Content uploaded by Sebastian C. D.
Author content
All content in this area was uploaded by Sebastian C. D. on Feb 07, 2019
Content may be subject to copyright.
www.iaset.us editor@iaset.us
A STUDY ON THE MITOCHONDRIAL COI DNA SEQUENCE AND PHYLOGENETIC
STATUS OF ANASTATUS BANGALORENSIS MANI & KURIAN AND ANASTATUS
ACHERONTIAE NARAYANAN, SUBBA RAO & RAMACHANDRA RAO
(HYMENOPTERA: EUPELMIDAE)
RUKHSANA, K. & SEBASTIAN, C. D
Molecular Biology Laboratory, Department of Zoology, University of Calicut, Kerala, India
ABSTRACT
Anastatus (Hymenoptera: Eupelmidae) species are end parasitoids of a wide variety of insect eggs of Hemiptera,
Lepidoptera and Orthoptera. It included the family Eupelmidae of Hymenoptera and they are an important egg parasitoid
of several major insect pests. Here we report the partial sequence of cytochrome oxidase sub unit I gene (COI) of Anatatus
bangalorensis (KU052674) and Anastatus acherontiae (KU052673) and its phylogenetic relationship. The COI gene
sequence of A. bangalorensis and A. acherontiae are showed considerable variation with other related species. The
mitochondrial COI DNA barcode developed in this study can be used for the accurate identification. The COI partial
coding sequence of A. bangalorensis (KU052674) are showed 1.6% difference to A. acherontiae (KU052673), A.
bangalorensis and A. acherontiae demonstrates the efficiency of the barcoding gene in discriminating global
phylogeographical variants among the related species complex. A. bangalorensis and A. acherontiae are in a same clade on
the phylogenetic tree.
KEYWORDS:
A. Acherontiae, A. Bangalorensis, Cytochrome Oxidase, DNA Bar-coding, Molecular Phylogeny
INTRODUCTION
Species of Anastatus (Hymenoptera: Eupelmidae) are included in the egg parasitoids of Lepidoptera, Orthoptera,
Hemiptera and Phasmidae. The common host of A. acherontiae is Acherontia styx which is a Sphingid moth commonly
found in Asia. They are also known to be a pest of Citrus junos in South Korea, using their tongue to pierce and damage
the fruit. It is also found in other eggs of lepidopterans, A. bangalorensis lays eggs on Halymorpha marmorea
(Heteroptera: Pentatomidae), a serious pest of arecanut plant causing tender nut fall. Head of A. bangalorensis and
A. acherontiae is dark with metallic green refringence. Antennal pedicel brown or black, scape pale yellow or pale
brownish yellow, mesosoma dark brown with metallic green, legs brown with mid tibial spur and tarsus pale yellow
(Narendran, 2009). The identification of these two species is difficult in morphologically due to their similarities.
Molecular phylogenetic analysis were extensively carried out using COI gene sequences in various group of insects like
dipterans (Bindu and Sebastian, 2014; Priya and Sebastian, 2014), lepidopterans (Akhilesh and Sebastian, 2014; Pavana
and Sebastian, 2014), heteropterans (Sreejith and Sebastian, 2014), odonates (Jisha and Sebastian, 2015), and
hymenopterans (Rukhsana and Sebastian, 2014).
