Content uploaded by Abdul-Razak Mariatulqabtiah
Author content
All content in this area was uploaded by Abdul-Razak Mariatulqabtiah on Feb 20, 2019
Content may be subject to copyright.
AsPac J. Mol. Biol. Biotechnol. 2019
Vol. 27 (1) : 84-94
Inoculation of fowlpox viruses coexpressing avian influenza H5 and
chicken IL-15 cytokine gene stimulates diverse host immune responses
Abdul Razak Mariatulqabtiaha,b*, Nadzreeq Nor Majidb, Efstathios S. Giotisc, Abdul Rahman Omard,
Michael A. Skinnerc
aLaboratory of Vaccines and Immunotherapeutic, Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor, Malaysia.
bDepartment of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 UPM,
Serdang, Selangor, Malaysia.
cSection of Virology, Faculty of Medicine, Imperial College London, St. Mary’s Campus, Norfolk Place, London W2 1PG United Kingdom.
dDepartment of Veterinary Pathology and Microbiology, Faculty of Veterinary Medicine, Universiti Putra Malaysia, 43400 UPM, Serdang,
Selangor, Malaysia.
Received 27th Nove mber 2018 / Accepted 4th February 2019
Abstract.
Fowlpox virus (FWPV) has been used as a recombinant vaccine vector to express antigens
from several important avian pathogens. Attempts have been made to improve vaccine strains induced-
host immune responses by coexpressing cytokines. This study describes the construction of recombinant
FWPV (rFWPV) strain FP9 and immunological responses in specific-pathogen-free (SPF) chickens, co-
expressing avian influenza virus (AIV) H5 of A/Chicken/Malaysia/5858/2004, and chicken IL-15
cytokine genes. Expression of H5 (50 kD) was confirmed by western blotting. Anti-H5 antibodies, which
were measured by the haemagglutinin inhibition test, were at the highest levels at Week 3 post-inoculation
in both rFWPV/H5- and rFWPV/H5/IL-15-vaccinated chickens, but decreased to undetectable levels
from Week 5 onwards. CD3+/CD4+ or CD3+/CD8+T cell populations, assessed using flow cytometry,
were significantly increased in both WT FP9- and rFWPV/H5-vaccinated chickens and were also higher
than in rFWPV/H5/IL-15- vaccinated chickens, at Week 2. Gene expression analysis using real time
quantitative polymerase chain reaction (qPCR) demonstrated upregulation of IL-15 expression in all
vaccinated groups with rFWPV/H5/IL-15 having the highest fold change, at day 2 (117±51.53). Despite
showing upregulation, fold change values of the IL-18 expression were below 1.00 for all vaccinated
groups at day 2, 4 and 6. This study shows successful construction of rFWPV/H5 co-expressing IL-15,
with modified immunogenicity upon inoculation into SPF chickens.
Keywords: avian influenza virus, fowlpox virus, haemagglutinin, interleukin-15, interleukin-18
INTRODUCTION
Since the late 1980s, recombinant FWPVs
(rFWPV)s based on attenuated FWPV strains
have been developed to express antigens from
several important avian pathogens, including:
avian influenza virus (AIV; (Qian et al., 2012)),
Newcastle disease virus (NDV; (Sun et al., 2008)
and Marek’s disease virus (MDV; (Lee et al., 2003).
*Author for correspondence: Abdul Razak Mariatulqabtiah, Department of
Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular
Sciences, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor,
Malaysia. Email – mariatulqabtiah@upm.edu.my
rFWPVs expressing haemagglutinin (HA) H5
protein of AIV (rFWPV/H5), particularly derived
from A/Turkey/Ireland/83 (H5N9), or
A/Goose/Guangdong/96 (H5N1), have been
used in South East Asia as vaccines against highly
pathogenic avian influenza (HPAI) H5N1.
Despite this preventive measure, HPAI H5N1 is
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
85
still a major concern due to its ongoing, sporadic
re-emergence. The need to boost existing
eradication efforts to limit the spread and
occurrence of the outbreak has prompted
development of several strategies to improve
readily available avian influenza vaccines. We
describe here one such strategy: to co-express
host cytokines from rFWPV/H5.
In mice, recombinant vaccinia virus (rVACV)
co-expressing gp160 of human immunodeficiency
virus (HIV) and human interleukin 15 (hIL-15)
has been shown to provide a stronger and more
enduring response than rVACV expressing gp160
alone (Oh et al., 2003). Integration of hIL-15 into
rVACV Wyeth strain or Modified VACV Ankara
(MVA) resulted in better survival (Perera et al.,
2007) and enhanced in vivo viral clearance
(Zielinski et al., 2010) in vaccinated athymic nude
mice upon intranasal challenge with virulent
VACV strain Western Reserve, or intravenous
challenge with monkeypox virus strain Zaire 79,
respectively. Enhanced CD4 and CD8 T cell
memory responses, along with reduction in lung
mycobacterial load in lungs, was also observed in
mice infected with Bacille Calmette-Guérin
(BCG), supplemented with IL-7 and IL-15
recombinant proteins, but not IL-1, IL-6 or
interferon (IFN)-α (Singh et al., 2010). In mice
model, it has also been shown that IL-15 offers
potent antiviral effects against rVACV
coexpressing IL-15, with high dependency on the
presence of NK cells and IFNs (Foong et al.,
2009).
Almost all of the chicken cytokines that have
been investigated are Th1-like. In a rare avian
study, in ovo plasmid DNA vaccination against an
intestinal coccidial parasite, Eimeria acervulina,
using coccidial gene 3-1E coexpressed with
chicken IL-15, was shown to induce higher serum
antibody levels than immunization with 3-1E
alone. Following challenge with the homologous
parasite, chickens vaccinated with 3-1E plus IL-
15 showed a significant decreased in oocyst
shedding and had an increased body weight,
compared to chickens vaccinated with 3-1E alone
(Lillehoj et al., 2005). Similar results were obtained
whether the construct was given subcutaneously
(Min et al., 2001) or intramuscularly (Ma et al.,
2013).
