remains elusive. Here, by exploiting comprehensive lipidome profiling, we unravel membrane lipid composition of six different HCC cell lines with mutations in components of Wnt/β-catenin signaling, leading to differences in their endogenous signaling activity. Among the differentially regulated lipids are diacylglycerol (DAG) and ceramide, which were downregulated at the membrane of HCC cells after Wnt3a stimulation. DAG and ceramide enhanced Wnt/β-catenin signaling in SNU475 and HepG2 cells. In contrast, depletion of DAG and ceramide suppressed Wnt/β-catenin signaling and significantly impeded the proliferation, tumor growth and in vivo migration capacity of SNU475 and HepG2 cells. This study, by pioneering plasma membrane lipidome profiling in HCC cells, exhibits the remarkable potential of lipids to correct dysregulated signaling pathways in cancer and stop abnormal tumor growth.
Article
Numerous agents (approximately 90) are shown to stimulate hair growth in cellular and animal models in a hormetic-like biphasic dose response manner. These hormetic dose responses occur within the framework of direct stimulatory responses as well as in preconditioning experimental protocols. These findings have important implications for experimental and clinical investigations with respect to study design strategies, dose selection and dose spacing along with sample size and statistical power issues. These findings further reflect the general occurrence of hormetic dose responses within the biological and biomedical literature that consistently appear to be independent of biological model, level of biological organization (i.e., cell, organ, and organism), endpoint, inducing agent, potency of the inducing agent, and mechanism.
Article
Full-text available
Background The human dermal papilla cells (hDPCs) play an important role in regulation of hair cycling and growth. Objective The aim of this study was to investigate the effect of different wavelengths of light-emitting diode (LED) irradiation on the proliferation of cultured hDPCs and on the growth of human hair follicles (HFs) in vitro. Methods We examined the effect of LED irradiation on Wnt/β-catenin signaling and mitogen-activated protein kinase (MAPK) pathways in hDPCs. Anagen HFs were cultured with LED irradiation and elongation of each hair shaft was measured. Results The most potent wavelength in promoting the hDPC proliferation is 660 nm and 830 nm promoted hDPC proliferation to a lesser extent than 660 nm. Various wavelengths significantly increased β-catenin, Axin2, Wnt3a, Wnt5a and Wnt10b mRNA expression. LED irradiation significantly increased β-catenin and cyclin D expression, and the phosphorylation of MAPK and extracellular signal-regulated kinase (ERK). HFs irradiated with 415 nm and 660 nm grew longer than control. Conclusion Our result suggests that LED has a potential to stimulate hDPC proliferation via the activation of Wnt/β-catenin signaling and ERK pathway. To our best knowledge, this is the first report which investigated that the effect of various wavelengths of LED on hDPC proliferation and the underlying mechanisms.
Article
Full-text available
Ceramides are crucial for skin barrier function but little is known about the regulation of epidermal appendages and whether stem cell populations that control their regeneration depend on specific ceramide species. Here we demonstrate that ceramide synthase 4 (CerS4) is highly expressed in the epidermis of adult mice where it is localized in the interfollicular epidermis and defined populations within the pilosebaceous unit. Inactivation of CerS4 in mice resulted in precocious activation of hair follicle bulge stem cells while expanding the Lrig1(+)-junctional zone and sebaceous glands. This was preceded first by a decrease in BMP and a subsequent increase in Wnt signaling. This imbalance in quiescent versus activating signals likely promoted a prolonged anagen-like hair follicle state after the second catagen, which exhausted stem cells over time ultimately resulting in hair loss in aged mice. K14-Cre-mediated deletion of CerS4 revealed a similar phenotype, thus suggesting an epidermis intrinsic function of CerS4 in regulating the regeneration of the pilosebaceous unit. The data indicate that CerS4-directed epidermal ceramide composition is essential to control hair follicle stem and progenitor cell behavior potentially through its regulation of BMP and Wnt signaling.Journal of Investigative Dermatology accepted article preview online, 23 February 2015. doi:10.1038/jid.2015.60.
