Content uploaded by Susan Zaidan
Author content
All content in this area was uploaded by Susan Zaidan on Jan 15, 2022
Content may be subject to copyright.
© 2018 Noor Basim Naser, Dr. Ezeddin At ia Albayyar and Dr. Susa n Abed Zaidan. This ope n access article is distributed
under a Creative Com mons Attribut ion (CC-BY) 3.0 license.
OnLine Journal of Biological Sciences
Original Research Paper
Molecular Detection of Follicle Stimulating Hormone
Receptor Polymorphisms and Luteinizing Hormone Gene
Variations in Primary and Secondary Iraqi Infertile Women
1Noor Basim Naser, 1Dr. Ezeddin Atia Albayyar and 2Dr. Susan Abed Zaidan
1Department of Biology, University of Anbar, Collage of Science, Iraq
2University of Anbar, Collage of Medicine, Iraq
Article history
Received: 17-09-2018
Revised: 24-09-2018
Accepted: 14-11-2018
Corresponding Author:
Noor Basim Naser
Department of Biology,
University of Anbar, Collage of
Science, Iraq
Email: asalafahad@gmail.com
Abstract: The current study aimed to determine the role of hormonal
disturbances in infertility, moreover assessing variations at the molecular
level that could affect this disease. The study examined 90 blood samples,
30 patients with primary infertility, 30 patients with secondary infertility
and 30 healthy women as control. FSH and LH were measured using
Electrochemiluminescence assay. DNA was isolated for molecular
detection of polymorphisms at the nucleotide level (rs6166 and
rs28928870) in FSHR gene using ASO PCR technique and identification
mutations in LH gene using PCR technique followed by sequencing. The
results showed no significant differences in FSH levels (6.95±4.55 mIU/ml,
5.48±4.64 mIU/ml and 5.52±3.07 mIU/ml) between control, primary and
secondary respectively, while LH showed significant differences between
primary and secondary groups (14.23±12.17 mIU/ml and 8.54±5.62
mIU/ml) respectively. A significant positive correlation was found between
FSH and LH. The molecular study showed different polymorphisms at
different positions in LH gene detected by sequencing. Regarding FSHR
polymorphisms our results showed that the OR (95% CI) for AA and AG
genotypes of Asn680Ser polymorphism (rs6166) was 3.32 (0.14-78-49) and
1.00 (0.06-15.99) respectively for primary infertility. Moreover, the OR
(95% CI) for AA and AG of this polymorphism was 1.00 (0.07-17.59) and
3.0 (0.13-70.59) respectively for secondary infertility. While regarding
Thr449Ile (rs28928870) only the wild type was detected in the studied
group. In conclusion, AG genotype ofAsn680Ser is more prevalent in the
Iraqi studied women. Furthermore, A allele is a risk factor for the disease as
the (OR: 1.49 95% CI: 0.44-5.03) for the primary group and (OR: 1.22 95%
CI: 0.35-4.23) for secondary group.
Keywords: Infertility, FSH, LH, Polymorphisms
Introduction
Infertility according to the World Health
Organization is "a disease of the reproductive system
defined by the failure to achieve a clinical pregnancy
after 12 months or more of regular unprotected sexual
intercourse" (Zegers-Hochschild et al., 2009). It has been
estimated that infertility of couples affect 10-15% of the
general population (Ekwere et al., 2007). Infertility in
women can be divided into two groups; primary infertility
in couples who have never been conceived and secondary
infertility that is related to couples who have previously
conceived and have difficulty in conceiving again. This
group includes full term pregnancy and also miscarriages,
abortions etc. (Sharma et al., 2011). Previous studies
discovered number of causes of female infertility and the
most important ones were menstrual disorders, impaired
ovulation, uterine causes, tubal factors and cervical
causes (Masoumi et al., 2015). The primary fertility
hormones that affect the reproductive function are
follicle stimulating hormone and luteinizing hormone.