Studies with rFWPV coexpressing HA from
AIV H5N1 and chicken IL-18 (Chen et al., 2011;
Mingxiao et al., 2006) or IL-6 (Qian et al., 2012)
have been described. The results showed that all
chickens vaccinated with rFWPV/H5/IL-18
exhibited reduced virus shedding and replication
(Chen et al., 2011), and had higher levels of cellular
immunity (Mingxiao et al., 2006), compared to
rFWPV/H5 alone. Study of the effect of chIL-15
coexpression by rFWPV/H5 in chickens, as
reported here, is novel.
MATERIALS AND METHODS
Ethical approval.
All animal experiments
performed in this study were in accordance with
the ethical standards of the local Institutional
Animal Care and Use Committee (IACUC) of
Universiti Putra Malaysia (UPM) with reference
number UPM/FPV/PS/3.2.1.551/AUP-R72.
Viruses and cells.
The initial stock of parental
FP9 was from M.A. Skinner laboratory (Imperial
College London, UK). The development of FP9
via 438 serial passages of the wild-type fowlpox
virus HP-1, followed by plaque purification, has
been described (Laidlaw and Skinner, 2004).
Chicken embryonic fibroblast (CEFs) used in this
study were cultured in 2% newborn bovine serum
(NBBS) in DMEM media (both from Gibco).
Construction of recombinant plasmids.
Previously cloned and sequenced cDNA
encoding full-length H5 of influenza strain
A/Ch/Malaysia/5744/2004 (Balasubramaniam et
al., 2011) was amplified by PCR with primers H5-
F: 5’-ATCGGATATCATGGAGAAAATAGTG
C-3’ and H5-R: 5’-GACTGATATCTTAAA
TGCAAATTCTGC-3’, introducing EcoRV sites
as underlined. Sequence encoding the pentabasic
peptide motif at the protease cleavage site of H5
was replaced with threonine (T) using mutagenic
primers S(2-F): 5’-CAAAGAGAGACAAGAGG
ATTATTTGGAGCTATAG-3’ and S(1-R): 5’-
CAAATAATCCTCTTGTCTCTCTTTGAGG
GCTATTTC-3’.
The assembled amplicon was inserted into the
SmaI site of lac Z-selectable, FWPV
expression/recombination vector pEFL29
(Qingzhong et al., 1994), downstream of a copy of
the vaccinia virus p7.5 early/late promoter. The
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
86
chicken IL-15 gene (supplied by the late Prof. Dr.
Pete Kaiser from the then Institute for Animal
Health, Compton, UK) was inserted downstream
of a synthetic/hybrid promoter in vector
pEFgpt12S, before being subcloned into vector
pPC1.X (Abd Razak, 2011). Positive
transformants were grown in LB broth (15 mL)
supplemented with appropriate antibiotic(s) (750
µg) at 37°C overnight. The culture (0.5 µL) was
used to provide templates for analytical PCR. The
reaction mixture for a small scale PCR verification
contained 10X PCR buffer (2 µL; Sigma),
JumpStart Taq DNA polymerase (0.5 U; Sigma),
dNTPs (0.5 µL of 10 mM) and oligonucleotide
primers (0.5 µL of each 10 µM stock), in a total
volume of 20 µL. PCR was conducted in 2 steps;
4 cycles of 95°C for 3 min, 95°C for 30 s, 50°C
for 30 s, and 72°C for 1.5 min followed by 26
cycles of 95°C for 30 s, 59°C for 30 s, and 7°C for
1.5 min. Final extension was operated at 72°C for
10 minutes. Verification of H5 integration into
FWPV was carried out using H5-F and H5-R
primers, while primers pPC1.X-F: 5’-
ATGAAAAATAGTACCACTATGG-3’ and IL-
15R: 5’-ACAGAGTTTTGTAAAGGTTATACA
GAGG-3’ were used to screen for rFWPV/H5
carrying IL-15 gene.
Recombination/transfection, selection and
purification of recombinant viruses.
The
detailed protocol for recombination/transfection
has been described (Laidlaw and Skinner, 2014),
with minor modifications i.e. replacing 199 media
with DMEM (Gibco), and polyfect with lipofectin
(Thermo Fisher Scientific), of the same volume.
Successful recovery of rFWPV/H5 carrying a
LacZ gene from pEFL29 into FP9 was
demonstrated by blue plaques upon X-Gal
overlay (at final concentration of 0.4 mg/mL) on
day 4 post-transfection. Further screening for
rFWPV/H5 carrying chIL-15 was done by
mycophenolic acid (MPA) selection of gpt gene
and spontaneous resolving of the gpt gene by a
second crossover event, as described previously
(Laidlaw et al., 1998). The recombinant protein
lysates were prepared by infecting CEFs, with
rFWPV/H5 at a multiplicity of infection (MOI)
of 3, for 48 hours. The cell pellet was subjected to
15% SDS-PAGE. The electro-transferred
nitrocellulose membrane (GE Healthcare) was
incubated with a goat polyclonal primary antibody
against haemagglutinin H5 (Cat. No. ab62587,
Abcam, USA) with the final concentration 1
µg/µL, for 1 hour. The membrane was developed
using a commercial kit using the chromogenic
substance, WesternBreeze (Invitrogen).
