ArticlePDF Available

Whole-genome sequencing reveals a large deletion in the MITF gene in horses with white spotted coat colour and increased risk of deafness

DOI:10.1111/age.12762
Authors:
J. Henkel
J. Henkel
J. Henkel
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Christa Lafayette at Etalon, Inc.
Christa Lafayette
  • Etalon, Inc.
Samantha Ann Brooks at University of Florida
Samantha Ann Brooks
K. Martin
K. Martin
K. Martin
  • This person is not on ResearchGate, or hasn't claimed this research yet.
Show all 8 authorsHide
Download full-text PDF
Read full-text
Download citation

Abstract and Figures

White spotting phenotypes in horses are highly valued in some breeds. They are quite variable and may range from the common white markings up to completely white horses. EDNRB, KIT, MITF, PAX3 and TRPM1 represent known candidate genes for white spotting phenotypes in horses. For the present study, we investigated an American Paint Horse family segregating a phenotype involving white spotting and blue eyes. Six of eight horses with the white‐spotting phenotype were deaf. We obtained whole‐genome sequence data from an affected horse and specifically searched for structural variants in the known candidate genes. This analysis revealed a heterozygous ~63‐kb deletion spanning exons 6–9 of the MITF gene (chr16:21 503 211–21 566 617). We confirmed the breakpoints of the deletion by PCR and Sanger sequencing. PCR‐based genotyping revealed that all eight available affected horses from the family carried the deletion. The finding of an MITF variant fits well with the syndromic phenotype involving both depigmentation and an increased risk for deafness and corresponds to human Waardenburg syndrome type 2A. Our findings will enable more precise genetic testing for depigmentation phenotypes in horses.
Figures - uploaded by Christa Lafayette
Author content
All figure content in this area was uploaded by Christa Lafayette
Content may be subject to copyright.
Content uploaded by Christa Lafayette
Author content
All content in this area was uploaded by Christa Lafayette on Jan 21, 2019
Content may be subject to copyright.
SHORT COMMUNICATION
Whole-genome sequencing reveals a large deletion in the MITF
gene in horses with white spotted coat colour and increased risk of
deafness
J. Henkel*
†
, C. Lafayette
‡
, S. A. Brooks
§
, K. Martin
‡
, L. Patterson-Rosa
§
, D. Cook
‡
,
V. Jagannathan*
†
and T. Leeb*
†
*Institute of Genetics, Vetsuisse Faculty, University of Bern, 3001, Bern, Switzerland.
†
DermFocus, University of Bern, 3001, Bern,
Switzerland.
‡
Etalon Inc., Menlo Park, CA 94025, USA.
§
Department of Animal Sciences, University of Florida, Gainesville, FL 32611-0910,
USA.
Summary White spotting phenotypes in horses are highly valued in some breeds. They are quite
variable and may range from the common white markings up to completely white horses.
EDNRB,KIT,MITF,PAX3 and TRPM1 represent known candidate genes for white spotting
phenotypes in horses. For the present study, we investigated an American Paint Horse
family segregating a phenotype involving white spotting and blue eyes. Six of eight horses
with the white-spotting phenotype were deaf. We obtained whole-genome sequence data
from an affected horse and specifically searched for structural variants in the known
candidate genes. This analysis revealed a heterozygous ~63-kb deletion spanning exons 6–9
of the MITF gene (chr16:21 503 211–21 566 617). We confirmed the breakpoints of the
deletion by PCR and Sanger sequencing. PCR-based genotyping revealed that all eight
available affected horses from the family carried the deletion. The finding of an MITF
variant fits well with the syndromic phenotype involving both depigmentation and an
increased risk for deafness and corresponds to human Waardenburg syndrome type 2A. Our
findings will enable more precise genetic testing for depigmentation phenotypes in horses.
Keywords Equus caballus, heterogeneity, leucism, melanocyte, pigmentation, splashed
white, structural variant
White spotting in horses and other mammals may result
from an altered embryonic development of the neural crest
melanocyte lineage and a lack of mature melanocytes in the
unpigmented skin areas (‘leucism’). Candidate genes for
such phenotypes in the horse include EDNRB,KIT,MITF,
PAX3 and TRPM1 (Thomas & Erickson 2008; OMIA
000629, 000209, 001688, 000214, 001341).