These gonadotropins are the key drivers of the menstrual
cycle. Follicular growth and maturation depends on the
joint action between these gonadotropins. FSH is well
Noor Basim Naser et al. / OnLin e Journal of Bio logical Sciences 2018, 18 (4) : 435.441
DOI: 10.3844/ojbsci.2018.435.441
436
known as it is the responsible of ovarian follicle growth
and maturation. LH main action is ovulation induction and
acts on theca cells to induce androgen substrate for
estrogen conversion by the aromatase system (Filicori and
Cognigni, 2001). In the past years different gene
mutations or polymorphisms had been identified that
result in or are linked to infertility. Thus the causes of
this disease could be at the molecular level or even
inherited (Matzuk and Lamb, 2008). FSH receptor is
important and crucial for FSH biological activity. Thus
Identification different activating and inactivating
mutations and SNPs in the FSHR gene and associate
them with some respective phenotypes such as PCOS,
Premature Ovarian Failure POF and amenorrhea suggest
that receptor function is impaired resulting in infertility.
These mutations or SNPs could alter the receptor
structure and result in the inability of binding between
hormone and its receptor (Desai et al., 2013). On the
other hand LHB G1502A polymorphism can be involved
in the predisposition to infertility and minimal/mild
endometriosis-associated infertility, although
endometriosis might be only a coincidental finding along
with infertility (Mafra et al., 2010). This study aimed to
evaluate FSH and LH levels among infertile and fertile
women and further investigation of the molecular
changes in DNA bands of LH gene and detection of two
SNPs in FSHR gene (rs6166) and (rs28928870).
Materials and Methods
A case-control study was conducted in Fallujah city
involved a total of 90 women. They were divided into
three groups; 30 women with primary infertility, 30 with
secondary infertility and 30 as control group. 5 ml of
venous blood was collected for both hormonal analysis
and molecular detection.
FSH and LH levels were measured by using
electrochemiluminscence assay. 24 µL and 20 µL of sample
for both FSH and LH were used for determination. The
Elecys assay uses the principle of the sandwich test
DNA was extracted from leukocyte and amplified
with primers in Table 1 using conventional PCR for LH
gene that was further sequenced and Allele Specific
Oligonucleotide PCR technique for FSHR gene
polymorphisms. The PCR end product was then
electrophoresed with 2%agarose gel and the bands were
visualized under UV light.
Statistical Analysis: Statistical analysis was used
depending on Complete Randomized Design (CRD)
and by using means comparison with Least Significant
Difference (L.S.D.) test. Correlation coefficient and
relation between variables was also measured by
using ready SPSS program version 23. Genotype
frequency and allele frequency were determined using
Winpepi compare 2.
Table 1: Primers used in this study
Gene Primer
FSHR rs6166 Fw.t:GGGACAAGTATGTAAGTGGAACCTT
Fm:GGGACAAGTATGTAAGTGGAACCTC
R:ACTGTGTCCAAAGCAAAGAT
FSHR Fw.t:AGCTCACTGGCAAAGACTG
rs28928870 Fm: AGCTCACTGGCAAAGACTA
R:GTGATCCTAACTACCAGCCA
LH 1 F:GGATGGAGATGCTCCAGGTA
R:CCTGAGGTGGCAGCATCT
LH 2 F:CCTCAGGCACATGCTCATT
R:CCTTTATTGTGGGAGGATCG
Results
Table 2 shows the mean ± S.D for FSH and LH
concentrations. Mean ± S.D for FSH was 6.95±4.55
mIU/ml, 5.48±4.64 mIU/ml and 5.52±3.07 mIU/ml in
control, primary and secondary group respectively. No
significant differences were found in FSH level among
the three groups. Mean ± S.D for LH was 10.36±12.62
mIU/ml, 14.23±12.17 mIU/ml and 8.54±5.62 mIU/ml in
control, primary and secondary groups respectively.