International Journal of Applied
and Natural Sciences (IJANS)
ISSN(P): 2319-4014; ISSN(E): 2319-4022
Vol. 5, Issue 1, Dec – Jan 2016; 69-74
© IASET
70
Rukhsana, K. & Sebastian, C. D
Impact Factor (JCC): 2.9459 NAAS Rating 2.74
MATERIALS AND METHODS
A. bangalorensis and A. acherontiae used in the present study was collected from Wayanad district in Kerala,
India. Mitochondrial genomic DNA was extracted from the experimental insects, A. bangalorensis and A. acherontiae. The
tissue was homogenized using a glass pestle and mortar. The genomic DNA in the homogenate was extracted using a
GeNei Ultrapure Mammalian Genomic DNA Prep Kit in accordance to the manufacturer’s instructions. About 2 ng of
genomic DNA was amplified for mitochondrial cytochrome oxidase subunit I (COI) gene using the forward primer with
DNA sequence 5'- GGTCAACAAATCATAAAGATATTGG -3' and reverse primer with DNA sequence
5'- TAAACTTCAGGGTGACCAAAAAATCA -3'. The PCR reaction mixture consisted of 2 ng of genomic DNA, 1µl
each forward and reverse primers at a concentration of 2.5 µM, 2.5 µl of dNTPs (2mM), 2.5 µl of 10X reaction buffer,
0.20µl of Taq polymerase (3U/µl) and 11.8 µl H
2
O. The PCR profile consisted of an initial denaturation step of 2 minutes
at 95
0
C, followed by 30 cycles of 5s at 95
0
C, 45s at 50
0
C and 45s at 72
0
C and ending with a final phase of 72
0
C for 3
minutes. The PCR products were resolved on a 1% TAE-agarose gel, stained with Ethidium Bromide and photographed
using a gel documentation system. After ascertaining the PCR amplification of the corresponding COI fragment, the
remaining portion of the PCR products were column purified using Mo Bio Ultraclean PCR Clean-up Kit (Mo Bio
Laboratories, Inc. California) as per the manufacturer’s instructions. The purified PCR products were sequenced from both
ends using the forward and reverse primers used for the PCR using Sanger’s sequencing method (Sanger, 1975). The
forward and reverse sequences obtained were trimmed for the primer sequences, assembled by using ClustalW and the
consensus was taken for the analysis. The nucleotide sequence and peptide sequence were searched for its similarity using
BLAST programme of NCBI (www.ncbi.nlm.nih.gov/) and Inter and intra specific genetic diversity were calculated using
Kimura 2-parameter model with the pair wise deletion option and the difference in the nucleotide in codon usage partial
COI sequence of A. bangalorensis and A. acherontiae was analyzed using MEGA6 software.
RESULTS AND DISCUSSION
The PCR of the COI gene fragment of A. bangalorensis (KU052674) and A. acherontiae (KU052673) yielded
products of 652 bp and 663 bp respectively. The BLAST search using the sequences revealed that the sequences obtained
in this study was novel. The average divergence in inter specific comparisons is 1.6%. Partial COI DNA sequence of A.
bangalorensis showed 1.6% difference to that of A. acherontiae sequenced.
The average nucleotide composition across the species A. bangalorensis was T=45.3%; A=30.5%; C=10.6%;
G=13.5% and A. acherontiae was T=43.2%; A=29.3%; C=11.7%; G=15.8% (Table 1). This results show that analysis
based on mitochondrial gene can be useful for unraveling phylogenetic relationships in these species. The percentage of
A+T was higher than that of G+C which reflected further in the codon usage in these two species. The probability of
substitution (r) from one base to another base also calculated for 14 nucleotide sequences (Tamura et al, 2004) shows in
Table 2. The nucleotide frequencies are 31.62% (A), 43.49% (T/U), 11.82% (C), and 13.08% (G). The
transition/transversion rate ratios are k1 = 1.394 (purines) and K2 = 0.628 (pyrimidines). The overall
transition/transversion bias is R = 0.364, where R = [AxGxk1 + TxCxk2] / [(A+G) x (T+C)] (Tamura et al., 2013).
The evolutionary history was inferred using the Neighbor-joining method using COI partial sequence. The
evolutionary history of A. bangalorensis and A. acherontiae were inferred using the Neighbor- joining method (Figure 1).
The amino acids arginine and glutamic acid are not found in these partial nucleotide sequences (Table 3). DNA sequence
A Study on the Mitochondrial Coi Dna Sequence and Phylogenetic Status of Anastatus Bangalorensis
71
Mani & Kurian and Anastatus Acherontiae Narayanan, Subba Rao & Ramachandra Rao
(Hymenoptera: Eupelmidae)
www.iaset.us editor@iaset.us
based identification technique has revealed the morphological and ecological traits of many species during larval stages
(Foltan, 2005; Smith, 2006; Hayashi and Sota, 2010). Gurney et al. (2000) reported that closely related species have 90%
similarity in the standardized DNA sequence and distantly related species have less than 90% similarity in the same genes
sequence. Here we can clearly classify the two species, A. bangalorensis and A. acherontiae by comparing the nucleotide
sequences.
