Available via license: CC BY-NC 4.0
Content may be subject to copyright.
JH Oh, et al
164 Ann Dermatol
Received July 30, 2018, Revised October 16, 2018, Accepted for publication
October 23, 2018
Corresponding author: Hoon Kang, Department of Dermatology, St. Paul’s
Hospital, College of Medicine, The Catholic University of Korea, 180
Wangsan-ro, Dongdaemun-gu, Seoul 02259, Korea. Tel: 82-2-958-2143,
Fax: 82-2-969-8999, E-mail: johnkang@catholic.ac.kr
ORCID: https://orcid.org/0000-0002-9822-4760
T
his is an Open Access article distributed under the terms of the Creative
Commons Attribution Non-Commercial License (http://creativecommons.
org/licenses/by-nc/4.0) which permits unrestricted non-commercial use,
distribution, and reproduction in any medium, provided the original work
is properly cited.
Copyright © The Korean Dermatological Association and The Korean
Society for Investigative Dermatology
pISSN 1013-9087ㆍeISSN 2005-3894
Ann Dermatol Vol. 31, No. 2, 2019 https://doi.org/10.5021/ad.2019.31.2.164
ORIGINAL ARTICLE
Synthesized Ceramide Induces Growth of Dermal
Papilla Cells with Potential Contribution to Hair Growth
Jee Hye Oh, Kwan Ho Jeong, Jung Eun Kim, Hoon Kang
Department of Dermatology, St. Paul’s Hospital, College of Medicine, The Catholic University of Korea, Seoul, Korea
Background: The ceramide is known to play an important
role in the formation of intracellular lipids, and play a crucial
role as a barrier for skin and hair cuticle. Recent study has re-
vealed that ceramide has potential effect on hair growth in a
mouse model. However, the role of ceramide in human der-
mal papilla cells (hDPCs) known to play an important role in
hair growth is not well understood yet. Objective: The goal
of this study was to investigate the effect of synthetic ceram-
ides (oleyl and stearyl ceramides) on hair growth using
hDPCs. Methods: hDPCs were treated with synthesized
ceramides. hDPCs viability was evaluated by MTT assay. The
expression of hair growth related factors were investigated
by western blot, real-time polymerase chain reaction and
growth factor array. The expression of β-catenin was con-
firmed by immunofluorescence. Results: Treatment with ce-
ramides increased the expression of proteins affecting cell
proliferation such as Bcl-2, BAX, phosphorylated-ERK and
Cyclin D1. Also, ceramides treatment were increased the ex-
pression of several growth factors, including epidermal
growth factor family, and promote the expression of Wnt/
β-catenin and BMP2/4 signaling. Conclusion: Our data sug-
gest that synthetic ceramides stimulates hair growth by in-
duction proliferation of hDPCs via modulation of Wnt/β
-catenin and BMP2/4 signaling. (Ann Dermatol 31(2) 164∼
174, 2019)
-Keywords-
Ceramide, Dermal papilla cell, Hair, Wnt signaling path-
way
INTRODUCTION
Hair aging is a complicated process involving various
factors. The study of hair aging is divided into two main
streams1. One is an intrinsic biological process at cellular
level that is directly linked to hair growth. For hair growth
and cycling, interaction between human dermal papilla
cells (hDPCs) and mesenchymal stem cells in hair follicles
and various growth factors are essential2. The other one is
an extrinsic process that happens outside the scalp1. Ex-
trinsic process is highly related to the cuticle layer. The
cuticle exists at the outermost part of the hair. It protects
the hair shaft from external mechanical stress. The cuticle
layer is damaged by external stress such as ultraviolet rays,
smoking, and malnutrition. It is known that when the cu-
ticle layer is damaged, aging process of the hair can be ini-
tiated easily3.
In terms of structure of hair cuticle which protects hair
from extrinsic stimuli, ceramide is the most important in-
tracellular lipid that constitutes the lipid layer of hair cu-
ticle along with fatty acid and cholesterol4. Ceramide is a
component of intercellular lipids that are present in hair
cuticles to protect and strengthen internal components of
hair. Moreover, ceramide is a crucial second signal mole-
cule that regulates various signaling pathways, including
cell cycle, cellular senescence, and apoptosis5.
Previous studies have shown that ceramide has an antago-
nistic effects for cell growth and cell survival6. However,
recently it has been reported that ceramide can affect hair
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 165
Fig. 1. Effects of ceramides on viability of human dermal
papilla cells (hDPCs). (A) Scheme of ceramide’s synthesis
process. (B) Chemical structures of synthetic ceramides (oleyl
and stearyl ceramide). (C) The effect of ceramides on hDPC
s
viability was determined by MTT assay. hDPCs were cultured
for 24 hours. After starvation, these cultured hDPCs were
treated with three kinds of ceramides for 72 hours. Stearyl Cer:
stearyl ceramide, Oleyl Cer: oleyl ceramide. *p＜0.05 com-
pared with C8-ceramide treatment group, **p＜0.01 com-
p
ared with
g
rou
p
treated with C8-ceramide (
p
ositive control).
loss prevention and hair growth enhancement7. In partic-
ular, ceramide synthase 4 (CerS4) plays an important role
in the maintenance of epidermal stem cell homeostasis
and regulation of the hair cycle by regulating Wnt signal
and BMP signal8. Although ceramide can affect Wnt/BMP
balance in vivo8, the effect of ceramide on growth path-
way such as Wnt/BMP balance in vitro has not been con-
firmed.