The horse currently represents the species with the
largest number of molecularly defined white spotting alleles
among domesticated animals. A missense variant in the
EDNRB gene causes the frame overo white spotting pattern
or lethal white foal syndrome if present in heterozygous or
homozygous state respectively (Santschi et al. 1998). Vari-
ants in MITF and PAX3 cause the so-called splashed white
phenotype, which closely resembles human Waardenburg
syndrome (Pingault et al. 2010; Hauswirth et al. 2012,
2013; D€
urig et al. 2017). A variant in the equine TRPM1
gene causes the so-called leopard complex spotting (Bellone
et al. 2013). Furthermore, according to our knowledge, 29
different functional alleles at the equine KIT gene have been
described so far. These include the alleles for sabino-1 and
tobiano spotting as well as an allelic series termed W1–W27
(Brooks & Bailey 2005; Brooks et al. 2007; Haase et al.
2007, 2008, 2009, 2011, 2015; Holl et al. 2010;
Hauswirth et al. 2013; Capomaccio et al. 2017; Hoban
et al. 2018; Table S1).
We studied a family of American Paint horses segregating
for a white spotting phenotype resembling the splashed
white pattern that could not be explained by any of the
previously published white spotting alleles (Fig. 1). We had
access to samples from one affected stallion and eight of his
daughters (Fig. S1). Seven of the daughters also had white
spotting patterns that could not be explained by their
genotypes at the known white spotting variants. One of the
daughters had a regular frame overo phenotype, which was
Address for correspondence
T. Leeb, Institute of Genetics, Vetsuisse Faculty, University of Bern,
Bremgartenstrasse 109a, 3001 Bern, Switzerland.
E-mail: tosso.leeb@vetsuisse.unibe.ch
Accepted for publication 12 December 2018
doi: 10.1111/age.12762
1
©2019 Stichting International Foundation for Animal Genetics
inherited from the dam. The coat colour phenotypes in this
family were quite variable, as all horses carried additional
known white-spotting alleles. All affected horses had white
faces. The amount of body pigmentation was variable and
one of the studied horses was even completely white. At
least six of the affected horses had blue eyes. The quality of
our photos of the two remaining affected horses did not
allow unambiguous determination of their eye colour. Six
out of eight horses with unexplained white spotting
phenotypes were deaf.
We prepared an Illumina TruSeq PCR free genomic DNA
library and re-sequenced the genome of one affected horse
at 199coverage using 2 9150 bp reads on an Illumina
NovaSeq 6000 instrument. Sequencing and read mapping
to the EquCab 3 reference assembly was performed as
previously described (Jagannathan et al. 2018). Data were
deposited at the European Nucleotide Archive (study
accession no. PRJEB14779, sample SAMEA4822838). This
analysis failed to reveal any single nucleotide or small indel
variants in the candidate genes EDNRB,KIT,MITF, PAX3
and TRPM1. To search for large structural variants, we
visually inspected the read alignments for these genes in the
INTEGRATIVE GENOMICS VIEWER (IGV; Robinson et al. 2011).
The analysis revealed a large heterozygous deletion
spanning the last four exons of the MITF gene correspond-
ing to exons 6–9 of the MITF-M transcript isoform (Fig. 2).
Specifically, 63 407 bp were missing (chr16:21 503 211–
21 566 617). There is currently no RefSeq entry for the
equine melanocyte-specific MITF-M transcript isoform
available. We therefore used the accessions JN896378.1
(mRNA) and AFH66983.1 (protein) to analyse the putative
effects of the deletion on the transcript and protein.
Assuming regular splicing and polyadenylation of the
remaining exons, the deletion removes 706 nucleotides
(56%) from the open reading frame (JN896378.1:
c.555_1260del). This includes the codons required to
encode the functionally important bHLH-Zip domain
required for DNA binding. We did not find any other
obvious structural variants in the EDNRB,KIT, PAX3 and
TRPM1 genes.
