ArticlePDF Available
Journal of Biotechnology 14(1A): 245-253, 2016
245
EVALUATION OF GENETIC DIVERSITY OF PHU QUOC RIDGEBACK DOGS BASED
ON MITOCHONDRIAL DNA HYPERVARIABLE-1 REGION
Thai Ke Quan1, Nguyen Van Tu1, Tran Ngoc Trinh4, Huynh Van Hieu2, Chung Anh Dung3, Tran Hoang
Dung2
1Saigon University
2Nguyen Tat Thanh University
3Institute of Agricultural Science for Southern Vietnam
Received: 28.12.2015
Accepted: 24.01.2016
SUMMARY
Phu Quoc ridgeback dog is one of Vietnamese valuable dog breeds carrying many good characteristics
such as intelligence, strength, good parenting, people friendly and more importantly, still keeping wild
characteristics of hunting dogs. Besides Rhodesian ridgeback dog and Thai ridgeback dog, Phu Quoc ridgeback
dog is characterized by the ridge of hair running along their back in the opposite direction from the rest of the
coat. However, the origin of this dog breed is unclear and controversial. Some documents stated that Thai
ridgeback dog is the ancestor of Phu Quoc ridgeback dog but did not give a reasonable evidence. Previous
studies have shown that mitochondrial DNA is a promising source of valuable information about the
evolutionary history of dog breeds. In this study, mitochondrial DNA was extracted from hairs of 30 Phu Quoc
ridgeback dogs living in Phu Quoc island, Vietnam. Segments of 582 base pairs in the mitochondrial DNA
hypervariable-1 region were sequenced and analysed for evaluation of genetic diversity. Twenty-eight single
nucleotide polymorphisms were identified, belonged to 11 haplotypes distributed in four haplogroups A, B, C
and E. Although considered as rare haplogroup and was found in only 0.63% of dogs all over the world,
haplogroup E was found in Phu Quoc ridgeback dogs with high rate (16.67%) while there is no haplogroup E
found in Thai ridgeback dogs in previous studies. Characteristics of Phu Quoc ridgeback dog and the presence
of five out of thirty dogs harbouring rare haplotypes E may be clues for seeking the origin of Phu Quoc
ridgeback dog.
Keywords: Control region, haplotype E, Phu Quoc ridgeback dog, phylogeny
INTRODUCTION
Phu Quoc ridgeback dogs primarily live in the
Phu Quoc island in Vietnam's southern Kien Giang
province, VietNam. They are considered as one of
the Vietnamese valuable dog breeds carrying many
good characteristics such as intelligence, strength,
good parenting, people friendly and more
importantly, still keeping wild characteristics of
hunting dogs (Chiếm et al., 2004). Besides
Rhodesian ridgeback dog and Thai ridgeback dog,
Phu Quoc ridgeback dog is characterized by the
ridge of hair running along their back in the opposite
direction from the rest of the coat. However, the
origin of Phu Quoc ridgeback dogs are
undocumented and unclear (Chiếm et al., 2004).
Fédération Cynologique Internationale (FCI) has not
approved Phu Quoc ridgeback dog as a dog breed so
far. Some documents stated that Thai ridgeback dog
is the ancestor of Phu Quoc ridgeback dog but did
not give a reasonable evidence.
Mitochondrial DNA (mtDNA) is the best source
of valuable information about the evolutionary
history of the domesticated dog (Pang et al., 2009a;
Vila et al., 1997) as well as the origin of some dog
breeds (Li et al., 2008). mtDNA genome of a
domestic dog (Canis lupus familiaris) is about
16,727 bp long with the control region (CR)
spanning positions 15,458 16,727. This 1,270 bp
non-coding DNA segment contains two
hypervariable regions, HV1 and HV2 (Bekaert et al.,
2012; Kim et al., 1998). HV1 has the higher
mutation rate making it a popular region of analysis
to search for DNA variation. A 582 bp region in the
mtDNA HV1 exhibited high variation has become
one of the molecular markers used to determine the
maternally inherited relationships between
Thai Ke Quan et al.
246
individuals or populations of the same species (Baute
et al., 2008; Himmelberger et al., 2008; Savolainen
et al., 1997). Analyzing the phylogenetic relationship
of 582 bp sequences in the HV1 of 1,576 dogs, Pang
et al. (2009a) found that all sequences were grouped
into six previously described distinct haplogroups A,
B, C, D, E, F. In which, 71.3% of sequences were
found in haplogroup A; 17.26% in haplogroup B,
7.80% in haplogroup C, 1.78% in haplogroup D,
0.63% in haplogroup E and 0.19% in haplogroup F.
Li and Zang (2012) analyzed 582 bp sequences in
the HV1 of 50 Tibetan Mastiffs to study their origin
and evolution and the relationship with other dog
breeds across the world. The discovery rate for
Tibetan Mastiffs haplotypes (30%) was higher than
for dogs from East Asia (16.58%). In published data,
a total of 15 haplotypes were found in 50 Tibetan
Mastiffs, and three Tibetan Mastiffs showed a
genetic link between dogs of the Qing-Tibet Plateau
and Japan (A29, A11, A19), similar to the genetic
link between Tibetans and Japanese (Li and Zang,
2012). Haplotypes in haplogroup A, B and C had the
same frequency distribution across the world
(haplogroup C have not been found in America)
while haplogroups D, E and F were rare with limited
distributions, i.e. in Turkey, Spain and Scandinavia
(haplogroup D); in Japan, China and South Korea
(haplogroup E); in Japan and Siberia (haplogroup F)
(Pang et al., 2009b). Imes et al. (2012) sequenced
the whole ~16.7 kb canine mitochondrial genome of
100 unrelated domestic dogs that exhibited 35
haplotypes, all of which clustered within one of four
previously described haplogroups (A, B, C, D). Of
these, 23 haplotypes were previously observed, 11
were novel, and one was ambiguous. The ten most
commonly observed haplotypes (A2, A11, A16,
A17, A18, A19, A22, A26, B1, C3) composed
approximately 53% of the sequences (Imes et al.,
2012). Thai ridgeback dogs were also included in
some previous studies (Oskarsson et al., 2012; Pang
et al., 2009c) which showed that all of their HV1
sequences (13 samples) belonged to the haplogroup
A and B.