There were not significant differences in LH levels
among the three groups; except for primary and
secondary group where the mean difference was
statically significant with higher Mean ± S.D was in
primary group (p = 0.037). FSH showed significant
positive correlation with LH (.496**) (Data not shown).
Results of direct sequencing for LH gene showed
different polymorphisms in different positions. G/A
polymorphism which is a transition mutation had the
higher percent of frequency. Both C/T at position 159
and G/A at positions (67, 135 and 230) were found in
control and primary groups and associated with elevated
LH levels, Table 3.
The separated bands of FSHR gene for Asn680Ser
polymorphism are shown in Fig. 1. The genotype
frequency for rs6166 between control and primary
group, then between control and secondary group has
been calculated. FSHR polymorphic variant (AA, AG
and GG) were (0, 90% and 10%) respectively in the
control group and were (10%, 90% and 0) respectively in
the primary group. The Odd Ratio (OR) for AA and AG
genotypes were (OR:3.32 95%CI:0.14-78.49) and
(OR:1.00 95%CI:0.06-15.99) respectively I primary
infertility group. The frequency of allele A and G in
control group were (45%) and (55%) respectively, while
the frequencies in primary group were (55%) and
(45.00%) respectively. The OR for allele A was (OR:
1.49 95%CI:0.44-5.03).
Regarding the comparing between control and
secondary group; the polymorphic variant (AA, AG and
GG) were (0, 100% and 0) respectively. The OR for the
AG genotype was (OR: 3.0 95%CI:0.13-70.59). The
frequency of allele A and G were (50%) and (50%)
respectively in the secondary group. The OR for allele A
was (OR: 1.22 95%CI:0.35-4.23) Table 4.
Noor Basim Naser et al. / OnLin e Journal of Bio logical Sciences 2018, 18 (4) : 435.441
DOI: 10.3844/ojbsci.2018.435.441
437
(A)
(B)
Fig. 1: Gel electrophoresis of PCR end product for rs6166 (A) Samples with the wild type of the SNP (B) samples with the mutant
type of the SNP
(A)
Noor Basim Naser et al. / OnLin e Journal of Bio logical Sciences 2018, 18 (4) : 435.441
DOI: 10.3844/ojbsci.2018.435.441
438
(B)
Fig. 2: Gel electrophoresis of PCR end product for rs28928870 (A) samples with the wild type of the SNP (B) samples the mutant
type of the SNP
Table 2: Mean serum concentrations and standard deviation of FSH and LH
FSH LH
Case Mean ± S.D Mean ± S.D
Control 6.95±4.55a 10.36±12.62a
Primary 5.48±4.64a 14.23±12.17ab
Secondary 5.52±3.07a 8.54±5.62ac
Total 5.98±4.17 11.08±10.80
Table 3: Polymorphisms detected in the LH gene
Polymorphism Type Position Frequency
A/C Transversion 236 2
A/G Transition 98 2
C/T Transition 159 3
G/A Transition 67 3
79 2
96 2
135 3
230 3
570 2
G/C Transversion 61 2
G/T Transversion 127 2
Table 4: Genotype distribution of FSHR rs6166 polymorphism
Group
-------------------------------------------
rs6166 Control Primary OR (95% CI) P value
Genotype AA 0 -10% 3.32 (0.14-78.49) 0.5
AG -90% (90%) 1.00 (0.06-15.99) 0.763
GG -10% 0 0.30 (0.01-7.14) 0.500
Allele frequency, A -45% -55% 1.49 (0.44-5.03) 0.376
G -55% -45% 0.67 (0.20-2.25)
Control Secondary OR (95% CI) P value
Genotype AA 0 0 1.00 (0.07-17.59) 1.00
AG -90% -100% 3.0 (0.13-70.59) 0.526
GG -10% 0 0.33 (0.01-7.84) 0.526
Allele frequency, A -45% -50% 1.22 (0.35-4.23) 0.507
G -55% -50% 0.82 (0.24-2.83)
Noor Basim Naser et al. / OnLin e Journal of Bio logical Sciences 2018, 18 (4) : 435.441
DOI: 10.3844/ojbsci.2018.435.441
439
Regarding the other SNP (rs28928870) in this study,
the PCR end product was electrophoresed with 2%
agarose gel. The separated bands are shown in Fig. 2.