Immunofluorescence antibody test (IFAT)
was performed using 80% confluent CEFs. Cells
were either infected with viruses at 0.3 MOI, or
left uninfected (negative control). The infection
was left overnight in 2% NBBS DMEM medium,
before incubation with a rabbit polyclonal primary
antibody against haemagglutinin H5 (Cat. No.
ab70077, Abcam, USA) with the final
concentration 1 µg/µL, for 2 hours. After three
washes with PBS, cells were incubated with
fluorescein-labelled secondary antibodies for 1
hour. Slides were viewed under a fluorescent
microscope (model Leica DMRA II).
Immunization of animals.
One-day old specific
pathogen-free (SPF) chickens were inoculated
subcutaneously with 105 plaque forming unit
(PFU) of parental FWPV FP9 (WT FP9),
rFWPV/H5 or rFWPV/H5/IL-15, diluted in
PBS to a total volume of 100 μL, at the scruff of
the neck, using a 27-G needle. One control group
was mock-treated with 100 μL of PBS. Nine
chickens were assigned for each group. Blood
sampling (for serum) of each chicken was done on
a weekly basis. At Weeks 2 and 5, whole blood
(0.2 mL) of each chicken in each group of nine
was sampled and pooled into 3 groups (0.6 mL in
total), for CD4+ and CD8+ lymphocyte isolation,
followed by flow cytometry analysis. As for IL-15
and IL-18 gene expression analysis, immunization
of 105 PFU of aforementioned vaccine groups
was done on 14-days old SPF chickens; twelve
chickens for each group. At every two consecutive
days’ post immunization, RNA was extracted
from the spleens (four from each group) and
processed for qPCR.
Serological tests.
Haemagglutination inhibition
(HI) tests were performed in U-bottomed 96-well
microtitre plates using 4 HA units/25 μL of
H5N2 virus strain A/Malaysia/Duck/8443/04
(Veterinary Research Institute Ipoh, Malaysia),
and washed chicken erythrocytes (25 μL of 0.8%
v/v). The antigen-antibody was incubated for 1
hour. HI titres were determined as the reciprocal
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
87
of the highest serum dilution that completely
inhibited haemagglutination.
Immunophenotyping analysis.
Fresh, non-
coagulated chicken whole blood was diluted to 1
mL using cold PBS and was carefully layered on 2
mL Ficoll-Paque PLUS (GE Healthcare).
Isolation of peripheral blood mononuclear cells
(PBMC) was done by following the standard
Ficoll-Paque PLUS protocol. Approximately 106
cells were incubated with mouse anti-chicken
CD8a-PerCP-Cy5-conjugated (1 µg/mL), CD3-
PE-conjugated (0.5 µg/mL) and CD4-FITC-
conjugated (0.5 µg/mL) monoclonal antibodies
(all from Southern Biotech), prior to analysis
using a BD FACSCalibur flow cytometer (Becton
Dickinson, San Jose, CA, USA).
Quantitative real time polymerase chain
reaction (qPCR
). The total RNA from chicken
spleens was harvested using TRIzol reagent
(Ambion) according to manufacturer’s
recommendations. The extracted RNA was
reverse-transcribed using Script cDNA synthesis
kit (Jena Bioscience) in a total volume of 20 μL
containing 2.5 μM primers, 1X Script reverse
transcriptase (RT) buffer, 500 μM dNTP, 5 μM
DTT stock, 40 units RNAse inhibitor, 100 units
Script RT and 5 μg RNA template. The reaction
mix was incubated at 42oC for 10 minutes
followed by 50°C for 60 minutes. Primer
sequences for cytokines IL-15 and IL-18, and a
housekeeping gene, glyceraldehyde 3-phosphate
dehydrogenase (GAPDH), were designed from
public databases (Brisbin et al., 2010; Cai et al.,
2009), as shown in Table 1. The qPCR
amplification was performed according to the
KAPA SYBR FAST qPCR kit (KAPA Biosystem)
using Bio-Rad CFX96 real-time system. The data
was imported into the analysis module of the Bio-
Rad CFX Manager. The expression of GAPDH
gene were used as the qPCR normalization
standards. All results are reported as delta-delta
CT (ΔΔCT), relative to the control group.
Statistical analysis.
Data variations between
groups were analysed by one-way ANOVA or
paired-samples T test using SPSS (Version 15)
software. Results were expressed as the mean ±
standard error of the mean (SE). P values less than
0.05 were considered statistically significant in all
cases.
Table 1. Forward and reverse primer sequences used for qPCR.
Primer name
Primer sequence (5’ to 3’)
GenBank accession number
IL-15 - F
CGAGGCTTGTACCGCAATGT
AF139097
IL-15 - R
GCCATCCCCAGCATCTTGT
IL-18 - F
ACAAGGAATGTTCTTGGCCTTT
NM_204608
IL-18 - R
CTTCATCTTCTCTCGGCAGTTTC
GAPDH - F
CTACACACGGACACTTCAAG
NM_204305
GAPDH - R
ACAAACATGGGGGCATCAG
F, forward; R, reverse; IL, interleukin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
RESULTS
PCR amplification of H5 gene.
The HPAIV
haemagglutinin (HA) gene of the H5 virus
contains multiple basic amino acids, arginine and
lysine, that allow cleavage by ubiquitous proteases
(furin and PC6) (Horimoto et al., 1994). To
maintain compatibility with recombinant, killed
H5N1 influenza vaccines (J. Wood, personal
communication), and to reduce any potential
biosafety issues, the pentabasic peptide motif
(underlined) at the protease cleavage site of H5, S-
P-Q-R-E-R-R-R-K-K-R was removed and
replaced with threonine (T), leaving a monobasic
arginine (R) at the site (S-P-Q-R-E-T-R). The H5-
F and S(1-R) primers generated the first H5
fragment (1036 bp), while primers H5-R and S(2-
F) generated the second H5 fragment (684 bp).
Full length mutated H5 gene (1695 bp), was
obtained through PCR overlap extension
mutagenesis (Figure 1a).