At the beginning in the framework of seeking
the origin of Phu Quoc ridgeback dogs, we analyzed
fifteen 582 bp sequences of the HV1 region of Phu
Quoc ridgeback dogs living around in Ho Chi Minh
city and found nine individuals harbouring
haplogroup E (GenBank accession: KF757293.1,
KF757294.1, KF757295.1, KF757296.1,
KF757297.1, KF757307.1, KF757309.1,
KF757311.1, KF757312.1). Although some of them
are in maternal relationship (data not shown), the
presence of Phu Quoc ridgeback dogs harbouring
haplogroup E encouraged us to examine the genetic
diversity of these dogs living in the Phu Quoc island
to check whether the Phu Quoc ridgeback dog
harbouring haplogroup E is commonly present in the
Phu Quoc island. The consequent phylogenetic
analysis would offer primary information about the
evolutional relationship between them and other dog
breeds.
MATERIALS AND METHODS
Samples collection and preparation
Hair roots were collected from 30 Phu Quoc
ridgeback dogs living in Phu Quoc island. To avoid
testing related dogs, samples from sibling dogs or
dogs with maternal bond were excluded. Each
sample was stored in a plastic ziplock bag at -30ºC
until being used. Samples were numbered from
PQ33 through PQ62.
DNA extraction
20 hair roots of each dog were vortexed with
lysis buffer (Tris-HCl 10 mM, pH 8; Triton X100
1%; SDS 1%; EDTA 10 mM) for 30 seconds and
incubated at 50ºC for 20 minutes. The solution was
then incubated at 50ºC for 1 hour with 5 µl
proteinase K (20 mg/ml). Released DNA in the
solution is separated with other contents (protein,
cell debris,…) by phenol:chloroform:isoamylalcohol
mixture, and precipitated in absolute ethanol.
Extracted DNA is then dissolved in distilled water
and stored at -30oC. The concentration, yield and
purity of DNA samples were determined using sing
absorbance and agarose gel electrophoresis methods.
Polymerase Chain Reaction
A pair of previously reported oligonucleotide
primers (15412F- CCACTATCAGCACCCAAAG
and 16625R-AGACTACGAGACCAAATGCG) that
amplified 1,267 bp CR fragment was used for PCR
(Gundry et al., 2007). Two microlitres of template
DNA were added to the PCR reaction mixture
consisting of Prime Taq Premix (2X) (0.1U/µl Taq
DNA Polymerase; 0.4 mM of each dNTP; 0.4 mM
MgSO4; 20 mM KCl; 16 mM (NH4)2SO4; 20 mM
Tris-HCl, pH8.8) and 10 µM of forward (15412F)
and reverse (16625R) primer in a total volume of 20
µl. The amplification program consisted of a
predenaturation step (95ºC, 5 min), followed by 35
cycles of denaturation at 95ºC for 30 sec, primer
annealing (49ºC, 30 sec), extension (72ºC, 1 min),
Journal of Biotechnology 14(1A): 245-253, 2016
247
and final extension at 72ºC for 5 min. PCR reactions
were performed in a Techne TC-3000 (USA). Three
microlitres of a PCR product were analysed on a 1%
agarose gel with ethidium bromide staining.
DNA sequencing
PCR products were sequenced with two primers
(15412F- CCACTATCAGCACCCAAAG and
16114R- CCTGAAACCATTGACTGAATAG)
using the Sanger method (Sanger et al., 1977) by
NICEM, South Korea. Nucleotide sequences were
evaluated using FinchTV 1.4.0. Manual editing was
used to resolve any inconsistencies between forward
and reverse sequences. All sequences were aligned
and trimmed using ClustalW (Larkin et al., 2007)
and FinchTV1.4.0 to produce 582 bp sequences.
Haplotyping
The 582 bp segment extracted from the first
complete mtDNA sequence of the dog (GenBank
accession: U96639.2 (Kim et al., 1998)) was used
as reference sequence. Each 582 bp sequence of
Phu Quoc ridgeback dog was aligned with
reference sequence using ClustalW program. If the
sequence is identical to a sequence with known
haplotype, the haplotype of query sequence is
defined accordingly, otherwise it would be defined
as a novel haplotype.
Phylogenetic analysis
Thirty Phu Quoc ridgeback dogs HV1
sequences, 252 sequences of previously described
haplotypes (Accession #: U96639, KF002306,
AF531654 AF531741, AY656703 AY656710,
EU816457 EU816557, GQ896338 GQ896345,
HQ452433, HQ452439 HQ452465, HQ452424
HQ452430, HQ452435 HQ452438, D83611,
D83637, AB007381) (Ardalan et al., 2011; Kim et
al., 1998; Klutsch et al., 2011; Okumura et al.,
1996; Savolainen et al., 2002; Tsuda et al., 1997;
Van Asch et al., 2013) and 6 representative coyotes
(Canis latrans) (Accession #: NC_008093,
KF661096, DQ480509 DQ480511, EU789789)
(Bjornerfeldt et al., 2006; Pang et al., 2009b;
Thalmann et al., 2013) were used for phylogenetic
analysis. The phylogenetic tree was inferred using
Maximum Likelihood method and the Neighbor
Joining method with the T92+I+G model
(lnL=2565.47, G=0.1204 and I=0.7865) and 1,000
repeats bootstrapping.
RESULTS AND DISCUSSION
DNA extraction, PCR and sequencing
Genomic DNA extracted from 30 dog hair
samples were good enough for further experiments.
DNA bands on 1% agarose gel were observed under
ultraviolet light. DNA concentrations were from 5.5
to 9.1 ng/µl with A260/A280 ratio of 1.82.0.
Although two primers 15412F and 16625R were
successful in amplification of the 1,267 bp sequence
containing HV1 region, they did not work well in the
sequencing. The chromatogram showed high
baseline noise and mixed peaks in the VNTR region
between HV1 and HV2. The annealing position of
16625R is right after the VNTR that probably disturb
the sequencing process. Therefore, the 16114R was
chosen as reverse primer to excluded the VNTR in
the sequencing. Results showed the high consistency
between forward and reverse sequences. After
manually edited, 582 bp sequences were produced
for further analysis.
Single nucleotide polymorphisms
Table 1. Grouping of Phu Quoc ridgeback dogs.