This polymorphism did not show any differences
between groups. Where only the wild type for this
polymorphism was noticed in the three groups in current
study and neither the homo mutant type nor the
heterozygous were found.
Discussion
Our results for FSH were in accordance with
(Al-Fahham and Al-Nowainy, 2016) who noticed that
there were not any significant differences in FSH
concentration among the infertile women and it was
within the normal range. It also in agreement with
(Digban et al., 2017) who noticed that there were not any
significant differences in FSH levels between infertile
and fertile women. He suggested that this could be due
to primary hypogonadism particularly where low
estrogen and progesterone were observed. Primary
hypogonadism characterized by decreased ovarian
functional activity as a result of decreased sex hormone
production which could lead to fail in conceiving.
For LH, our current study agreed with (Al-Fahham and
Al-Nowainy, 2016) in terms of no significant differences
have been found between fertile and infertile women in
LH level. However, high mean LH level in primary
infertile women in our study agreed with (Odiba et al.,
2014) who noticed that serum LH was higher in women
with primary infertility. LH levels higher than the
normal limit predict a problem in a part of the
reproductive system, possibly a disorder of the mechanism
of negative feedback regulation in the hypothalamus by
progesterone and estrogen (Abbott et al., 2006). This
explains that infertility arising from abnormal LH and
FSH serum levels could be caused by a factor that is
responsible for regulation or synthesis of these
hormones such as GnRH which is responsible for their
production, defect in pituitary gland, or even
hypothalamus which controls their production by
releasing GnRH (Nemeskéri et al., 1986).
Regarding LH gene and as the two polymorphisms
was associated with elevated LH levels thus it might
affect its structure further its binding capability to its
receptor, however this require a prospective studies with
larger population to detect this polymorphisms and their
exact effect (Liao et al., 1998). Reported a G1502A
mutation of LHB-subunit gene in only two infertile
women that had endometriosis. An amino acid 102
substitution from Gly to Ser was the result of this
mutation. Since glycine is one of the essential segments
for forming the hydrophobic locales in a protein and
serine has a polar side chain, the interchange of glycine
with serine at amino acid 102 presents a hydrophilic
power in the particle. This could influence the typical
conformation and capacity of LH and thus could be
involved in the pathogenesis of infertility in human. As
this mutation was the only one noticed in the gene
sequence that is responsible for encoding a mature LH, it
is suggested that this mutation could be associated with
female infertility; especially endometriosis correlated
infertility. Moreover, Du et al. (2012) found that the
genotype frequency of the two point mutations Trp8Arg
and Ile15Thr in the LHβ-subunit gene showed
significant differences between fertile and infertile
women and women with both mutations showed the
highest LH level. These mutations might be associated
with menstrual disorders in women. This study suggests
a correlation between these mutation and infertility; thus
they could be a risk factor for women infertility. The
mechanism of this situation could be due to the inability
of binding between mutated LH and its receptor, thus
reducing the biological function of LH.
The current study conflict with (Laven et al., 2003) in
terms of the predominant genotype where he found that
the Ser/Ser 680 was significantly high inanovulatory
infertile women and this variant was correlated with
higher basal FSH levels in comparison with the two
other variants Asn/Ser 680 and Asn/Asn 680, while
patients in our study were have Asn/Ser 680 the
predominant one. This could suggest that this Ser/Ser
680 variant in the FSHR is correlated with diminished
FSH sensitivity. On the other hand, Schmitz et al. (2015)
reported that there were no differences in the frequency
of FSHR polymorphism Asn 680 Ser between women
with endometriosis and infertility and fertile women.