Therefore, the objective of this study was to investigate the
effect of ceramide on hDPCs at cellular level. To inves-
tigate the effect of existing natural C8-ceramide (N-octa-
noyl sphingosine) and ceramide-like synthetic compound
on hair growth, we evaluated the hair growth pathway in-
cluding Wnt/β-catenin and BMP signaling changes after
stimulation with ceramide. Three types of ceramide were
used in this experiment: C8-ceramide and two newly syn-
thetic ceramides (oleyl and stearyl ceramide). These newly
synthesized ceramides are different from C8-ceramide in
that they have higher solubility through double bonds and
carbon chain length.
MATERIALS AND METHODS
Ceramide material preparation
C8-ceramide was purchased from Cayman Chemical (Ann
Arbor, MI, USA). Oleyl ceramide was synthesized by re-
acting one equivalent of 2-dodecenyl succinic anhydride
and oleyl amine in methylene chloride at room temper-
ature (RT) for 30 minutes. The reaction mixture was then
extracted with ethanol and water and recrystallized to a
pale yellow paste, with a purity of 95% and a yield of 98%.
Structure of the compound was confirmed by 1H-NMR
and LC-MSMS spectrometer. 1H-NMR spectra were record-
ed on a ZEOL 400 MHz FT-NMR spectrometer in CDCl3.
LC-MSMS spectra were recorded on a Shiseido HTS HPLC
system and an AB SCIEX API 3200 triple quadruple mass
spectrometer. LC-MSMS separations module with electro-
spray ionization was carried out in positive ion mode.
Stearyl ceramide was synthesized in the same manner using
stearyl amine (Fig. 1A). All ceramides were dissolved in eth-
anol to obtain concentration of 1 mM and store at −20oC.
JH Oh, et al
166 Ann Dermatol
Table 1. List of primers and real-time polymerase chain reaction conditions
Species Primer name Forward Reverse
Human β-catenin TTTAAGCCTCTCGGTCTGTG CAAATACCCTCAGGGGAACA
Wnt3 CCTCAAGGACAAGTACGACA GGCACCTTGAAGTAGGTGTA
Wnt5a AATTCTGGCTCCACTTGTTG CAATTACAACCTGGGCGAAG
Wnt7a TCTGTAACAAGATCCCAGGC CATTGCGGAACTGAAACTGA
AP1 TGTCCGAGAACTAAAGCCAA AAAAGTCCAACGTTCCGTTC
Lef1 CAGTGACGAGCACTTTTCTC CGTGATGGGATATACAGGCT
Axin2 CAGTGGATGCTGGAGAGTGA TGCCAGTTTCTTTGGCTCTT
BMP2 CAGGTCCTTTGACCAGAGTT CCATGGTCGACCTTTAGGAG
BMP4 ATTCCCGTCCAAGCTATCTC CTACGGAATGGCTCCATAGG
GAPDH GAAGGTGAAGGTCGGAGTCAA GCTCCTGGAAGATGGTGATG
β-catenin: beta-catenin, Wnt3: wingless type MMTV integration site family, member 3, Wnt5a: wingless type MMTV integration site
family, member 5A, Wnt7a: wingless type MMTV integration site family, member 7a, AP1: activator protein 1, Lef1: lymphoid
enhancer-binding factor-1, Axin2: axin-related protein 2, BMP2: bone morphogenetic protein 2, BMP4: bone morphogenetic protein
4, GAPDH: glyceraldehydes 3-phosphate dehydrogenase.
Cell culture
hDPCs were purchased and cultured in Follicle Dermal
papilla cell growth medium (PromoCell GmbH, Heidelberg,
Germany) supplemented with 10% fetal bovine serum
and 1% penicillin and placed in an incubator at 37oC with
5% CO2.
Cell viability assay (MTT assay)
The viability of hDPCs was evaluated by 3-[4,5-dime-
thylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT)
assay. Briefly, hDPCs were seeded into 24-well plates at
density of 1.0×104 cell per well. After 48h of incubation
for hDPCs to reach confluency, three kinds of ceramides
(C8-ceramide, oleyl, and stearyl ceramides) at various con-
centrations of 10 μM, 100 μM, 500 μM, 1,000 μM and
5,000 μM were used for treatment for 24 hours, 48 hours,
and 72 hours under 1% penicillin conditions. After in-
cubation, 100 μl of MTT solution was added to each well
and the hDPCs were then incubated at 37oC for 4 hours.