Group
Samples
1
PQ34/PQ35/PQ42/PQ58/PQ59
2
PQ47/PQ57/PQ62
3
PQ40
4
PQ55
5
PQ33/PQ36/PQ38/PQ39/
PQ43/PQ52/PQ53/PQ54/PQ60
6
PQ45
7
PQ37
8
PQ46
9
PQ41/PQ44/PQ51
10
PQ48/PQ56
11
PQ49/PQ50/PQ61
Based on the difference among the sequences,
30 sequences were classified into 11 groups. The
nucleotide sequences of PQ37, PQ40, PQ45,
PQ46, PQ55 were very different from other
sequences. The remaining nucleotide sequences
were similar at least one of 30 nucleotide
sequences completely identical (Table 1). There
are totally 28 SNPs (4.81% of nucleotide sites, i.e
the sequence) and the pairwise differences are
between 1 (0.172%) and 17 (2.921%). All
sequences harbour a transition mutation at
position 15814 (a C to a T). Based on the position
of the SNPs appearance, four groups of sequences
could be identified: (1) nucleotide sequences did
Thai Ke Quan et al.
248
not have any common mutation positions which
had a few mutation positions (less than 7); (2)
nucleotide sequences had three mutations at
specific positions 15612, 15643 and 15815; (3) the
nucleotide sequences had three mutations at
specific positions 15508, 15611 and 15650; (4) the
nucleotide sequences had two mutations at specific
positions 15553 and 15811 (Table 2).
Table 2. The 28 polymorphic sites in HV1 sequences of 30 Phu Quoc ridgeback dogs analysed in this study.
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
5
6
6
6
5
5
5
5
5
5
5
6
6
6
6
6
6
6
6
7
7
8
8
8
8
8
9
9
9
0
0
0
0
2
3
3
3
5
9
1
1
2
3
3
4
5
5
1
8
0
0
1
1
1
1
3
5
0
2
3
8
6
0
4
5
3
5
1
2
7
2
9
3
0
2
0
1
0
7
1
4
5
2
8
5
3
5
8
1
Reference sequence
C
C
T
-
T
A
C
T
T
A
C
T
A
T
G
C
C
T
C
A
C
T
C
G
C
A
T
C
PQ34/PQ35/PQ42/PQ5
8/PQ59
.
.
.
T
-
.
.
.
.
.
.
A
.
.
.
.
.
.
.
.
T
.
.
.
.
.
C
.
PQ47/PQ57/PQ62
.
.
.
-
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
T
.
.
.
.
.
.
.
PQ40
.
-
C
C
.
.
.
.
.
G
.
G
.
.
.
.
.
.
.
.
T
.
.
.
.
.
C
.
PQ55
.
.
.
T
-
.
.
.
.
.
.
A
.
.
.
.
T
.
T
.
T
.
.
.
.
.
.
.
PQ33/PQ36/PQ38/PQ3
9/PQ43/
PQ52/PQ53/PQ54/PQ6
0
.
T
.
-
.
.
T
.
C
.
T
G
G
.
A
.
.
C
.
.
T
C
T
.
T
G
.
.
PQ37
.
T
.
-
.
.
.
.
C
.
T
G
G
.
A
.
.
C
.
.
T
C
T
.
T
G
.
.
PQ46
T
T
.
-
.
.
.
C
.
.
.
G
.
C
.
.
.
C
.
.
T
.
T
-
T
G
.
.
PQ41/PQ44/PQ51
T
T
.
-
.
.
.
C
.
.
.
G
.
C
.
T
.
C
.
.
T
.
T
-
T
G
.
.
PQ48/PQ56
.
T
.
-
.
G
.
.
.
.
T
A
.
.
A
.
.
C
.
G
T
.
T
-
T
G
.
.
PQ49/PQ50/PQ61
.
T
.
-
.
G
.
.
.
.
T
A
.
.
A
.
.
C
.
G
T
.
T
-
.
G
.
.
Reference sequence: U96639.2
Nucleotide substitutions are shown relatively to the reference sequence. A dot (.) indicates a match to the reference
sequence and a dash (-) indicates an indel.
Journal of Biotechnology 14(1A): 245-253, 2016
249
Previous studies showed that the SNPs discovery
rate of Kangal dogs was 5.13% (30 SNPs observed
in 585 bp HV1) (Gökçek, 2005), the discovery rate
of Croatian dogs was 7.83% (22 SNPs observed in
281 bp HV1) (Sindičić et al., 2011), the discovery
rate of Swedish dogs was 8.95% (23 SNPs observed
in 257 bp HV1) (Savolainen et al., 1997), the
discovery rate of American dogs was 7.04% (41
SNPs observed in 582 bp HV1) (Imes et al., 2012)
(Figure 1). 25 SNPs (41.67%) were identified in 60
bp HV1 sequences of 83 American dogs (Baute et
al., 2008).
However, nucleotide sequences in different
length were analysed resulting the difference of the
SNPs. Sequences of Phu Quoc ridgeback dog were
trimmed to corresponding length to make it
comparable. By 281 bp HV1 sequences, the
discovery rate for Phu Quoc ridgeback dog SNPs
(5.69%) was slightly lower than that for dogs from
Croatia (7.83%) and Sweden (8.95%). By 582 bp
HV1 sequences, the discovery rate for Phu Quoc
ridgeback dog SNPs (4.81%) was slightly lower that
for dogs from America (7.04%) and Kangal dogs
(Turkey) (4.98%). Nine SNPs in the 60 bp HV1
sequences of Phu Quoc ridgeback dogs (15%) were
identified while in the same region of different dog
breeds in American, 25 SNPs (41.67%) were
identified (Baute et al., 2008). Number of SNPs
belonged to the 60 bp HV1 sequence occupied 1/3
SNPs which were found. These results were
compatible with the previously results (Baute et al.,
2008; Himmelberger et al., 2008).
Haplotyping. By sequence comparison, 11
groups of nucleotide sequence were identified that
were belonged to haplotypes A11, A18, A24, A65,
B1, B5, B10, C2, C3, E1 and E4; no new haplotype
was found (Table 3). The result showed that
haplotypes A, B and C occupied 83.33%; therein
haplotype B1 (30%), haplotype A11 (16.67%),
haplotype A18 (10%) and haplotype C3 (10%). These
were the highest haplotype frequencies in groups A, B
and C. It was similar to the previous study of Imes
(Imes et al., 2012). Amazingly, haplotypes E1 and E4
were found in the samples with remarkable rate
(16.67%). It is worth reminding that haplotypes D, E
and F only occupied less than 3% individual dogs
across the world (Pang et al., 2009b).