We designed primers flanking the deletion (TTAGCAA
TAAGCCACTGGTC, TCATTGTGTCCAGGCTGCTG) and con-
firmed the breakpoints of the deletion by PCR and Sanger
sequencing (Fig. 2). A PCR with these primers and ATG360
polymerase (ThermoFisher) was used as diagnostic assay to
genotype additional horses for the deletion. All eight
affected horses from this family, from which genomic DNA
was available, carried the deletion. The phenotype resem-
bling the splashed white pattern with an extremely large
blaze on the head and frequently associated with blue eyes
is similar to the phenotypes of horses with other mutant
MITF alleles. Most of the horses carrying this deletion were
(a) (b)
(c) (d) Figure 1 White spotting phenotype resem-
bling the splashed white pattern. (a, b) This
horse had light blue eyes, a white face, white
legs and a small white belly spot. The horse
was deaf. (c, d) This horse had a more
pronounced white spotting phenotype com-
pared to its full sibling shown in (a) and (b). It
also had light blue eyes and was deaf. Geno-
types at important white spotting loci are
indicated. MITF
del
designates the new MITF
allele identified in this study.
Figure 2 Details of the MITF deletion. (a) A coverage plot of the whole
genome sequence data indicates a heterozygous ~63-kb deletion
comprising exons 6–9 of the MITF gene. (b) Sanger sequencing of a PCR
product from the deletion allele precisely defined the breakpoints of the
deletion (Chr16:21 503 211–21 566 617del, EquCab 3 assembly).
©2019 Stichting International Foundation for Animal Genetics, doi: 10.1111/age.12762
Henkel et al.2
deaf. This confirms earlier observations that horses with a
lack of functional MITF have an increased risk for deafness
(Hauswirth et al. 2012). All deaf horses carried additional
white spotting alleles, which may have exacerbated the
functional impact of the MITF deletion.
In conclusion, our study revealed a large structural
variant at the equine MITF gene, which most likely causes a
splashed white depigmentation phenotype and predisposes
to deafness.
Acknowledgements
The authors would like to thank all involved horse owners
for donating samples and pictures and for sharing pedigree
information of their horses. The authors also wish to thank
Nathalie Besuchet, Muriel Fragni
ere and Sabrina Schenk for
expert technical assistance. The Next Generation Sequenc-
ing Platform of the University of Bern is acknowledged for
performing the whole genome re-sequencing experiments
and the Interfaculty Bioinformatics Unit of the University of
Bern for providing high performance computing infrastruc-
ture. This study was supported by grant 31003A_172964
from the Swiss National Science Foundation.
Conflicts of interest
Christa Lafayette, Katie Martin and Deborah Cook are
affiliated with a genetic testing laboratory offering tests for
white spotting in horses.
References
Bellone R.R., Holl H., Setaluri V. et al. (2013) Evidence for a
retroviral insertion in TRPM1 as the cause of congenital
stationary night blindness and leopard complex spotting in the
horse. PLoS ONE 8, e78280.
Brooks S.A. & Bailey E. (2005) Exon skipping in the KIT gene causes a
Sabinospotting pattern in horses.Mammalian Genome16,893–902.
Brooks S.A., Lear T.L., Adelson D.L. & Bailey E. (2007) A
chromosome inversion near the KIT gene and the Tobiano
spotting pattern in horses. Cytogenetic and Genome Research 119,
225–30.
CapomaccioS., Milanesi M., NocelliC., Giontella A., Verini-Supplizi A.,
Branca M., Silvestrelli M. & Cappelli K. (2017) Splicing site
disruption in the KIT gene as strong candidate for white dominant
phenotype in an Italian Trotter. Animal Genetics 48,727–8.
D€
urig N., Jude R., Jagannathan V. & Leeb T. (2017) A novel MITF
variant in a white American Standardbred foal. Animal Genetics
48, 123–4.
Haase B., Brooks S.A., Schlumbaum A. et al. (2007) Allelic
heterogeneity at the equine KIT locus in dominant white (W)
horses. PLoS Genetics 3, e195.
Haase B., Jude R., Brooks S.A. & Leeb T. (2008) An equine
chromosome 3 inversion is associated with the tobiano spotting
pattern in German horse breeds. Animal Genetics 39, 306–9.
Haase B., Brooks S.A., Tozaki T., Burger D., Poncet P.-A., Rieder S.,
Hasegawa T., Penedo C. & Leeb T. (2009) Seven novel KIT
mutations in horses with white coat colour phenotypes. Animal
Genetics 40, 623–9.