After the medium was aspirated, 400 μl DMSO was add-
ed to each well. The absorbance of the plate was meas-
ured at wavelength of 540 nm using an ELISA plate reader.
Real time polymerase chain reaction
RNA was isolated from cultured hDPCs using TRIZOL re-
agent (Invitrogen, Carlsbad, CA, USA) and cDNA synthe-
sis was performed using a cDNA synthesis kit (Takara,
Shiga, Japan) according to the manufacturer’s instructions.
The cDNA was used for real-time polymerase chain re-
action (PCR) which was carried out with SYBR Green (Bio-
Rad, Hercules, CA, USA). Sequences of primers used in
real-time PCR are listed in Table 1.
Western blot analysis
The protocol for western blot analysis was described in a
previous report9. Briefly, protein lysates from hDPCs were
prepared using radio immunoprecipitation assay cell lysis
buffer containing protease inhibitor cocktail. The cell ly-
sate was collected by scraping after removed cell debris
from lysed cells. Protein concentration was determined us-
ing a Bradford assay. Proteins were separated by 10%
SDS-polyacrylamide gel electrophoresis and blotted onto
polyvinylidene fluoride membrane. The membrane was
blocked with 5% BSA/TBST reagent for 1 hour at RT. It
was then incubated with primary antibodies against total
ERK, total Akt, phosphorylated-ERK, Akt, and GSK3β,
Cyclin-D1, β-catenin (Cell Signaling Technology, Beverly,
MA, USA), Bcl-2, BAX, and β-actin (Santa Cruz Biotech-
nology Inc., Dallas, TX, USA) overnight at 4oC on a rotary
shaker. The blotted membrane was then visualized with
an AI600 Bio-Image analysis system (GE Healthcare Life
Science, Chicago, IL, USA).
Growth factor array
Synthetic ceramides were screened for their effects on the
expression of growth factors by using Human Growth
Factor Antibody Array G1 (RayBiotech Inc., Norcross, GA,
USA) in accordance with the manufacturer’s protocol.
Immunofluorescence staining
Cultured hDPCs were seeded on 4-well chamber slides at
density of 5×103 cells per well (SPL Life Science, Po-
cheon, Korea). After starvation, hDPCs were treated with
C8-ceramide, oleyl, and stearyl ceramides at concentra-
tion of 1,000 μM for 24 hours. After aspirating the me-
dium, cells were rinsed with 1X PBS three times for 5 mi-
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 167
nutes each time. Then hDPCs were fixed with 4% paraf-
ormaldehyde for 15 minutes and permeabilized with 0.1%
Triton X-100 for 10 minutes. After washing with 1X PBS,
cells were blocked with 1% BSA in 1X PBS for 1 hour at
RT on a shaker. They were incubated with anti-rabbit β-
catenin (Cell Signaling Technology) primary antibody di-
luted at 1:100 in blocking buffer and incubated at 4oC
overnight. On the next day, they were incubated with
Alexa Fluor 488 labeled goat anti-rabbit secondary anti-
body (Invitrogen) diluted at 1:200 in PBST at RT for 1 hour
in the dark. These stained cells were mounted with moun-
ting medium containing DAPI to counterstain nuclei. Cells
were then observed with a fluorescence microscope
(Axiovert 200; Zeiss, Oberkochen, Germany).
Statistical analysis
All statistical data analyses were carried out using Graphpad
Prism 5 Software. One-way analysis of variance (ANOVA)
was used to evaluate significant difference at p＜0.05.
RESULTS
Viability of hDPCs after treatment with ceramides
To investigate the effect of synthetic ceramides (Fig. 1B)
on viability of hDPCs, we performed MTT assay. Firstly,
optical concentrations of oleyl and stearyl ceramides and
C8-ceramide as a positive control were determined. hDPCs
were treated with various concentrations (0 μM, 10 μM,
100 μM, 500 μM, 1,000 μM, and 5,000 μM) of oleyl
and stearyl ceramides, and C8-ceramide for 72 hours.
Results showed that oleyl and stearyl ceramides inhibited
cell viability at 5,000 μM (Fig. 1C). However, viability of
hDPCs was increased after treatment with C8-ceramide
(110%), oleyl ceramide (109%), and stearyl ceramide
(102%) at 1,000 μM. Based on these results, 1,000 μM
was chosen as the proper concentration of ceramides for
further experiments.
Ceramides regulates Bcl-2/BAX and ERK/Cyclin-D1 in
hDPCs
We examined expression levels of Bcl-2 and BAX known
as apoptosis regulator genes by western blot analysis.
Results showed that Bcl-2 expression was significantly en-
hanced by treatment with ceramides compare to that in
the control group. However, treatment with ceramides
showed no significant effect on BAX expression (Fig. 2A).
When the ratio of Bcl-2 to BAX was compared, there was
no significant difference between C8-ceramide treatment
group and the control group. However, in groups treated
with the two newly synthesized ceramides, the ratio of
Bcl-2 to BAX was increased 1.22-fold in the group treated
with oleyl ceramide and 1.53-fold in the group treated
with stearyl ceramide. Such increases were statistically sig-
nificant.