Table 3. Haplotype frequencies of 30 Phu Quoc ridgeback
dogs.
Haplotype
Samples
N
Freq
(%)
A11
PQ34/PQ35/PQ42/PQ58/PQ59
5
16,67
A18
PQ47/PQ57/PQ62
3
10
A24
PQ40
1
3,33
A65
PQ55
1
3,33
B1
PQ33/PQ36/PQ38/PQ39/
PQ43/PQ52/PQ53/PQ54/PQ60
9
30
B5
PQ45
1
3,33
B10
PQ37
1
3,33
C2
PQ46
1
3,33
C3
PQ41/PQ44/PQ51
3
10
E1
PQ48/PQ56
2
6,67
E4
PQ49/PQ50/PQ61
3
10
Note: N: Number of individuals.
Figure 1. The discovery rate of SNPs of some dog breeds across the world.
Thai Ke Quan et al.
250
Figure 2. The phylogenetic tree (simplified) described positions of 30 Phu Quoc ridgeback dog samples. Icon "arrow"
showed positions of Phu Quoc ridgeback dog samples.
Journal of Biotechnology 14(1A): 245-253, 2016
251
To exclude the errancy which may happen when
using data from GenBank (Thai and Pleiss, 2010;
Thai et al., 2009), the phylogenetic trees were
constructed using the Maximum Likelihood method
and the Neighbor Joining method with optimal
models to verify reliability of haplotype
identification. The coyote sequences (Canis latrans)
were chosen as outgroup. Since the phylogenetic
trees constructed using 2 methods were similar, we
used a phylogenetic tree drawn by the Maximum
Likelihood method to present our analysis results.
Phylogenetic analysis grouped all dog sequences into
the previously described six distinct haplogroups,
clades A F (Figure 2).
The estimation of evolutionary distances produced
during sequence alignment and the phylogenetic tree
construction (data not shown) showed that all
nucleotide sequences of Phu Quoc ridgeback dogs were
identified correctly. The discovery rate for Phu Quoc
ridgeback dog haplotypes (36.67%; 11 haplotypes
observed in 30 individuals) was slightly higher than that
for some dog breeds such as Kangal dogs (20.96%)
(Gökçek, 2005), Tibetan Mastiffs (30%) (Li and Zang,
2012), American dogs (20.49%) (Webb and Allard,
2009), dogs from East Asia (16.58%) (Savolainen et
al., 2002).
In this study, five individuals belonging to
haplogroup E were found. The analysis showed
that the rate of Phu Quoc ridgeback dogs
harbouring haplogroup E is quite high (16.67%). It
was amazing since haplogroup E has been rarely
found in dogs all over the world. A BLAST search
against the GenBank gave the result of 16
sequences with haplogroup E, in which nine
sequences originated from Phu Quoc ridgeback
dogs that were directly submitted in advance.
Interestingly, there is no haplogroup E found in
Thai ridgeback dogs in previous studies
(Oskarsson et al., 2012; Pang et al., 2009c) and in
the GenBank.
Analysis of haplotypes of dogs from East Asia
showed that few haplotypes of haplogroup E could
be found in dog breeds such as Shiba (Japan), Shar-
Pei (China) and Jindo (South Korea) (Ardalan et al.,
2011; Li and Zang, 2012; Oskarsson et al., 2012;
Savolainen et al., 2002; Tsuda et al., 1997).
Probably, some domestic dogs harbouring
haplogroup E from mainland of Vietnam or migrated
via trading boats from East Asia to Phu Quoc island.
The origin of Phu Quoc ridgeback dogs is assumed
to be in one of two hypotheses: (1) the interbreeding
between the Phu Quoc dog harbouring haplogroup E
and the Thai ridgeback dog; (2) the ridgeback trait
which is a kind of disease (Hillbertz, 2005) were
malformed later from the Phu Quoc dog harbouring
haplotype E because of the living condition on the
island. The isolated location of Phu Quoc island and
the inbreeding have kept the frequency of dogs
harbouring haplogroup E at the high level in the
population.
CONCLUSION
Analysing 582 bp mtDNA HV1 sequences of 30
Phu Quoc ridgeback dog living in Phu Quoc island,
28 SNPs and 11 haplotypes belonged to 4
haplogroups A, B, C and E were identified. It
showed the high genetic diversity of the population.
The amazing result is the high frequency of Phu
Quoc ridgeback dogs harbouring haplogroup E
which are rare distribution all over the world. This
could be a clue for seeking the origin of endemic
Phu Quoc ridgeback dog in Vietnam.
Acknowledgement: We would like to thank Mr. Le
Quoc Tuan, the owner of Thanh Nga farm,
Preservation center for Phu Quoc ridgeback dog,
Phu Quoc island for the fruitful discussion and his
supporting in dog sampling. This study is financially
supported by The Vietnam National Gene Fund
(Project no. 01/2015 HĐ-NVQG).
REFERENCES
Ardalan A, Kluetsch CF, Zhang AB, Erdogan M, Uhlen M,
Houshmand M, Tepeli C, Ashtiani SR, Savolainen P (2011)
Comprehensive study of mtDNA among Southwest Asian
dogs contradicts independent domestication of wolf, but
implies dog-wolf hybridization. Ecol Evol 1(3): 373-385.
Baute DT, Satkoski JA, Spear TF, Smith DG, Dayton MR,
Malladi VS, Goyal V, Kou A, Kinaga JL, Kanthaswamy S
(2008) Analysis of forensic SNPs in the canine mtDNA
HV1 mutational hotspot region. J Forensic Sci 53(6):
1325-1333.
Bekaert B, Larmuseau MH, Vanhove MP, Opdekamp A,
Decorte R (2012) Automated DNA extraction of single
dog hairs without roots for mitochondrial DNA analysis.
Forensic Sci Int Genet 6(2): 277-281.
Bjornerfeldt S, Webster MT, Vila C (2006) Relaxation of
selective constraint on dog mitochondrial DNA following
domestication. Genome Res 16(8): 990-994.
Thai Ke Quan et al.