Haase B., Rieder S., Tozaki T., Hasegawa T., Penedo M.C., Jude R. &
Leeb T. (2011) Five novel KIT mutations in horses with white
coat colour phenotypes. Animal Genetics 42, 337–9.
Haase B., Jagannathan V., Rieder S. & Leeb T. (2015) A novel KIT
variant in an Icelandic horse with white-spotted coat colour.
Animal Genetics 46, 466.
Hauswirth R., Haase B., Blatter M. et al. (2012) Mutations in MITF
and PAX3 cause “splashed white” and other white spotting
phenotypes in horses. PLoS Genetics 8, e1002653.
Hauswirth R., Jude R., Haase B. et al. (2013) Novel variants in the
KIT and PAX3 genes in horses with white-spotted coat colour
phenotypes. Animal Genetics 44, 763–5.
Hoban R., Castle K., Hamilton N. & Haase B. (2018) Novel KIT
variants for dominant white in the Australian horse population.
Animal Genetics 49,99–100.
Holl H., Brooks S. & Bailey E. (2010) De novo mutation of KIT
discovered as a result of a non-hereditary white coat colour
pattern. Animal Genetics 41(Suppl 2), 196–8.
Jagannathan V., Gerber V., Rieder S., Tetens J., Thaller G.,
Dr€
ogem€
uller C. & Leeb T. (2018) Comprehensive characterization
of horse genome variation by whole genome sequencing of 88
horses. Animal Genetics, in press. https://doi.org/10.1111/age.
12753
Pingault V., Ente D., Dastot-Le Moal F., Goossens M., Marlin S. &
Bondurand N. (2010) Review and update of mutations causing
Waardenburg syndrome. Human Mutation 31, 391–406.
Robinson J.T., Thorvaldsd
ottir H., Winckler W., Guttman M.,
Lander E.S., Getz G. & Mesirov J.P. (2011) Integrative genomics
viewer. Nature Biotechnology 29,24–6.
Santschi E.M., Purdy A.K., Valberg S.J., Vrotsos P.D., Kaese H. &
Mickelson J.R. (1998) Endothelin receptor B polymorphism
associated with lethal white foal syndrome in horses. Mammalian
Genome 9, 306–9.
Thomas A.J. & Erickson C.A. (2008) The making of a melanocyte:
the specification of melanoblasts from the neural crest. Pigment
Cell & Melanoma Research 21, 598–610.
Supporting information
Additional supporting information may be found online in
the Supporting Information section at the end of the article.
Figure S1 Pedigree of the studied American Paint Horse
family.
Table S1 Variants, horses and their genotypes.
©2019 Stichting International Foundation for Animal Genetics, doi: 10.1111/age.12762
Equine MITF deletion 3
... Among domesticated mammals, the horse (Equus caballus) currently possesses the most variants associated with white spotting patterns (Henkel et al., 2019). Forty-three genetic variants, mostly located in the KIT proto-oncogene, receptor tyrosine kinase (KIT) and the melanocyte inducing transcription factor (MITF) genes, are implicated in white spotting and depigmentation phenotypes in the horse (Brooks et al., 2008;Brooks & Bailey, 2005;Dürig et al., 2017;Haase et al., 2007;Haase et al., 2009;Haase et al., 2011;Haase et al., 2015;Hauswirth et al., 2012;Hauswirth et al., 2013;Holl et al., 2010;Holl et al., 2017;Martin et al., 2020;Metallinos et al., 1998;Patterson Rosa et al., 2021). ...
... Phenotypes for white spotting alleles can range from small white markings on the extremities, as observed with KIT W20 , to complete white phenotypes in other mutant MITF or multiallelic individuals. The splashed white (SW) phenotype is associated with variants in two genes, MITF and PAX3, and is phenotypically similar to the human Waardenburg syndrome (Dürig et al., 2017;Hauswirth et al., 2012;Hauswirth et al., 2013;Henkel et al., 2019;Magdesian et al., 2020;Pingault et al., 2010). MITF variants have also been associated to diminished or lacking auditory response in heterozygotes, as in SW5 (Henkel et al., 2019). ...