ERK is also an important factor involved in cell survival
and proliferation10,11. We examined the effect of ceram-
ides on phosphorylated-ERK in order to determine if our
synthetic ceramides could affect mitogen-activated protein
kinase (MAPK) signaling involved in the growth of hDPCs.
Protein expression level of phosphorylated-ERK was in-
creased following treatment with ceramides (Fig. 2B).
PD98059, an ERK inhibitor, is known to regulate the pro-
liferation of hDPCs. hDPCs were pretreated with ERK in-
hibitor PD98059 (10 μM) for 1 hour and then incubated
with ceramides for 24 hours.
Treatment of PD98059 reduced the overall activation of
ERK compared to the untreated group. In Fig. 2C, phos-
phorylated-ERK expression was abolished in the PD98059
treated group compared to the untreated group. Also, we
tested whether the ceramides affected phosphorylation
tendency to aggravate. As a results, in the ceramide-treat-
ed group, the expression of phosphorylated-ERK was sup-
pressed compared with Fig. 2B, but the expression was in-
creased as compared with the control group.
Our results revealed that the expression level of Cyclin-D1
was increased after treatment with C8-ceramide, oleyl, and
stearyl ceramide (Fig. 2D). These results indicate that our
synthetic ceramides could regulate proliferation of hDPCs
by regulating Bcl-2/BAX ratio and ERK/Cyclin-D1.
Ceramide treatment upregulates growth factors i ncluding
epidermal growth factor family
Growth factors were assessed using growth factor mem-
brane microarray (RayBiotech Inc.) according to the manu-
facturer’s instructions. As shown in Fig. 3A, treatment with
oleyl and stearyl ceramides increased growth factors levels
overall. Epidermal growth factor (EGF) family members
such as amphiregulin (AR), EGF, EGF receptor (EGFR), and
insulin-like growth factor 1 (IGF-1) are known to stimulate
nuclear translocation of β-catenin.
We confirmed that the IGF-1, EGF and EGFR expressions
were increased in response to ceramides-treatment (Fig.
3B). AR expression was decreased by C8-cer treatment,
but oleyl and stearyl ceramide-treatment increased AR
expression.
Ceramides activates β-catenin pathway in hDPCs
We focused on the β-catenin pathway involved in hair
growth. The level of phosphorylated-Akt was significantly
increased by treatment with ceramides compared to that
in the control group (Fig. 4A). Our results also showed
that oleyl and stearyl ceramides had a reversal effect on
JH Oh, et al
168 Ann Dermatol
Fig. 2. Ceramide increases expression levels of Bcl-2/BAX and ERK/Cyclin-D1. (A) Expression levels of various factors known to affect
proliferation were examined by western blot. Bcl-2 expression in groups treated with oleyl and stearyl ceramides was increased compare
to those of the control group and C8-ceramide group. (B∼D) Phosphorylated-ERK was normalized relative to total ERK. Cyclin-D1
was normalized relative to β-actin. Western blot results showed upregulated levels of Cyclin-D1 and phosphorylated ERK after treatment
with ceramides compare to the control group. Results are expressed as mean±standard deviation. C8-Cer: C8-ceramide, Stearyl Cer:
stearyl ceramide, Oleyl Cer: oleyl ceramide. *p<0.05 compared with the control, **p<0.01 compared with the control, ***p<0.001
compared with the control.
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 169
Fig. 3. (A) Ceramides upregulate growth factor protein levels. Human growth factor antibody array was used to detect growth factor
expression in human dermal papilla cells (hDPCs). (B) Ceramide treatment significantly increased the expression of growth factors
in hDPCs. Results are expressed as mean±standard deviation. C8-Cer: C8-ceramide, Stearyl Cer: stearyl ceramide, Oleyl Cer: oleyl
ceramide, AR: amphiregulin, IGF-1: insulin-like growth factor 1, EGF: epidermal growth factor, EGFR: receptor.. *p＜0.05 compared
with the control, **p＜0.01 compared with the control.
LY294002, an Akt inhibitor. They induced a decrease in
phosphorylation of Akt (Fig. 4A). Our results showed that
protein expression level of phosphorylated-GSK3β was
increased by treatment with ceramides including C8-cera-
mide, oleyl, and stearyl ceramides (Fig. 4B).
Western blot results showed that β-catenin expression
was increased in groups treated with ceramides compared
to that in the control group (Fig. 4B). Additionally, our im-
munofluorescent staining results confirmed the expression
of β-catenin in the nucleus. Interestingly, the expression
of β-catenin in the nucleus was very weak in the control
group untreated with ceramides whereas the expression of
β-catenin in the nucleus was significantly increased in
groups treated with synthetic ceramides. In particular, its
expression in the nuclei and cytoplasm in groups treated
with synthetic ceramides (oleyl and stearyl ceramides) was
significantly increased compared to that in the control
group (Fig. 4C). These results suggest that our synthetic ce-
ramides could induce β-catenin expression.