Article
Full-text available
Hair follicle morphogenesis depends on Wnt, Shh, Notch, BMP and other signaling pathways interplay between epithelial and mesenchymal cells. The Wnt pathway plays an essential role during hair follicle induction, Shh is involved in morphogenesis and late stage differentiation, Notch signaling determines stem cell fate while BMP is involved in cellular differentiation. The Wnt pathway is considered to be the master regulator during hair follicle morphogenesis. Wnt signaling proceeds through EDA/EDAR/NF-κB signaling. NF-κB regulates the Wnt pathway and acts as a signal mediator by upregulating the expression of Shh ligand. Signal crosstalk between epithelial and mesenchymal cells takes place mainly through primary cilia. Primary cilia formation is initiated with epithelial laminin-511 interaction with dermal β-1 integrin, which also upregulates expression of downstream effectors of Shh pathway in dermal lineage. PDGF signal transduction essential for crosstalk is mediated through epithelial PDGF-A and PDGFRα expressed on the primary cilia. Dermal Shh and PDGF signaling up-regulates dermal noggin expression; noggin is a potent inhibitor of BMP signaling which helps in counteracting BMP mediated β-catenin inhibition. This interplay of signaling between the epithelial and dermal lineage helps in epithelial Shh signal amplification. The dermal Wnt pathway helps in upregulation of epithelial Notch expression. Dysregulation of these pathways leads to certain abnormalities and in some cases even tumor outgrowth.
Article
Full-text available
early event after the alveolar macrophage comes in contact with LPS is activation of the phosphatidylinositol 3 kinase (PI 3-kinase). This study evaluates the downstream effects of that activation. We observed that LPS exposure results in phosphory- lation of Akt (serine 473). We found this using both phosphorylation-specific Abs and also by in vivo phosphorylation with 32 P-loaded cells. AKT activation resulted in the phosphorylation-dependent inactivation of glycogen synthase kinase (GSK-3) (serine 21/9). We found that both of these events were linked to PI 3-kinase because the PI 3-kinase inhibitors, wortmannin and LY294002, inhibited LPS-induced phosphorylation of both AKT and GSK-3. Inactivation of GSK-3 has been shown to reduce the ubiquitination of b-catenin, resulting in nuclear accumulation and transcriptional activity of b-catenin. Consistent with this, we found that LPS caused an increase in the amounts of PI 3-kinase-dependent nuclear b-catenin in human alveolar macrophages and expression of genes that require nuclear b-catenin for their activation. This is the first demonstration that LPS exposure activates AKT, inactivates GSK-3, and causes accumulation and transcriptional activity of b-catenin in the nucleus of any cell, including alveolar macrophages. The Journal of Immunology, 2001, 166: 4713- 4720.
Article
The formation of the hair follicle and its cyclical growth, quiescence, and regeneration depend on reciprocal signaling between its epidermal and dermal components. The dermal organizing center, the dermal papilla (DP), regulates development of the epidermal follicle and is dependent on signals from the epidermis for its development and maintenance. GFP specifically expressed in DP cells of a transgenic mouse was used to purify this population and study the signals required to maintain it. We demonstrate that specific Wnts, but not Sonic hedgehog (Shh), maintain anagen-phase gene expression in vitro and hair inductive activity in a skin reconstitution assay.
Article
Based on the crucial roles of ceramides in skin barrier function, use of ceramides or their structural mimetic compounds, pseudoceramides, as cosmetic ingredients are getting more popular. While currently used pseudoceramides are intended to substitute the structural roles of ceramides in stratum corneum, development of bioactive pseudoceramides has been repeatedly reported. In this study, based on the potential involvement of sphingolipids in hair cycle regulation, we investigated the effects of newly synthesized pseudoceramide, bis-oleamido isopropyl alcohol (BOI), on hair growth using cultured human hair follicles and animal models. BOI treatment promoted hair growth in cultured human hair follicles ex vivo and induced earlier conversion of telogen into anagen. Although we did not find a significant enhancement of growth factor expression and follicular cell proliferation, BOI treatment resulted in an increased sphinganine and sphingosine contents as well as increased ceramides contents in cultured dermal papilla (DP) cells. Taken together, our data strongly suggest that biologically active pseudoceramide promotes hair growth by stimulating do novo synthesis of sphingolipids in DP cells.