... The splashed white (SW) phenotype is associated with variants in two genes, MITF and PAX3, and is phenotypically similar to the human Waardenburg syndrome (Dürig et al., 2017;Hauswirth et al., 2012;Hauswirth et al., 2013;Henkel et al., 2019;Magdesian et al., 2020;Pingault et al., 2010). MITF variants have also been associated to diminished or lacking auditory response in heterozygotes, as in SW5 (Henkel et al., 2019). ...
... Table S4: Allele frequencies for each coat color locus analyzed in this study after filtering for relatedness across breeds. References [41,42] are cited in the supplementary materials. ...
Breed Distribution and Allele Frequencies of Base Coat Color, Dilution, and White Patterning Variants across 28 Horse Breeds
Article
Full-text available
  • Sep 2022
Since domestication, horses have been selectively bred for various coat colors and white spotting patterns. To investigate breed distribution, allele frequencies, and potential lethal variants for recommendations on genetic testing, 29 variants within 14 genes were investigated in 11,281 horses from 28 breeds. The recessive chestnut ea allele in melanocortin 1 receptor (MC1R) (p.D84N) was identified in four breeds: Knabstrupper, Paint Horse, Percheron, and Quarter Horse. After filtering for relatedness, ea allele frequency in Knabstruppers was estimated at 0.035, thus illustrating the importance of testing for mate selection for base coat color. The Rocky Mountain Horse breed had the highest allele frequency for two of the dilution variants under investigation (Za.f. = 0.32 and Cha.f. = 0.026); marker-assisted selection in this breed could aid in the production of horses with desirable dilute coats with less severe ocular anomalies caused by the silver (Z) allele. With regard to white patterning, nine horses homozygous for the paired box 3 (PAX3) splashed white 2 (SW2) allele (p.C70Y) and six horses homozygous for the KIT proto-oncogene, receptor tyrosine kinase (KIT) sabino 1 (SB1) allele (ECA3g.79544206A>T) were identified, thus determining they are rare and confirming that homozygosity for SW2 is not embryonic lethal. The KIT dominant white 20 (W20) allele (p.R682H) was identified in all but three breeds: Arabian (n = 151), Icelandic Horse (n = 66), and Norwegian Fjord Horse (n = 90). The role of W20 in pigmentation across breeds is not well understood; given the different selection regimes of the breeds investigated, these data provide justification for further evaluating the functional role of this allele in pigmentation. Here, we present the largest dataset reported for coat color variants in horses to date, and these data highlight the importance of breed-specific studies to inform on the proper use of marker-assisted selection and to develop hypotheses related to pigmentation for further testing in horses.
... MITF has been shown to affect pigmentation in cattle [41][42][43][44], mice [45][46][47], horses [48][49][50][51], dogs [52,53], humans [54,55], and ducks [56]. MITF belongs to the basic helix-loop-helixleucine zipper (bHLHZip) family of proteins. ...
Genome-Wide Analysis Identifies Candidate Genes Encoding Beak Color of Duck
Article
Full-text available
  • Jul 2022
Beak color diversity is a broadly occurring phenomenon in birds. Here, we used ducks to identify candidate genes for yellow, black, and spotted beaks. For this, an F2 population consisting of 275 ducks was genotyped using whole genome resequencing containing 12.6 M single-nucleotide polymorphisms (SNPs) and three beak colors. Genome-wide association studies (GWAS) was used to identify the candidate and potential SNPs for three beak colors in ducks (yellow, spotted, and black). The results showed that 2753 significant SNPs were associated with black beaks, 7462 with yellow, and 17 potential SNPs with spotted beaks. Based on SNP annotation, MITF, EDNRB2, members of the POU family, and the SLC superfamily were the candidate genes regulating pigmentation. Meanwhile, isoforms MITF-M and EDNRB2 were significantly different between black and yellow beaks. MITF and EDNRB2 likely play a synergistic role in the regulation of melanin synthesis, and their mutations contribute to phenotypic differences in beak melanin deposition among individuals. This study provides new insights into genetic factors that may influence the diversity of beak color.