Wnt/β-catenin and BMP signaling in hDPCs
Wnt signaling is known as the master regulator of hair
JH Oh, et al
170 Ann Dermatol
Fig. 4. Effects of ceramide treatment on B-catenin pathway. Phosphorylation of Akt/GSK3β and β-catenin expression was determined
by western blot. Graph was schematized data of western blot band. (A, B) Phosphorylation of Akt/GSK3β and β-catenin expression
was increased by ceramide treatment compare to those in the control. (C) β-catenin expression in the nucleus of human dermal
papilla cells was determined by immunofluorescence staining. Oleyl and stearyl ceramides significantly increased β-catenin expression
in nuclei compare to C8-ceramide treatment or control. DAPI (blue) was used to counterstain nuclei (×100). Results are expressed
as mean±standard deviation. C8-Cer: C8-ceramide, Stearyl Cer: stearyl ceramide, Oleyl Cer: oleyl ceramide. *p<0.05 compared with
the control.
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 171
Fig. 5. Ceramides upregulate expression of Wnt
/
β
-catenin
targets but downregulate expression of BMP target. Expression
levels of target genes were determined using real-tim
e
polymerase chain reaction. (A) Wnt target genes: Wnt3,
Wnt5a, Wnt7a, Wnt10b; (B) β-catenin target genes: β
-
catenin, AP-1, Lef-1, Axin2; and (C) BMP target genes: BMP2,
BMP4. Results are expressed as mean±standard deviation.
C8-Cer: C8-ceramide, Stearyl Cer: stearyl ceramide, Oleyl Cer:
oleyl ceramide. *p＜0.05 compared with the control, **p＜0.01,
***p＜0.001 compared with the control, #p＜0.05 compare
d
with the group treated with C8-ceramide.
growth and hair cycle while β-catenin is a key tran-
scription factor activated by Wnt signaling12. BMP signal-
ing is known to regulate stem cell activation during hair
regeneration13. To determine whether our synthetic ce-
ramides might affect Wnt/β-catenin and BMP signaling,
we conducted real-time PCR analysis. As shown in Fig. 5,
treatment with stearyl ceramide increased Wnt signaling
such as mRNA expression level of wnt3a (2.1-fold), wnt5a
(1.8-fold), and wnt10b (6.1-fold) (Fig. 5A). Treatment with
stearyl ceramide also significantly increased β-catenin
signaling, including mRNA expression level of β-catenin
(5.5-fold), AP-1 (3.2-fold), Lef-1 (3.8-fold), and Axin2 (2.2-
fold) compared to the control group (Fig. 5B). Moreover,
treatment with oleyl ceramide increased mRNA expres-
sion level of wnt3a, wnt5a, and wnt7a (Fig. 5A), as well as
β-catenin, AP-1, Lef-1, and Axin compared to the control
group (Fig. 5B).
The mRNA expression of BMP2 and BMP4, which are
known as BMP target gene, were downregulated by oleyl
ceramide treatment. Stearyl ceramide treatment also in-
duced a decrease in BMP4 expression (Fig. 5C). Our data
support that our synthetic ceramides could regulate Wnt/
β-catenin pathway by inhibiting BMP target genes.
DISCUSSION
Ceramide is central component of cellular membrane. It is
a key player in many signaling pathways involved in cell
cycle arrest and differentiation14. Previous studies about
effects of ceramide on hair have focused on developing
cosmetics to protect hair shaft15. However, recent studies
have suggested that ceramide promotes hair lengthening,
leading to increased anagen follicles in mice and human
organ culture system7. These results indicate that ceramide
might not only play a role as hair shaft protector, but also
act as hair growth stimulator. Consistent with previous
studies, our results showed that the two newly synthesized
ceramides could stimulate hair growth at cellular levels.
In the present study, we demonstrated that synthetic ce-
ramides could increase proliferation of hDPCs accom-
panied by increased Bcl-2/BAX and phosphorylated-ERK/
Cyclin-D1 expression levels. We also observed that expres-
sion levels of β-catenin stimulated genes such as phos-
phorylated-Akt/GSK3β and AR/EGF/EGFR/IGF-1 were in-
creased after treatment with ceramides. In addition, oleyl
and stearyl ceramides could upregulate the expression of
Wnt/β-catenin signaling and downregulate BMP2 and
JH Oh, et al
172 Ann Dermatol
BMP4 (BMP2/4) expression. Taken together, our results sug-
gest that synthetic ceramides have hair growth stimulating
potentials.
Studies about hair growth have shown that the prolifera-
tion of hDPCs is accompanied by increased duration of
anagen phase16. Hair follicle size is determined by the vol-
ume of hDPCs while hDPCs volume depends on the num-
ber of cells17. Hence, we evaluated the effect of synthetic
ceramides on hDPCs proliferation. hDPCs were treated
with various concentrations of ceramides. Our results con-
firmed that synthetic ceramides at 1,000 μM could in-
crease viability of hDPCs. These results indicate that these
synthetic ceramides might contribute to the proliferation
of hDPCs.