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
88
Figure 1. (a) PCR amplification of H5 gene upon removal of polybasic sequence. Lane 1: Negative control;
Lane 2: Full length HA H5 gene (1707 bp); Lane 3: Fragment 1 (1036 bp) and Lane 4: Fragment 2 (684
bp) were generated using mutagenic primers S(2-F) and S(1-R); Lane 5: Re-assembled full length H5
sequence, lacking the polybasic region (1695 bp) was obtained using PCR overlap extension mutagenesis.
(b) Verification for the integration of the IL-15 gene into rFWPV/H5 by PCR after genomic DNA
extraction, with exclusive amplicon of 700 bp which corresponds to the positive control. Lanes 1-8:
Genomic DNA of recombinant clones rFWPV/H5 after second homologous recombination. Lane 9: IL-
15 plasmid positive control. M1: 1 kb ladder marker (New England Biolabs); M2: 100 bp ladder marker
(New England Biolabs). The DNA bands were observed in 1% (w/v) agarose gel.
Verification of H5-recombinant fowlpox
viruses coexpressing chicken IL-15.
Upon
successful transfection, the recombinant clones
were verified for presence of the inserted H5 gene
by PCR of extracted FWPV genomic DNA (data
not shown). Positive recombinants (rFWPV/H5)
were subjected to second homologous
recombination of vector pPC1.X carrying chicken
cytokine gene IL-15 at a second non-essential site,
the PC-1 (fpv030) homology region. The cytokine
expression cassettes in pPC1.X/IL-15 were
previously confirmed by restriction digests and
sequencing (data not shown). Screening of
positive recombinant viruses (rFWPV/H5/IL-
15) was done using primers external and internal
to the inserted genes (the latter resulting in PCR
products exclusively for recombinant clones)
(Figure 1b). H5 protein expression was analysed
by western blotting (Figure 2). A faint band at ~50
kD was observed for H5 recombinant, none for
uninfected cell lysate and negative control (WT
FP9). This is the first report on the size of H5
protein from strain A/Ch/Malaysia/5744/2004.
Further analysis using IFAT detected fluorescent
signals only for CEF infected with H5
recombinant, which indicates successful H5
protein expression. No reactivity was observed
for uninfected or WT FP9-infected CEF (Figure
3).
Figure 2. Western blot analysis of CEF cells
infected with rFWPV/H5. Transferred
nitrocellulose membrane was incubated with a
goat polyclonal primary antibody against
haemagglutinin H5 (Cat. No. ab62587, Abcam,
USA) with the final concentration 1 µg/µL, for 1
hour and separated on 12% SDS-PAGE. M:
BenchmarkTM Pre-stained Protein Ladder
(Thermo Fisher Scientific); Lane 1: Uninfected
CEF as negative control; Lane 2: CEF infected
with WT FP9; Lane 3: CEF infected with
rFWPV/H5.
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
89
Figure 3. IFAT analysis for verification of H5
protein expression from rFWPV/H5. CEFs were
(A) uninfected; (B) infected with WT FP9 as
negative control; (C) infected with rFWPV/H5.
Infected cells were incubated with a rabbit
polyclonal primary antibody against
haemagglutinin H5 (Cat. No. ab70077, Abcam,
USA) with the final concentration 1 µg/µL.
Observation was performed under visible light (ii)
or UV light (ii). The images did not represent 80%
of cell confluency due to repeated washing of the
cells without fixation during procedure.
Haemagglutinin inhibition tests for chickens
following rFWPV immunizations.
None of the
nine control chickens inoculated with PBS or WT
FP9 showed any evidence of HI antibody
responses. Mean HI titres, in log2, of all groups
were calculated for general comparison (Table 2).
H5 antibodies reached detectable levels in
chickens vaccinated with rFWPV/H5/IL-15 one
week earlier than those vaccinated with
rFWPV/H5 but, thereafter, there was no
significant difference between the two groups.
Responses were highest at Week 3 in both groups
of recombinant vaccine-treated chickens.
However, the antibodies were undetectable based
on HI tests that have been carried out from Week
5 onwards.
CD3+/CD4+ and CD3+/CD8+ T cells
population following rFWPV immunizations.
The levels of CD3+/CD4+ T cells in the control
group remained relatively constant at Weeks 2 and
5. Samples from groups vaccinated with WT FP9
or rFWPV/H5/IL-15 demonstrated increases in
CD3+/CD4+ T cell population levels over time,
of 2.06 and 3.16 point percentages, respectively.
The rFWPV/H5 vaccinated group showed a
significantly higher CD3+/CD4+ T cell
population relative to control at Week 2 (P≤0.05)
but had returned to control levels by Week 5. No
statistically significant difference in CD3+/CD4+
T cell levels was observed for other groups at
either sampling point (Figure 4).
Animal experiments also revealed a relatively
constant CD3+/CD8+ T cell population for
control chickens. The same was true for the slight
to somewhat higher levels observed in
rFWPV/H5/IL-15-, WT FP9- and rFWPV-
vaccinated birds (significant for WT- and
rFWPV/H5- but not rFWPV/H5/IL-15-
vaccinated birds), although a fall to control levels
was observed in rFWPV/H5-vaccinated birds at
Week 5.
Table 2. Mean of HI titre, log2, of sera from immunized chickens.
Vaccine group
HI titre
Weeks, post immunization
1
2
3
4
5
6
7
Control
ND
ND
ND
ND
ND
ND
ND
WT FP9
ND
ND
ND
ND
ND
ND
ND
rFWPV/H5
ND
ND
8.11±4.60
3.56±1.94
ND
ND
ND
rFWPV/H5/IL-15
ND
0.56±0.44
9.89±2.16
3.11±1.74
ND
ND
ND
ND indicates undetected titre. Each value represents the means±SE of nine birds.