252
Chiếm NH, Bin NV, Thành VC, Thin NH, Hng TTK,
Đưc NV, Quc LT, Khai LTL, Phng BTM, Truyên NĐ.
2004. Điu tra nghiên cu bo tn gen đng vt: chó Phú
Quc, tnh Kiên Giang. Báo cáo Tng kết, trưng Đi hc
Cn Thơ. Report no.
Gökçek Ç (2005) Mitochondrial DNA (mtDNA) sequence
analyses of Kangal dogs in Turkey. Master Thesis, Middle
East Technical University: 1-62.
Gundry RL, Allard MW, Moretti TR, Honeycutt RL,
Wilson MR, Monson KL, Foran DR (2007) Mitochondrial
DNA analysis of the domestic dog: control region
variation within and among breeds. J Forensic Sci 52(3):
562-572.
Hillbertz NHCS (2005) Inheritance of dermoid sinus in the
Rhodesian ridgeback. Journal of Small Animal Practice
46(2): 71-74.
Himmelberger AL, Spear TF, Satkoski JA, George DA,
Garnica WT, Malladi VS, Smith DG, Webb KM, Allard
MW, Kanthaswamy S (2008) Forensic utility of the
mitochondrial hypervariable region 1 of domestic dogs, in
conjunction with breed and geographic information. J
Forensic Sci 53(1): 81-89.
Imes DL, Wictum EJ, Allard MW, Sacks BN (2012)
Identification of single nucleotide polymorphisms within
the mtDNA genome of the domestic dog to discriminate
individuals with common HVI haplotypes. Forensic Sci Int
Genet 6(5): 630-639.
Kim KS, Lee SE, Jeong HW, Ha JH (1998) The complete
nucleotide sequence of the domestic dog (Canis familiaris)
mitochondrial genome. Mol Phylogenet Evol 10(2): 210-220.
Klutsch CF, Seppala EH, Fall T, Uhlen M, Hedhammar A,
Lohi H, Savolainen P (2011) Regional occurrence, high
frequency but low diversity of mitochondrial DNA
haplogroup d1 suggests a recent dog-wolf hybridization in
Scandinavia. Anim Genet 42(1): 100-103.
Larkin MA, Blackshields G, Brown NP, Chenna R,
McGettigan PA, McWilliam H, Valentin F, Wallace IM,
Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG
(2007) Clustal W and Clustal X version 2.0.
Bioinformatics 23(21): 2947-2948.
Li Q, Liu Z, Li Y, Zhao X, Dong L, Pan Z, Sun Y, Li N,
Xu Y, Xie Z (2008) Origin and phylogenetic analysis of
Tibetan Mastiff based on the mitochondrial DNA
sequence. J Genet Genomics 35(6): 335-340.
Li Y, Zang Y (2012) High genetic diversity of Tibetan
Mastiffs revealed by mtDNA sequences. Chinese Science
Bulletin 53(13): 1483-1487.
Okumura N, Ishiguro N, Nakano M, Matsui A, Sahara M
(1996) Intra- and interbreed genetic variations of
mitochondrial DNA major non-coding regions in Japanese
native dog breeds (Canis familiaris). Anim Genet 27(6):
397-405.
Oskarsson MC, Klutsch CF, Boonyaprakob U, Wilton A,
Tanabe Y, Savolainen P (2012) Mitochondrial DNA data
indicate an introduction through Mainland Southeast Asia
for Australian dingoes and Polynesian domestic dogs. Proc
Biol Sci 279(1730): 967-974.
Pang JF, Kluetsch C, Zou XJ, Zhang AB, Luo LY,
Angleby H, Ardalan A, Ekstrom C, Skollermo A,
Lundeberg J, Matsumura S, Leitner T, Zhang YP,
Savolainen P (2009a) mtDNA data indicate a single origin
for dogs south of Yangtze River, less than 16,300 years
ago, from numerous wolves. Mol Biol Evol 26(12): 2849-
2864.
Pang JF, Kluetsch C, Zou XJ, Zhang AB, Luo LY,
Angleby H, Ardalan A, Ekström C, Sköllermo A,
Lundeberg J, Matsumura S, Leitner T, Zhang YP,
Savolainen P (2009b) mtDNA data indicate a single origin
for dogs south of Yangtze River, less than 16,300 years
ago, from numerous wolves. Mol Biol Evol 26(12): 2849-
2864.
Pang JF, Kluetsch C, Zou XJ, Zhang AB, Luo LY,
Angleby H, Ardalan A, Ekström C, Sköllermo A,
Lundeberg J, Matsumura S, Leitner T, Zhang YP,
Savolainen P (2009c) mtDNA data indicate a single origin
for dogs south of Yangtze River, less than 16,300 years
ago, from numerous wolves. Molecular Biology and
Evolution 26(12): 2849-2864.
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing
with chain-terminating inhibitors. Proc Natl Acad Sci U S
A 74(12): 5463-5467.
Savolainen P, Zhang YP, Luo J, Lundeberg J, Leitner T
(2002) Genetic evidence for an East Asian origin of
domestic dogs. Science 298(5598): 1610-1613.
Savolainen P, Rosen B, Holmberg A, Leitner T, Uhlen M,
Lundeberg J (1997) Sequence analysis of domestic dog
mitochondrial DNA for forensic use. J Forensic Sci 42(4):
593-600.
Sindičić M, Gomerčić T, Galov A, Arbanisić H, Kusak J,
Slavica A, a.D. H (2011) Mitochondrial DNA control
region as a tool for species identification and distinction
between wolves and dogs from Croatia. Veterinarski Arhiv
81(2): 249-258.
Thai QK, Pleiss J (2010) SHV Lactamase Engineering
Database: a reconciliation tool for SHV beta-lactamases in
public databases. BMC Genomics 11: 563.
Thai QK, Bos F, Pleiss J (2009) The Lactamase
Engineering Database: a critical survey of TEM sequences
in public databases. BMC Genomics 10: 390.
Thalmann O, Shapiro B, Cui P, Schuenemann VJ, Sawyer
SK, Greenfield DL, Germonpre MB, Sablin MV, Lopez-
Giraldez F, Domingo-Roura X, Napierala H, Uerpmann
HP, Loponte DM, Acosta AA, Giemsch L, Schmitz RW,
Worthington B, Buikstra JE, Druzhkova A, Graphodatsky
Journal of Biotechnology 14(1A): 245-253, 2016
253
AS, Ovodov ND, Wahlberg N, Freedman AH, Schweizer
RM, Koepfli KP, Leonard JA, Meyer M, Krause J, Paabo
S, Green RE, Wayne RK (2013) Complete mitochondrial
genomes of ancient canids suggest a European origin of
domestic dogs. Science 342(6160): 871-874.