Apoptosis is mainly processed through the intrinsic death
pathway18. The most important regulators of apoptosis pro-
cess are members of the Bcl-2 gene family. Bcl-2 protein is
known to possess anti-apoptotic ability to obstruct a varie-
ty of apoptotic signals. BAX protein is another member of
the Bcl-2 family. It plays a pro-apoptotic role by stimulat-
ing apoptosis function, unlike Bcl-2 protein19. It has been
reported that cellular Bcl-2/BAX ratio represents regulation
of cell survival20. Also, Bcl-2/BAX ratio was considered im-
portant in the hair cycle. It is known that the expression of
Bcl-2 is dependent on the cycling of hair follicle, and apo-
ptosis is the central program of the hair cycle21. Our re-
sults revealed that BAX expression did not change while
Bcl-2 expression was significantly increased in groups
treated with synthetic ceramides. Bcl-2/BAX ratio was in-
creased in oleyl or stearyl ceramide treated group com-
pared to that in the control group.
Ceramide activation may either activate or inhibit the
MAPK pathway depending on the cell type22. MAPK sig-
nal is known to regulate various cellular responses such as
cellular proliferation, cell differentiation, development, and
apoptosis23. ERK is known as one of MAPK signaling path-
ways involved in cell survival and growth10. Also, ERK path-
way was known stimulate hDPCs proliferation24. Cyclin-
D1 is also a key protein that promotes cell cycle (G1-S
phase) progression. An increase in cyclin-D1 expression is
required for cell proliferation to occur25.
In this study, we examined the effect of synthetic ceram-
ides on phosphorylation of ERK and Cycin-D1 expression.
Results showed that treatment with oleyl and stearyl ce-
ramides increased phosphorylation of ERK and induced
expression of Cyclin-D1 protein. Previous studies have
shown that high concentration of ceramide in cells in-
duces apoptosis6. However, our results showed Bcl-2/BAX
ratio and ERK/Cyclin-D1 levels were increased by treat-
ment with our synthetic ceramides. Although the under-
lying apoptotic effect of ceramide on hDPCs is not fully
understood yet, our results show that synthetic ceramides
may stimulate proliferation of hDPCs by regulating Bcl-2/
BAX ratio and ERK/Cyclin-D1 pathway.
Hair growth involves various transcription factors. EGF
family members are known to stimulate nuclear trans-
location of β-catenin and upregulate the expression of
Wnt10b and β-catenin levels. Especially, IGF-1 is known
as an important effect on hair growth and extended the an-
agen phase generally26. The Wnt/β-catenin signaling path-
way is known as a master regulator for hair growth and
hair follicle morphogenesis12. We investigated Akt/β-cate-
nin signaling pathway to elucidate the molecular mecha-
nism involved in the effect of ceramides relate to β-cat-
enin activation. To activate β-catenin translocation into
nucleus, activation of Akt is needed. Akt is involved in sig-
nal transduction pathways such as inflammatory mediator,
glycogen metabolism, and proliferation apoptosis27. Acti-
vation of Akt results in phosphorylation of several sub-
strates such as GSK-3β. GSK-3β is an active enzyme
negatively regulated by Wnt pathway and Akt-induced
phosphorylation. In the Wnt pathway, GSK-3β phosphor-
ylation and inactivation will lead to the accumulation and
nuclear translocation of β-catenin28. Activated β-catenin
induces Wnt signaling activation. Therefore, β-catenin is
an essential molecule in Wnt signaling. As shown in Fig.
4, ceramides-treatment increased phosphorylated GSK3β
via activation of Akt. Finally, β-catenin expression in the
nucleus was increased by ceramide-treatment. Our find-
ings are consistent with results of Kwack et al.16 reporting
that minoxidil can increase phosphorylation levels of Akt/
GSK3β and β-catenin expression.
The balance between Wnt/β-catenin pathway and BMP
pathway is important for hair growth cycling29. Axin2 and
Lef-1 are directed target genes of the β-catenin pathway.
Axin2 plays a role in regulating β-catenin level. Cytoplasmic
protein is activated when Axin2 binds to β-catenin. Lef-1
is known as the binding site for β-catenin to accelerate
directional differentiation of hair follicle stem cells30. Wnt3a
and Wnt7a are inductive signals to maintain hDPCs in an
anagen state31. Wnt5a is a key target gene of Shh in hair
follicle morphogenesis32. Wnt10b, also known as hair fol-
licle’s growth stimulator, promotes hair follicle regrowth
by upregulating Wnt/β-catenin signaling pathway related
factors including Axin2 and Lef-133. Previous studies have
also reported that Wnt10b/β-catenin signaling causes re-
generation of hair follicles and proliferation of hair matrix
cells33,34. As shown in Fig. 5, treatment with synthetic ce-
ramides upregulated expression of β-catenin target genes
such as Lef-1, AP-1, and Axin2. Especially, Wnt10b and β-
catenin expression levels were significantly increased by
treatment with stearyl ceramide. These findings indicate
Ceramide Induces Dermal Papilla Cells Proliferation
Vol. 31, No. 2, 2019 173
that treatment with synthetic ceramides has potential to af-
fect hair growth.