No significant difference was observed between rFWPV/H5 and rFWPV/H5/IL-15 at any time point (P≥0.05).
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
90
Figure 4. Immunophenotyping of CD3+/CD4
(a) and CD3+/CD8+ (b) lymphocytes from
chickens after mock-treatment with PBS
(control), or vaccination with WT FP9,
rFWPV/H5 or rFWPV/H5/IL-15. Each value
represents the mean percentages of T
lymphocytes sub-population ± SE, from PBMC
samples of nine chickens pooled in threes (n=3),
sampled at Weeks 2 and 5. Significant differences
between vaccinated and control groups (*), were
determined by one-way ANOVA (P≤0.05).
Significant differences within the same group at
different points were determined by paired-
samples T-test (P≤0.05).
Gene expression analysis of IL-15 and IL-18
.
IL-15 expression in all vaccinated groups showed
upregulation on day 2, notably in those vaccinated
with rFWPV/H5/IL-15, which overexpress
chicken IL-15 (Figure 5). WT FP9- and
rFWPV/H5-vaccinated birds expressed 7- to 19-
fold more IL-15 than control birds; over-
expression by rFWPV/H5/IL-15 boosted IL-15
levels to 120 fold more than control. Expression
of IL-15 dropped to control levels by day 4, for all
tested groups.
IL-18 expression was lower in all of the
FWPV-infected groups (two to five fold lower for
WT FP9- and rFWPV/H5-vaccinated groups,
possibly up to ten fold lower for rFWPV/H5/IL-
15) and this decreased expression was extended
out to 6 days.
Figure 5. Relative expression level, by qPCR, of
IL-15 (a) and IL-18 genes (b) in inoculated SPF
chickens compared to control SPF chickens. The
expression was expressed as fold change (2 log -
∆∆CT) to that of the unvaccinated controls after
normalization of expression to GAPDH. The
standard errors were calculated from the result of
three replicates. Significant differences between
vaccinated groups and WT FP9 (*) were
determined by paired-samples T-test (P≤0.05).
DISCUSSION
The most important component of host immune
response that confers protection in chickens
against AIV is the humoral response against HA
(Swayne, 2007). To achieve this, several different
types of vaccines have been developed, e.g.
inactivated AIV vaccines (Bublot et al., 2007; Tian
et al., 2010), DNA vaccines (Lim et al., 2012), and
virus-like particles (Hendin et al., 2017). In this
study, a safe, lab-adapted FWPV-based vector
expressing the H5 of AIV was modified to co-
express a chicken IL-15 cytokine gene to test if it
would enhance the host cell mediated immune
response, which may be critical in clearance of
AIV during infection (Foong et al., 2009).
However, we did not perform protective or
challenge studies for AIV, nor did we evaluate
protection against FWPV.
Vaccination with rFWPV/H5/IL-15
produced HA antibody titres comparable to
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
91
vaccination with rFWPV/H5. This finding
contrasts with several studies conducted in mice,
including that by Perera et al. (2007) which
reported induction of two-fold higher VACV-
neutralizing antibody titres in hIL-15-expressing
recombinant VACV. The group also showed that
recombinant VACV strain Wyeth, expressing five
heterologous influenza virus genes, induced
stronger neutralizing antibodies against AIV H5
when adjuvanted with hIL-15 (Poon et al., 2009).
The inconsistencies in HA antibody titres
between our study and those by Perera et al. (2007)
and Poon et al. (2009) might be due to the usage
of heterologous (instead of a homologous) H5N2
virus strain A/Malaysia/Duck/8443/04 antigens
against the H5 antibodies from our rFWPV
recombinants. Heterologous antigens used to
assay H5 antibodies induced by rFWPV were
shown to produce either low (Taylor et al., 1988),
highest (Bublot et al., 2010) or inconsistent
(Swayne et al., 2007) HI titres. Although these
studies did not use homologous antigens, which
might be more suitable for their HI testing, the
results provide useful comparisons of HI
antibody levels elicited by rFWPV/H5 and
rFWPV/H5/IL-15. Several studies have shown
rFWPV expressing H5 can provide complete or
nearly complete protection against lethal
challenge, even when achieving pre-challenge HI
titres of as low as 3 log2 (Bublot et al., 2010;
Webster et al., 1991). Post-vaccination protection
of chickens against AIV may not be dependent
entirely on HI antibodies but also on non-HI
antibodies and possibly also on cell-mediated
immunity.
rFWPV/H5/IL-15 did not increase CD4+ T
cell populations, compared to rFWPV/H5,
following vaccination. This finding is consistent
with previous reports that IL-15 only has
profound effects on the proliferation and survival
of memory CD8+ T cells, not on CD4+ T cells
(Marks-Konczalik et al., 2000; Zhang et al., 1998),
although a significant increment of CD4+ T cell
populations was observed in a DNA vaccine
coexpressing H5 and chicken IL-15 genes (Lim et
al., 2012). It is not known whether inherent
molecular patterns of, or immunomodulatory
proteins expressed by, FWPV FP9 can influence
IL-15 levels in vaccinated chickens. It has been
reported that IL-15 can only activate CD4+ T cell
proliferation when at high concentration presence
(Kanegane and Tosato, 1996). Niedbala et al.
(2002) showed that 2 to 4 fold higher
concentrations of IL-15 are required to achieve
optimal CD4+ T cell proliferation than to
promote CD8+ T cell response.
The co-stimulatory effects of IL-15 on CD8
cells have been studied widely, especially with
regard to proliferation and survival of memory
CD8+ T cells. IL-15 has been found to directly
stimulate purified CD8+ memory cells in vitro
(Zhang et al., 1998). Transgenic mice which
constitutively expressed a significant level of IL-
15 in the serum had higher numbers of memory
CD8+ T cells (Marks-Konczalik et al., 2000;
Yajima et al., 2002). In our study, chickens
vaccinated with WT FP9 or rFWPVs showed low
to moderate increase in levels of CD8+ T cells.