Tsuda K, Kikkawa Y, Yonekawa H, Tanabe Y (1997)
Extensive interbreeding occurred among multiple
matriarchal ancestors during the domestication of dogs:
evidence from inter- and intraspecies polymorphisms in
the D-loop region of mitochondrial DNA between dogs
and wolves. Genes Genet Syst 72(4): 229-238.
Van Asch B, Zhang AB, Oskarsson MC, Klutsch CF,
Amorim A, Savolainen P (2013) Pre-Columbian origins of
Native American dog breeds, with only limited
replacement by European dogs, confirmed by mtDNA
analysis. Proc Biol Sci 280(1766): 20131142.
Vila C, Savolainen P, Maldonado JE, Amorim IR, Rice JE,
Honeycutt RL, Crandall KA, Lundeberg J, Wayne RK
(1997) Multiple and ancient origins of the domestic dog.
Science 276(5319): 1687-1689.
Webb KM, Allard MW (2009) Identification of forensically
informative SNPs in the domestic dog mitochondrial control
region. J Forensic Sci 54(2): 289-304.
ĐÁNH GIÁ S ĐA DNG DI TRUYN CA CHÓ LƯNG XOÁY PHÚ QUC DA VÀO
VÙNG SIÊU BIN HV1 CA DNA TY TH
Thái Kế Quân1,!, Nguyn Văn Tú1, Trn Ngc Trình4, Hunh Văn Hiếu2, Chung Anh Dũng3, Trn
Hoàng Dũng2
1Đại hc Sài Gòn
2Đại hc Nguyn Tt Thành
3Vin Khoa hc K thut Nông nghip min Nam
TÓM TT
Chó lưng xoáy Phú Quc là mt trong nhng ging chó đc hu, có giá tr cao ca Vit Nam. Ging chó
này có nhiu đc tính quý như thông minh, lanh l, thân thin và còn gi đưc nhiu bn năng t nhiên ca chó
săn. Cùng vi chó lưng xoáy Nam Phi và chó lưng xoáy Thái Lan, chó lưng xoáy Phú Quc d dàng đưc nhn
biết vi vùng lông đc trưng dc trên lưng mc ngưc chiu vi lông ca các vùng khác. Cho đến nay, ngun
gc ca chó lưng xoáy Phú Quc vn chưa rõ ràng còn tranh cãi. Có tài liu cho rng chó lưng xoáy Phú
Quc có ngun gc t chó lưng xoáy Thái Lan nhưng không đưa ra bng chng thuyết phc. Nhiu nghiên cu
trưc đây cho thy rng DNA ty th th đưc dùng đ tìm hiu v ngun gc ca mt s ging chó. Trong
nghiên cu này, DNA ty th đưc tách chiết t lông ca 30 mu chó Phú Quc sng trên đo Phú Quc, Vit
Nam. Đon 582 cp base nm trên vùng siêu biến 1 ca DNA ty th chó đưc gii trình t và phân tích để đánh
giá mc đ da dng di truyn ca chúng. Kết qu phân tích cho thy có 28 v trí đt biến trên các trình t kho
sát, hình thành 11 haplotype thuc 4 haplogroup A, B, C và E. Dù là haplogroup hiếm, ch đưc tìm thy vi t
l 0,63% chó trên toàn thế gii, haplogroup E li đưc tìm thy vi t l cao chó lưng xoáy Phú Quc
(16,67%) còn chó lưng xoáy Thái Lan thì các nghiên cu đến nay vn chưa phát hin đưc haplogroup E. S
phát hin này đã cho chúng tôi nhng manh mi đu tiên trong vic truy tìm ngun gc chó Phú Quc ca Vit
nam.
T khóa: Chó lưng xoáy Phú Quc, haplotype E, phát sinh loài, vùng kim soát
! Author for correspondence: Tel: +84-918297640; E-mail: quan.tk@cb.sgu.edu.vn
... Trong một công bố trước, Thai et al., (2016) đã phát hiện tính đa dạng di truyền của chó lưng xoáy Phú Quốc rất cao. Theo đó, ba mươi mẫu chó Phú Quốc thu tại huyện đảo Phú Quốc mang 11 haplotype thuộc 3 haplogroup chính là A, B và E, đặc biệt 16,67% mang haplotype E (bao gồm E1 và E4). ...
... Ba cá thể chó Phú Quốc có ký hiệu là PQ1, PQ2 và PQ8 mang haplotype lần lượt E4, B1 và E1 đã được xác định trước đó (Thai et al., 2016) được chọn để đọc toàn bộ trình tự genome ty thể. Haplotype B1 (chó PQ2) được chọn như một mẫu đối chứng vì đây một haplotype cổ xưa phổ biến ở chó. ...
... Phả hệ đồ (phylogram) dựa trên trình tự mtDNA cho thấy các haplogroup A, B, C và E tách ra rõ rệt như quan sát trên phả hệ đồ sử dụng trình tự vùng CR như phân tích trước đó (Thai et al., 2016) Hình 3. Cây phả hệ (phylogenetic tree) mô tả chi tiết vị trí phân bố của chó lưng có xoáy Phú Quốc trong các nhóm đơn bội B, C và E (không mô tả nhóm A) trên cây tiến hóa có gốc Maximum Likelihood được suy luận từ 72 trình tự vùng phân tích là toàn bộ mtDNA có độ dài 12.564 ký tự (khoảng trống bị loại bỏ hoàn toàn). Mô hình tiến hóa là HKY+G+I (-lnL = 25852.5445, ...