Article
Mycophenolic acid (MPA), the active metabolite of mycophenolate mofetil, has anti-inflammatory effects, and is widely used as an immunomodulatory agent. However, the beneficial effect of MPA in hair-loss disorders is not fully understood. To investigate the direct effect of MPA on dermal papilla cells (DPCs), and to examine the hair growth-stimulating effects of MPA topically applied to mouse skin. Cultured DPCs were treated with various concentrations of MPA and analysed by MTT assay. Expressions of hair growth-related genes, including Wnt/β-catenin pathway-related genes and cellular apoptosis-regulating genes, such as Bcl-2, Bax and caspase-9, were examined using reverse transcription (RT)-PCR and western blotting. The Wnt/extracellular signal-regulated kinase (ERK) pathway was analysed by western blotting. The effect of topically applied MPA on anagen hair follicle induction after microneedle (MN) treatment with or without minoxidil (MXD) was evaluated by histopathological examination and RT-PCR. MPA showed a promoting effect on DPC proliferation, which was associated with increased Axin2 transcription levels. In addition, phospho-ERK protein was detected in the MPA-treated DPCs. An increased Bcl-2/Bax transcript ratio contributed to cellular proliferation, and this was maintained in the MPA-treated environment. Topically applied MPA promoted anagen hair follicle induction in mice. The effect of MPA on hair follicles was compatible with that of MXD, and this effect was accelerated by MN treatment. MPA promotes proliferation of DPCs and induction of anagen hair follicles in mice. This finding raises the possibility that MPA could be used as a treatment option for hair-loss disorders. © 2015 British Association of Dermatologists.
Article
Background Human hair cuticle is always exposed to various stresses and then gradually lost in daily life. There are two typical patterns of cuticle damage: type L, where the cell membrane complex, the structure located between cuticle cells, is split and the cuticle lifts up, and type E, where the fragile substructure of the cuticle cell (endocuticle) is damaged so that its rugged residue is exposed. We previously reported that type L damage preferentially occurs in the case of Japanese females in their 20s to 40s.AimsThis study aims to elucidate the age-dependent change of cuticle and its effect on hair properties.Methods Hair fibers collected from Japanese females (ranging from 10 to 70 years old) were evaluated in the aspects of inclination for each type of damage, resistance of cuticle against grooming stresses and content of fatty acid 18-MEA on hair surface.ResultsIt was revealed that the dominant damage pattern shifts from type L to E with aging. Furthermore, the cuticle becomes gradually less resistant to daily grooming stress. The dominance of type E damage accelerates cuticle loss. Reduction of 18-MEA on weathered hair is accelerated with aging on elder hair.Conclusions It has been reported that various age-dependent changes of whole hair shaft, such as diameter, density, elasticity, etc., occur in the age range of 40s and 50s. In this study, it was revealed that cuticle becomes more fragile and the hair surface properties deteriorate in the same age range.
Article
Ceramide, the backbone structure of all sphingolipids, as well as a minor component of cellular membranes, has a unique role in the skin, by forming the epidermal permeability barrier at the extracellular domains of the outermost layer of skin, the stratum corneum, which is required for terrestrial mammalian survival. In contrast to the role of ceramide in forming the permeability barrier, the signaling roles of ceramide and its metabolites have not yet been recognized. Ceramide and/or its metabolites regulate proliferation, differentiation, and apoptosis in epidermal keratinocytes. Recent studies have further demonstrated that a ceramide metabolite, sphingosine-1-phosphate, modulates innate immune function. Ceramide already has been applied to therapeutic approaches for treatment of eczema associated with attenuated epidermal permeability barrier function. Pharmacological modulation of ceramide and its metabolites signaling can also be applied to cutaneous disease prevention and therapy. The author here describes the signaling roles of ceramide and its metabolites in mammalian cells and tissues, including epidermis. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier.
Article
Hair follicles facilitate the study of stem cell behavior because stem cells in progressive activation stages, ordered within the follicle architecture, are capable of cyclic regeneration. To study the gene network governing the homeostasis of hair bulge stem cells, we developed a Keratin 15-driven genetic model to directly perturb molecular signaling in the stem cells. We visualize the behavior of these modified stem cells, evaluating their hair-regenerating ability and profile their molecular expression. Bone morphogenetic protein (BMP)-inactivated stem cells exhibit molecular profiles resembling those of hair germs, yet still possess multipotentiality in vivo. These cells also exhibit up-regulation of Wnt7a, Wnt7b, and Wnt16 ligands and Frizzled (Fzd) 10 receptor. We demonstrate direct transcriptional modulation of the Wnt7a promoter. These results highlight a previously unknown intra-stem cell antagonistic competition, between BMP and Wnt signaling, to balance stem cell activity. Reduced BMP signaling and increased Wnt signaling tilts each stem cell toward a hair germ fate and, vice versa, based on a continuous scale dependent on the ratio of BMP/Wnt activity. This work reveals one more hierarchical layer regulating stem cell homeostasis beneath the stem cell-dermal papilla-based epithelial-mesenchymal interaction layer and the hair follicle-intradermal adipocyte-based tissue interaction layer. Although hierarchical layers are all based on BMP/Wnt signaling, the multilayered control ensures that all information is taken into consideration and allows hair stem cells to sum up the total activators/inhibitors involved in making the decision of activation.