The increases, at 1.6 to 2 fold, were significant for
WT FP9 or rFWPV/H5 respectively but, at 1.25
fold increment, was insignificant from the
rFWPV/H5/IL-15. These results suggest that
FWPV enhances chicken CD8+ T cells
stimulation and possibly that IL-15 has the
opposite effect.
Although hIL-15 has been shown to stimulate
CD8+ T cells population and promote the
maintenance of CD8+ CD44hi memory T cells,
the responsiveness of CD8+ T cells to IL-15
might depend on the cytokine background
(Niedbala et al., 2002; Oh et al., 2003).
Unfortunately, in this study, we did not measure
the levels of IL-15, secreted by cells infected with
an initial dose of 105 PFU rFWPV/H5/IL-15, in
peripheral blood prior to flow analysis. Since a
strong synthetic/hybrid promoter was used for
IL-15 co-expression, levels of expression might
have been inconsistent with generation of the
desired immune responses.
We observed elevation of the CD4+ T cell
population and sustained CD8+ T cell population
from WT FP9 and rFWPV/H5/IL-15 inoculated
groups. However, rFWPV/H5 inoculated group
showed a consistent decreasing pattern for both
T cells. By way of comparison, an in vivo study
examining T cell populations in the peripheral
blood of rhesus macaques treated with rhesus IL-
15, where the level of CD4+ and CD8+ memory,
but not naïve, T cells peaked at Weeks 1 to 2 and
returned to baseline by Weeks 3 to 4 (Picker et al.,
2006).
Acting synergistically, IL-15 and IL-18 can
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
92
perpetuate Th1 responses (Gracie et al., 1999) and
enhance IL-12 stimulation of NK cell to produce
IFN gamma (French et al., 2006). A DNA vaccine
co-expressing H5 and chicken IL-15, induced a
significant increase in IL-15, but not IL-18, levels
post-vaccination (Lim et al., 2012). Our results are
comparable, where enhanced expression of host
IL-15 and reduced expression of host IL-18 are
mediated directly by infection with WT FP9 or
rFWPV/H5 co-expressing exogenous IL-15
(mediated by a strong synthetic poxvirus
promoter).
The dramatic drop of IL-15 levels from day 2
to day 4 in all FWPV-infected groups might be
due to clearance of these attenuated viruses by
NK cells, their cytolytic activity potentially
augmented by the ability of IL-15 (expressed
endogenously by the host or exogenously by the
recombinant FWPV) to enhance IFN expression
and increase poxvirus clearance (Foong et al.,
2009). However, we cannot currently explain the
concomitant drop in IL-18 mRNA expression
during FWPV infection but FWPV appears to
express one or more IL-18 binding proteins
(Laidlaw and Skinner, 2004), which might reduce
steady-state levels of circulating IL-18 in a similar
manner to the host-encoded regulator IL-18BP
(Harms et al., 2017). It is possible therefore that
the virus encodes additional mechanisms to
down-regulate expression of IL-18 mRNA.
CONCLUSION
rFWPV/H5 and rFWPV/H5/IL-15 inoculated
groups elicited the highest levels of anti-H5
antibodies at Week 3 post-inoculation.
CD3+/CD4+ or CD3+/CD8+ T cell
populations were significantly increased in both
WT FP9- and rFWPV/H5-, higher than in
rFWPV/H5/IL-15-vaccinated chickens, at Week
2 post-inoculation. IL-15 and IL-18 expressions
were upregulated in all vaccinated groups at day 2
post-inoculation. These diverse immunogenicity
findings may contribute to the limited exploration
of chicken IL-15 in vaccine developments.
ACKNOWLEDGEMENTS
This study was supported by the Ministry of
Energy, Science, Technology, Environment and
Climate Change (MESTECC) with project
number 02-01-04-SF1641, and the Ministry of
Education through Institute of Bioscience,
Higher Institution Centre of Excellence (IBS
HICoE) with project number 6369101, from the
Government of Malaysia. N.N.M. was funded by
MyBrain15 of Ministry of Education, Malaysia,
and Graduate Research Fellowship (GRF) of
Universiti Putra Malaysia. M.A.S. and E.S.G. are
supported by the Biotechnology and Biological
Sciences Research Council via Strategic LoLa
BB/K002465/1 (“Developing Rapid Responses
to Emerging Virus Infections of Poultry,
DRREVIP”).
REFERENCES
Abdul Razak, M. 2011. Construction and characterization of
H5N1-recombinant fowlpox viruses co-expressing host
cytokines. Thesis, PhD of Clinical Medicine Research,
Imperial College London, United Kingdom.
Balasubramaniam, V. R., Hassan, S. S., Omar, A. R., Mohamed,
M., Noor, S. M., Mohamed, R., & Othman, I. 2011. Cellular
transcripts regulated during infections with Highly
Pathogenic H5N1 Avian Influenza virus in 3 host systems.
Virology Journal 8: 196.
Brisbin, J. T., Gong, J., Parvizi, P., & Sharif, S. 2010. Effects of
lactobacilli on cytokine expression by chicken spleen and
cecal tonsil cells. Clinical and Vaccine Immunology 17: 1337-
1343.
Bublot, M., Le Gros, F. X., Nieddu, D., Pritchard, N., Mickle, T.
R., & Swayne, D. E. 2007. Efficacy of two H5N9-
inactivated vaccines against challenge with a recent H5N1
highly pathogenic avian influenza isolate from a chicken in
Thailand. Avian Diseases 51: 332-337.