Article
Full-text available
Phu Quoc ridgeback dog is an invaluable species in Vietnam. The discovery of high-frequency rare halophytes E4 and E1 in Phu Quoc ridgeback dog while evaluate analyzing its genetic distances is an unexpected event. In this research, the primer-walking strategy was used to sequence the whole mtDNA of Phu Quoc ridgeback dogs carrying E4, B1 and E1 halophytes to explore trace of Phu Quoc ridgeback dog's origin. These mtDNA’s length (16,760 bp for PQ1 and 16,731 for PQ2) fall into the range of 16.7 kb, particularly, 16.760 bp in E4 dogs and 16.731 bp in B1 dogs and is basically similar to the ones of other dog breeds. The difference in length between E4 and B1 haplotype is mainly due to the difference of motif repeat frequency in the control region. The number of genes, starting and ending codes of E4’s mtDNA are similar to other common halophytes. Genetic distances between Phu Quoc ridgeback dogs' E1, E4 haplotypes and Pungsan dogs (EU789662) in the same clade in the phylogenetic tree are 0,072% and 0,24%, respectively, showing that Phu Quoc dogs with E haplotypes are very close relatively to Pungsan dogs in North-Korea. Although belonging to the same haplogroup, the genetic distance between Phu Quoc dogs E1 and E4 haplotype is 0,23%. In the other hand, genetic distances between E1, E4 haplotypes Phu Quoc ridgeback dogs and the closest grey wolves on phylogenetic tree are 0,3% and 0,1%, respectively. This is the first mitochondrial genome of E4 haplotype dogs to be sequenced and analyzed.
... [10] Our research also demonstrates that out of 100 individuals of the Song Ma village dog, 51 haplotypes were discovered in four groups: A, B, C, and E, consistent with previous studies, and this information will help clarify the origins of Vietnam's Song Ma village dog. [15,27] The primary criteria utilized in the exploration of genetic diversity such as Pi, Hd, and Kt. Hd measures the uniqueness of a particular haplotype in the population, which reflects an abundance of haplotype Pi (Fu, 1997) and Kt are haplotype mutation. ...
Article
Background: Vietnam's Song Ma village dog is a breed of indigenous dog found along the Ma River in Vietnam. They have many excellent traits, like their intelligence, agility, friendliness toward humans, and more importantly, they are very easy to train, and have the instinctive hunting capabilities of their wild canine ancestors. However, the exploration of genetic diversity and the origins of Song Ma village dogs in Vietnam have a serious lack of information. It is very difficult to promote the conservation of these dogs. Therefore, urgently needed in order to uncover and better understand the genetic architecture of Song Ma village dogs. Methods: We used 100 blood samples collected in Vietnam to estimate genetic diversity by sequencing the hypervariable-1 region. Results: We reported high levels of genetic diversity in the Song Ma village dog (Pi = 0.00912, Hd = 0.969, and Kt = 5.456). A total of 51 different haplotypes were identified in four haplogroups (A, B, C, and E). Furthermore, Song Ma village dogs were discovered in rare groups such as B1, B5, B6, B10, C2, and E1. Notably, no one in the haplogroup has the haplotypes (D and F). There were 49 single nucleotide polymorphisms, including 48 nucleotide base substitution or insertion changes and six nucleotide indel mutations found in the Song Ma village dog. A phylogenetic tree showed that Song Ma village dogs have a close relationship with dogs that originated from East Asia. Conclusions: This study has provided a valuable platform for breeding and conservation and management of the species in Vietnam.
Article
Full-text available
Dog Domestication The precise details of the domestication and origins of domestic dogs are unclear. Thalmann et al. (p. 871 ; see the cover) analyzed complete mitochondrial genomes from present-day dogs and wolves, as well as 18 fossil canids dating from 1000 to 36,000 years ago from the Old and New Worlds. The data suggest that an ancient, now extinct, central European population of wolves was directly ancestral to domestic dogs. Furthermore, several ancient dogs may represent failed domestication events.
Article
Full-text available
Dogs were present in pre-Columbian America, presumably brought by early human migrants from Asia. Studies of free-ranging village/street dogs have indicated almost total replacement of these original dogs by European dogs, but the extent to which Arctic, North and South American breeds are descendants of the original population remains to be assessed. Using a comprehensive phylogeographic analysis, we traced the origin of the mitochondrial DNA lineages for Inuit, Eskimo and Greenland dogs, Alaskan Malamute, Chihuahua, xoloitzcuintli and perro sín pelo del Peru, by comparing to extensive samples of East Asian (n = 984) and European dogs (n = 639), and previously published pre-Columbian sequences. Evidence for a pre-Columbian origin was found for all these breeds, except Alaskan Malamute for which results were ambigous. No European influence was indicated for the Arctic breeds Inuit, Eskimo and Greenland dog, and North/South American breeds had at most 30% European female lineages, suggesting marginal replacement by European dogs. Genetic continuity through time was shown by the sharing of a unique haplotype between the Mexican breed Chihuahua and ancient Mexican samples. We also analysed free-ranging dogs, confirming limited pre-Columbian ancestry overall, but also identifying pockets of remaining populations with high proportion of indigenous ancestry, and we provide the first DNA-based evidence that the Carolina dog, a free-ranging population in the USA, may have an ancient Asian origin.
Article
Full-text available
Dogs worldwide share a single genetic origin from Asian wolves. While dog and wolf lineages are difficult to separate in terms of nuclear genes, mitochondrial lineages are clearly distinguishable for the two species, offering a good opportunity to evaluate the differences between them. Species identification from DNA is an important tool for wolf conservation in Croatia, and wolf - dog differentiation is necessary for forensic cases, wildlife management and scientific research. The goal of this paper was to provide a data set on Croatian dog and wolf mitochondrial DNA control region sequences, and to research if these sequences can be used as a reference for species identification. We analyzed 281 base pair sequences of the mitochondrial DNA (mtDNA) control region of 20 mixed breed dog blood samples, 91 grey wolf muscle samples and two muscle samples of wolf-like animals. We identified 12 dog and 4 wolf mtDNA control region haplotypes. None of the haplotypes were shared, confirming that mtDNA control region haplotypes can be used to discriminate between Croatian wolves and dogs, and to confirm the maternal ancestry of putative hybrids. The sequences of the two wolf-like animals clearly grouped into a dog cluster.