BMP signaling can promote telogen. It has been reported
that inhibition of BMP signaling induces Wnt signaling
and initiates hair growth early13. BMP2/4 activation can
elaborately regulate the development of hair follicle bulge
stem cell activation and growth during hair cycle35. As
shown in Fig. 5, treatment with oleyl ceramide downregu-
lated expression levels of BMP target genes (BMP2/4).
These results suggest that downregulating BMP2/4 expres-
sion could help hair growth via early activation of Wnt
signaling.
In conclusion, our study demonstrated that synthetic ce-
ramides had positive effects on hair cell proliferation by
regulating Bcl-2/BAX and ERK/Cyclin-D1 in hDPCs. More-
over, synthetic ceramides have potential to stimulate hair
growth via Wnt/β-catenin and BMP2/4 signaling in hDPCs.
Our results provide novel information that synthetic ce-
ramides such as oleyl and stearyl ceramides might have
potential to help hair growth via cell proliferation by regu-
lating gene expression in hDPCs. Although these findings
are just laboratory results, our results explained the possi-
bility of stimulating hair growth by treatment with cera-
mide. Furthermore, our synthetic ceramides might be used
as new therapeutic agents to promote hair growth.
ACKNOWLEDGMENT
This research was supported by the Ministry of Trade,
Industry & Energy (MOTIE), Korea Institute for Advance-
ment of Technology (KIAT) through the Encouragement
Program for The Industries of Economic Cooperation Re-
gion (R0005754).
CONFLICTS OF INTEREST
The authors have nothing to disclose.
ORCID
Jee Hye Oh, https://orcid.org/0000-0002-7971-9936
Kwan Ho Jeong, https://orcid.org/0000-0002-3631-0866
Jung Eun Kim, https://orcid.org/0000-0003-1670-0995
Hoon Kang, https://orcid.org/0000-0002-9822-4760
REFERENCES
1. Trüeb RM. Oxidative stress in ageing of hair. Int J Trich-
ology 2009;1:6-14.
2. Andl T, Reddy ST, Gaddapara T, Millar SE. WNT signals are
required for the initiation of hair follicle development. Dev
Cell 2002;2:643-653.
3. Takahashi T, Mamada A, Breakspear S, Itou T, Tanji N.
Age-dependent changes in damage processes of hair cuti-
cle. J Cosmet Dermatol 2015;14:2-8.
4. Lee WS, Oh TH, Chun SH, Jeon SY, Lee EY, Lee S, et al.
Integral lipid in human hair follicle. J Investig Dermatol
Symp Proc 2005;10:234-237.
5. Sasaki T, Hazeki K, Hazeki O, Ui M, Katada T. Permissive
effect of ceramide on growth factor-induced cell prolife-
ration. Biochem J 1995;311:829-834.
6. Venable ME, Lee JY, Smyth MJ, Bielawska A, Obeid LM.
Role of ceramide in cellular senescence. J Biol Chem 1995;
270:30701-30708.
7. Park BM, Bak SS, Shin KO, Kim M, Kim D, Jung SH, et al.
Promotion of hair growth by newly synthesized ceramide
mimetic compound. Biochem Biophys Res Commun 2017;
491:173-177.
8. Peters F, Vorhagen S, Brodesser S, Jakobshagen K, Brüning
JC, Niessen CM, et al. Ceramide synthase 4 regulates stem
cell homeostasis and hair follicle cycling. J Invest Dermatol
2015;135:1501-1509.
9. Jeong KH, Joo HJ, Kim JE, Park YM, Kang H. Effect of
mycophenolic acid on proliferation of dermal papilla cells
and induction of anagen hair follicles. Clin Exp Dermatol
2015;40:894-902.
10. Li W, Man XY, Li CM, Chen JQ, Zhou J, Cai SQ, et al.
VEGF induces proliferation of human hair follicle dermal
papilla cells through VEGFR-2-mediated activation of ERK.
Exp Cell Res 2012;318:1633-1640.
11. Han JH, Kwon OS, Chung JH, Cho KH, Eun HC, Kim KH.
Effect of minoxidil on proliferation and apoptosis in dermal
papilla cells of human hair follicle. J Dermatol Sci 2004;34:
91-98.
12. Rishikaysh P, Dev K, Diaz D, Qureshi WM, Filip S, Mokry
J. Signaling involved in hair follicle morphogenesis and
development. Int J Mol Sci 2014;15:1647-1670.
13. Zhang J, He XC, Tong WG, Johnson T, Wiedemann LM,
Mishina Y, et al. Bone morphogenetic protein signaling
inhibits hair follicle anagen induction by restricting epi-
thelial stem/progenitor cell activation and expansion. Stem
Cells 2006;24:2826-2839.