Bublot, M., Manvell, R. J., Shell, W., & Brown, I. H. 2010. High
level of protection induced by two fowlpox vector vaccines
against a highly pathogenic avian influenza H5N1 challenge
in specific-pathogen-free chickens. Avian Diseases 54: 257-
261.
Cai, Y., Song, Z., Zhang, X., Wang, X., Jiao, H., & Lin, H. 2009.
Increased de novo lipogenesis in liver contributes to the
augmented fat deposition in dexamethasone exposed
broiler chickens (Gallus gallus domesticus). Comparative
Biochemistry and Physiology Part C: Toxicology and Pharmacology
150(2): 164-169.
Chen, H. Y., Zhang, H. Y., Li, X. S., Cui, B. A., Wang, S. J., Geng,
J. W., & Li, K. 2011. Interleukin-18-mediated enhancement
of the protective effect of an infectious laryngotracheitis
virus glycoprotein B plasmid DNA vaccine in chickens.
Journal of Medical Microbiology 60: 110-116.
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
93
Foong, Y. Y., Jans, D. A., Rolph, M. S., Gahan, M. E., &
Mahalingam, S. 2009. Interleukin-15 mediates potent
antiviral responses via an interferon-dependent mechanism.
Virology 393: 228-237.
French, A. R., Holroyd, E. B., Yang, L., Kim, S., & Yokoyama, W.
M. 2006. IL-18 acts synergistically with IL-15 in stimulating
natural killer cell proliferation. Cytokine 35: 229-234.
Gracie, J. A., Forsey, R. J., Chan, W. L., Gilmour, A., Leung, B. P.,
Greer, M. R., Kennedy, K., Carter, R., Wei, X. Q., Xu, D.,
Field, M., Foulis, A., Liew, F. Y., & McInnes, I. B. 1999. A
proinflammatory role for IL-18 in rheumatoid arthritis. The
Journal of Clinical Investigation 104: 1393-1401.
Harms, R. Z., Creer, A. J., Lorenzo-Arteaga, K. M., Ostlund, K.
R., & Sarvetnick, N. E. 2017. Interleukin (IL)-18 binding
protein deficiency disrupts natural killer cell maturation and
diminishes circulating IL-18. Frontiers in Immunology 8: 1020.
Hendin, H. E., Pillet, S., Lara, A. N., Wu, C. Y., Charland, N.,
Landry, N., & Ward, B. J. 2017. Plant-made virus-like
particle vaccines bearing the hemagglutinin of either
seasonal (H1) or avian (H5) influenza have distinct patterns
of interaction with human immune cells in vitro. Vaccine 35:
2592-2599.
Horimoto, T., Nakayama, K., Smeekens, S. P., & Kawaoka, Y.
1994. Proprotein-processing endoproteases PC6 and furin
both activate hemagglutinin of virulent avian influenza
viruses. Journal of Virology 68: 6074-6078.
Kanegane, H., & Tosato, G. 1996. Activation of naive and memory
T cells by interleukin-15. Blood 88: 230-235.
Laidlaw, S. M., Anwar, M. A., Thomas, W., Green, P., Shaw, K., &
Skinner, M. A. 1998. Fowlpox virus encodes nonessential
homologs of cellular alpha-SNAP, PC-1, and an orphan
human homolog of a secreted nematode protein. Journal of
Virology 72: 6742-6751.
Laidlaw, S. M., & Skinner, M. A., 2004. Comparison of the genome
sequence of FP9, an attenuated, tissue culture-adapted
European strain of Fowlpox virus, with those of virulent
American and European viruses. Journal of General Virology
85: 305-322.
Laidlaw, S. M., & Skinner, M. A. 2014. Construction of Deletion-
knockout Mutant Fowlpox Virus (FWPV). Bio-Protocol 4.
Lee, L. E., Witter, R. L., Reddy, S. M., Wu, P., Yanagida, N., &
Yoshida, S. 2003. Protection and synergism by recombinant
fowl pox vaccines expressing multiple genes from Marek's
disease virus. Avian Diseases 47: 549-558.
Lillehoj, H. S., Ding, X., Quiroz, M. A., Bevensee, E., & Lillehoj,
E. P. 2005. Resistance to intestinal coccidiosis following
DNA immunization with the cloned 3-1E Eimeria gene
plus IL-2, IL-15, and IFN-gamma. Avian Diseases 49: 112-
117.
Lim, K. L., Jazayeri, S. D., Yeap, S. K., Alitheen, N. B., Bejo, M.
H., Ideris, A., & Omar, A. R. 2012. Co-administration of
avian influenza virus H5 plasmid DNA with chicken IL-15
and IL-18 enhanced chickens immune responses. BMC
Veterinary Research 8: 132.
Ma, D., Gao, M., Li, J., Ma, C., & Li, G. 2013. Construction of
novel cytokine by fusion of chicken IL-2 signal peptide to
mature chicken IL-15 and comparison of the adjuvant
effects by DNA immunization against Eimeria challenge.
Veterinary of Immunology and Immunopathology 156: 114-120.
Marks-Konczalik, J., Dubois, S., Losi, J. M., Sabzevari, H.,
Yamada, N., Feigenbaum, L., Waldmann, T. A., & Tagaya,
Y. 2000. IL-2-induced activation-induced cell death is
inhibited in IL-15 transgenic mice. Proceeding of the National
Academic of Science of the United States of America 97: 11445-
11450.
Min, W., Lillehoj, H. S., Burnside, J., Weining, K. C., Staeheli, P.,
& Zhu, J. J. 2001. Adjuvant effects of IL-1beta, IL-2, IL-8,
IL-15, IFN-alpha, IFN-gamma TGF-beta4 and
lymphotactin on DNA vaccination against Eimeria
acervulina. Vaccine 20: 267-274.