Article
Full-text available
Studies of mitochondrial DNA (mtDNA) diversity indicate explicitly that dogs were domesticated, probably exclusively, in southern East Asia. However, Southwest Asia (SwAsia) has had poor representation and geographical coverage in these studies. Other studies based on archaeological and genome-wide SNP data have suggested an origin of dogs in SwAsia. Hence, it has been suspected that mtDNA evidence for this scenario may have remained undetected. In the first comprehensive investigation of genetic diversity among SwAsian dogs, we analyzed 582 bp of mtDNA for 345 indigenous dogs from across SwAsia, and compared with 1556 dogs across the Old World. We show that 97.4% of SwAsian dogs carry haplotypes belonging to a universal mtDNA gene pool, but that only a subset of this pool, five of the 10 principal haplogroups, is represented in SwAsia. A high frequency of haplogroup B, potentially signifying a local origin, was not paralleled with the high genetic diversity expected for a center of origin. Meanwhile, 2.6% of the SwAsian dogs carried the rare non-universal haplogroup d2. Thus, mtDNA data give no indication that dogs originated in SwAsia through independent domestication of wolf, but dog-wolf hybridization may have formed the local haplogroup d2 within this region. Southern East Asia remains the only region with virtually full extent of genetic variation, strongly indicating it to be the primary and probably sole center of wolf domestication. An origin of dogs in southern East Asia may have been overlooked by other studies due to a substantial lack of samples from this region.
Article
Full-text available
In the late stages of the global dispersal of dogs, dingoes appear in the Australian archaeological record 3500 years BP, and dogs were one of three domesticates brought with the colonization of Polynesia, but the introduction routes to this region remain unknown. This also relates to questions about human history, such as to what extent the Polynesian culture was introduced with the Austronesian expansion from Taiwan or adopted en route, and whether pre-Neolithic Australia was culturally influenced by the surrounding Neolithic world. We investigate these questions by mapping the distribution of the mtDNA founder haplotypes for dingoes (A29) and ancient Polynesian dogs (Arc1 and Arc2) in samples across Southern East Asia (n = 424) and Island Southeast Asia (n = 219). All three haplotypes were found in South China, Mainland Southeast Asia and Indonesia but absent in Taiwan and the Philippines, and the mtDNA diversity among dingoes indicates an introduction to Australia 4600-18 300 years BP. These results suggest that Australian dingoes and Polynesian dogs originate from dogs introduced to Indonesia via Mainland Southeast Asia before the Neolithic, and not from Taiwan together with the Austronesian expansion. This underscores the complex origins of Polynesian culture and the isolation from Neolithic influence of the pre-Neolithic Australian culture.
Article
Many studies have been reported the origin and evolution of domesticated animals, particularly dogs, however, few have systematically examined the Tibetan Mastiff (TM), a dog that lives primarily in the Qing-Tibet Plateau. Here, we study the origin and evolution of TM based on the population comparison of mtDNA D-loop sequences from TM and other dogs across the world. Intriguingly, non-simultaneous arrivals of Tibetan Mastiffs ancestors to Tibet occurred, which may result from continuous Tibetans’ settlement on Qing-Tibet Plateau supported by archaeological and genetic evidence. High genetic and haplotype diversity and robust haplotypes sharing with other dogs unique to East Asia are observed in Tibetan Mastiff, supporting that it is a very archaic breed derived probably from East Asia.
Article
The mitochondrial DNA (mtDNA) control regions of 125 domestic dogs (Canis familiaris) encompassing 43 breeds, as well as one coyote and two wolves were sequenced and subsequently examined for sequence variation in an effort to construct a reference dog mtDNA data set for forensic analysis. Forty informative variable sites were identified that described 45 haplotypes, 29 of which were observed only once. Substantial variation was found both within and among breeds in the mtDNA derived from tissue, indicating that analysis of the mtDNA derived from dog hairs could be a valuable, discriminating piece of evidence in forensic investigations. The dog data set single nucleotide polymorphisms (SNPs) ranged from having one to six changes on a phylogenetic tree. On average, there were 1.9 character changes for each variable position on the tree. The most variable sites (with four or more changes each, listed from the most changes to the fewest) observed were 15,639 (L=6), 16,672 (L=5), 15,955 (L=4), 15,627 (L=3), 16,431 (L=3), and 16,439 (L=3). These sites were consistent with other reports on variable positions in the dog mtDNA genome. A total of 26 SNPs were chosen to best identify all major clusters in the domestic dog data set. The descriptive analyses revealed that this data set is similar to other published canine data sets and further demonstrates that this domestic dog data set is a useful resource for forensic applications. This reference data set has been compiled and validated against the published dog genetic literature with an aim to aid forensic investigations that seek to incorporate mtDNA sequences and SNPs from trace evidence such as dog hair.
Article
  The 608-bp hypervariable region 1 (HV1) sequences from 36 local dogs were analyzed to characterize the population genetic structure of canid mitochondrial DNA (mtDNA). Sixteen haplotypes were identified. A 417-bp segment of this sequence was compared with GenBank sequences from a geographically representative sample of 201 dogs, two coyotes, and two wolves. Sixty-six haplotypes were identified including 62 found only in domestic dogs. Fourteen of these correspond to the 16 local haplotypes and were among the most frequent haplotypes. The local sample was judged to be representative of the much broader geographic sample. No correlation was observed between local haplotypes and the owner’s characterization of dog breed. A 60-bp variation “hotspot” within the canid HV1 was identified as a potentially valuable molecular tool, particularly for assaying limited or degraded DNA samples.
Article
We sequenced the entire ∼16 kb canine mitochondrial genome (mtGenome) of 100 unrelated domestic dogs (Canis lupus familiaris) and compared these to 246 published sequences to assess hypervariable region I (HVI) haplotype frequencies. We then used all available sequences to identify informative single nucleotide polymorphisms (SNPs) outside of the control region for use in further resolving mtDNA haplotypes corresponding to common HVI haplotypes. Haplotype frequencies in our data set were highly correlated with previous ones (e.g., F(ST)=0.02, r=0.90), suggesting the total data set reasonably reflected the broader dog population. A total of 128 HVI haplotypes was represented. The 10 most common HVI haplotypes (n=184 dogs) represented 53.3% of the sample. We identified a total 71 SNPs in the mtGenomes (external to the control region) that resolved the 10 most common HVI haplotypes into 63 mtGenome subhaplotypes. The random match probability of the dataset based solely on the HVI sequence was 4%, whereas the random match probability of the mtGenome subhaplotypes was <1%. Thus, the panel of 71 SNPs identified in this study represents a useful forensic tool to further resolve the identity of individual dogs from mitochondrial DNA (mtDNA).