Table 1: The Evolutionary Nucleotide Divergence of A. Bangalorensis and
A. Acherontiae with Various Hymenopterans Species
Accession No. and Organism % of Divergence
KU052674 Anastatus bangalorensis 0%
KU052673 Anastatus acherontiae 1.60%
HQ599571 Aphelinus varipes 13.15%
KP072609 Perilampus tristis 13.81%
KF573404 Trichogramma pretiosum 13.59%
JX442923 Trichogramma brassicae 13.37%
JQ268913 Aphytis hispanicus 14.49%
JQ756596 Megastigmus aculeatus 15.23%
KJ208871 Eupelmidae sp. 13.18%
JQ756561 Philocaenus medius 15.75%
JQ756575 Philocaenus liodontus 15.94%
FM210164 Metaphycus flavus 14.06%
GQ374677 Megastigmus transvaalensis 15.64%
KJ083443 Eulophidae sp. 15.00%
Table 2: Maximum Composite Likelihood Estimate of the Pattern of Nucleotide Substitution.
Each Entry Shows the Probability of Substitution (r) from One Base (Row) to Another Base (Column)
A T C G
A - 14.64 3.98 6.14
T 10.64 - 2.5 4.4
C 10.64 9.2 - 4.4
G 14.84 14.64 3.98 -
Table 3: the Percentage of Various Amino Acids found in the Partial
COI Sequences of A. Bangalorensis and A. Acherontiae
Amino Acid % in A.
Bangalorensis % in A.
Acherontiae
Ala 0 0.6
Cys 5.1 7.9
Asp 1.7 1.7
Glu 0 0
Phe 18.9 15.2
Gly 1.1 3.4
His 0.6 0
Ile 14.3 15.2
Lys 6.9 5.6
Leu 4 2.8
Met 0 1.7
Asn 12 11.8
Pro 0.6 1.7
72
Rukhsana, K. & Sebastian, C. D
Impact Factor (JCC): 2.9459 NAAS Rating 2.74
Gln 0 0.6
Arg 0 0
Ser 13.7 13.5
Thr 3.4 2.2
Val 1.7 2.2
Trp 6.9 5.6
Tyr 9.1 8.4
Figure 1: Phylogenetic Status of A. Bangalorensis and
A. Acherontiae Compared with other Hymenopterans Species
CONCLUSIONS
Variation in the nucleotide is fundamental property of all living organisms which can be used for their
identification and phylogenetic status. The COI sequence obtained in this study showed nucleotide variation between A.
bangalorensis and A. acherontiae are 1.6%. Phylogeny analysis using NJ tree revealed the sharing of common ancestor to
these two species and both species in a same clade. The branch length of A. bangalorensis was less compared to the A.
acherontiae indicating the diversity. The phylogenetically close species of these two are a Eupelmidae species (KJ208871).
Inter specific divergence of partial coding fragment of COI gene is very efficient for species identification (Hebert et al.,
2003).
ACKNOWLEDGEMENTS
The financial assistance from University Grants Commission, New Delhi and Kerala State Council for Science
Technology and Environment under Research Projects and Ministry of Minority Affairs, Government of India in the form
of MANF are gratefully acknowledged.
REFERENCES
1. Akhilesh, V. P. and Sebastian, C. D. 2014. Molecular barcoding and phylogeny analysis of Herpetogramma
HQ599571 Aphelinus varipes
JQ268913 Aphytis hispanicus
KF573404 Trichogramma pretiosum
JX442923 Trichogramma brassicae
FM210164 Metaphycus flavus
JQ756596 Megastigmus aculeatus
GQ374677 Megastigmus transvaalensis
KJ083443 Eulophidae sp.
JQ756561 Philocaenus medius
JQ756575 Philocaenus liodontus
KP072609 Perilampus tristis
KJ208871 Eupelmidae sp.
KU052674 Anastatus bangalorensis
KU052673 Anastatus acherontiae
100
50
89
66
77
55
45
61
93
26
9
0.02
A Study on the Mitochondrial Coi Dna Sequence and Phylogenetic Status of Anastatus Bangalorensis
73
Mani & Kurian and Anastatus Acherontiae Narayanan, Subba Rao & Ramachandra Rao
(Hymenoptera: Eupelmidae)
www.iaset.us editor@iaset.us
stultalis (Lepidoptera: Crambidae) using cytochrome oxidase subunit I gene sequence. International Journal of
Advanced Life Sciences, 7: 463-466.