Mingxiao, M., Ningyi, J., Zhenguo, W., Ruilin, W., Dongliang, F.,
Min, Z., Gefen, Y., Chang, L., Leili, J., Kuoshi, J., & Yingjiu,
Z. 2006. Construction and immunogenicity of recombinant
fowlpox vaccines coexpressing HA of AIV H5N1 and
chicken IL18. Vaccine 24: 4304-4311.
Niedbala, W., Wei, X., & Liew, F.Y. 2002. IL-15 induces type 1
and type 2 CD4+ and CD8+ T cells proliferation but is
unable to drive cytokine production in the absence of TCR
activation or IL-12/IL-4 stimulation in vitro. European Journal
of Immunology 32: 341-347.
Oh, S., Berzofsky, J. A., Burke, D. S., Waldmann, T. A., & Perera,
L. P. 2003. Coadministration of HIV vaccine vectors with
vaccinia viruses expressing IL-15 but not IL-2 induces long-
lasting cellular immunity. Proceeding of the National Academic of
Science of the United States of America 100: 3392-3397.
Perera, L. P., Waldmann, T. A., Mosca, J. D., Baldwin, N.,
Berzofsky, J. A., & Oh, S. K. 2007. Development of
smallpox vaccine candidates with integrated interleukin-15
that demonstrate superior immunogenicity, efficacy, and
safety in mice. Journal of Virology 81: 8774-8783.
Picker, L. J., Reed-Inderbitzin, E. F., Hagen, S. I., Edgar, J. B.,
Hansen, S. G., Legasse, A., Planer, S., Piatak, M., Lifson, J.
D., Maino, V. C., Axthelm, M. K., & Villinger, F. 2006. IL-
15 induces CD4 effector memory T cell production and
tissue emigration in nonhuman primates. Journal of Clinical
Investigation 116: 1514-1524.
Poon, L. L., Leung, Y. H., Nicholls, J. M., Perera, P. Y., Lichy, J.
H., Yamamoto, M., Waldmann, T. A., Peiris, J. S., & Perera,
L. P. 2009. Vaccinia virus-based multivalent H5N1 avian
influenza vaccines adjuvanted with IL-15 confer sterile
cross-clade protection in mice. Journal of Immunology 182:
3063-3071.
Qian, C., Chen, S., Ding, P., Chai, M., Xu, C., Gan, J., Peng, D., &
Liu, X. 2012. The immune response of a recombinant
fowlpox virus coexpressing the HA gene of the H5N1
highly pathogenic avian influenza virus and chicken
interleukin 6 gene in ducks. Vaccine 30: 6279-6286.
Qingzhong, Y., Barrett, T., Brown, T. D., Cook, J. K., Green, P.,
Skinner, M. A., & Cavanagh, D. 1994. Protection against
turkey rhinotracheitis pneumovirus (TRTV) induced by a
fowlpox virus recombinant expressing the TRTV fusion
glycoprotein (F). Vaccine 12: 569-573.
Singh, V., Gowthaman, U., Jain, S., Parihar, P., Banskar, S., Gupta,
P., Gupta, U. D., & Agrewala, J. N. 2010. Coadministration
of interleukins 7 and 15 with bacille Calmette-Guerin
mounts enduring T cell memory response against
Mycobacterium tuberculosis. Journal of Infectious Diseases 202:
480-489.
Sun, H. L., Wang, Y. F., Tong, G. Z., Zhang, P. J., Miao, D. Y.,
Zhi, H. D., Wang, M., & Wang, M. 2008. Protection of
chickens from Newcastle disease and infectious
laryngotracheitis with a recombinant fowlpox virus co-
expressing the F, HN genes of Newcastle disease virus and
gB gene of infectious laryngotracheitis virus. Avian Diseases
52: 111-117.
Swayne, D. E., 2007. Understanding the complex pathobiology of
high pathogenicity avian influenza viruses in birds. Avian
Diseases 51: 242-249.
Taylor, J., Weinberg, R., Kawaoka, Y., Webster, R. G., & Paoletti,
E. 1988. Protective immunity against avian influenza
induced by a fowlpox virus recombinant. Vaccine 6: 504-
508.
Tian, G., Zeng, X., Li, Y., Shi, J., & Chen, H. 2010. Protective
efficacy of the H5 inactivated vaccine against different
highly pathogenic H5N1 avian influenza viruses isolated in
China and Vietnam. Avian Diseases 54: 287-289.
AsPac J. Mol. Biol. Biotechnol. Vol. 27 (1), 2019 Coexpression of AIV H5 and IL-15 in fowlpox viruses
94
Webster, R. G., Kawaoka, Y., Taylor, J., Weinberg, R., & Paoletti,
E. 1991. Efficacy of nucleoprotein and haemagglutinin
antigens expressed in fowlpox virus as vaccine for influenza
in chickens. Vaccine 9: 303-308.
Yajima, T., Nishimura, H., Ishimitsu, R., Watase, T., Busch, D. H.,
Pamer, E. G., Kuwano, H., & Yoshikai, Y. 2002.
Overexpression of IL-15 in vivo increases antigen-driven
memory CD8+ T cells following a microbe exposure.
Journal of Immunology 168: 1198-1203.
Zhang, X., Sun, S., Hwang, I., Tough, D. F., & Sprent, J. 1998.
Potent and selective stimulation of memory-phenotype
CD8+ T cells in vivo by IL-15. Immunity 8: 591-599.
Zielinski, R. J., Smedley, J. V., Perera, P. Y., Silvera, P. M.,
Waldmann, T. A., Capala, J., & Perera, L. P. 2010. Smallpox
vaccine with integrated IL-15 demonstrates enhanced in
vivo viral clearance in immunodeficient mice and confers
long term protection against a lethal monkeypox challenge
in cynomolgus monkeys. Vaccine 28: 7081-7091.