14. Uchida Y. Ceramide signaling in mammalian epidermis.
Biochim Biophys Acta 2014;1841:453-462.
15. Méndez S, Manich AM, Martí M, Parra JL, Coderch L. Da-
maged hair retrieval with ceramide-rich liposomes. J Cos-
met Sci 2011;62:565-577.
16. Kwack MH, Kang BM, Kim MK, Kim JC, Sung YK. Minoxidil
activates β-catenin pathway in human dermal papilla cells:
a possible explanation for its anagen prolongation effect. J
Dermatol Sci 2011;62:154-159.
17. Elliott K, Stephenson TJ, Messenger AG. Differences in hair
follicle dermal papilla volume are due to extracellular
matrix volume and cell number: implications for the control
of hair follicle size and androgen responses. J Invest Der-
matol 1999;113:873-877.
18. Elmore S. Apoptosis: a review of programmed cell death.
Toxicol Pathol 2007;35:495-516.
JH Oh, et al
174 Ann Dermatol
19. Lutter M, Perkins GA, Wang X. The pro-apoptotic Bcl-2
family member tBid localizes to mitochondrial contact sites.
BMC Cell Biol 2001;2:22.
20. Hanada M, Aimé-Sempé C, Sato T, Reed JC. Structure-
function analysis of Bcl-2 protein. Identification of con-
served domains important for homodimerization with Bcl-2
and heterodimerization with Bax. J Biol Chem 1995;270:
11962-11969.
21. Stenn KS, Lawrence L, Veis D, Korsmeyer S, Seiberg M.
Expression of the bcl-2 protooncogene in the cycling adult
mouse hair follicle. J Invest Dermatol 1994;103:107-111.
22. Mathias S, Peña LA, Kolesnick RN. Signal transduction of
stress via ceramide. Biochem J 1998;335:465-480.
23. Zhang W, Liu HT. MAPK signal pathways in the regulation
of cell proliferation in mammalian cells. Cell Res 2002;12:
9-18.
24. Joo HJ, Jeong KH, Kim JE, Kang H. Various wavelengths of
light-emitting diode light regulate the proliferation of human
dermal papilla cells and hair follicles via Wnt/β-catenin and
the extracellular signal-regulated kinase pathways. Ann
Dermatol 2017;29:747-754.
25. Yang K, Hitomi M, Stacey DW. Variations in cyclin D1
levels through the cell cycle determine the proliferative fate
of a cell. Cell Div 2006;1:32.
26. Ahn SY, Pi LQ, Hwang ST, Lee WS. Effect of IGF-I on hair
growth is related to the anti-apoptotic effect of IGF-I and
up-regulation of PDGF-A and PDGF-B. Ann Dermatol 2012;
24:26-31.
27. Liu P, Cheng H, Roberts TM, Zhao JJ. Targeting the phos-
phoinositide 3-kinase pathway in cancer. Nat Rev Drug
Discov 2009;8:627-644.
28. Monick MM, Carter AB, Robeff PK, Flaherty DM, Peterson
MW, Hunninghake GW. Lipopolysaccharide activates Akt
in human alveolar macrophages resulting in nuclear ac-
cumulation and transcriptional activity of beta-catenin. J
Immunol 2001;166:4713-4720.
29. Kandyba E, Leung Y, Chen YB, Widelitz R, Chuong CM,
Kobielak K. Competitive balance of intrabulge BMP/Wnt
signaling reveals a robust gene network ruling stem cell
homeostasis and cyclic activation. Proc Natl Acad Sci U S A
2013;110:1351-1356.
30. DasGupta R, Kaykas A, Moon RT, Perrimon N. Functional
genomic analysis of the Wnt-wingless signaling pathway.
Science 2005;308:826-833.
31. Kishimoto J, Burgeson RE, Morgan BA. Wnt signaling main-
tains the hair-inducing activity of the dermal papilla. Genes
Dev 2000;14:1181-1185.
32. Reddy S, Andl T, Bagasra A, Lu MM, Epstein DJ, Morrisey
EE, et al. Characterization of Wnt gene expression in
developing and postnatal hair follicles and identification of
Wnt5a as a target of Sonic hedgehog in hair follicle mor-
phogenesis. Mech Dev 2001;107:69-82.
33. Ouji Y, Yoshikawa M, Shiroi A, Ishizaka S. Promotion of
hair follicle development and trichogenesis by Wnt-10b in
cultured embryonic skin and in reconstituted skin. Biochem
Biophys Res Commun 2006;345:581-587.
34. Li YH, Zhang K, Ye JX, Lian XH, Yang T. Wnt10b promotes
growth of hair follicles via a canonical Wnt signalling
pathway. Clin Exp Dermatol 2011;36:534-540.
35. Plikus MV, Mayer JA, de la Cruz D, Baker RE, Maini PK,
Maxson R, et al. Cyclic dermal BMP signalling regulates
stem cell activation during hair regeneration. Nature 2008;
451:340-344.