This could be attributed to the Brazilian population
heterogeneity and due to the nature of endometriosis
which is a very heterogeneous disease thus it is hard to
find a polymorphism correlated with it.
In regard to the other SNP, patients and control of our
study were all wild type for this polymorphism. This
disagree with (Vasseur et al., 2003) who found a
heterozygous C/T mutation that result in threonine to
isoleucine substitution at codon 449 in women with
ovarian hyperstimulation syndrome. The binding of FSH
to the mutant receptor was similar to the wild type
receptor; also there were no statistically differences
between the two receptors in terms of response to the
recombinant follicle stimulating hormone. On the other
hand, an increase in cyclic adenosine monophosphate
cAMP was noticed in the mutant receptor in response to
chorionic gonadotropin, while the wild receptor was
insensitive except at elevated levels. This mutation
expands the receptor sensitivity thus it responds to
another ligand; chorionic gonadotropin. Chorionic
gonadotropin fluctuation during gestation suggests that it
was a trigger for the OHSS. This mutation is a highly
conserved residue that is located in the serpentine
domain; Thr residue position 449. The serpentine
consider as a portion responsible for coupling to G
Noor Basim Naser et al. / OnLin e Journal of Bio logical Sciences 2018, 18 (4) : 435.441
DOI: 10.3844/ojbsci.2018.435.441
440
protein. It was referred that the serpentine and
extracellular domain interacts and residues in domains
are involved in the modulation of the binding. This
mutation is probably triggers a conformational change
that influence the extracellular domain.
Conclusion
Hormonal screening in infertile women is
recommended; despite it is not always the main cause of
the disease. Polymorphisms in specific genes that are
associated with the reproductive function like FSHR and
LH particularly could affect the biological activity or the
sensitivity of the hormone, thus affecting ovarian activity
furthermore women fertility. Asn680Ser polymorphism
could have a relationship with the disease, while
Thr449Ile is not. Moreover the AG genotype and A
allele of Asn680Ser could be implicated in both primary
and secondary infertility in the Iraqi studied women.
Acknowledgment
We aknowledge College of Science-University of
Anabr for contribute in this work, also we would like to
appreciate Ass. Prof. Ahmed A. Suleiman for his
assistance in primer design and molecular work
Author’s Contributions
All authors contribute equally in this work
Ethics
The ethical issue for this work was under the
condition of ethics commity of University of Anbar
References
Abbott, D.H., V. Padmanabhan and D.A. Dumesic,
2006. Contributions of androgen and estrogen to
fetal programming of ovarian dysfunction.
Reproductive Biol. Endocrinol., 4: 1-8.
Al-Fahham, A.A. and H.Q. Al-Nowainy, 2016. The role
of FSH, LH and prolactin hormones in female
infertility. Am. J. PharmTech. Res., 6: 110-118.
Desai, S.S., B.S. Roy and S.D. Mahale, 2013. Mutations
and polymorphisms in FSH receptor: Functional
implications in human
reproduction. Reproduction, 146: R235-R248.
DOI: 10.1530/REP-13-0351
Digban, K.A., M.E. Adu, J.D. Jemikalajah and S.
Adama, 2017. Hormonal profile of some infertile
women in bida Nigeria. Libyan J. Med. Sci., 2: 1-5.
Du, J.W., K.Y. Xu, L.Y. Fang and X.L. Qi, 2012.
Association between mutations of the luteinizing
hormone β subunit and female infertility. Molecular
Med. Rep., 5: 473-476.
Ekwere, P.D., E.I. Archibong, E.E. Bassey, J.E. Ekabua
and E.I. Ekanem et al., 2007. Infertility among
Nigerian couples as seen in Calabar. Port. Harcourt.
Med. J., 2: 35-40. DOI: 10.4314/phmedj.v2i1.38890
Filicori, M. and G.E. Cognigni, 2001. Roles and novel
regimens of luteinizing hormone and follicle-
stimulating hormone in ovulation induction. J. Clin.