2. Bindu, P. U. and Sebastian, C. D. 2014. Genetic structure of mitochondrial cytochrome oxidase subunit I gene of
the mosquito, Armigeres subalbatus. International Journal of Research, 1(10): 49-56.
3. Foltan, P., Sheppard, S. K., Konvicka, M. and Symondson, W.O.C. 2005. The significance of facultative
scavenging in generalist predator nutrition: detecting decayed prey in the guts of predators using PCR. Molecular
Ecology, 14: 4147–4158.
4.
Gurney, T., Elbel, R., Ratnapradipa, D. and Brossard, R.
2000.
Introduction to the molecular phylogeny of
insects. Tested studies for laboratory teaching. S. J. Karcher, Eds., Proceedings of the
21st
Workshop/Conference of the Association for Biology Laboratory Education, 21: 63-79.
5. Hayashi, M. and Sota, T. 2010.Identification of Elmid larvae (Coleoptera: Elmidae) from Sanin District of
Honshu, Japan, based on mitochondrial DNA sequences. Entomological Science, 13: 417–424.
6. Hebert, P.D.N., Ratnasingham, S. and Dewaard, J. D. 2003. Barcoding animal life, Cytochrome c oxidase subunit
I divergences among closely related species. Proceedings of the Royal Society London Biological Science, 2003;
270: 96-99.
7. Jisha Krishnan, E. K. and Sebastian, C. D. 2015. Genetic and Phylogenetic Assesment of Sexually Dimorphic
Species, Diplacodes trivalis (Odonata: Libellulidae) using Cytochrome Oxidase I Gene. International Journal of
Pure and Applied Bioscience, 3 (2): 317-320.
8. Narendran, T. C. 2009. A review of the species of Anastatus Motschulsky (Hymenoptera: Chalcidoidea:
Eupelmidae) of the Indian subcontinent. Journal of Threatened Taxa 1:74,751.
9. Pavana, E. and Sebastian, C. D. 2014. Genetic diversity and phylogenetic analysis of lepidopteran species by
molecular barcoding using CO I gene sequences. International Journal of Science and Research, 3(5): 450-452.
10. Priya Bhaskaran, K. P. and Sebastian, C. D. 2014. Molecular barcoding of green bottle fly, Lucilia sericata
(Diptera: Calliphoridae) using COI gene sequences. Journal of Entomology and Zoology Studies, 3(1): 10-12.
11. Rukhsana, K. and Sebastian, C. D. 2014. Deciphering the molecular phylogenetics of the Asian honey bee, Apis
cerana (Hymenoptera: Apidae) and inferring the phylogeographical relationships using DNA barcoding. Journal
of Entomology and Zoology Studies, 2(4): 218-220.
12. Sanger, F. and Coulson, A. R. 1975. A rapid method for determining sequences in DNA by primed synthesis with
DNA polymerase. Journal of Molecular Biology, 94 (3): 441–448.
13. Smith, M. A., Woodley, N. E., Janzen, D. H., Hallwachs, W. and Hebert, P.D.N. 2006. DNA barcodes reveal
cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera:
Tachinidae). Proceedings of National Academy of Sciences USA, 103: 3657–3662.
14. Sreejith, K. and Sebastian, C. D. 2014. Phylogenetic analysis and sequencing of the mitochondrial cytochrome
oxidase subunit I (COI) of white backed plant hopper, Sogatella furcifera (Horvath). International Research
74
Rukhsana, K. & Sebastian, C. D
Impact Factor (JCC): 2.9459 NAAS Rating 2.74
Journal of Pharmacy, 5 (12): 887-890.
15. Tamura, K., Nei, M., and Kumar, S. 2004. Prospects for inferring very large phylogenies by using the neighbor-
joining method. Proceedings of the National Academy of Sciences (USA), 101:11030-11035.
16. Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar S. 2013. MEGA6: Molecular Evolutionary
Genetics Analysis version 6.0. Molecular Biology and Evolution, 30: 2725-2729.