Endocrinol. Metabolism, 86: 1437-1441.
Laven, J.S., A.G. Mulders, D.A. Suryandari, J. Gromoll
and E. Nieschlag et al., 2003. Follicle-stimulating
hormone receptor polymorphisms in women with
normogonadotropic anovulatory infertility. Fertility
Sterility, 80: 986-992.
DOI: 10.1016/S0015-0282(03)01115-4
Liao, W.X., A.C. Roy, C. Chan, S. Arulkumaran and
S.S. Ratnam, 1998. A new molecular variant of
luteinizing hormone associated with female
infertility. Fertility Sterility, 69: 102-106.
DOI: 10.1016/S0015-0282(97)00445-7
Mafra, F.A., B. Bianco, D.M. Christofolini, Â.M. Souza
and K. Zulli et al., 2010. Luteinizing hormone β-
subunit gene (LHβ) polymorphism in infertility and
endometriosis-associated infertility. Eur. J. Obstetr.
Gynecol. Reproductive Biol., 151: 66-69.
DOI: 10.1016/j.ejogrb.2010.03.022
Masoumi, S.Z., P. Parsa, N. Darvish, S. Mokhtari, M.
Yavangi and G. Roshanaei, 2015. An epidemiologic
survey on the causes of infertility in patients referred
to infertility center in Fatemieh Hospital in
Hamadan. Iran. J. Reproductive Med., 13: 513.
Matzuk, M.M. and D.J. Lamb, 2008. The biology of
infertility: Research advances and clinical
challenges. Nature Med., 14: 1197.
DOI: 10.1038/nm.f.1895
Nemeskéri, A., A. Detta and R.N. Clayton, 1986.
Hypothalamic GnRH and pituitary gonadotroph
relationships during rat fetal life. Exp. Clin.
Endocrinol. Diabetes, 88: 275-284.
DOI: 10.1055/s-0029-1210607
Odiba, A.S., P.E. Joshua, C.Y. Ukegbu and I.
Onosakponome, 2014. Evaluation of the quantitative
expression and correlation between Follicle
Stimulating Hormone (FSH) and Luteinizing
Hormone (LH) during follicular phase in primary
infertile women of reproductive age. IOSR J. Dental
Med. Sci., 13: 60-65.
Schmitz, C.R., C.A.B. de Souza, V.K. Genro, U. Matte
and E. de Conto et al., 2015. LH
(Trp8Arg/Ile15Thr), LHR (insLQ) and FSHR
(Asn680Ser) polymorphisms genotypic prevalence
in women with endometriosis and infertility. J.
Assisted Reproduct. Genet., 32: 991-997.
DOI: 10.1007/s10815-015-0477-3
Noor Basim Naser et al. / OnLin e Journal of Bio logical Sciences 2018, 18 (4) : 435.441
DOI: 10.3844/ojbsci.2018.435.441
441
Sharma, S., M.P. Khinchi, N. Sharma, D. Agrawal and
M.K. Gupta, 2011. Female infertility: An
overview. Int. J. Pharmaceutical Sci. Res., 2: 1-12.
Vasseur, C., P. Rodien, I. Beau, A. Desroches and C.
Gérard et al., 2003. A chorionic gonadotropin–
sensitive mutation in the follicle-stimulating hormone
receptor as a cause of familial gestational
spontaneous ovarian hyperstimulation syndrome.
New England J. Med., 349: 753-759.
DOI: 10.1056/NEJMoa030065
Zegers-Hochschild, F., G.D. Adamson, J. de Mouzon, O.
Ishihara and R. Mansour et al., 2009. International
Committee for Monitoring Assisted Reproductive
Technology (ICMART) and the World Health
Organization (WHO) revised glossary on ART
terminology, 2009. Fertility Sterility, 92: 1520-1524.
DOI: 10.1016/j.fertnstert.2009.09.009