... Commercial genotyping for variants causing white patterning phenotypes (Splashed White 1-6, Sabino-1, Tobiano, Lethal White Overo, Leopard Complex Spotting, Pattern-1, Grey, W5, W10, W20, and W22) was conducted at the VGL (https://vgl.ucdav is.edu/ panel/ full-coat-color -patte rn-panel) Brooks et al., 2007;Brooks & Bailey, 2005;Dürig et al., 2017;Haase et al., 2009;Hauswirth et al., 2012Hauswirth et al., , 2013Henkel et al., 2019;Holl et al., 2016;Magdesian et al., 2020;Metallinos et al., 1998;Rosengren Pielberg et al., 2008). Due to the association between numerous KIT proto-oncogene, receptor tyrosine kinase (KIT) variants and similar white patterns in horses, the remaining known KIT variants were also screened. ...
... In most vertebrates, melanocytes mainly exist in the epidermis and hair bulb, which produce eumelanin and phaeomelanin to protect the skin from sunburn (Chang et al., 2017) and allow for the generation of diverse skin, hair, and feather colors (Morgan et al., 2018;Anello et al., 2019;Domyan et al., 2019;Henkel et al., 2019;Hofstetter et al., 2019). In blackboned chicken, the melanocytes are not confined in the epidermis, and also widely located in the dermis and inner organs (Dorshorst et al., 2010). ...
Melanocytes in black-boned chicken have immune contribution under infectious bursal disease virus infection
Article
Full-text available
In black-boned chicken, melanocytes are widely distributed in their inner organs. However, the roles of these cells are not fully elucidated. In this study, we used 3-week-old female Silky Fowl to investigate the functions of melanocytes under infection with infectious bursal disease virus (IBDV). We found the melanocytes in the bursa of Fabricius involved in IBDV infection shown as abundant melanin were transported into the nodule and lamina propria where obvious apoptotic cells and higher expression of BAX were detected. Genes related to the toll-like receptor (TLR) signaling pathway were highly detected by quantitative PCR, including TLR1, TLR3, TLR4, TLR15, myeloid differential protein-88, interferon-α, and interferon-β. We then isolated and infected primary melanocytes with IBDV in vitro and found that higher expressions of immune genes were detected at 24 and 48 h after infection; the up-regulated innate and adaptive immune genes were involved in the pathogenesis of IBDV infection, including TLR3, TLR7, interleukin 15 (IL15), IL18, IL1rap, CD7, BG2, ERAP1, and SLA2. These changes in gene expression were highly associated with microtubule-based movement, antigen processing and presentation, defense against viruses, and innate immune responses. Our results indicated that the widely distributed melanocytes in Silky Fowl could migrate to play important innate immune roles during virus infection.
... Não se observou perda fetal. Os brancos dominantes não são letais pós-desenvolvimento nem representam problemas de saúde para o animal, inclusive em suas variedades completamente brancas 10,14,16,26 . ...
Atualizações na Genética da Pelagem Equina
Article
Full-text available
  • Dec 2020
The knowledge about horse coat color genetics has several applications, ranging from selection of desirable characteristics, understanding of the domestication process and as an auxiliary diagnosis in the clinic. It is essential for the veterinary professional to have a basic understanding of the genetic and functional mechanisms of the coatings, to better provide patient care and help breeders/owners of horses. However, currently the literature on coat genetics in Portuguese is out-of-date, and many unfounded prejudices continue to be disseminated due to the lack of scientific knowledge. This article covers the major topics on horse coat color genetics, addressing phenotypic characteristics, detrimental pleiotropies and physiological mechanisms related to the coat of domestic horses.
... Previous investigations found that MC1R c.280_285del6 was more frequently presented in black rabbits, c.304_333del30 was recessive red/yellow, and c.[124A;125_130del6] was connected with Japanese brindling coat color [6,7,30]. The MITF gene polymorphism is known to be associated with the black and white colors in mice [31], pigs [32], cattle [33], horses [34], chickens [35], ducks [36], llamas [37], and so on. In this study, three SNPs (g.232587A < G, g.232650C < G, g.232766A < T) were found in the TB, SG, and SW breeds, and polymorphism distribution of the g.232587A < G sites were significantly different between TBs and SGs (p < 0.01). ...
Analysis of MC1R, MITF, TYR, TYRP1, and MLPH Genes Polymorphism in Four Rabbit Breeds with Different Coat Colors
Article
Full-text available
  • Jan 2021
Pigmentation genes such as MC1R, MITF, TYR, TYRP1, and MLPH play a major role in rabbit coat color. To understand the genotypic profile underlying coat color in indigenous Chinese rabbit breeds, portions of the above-mentioned genes were amplified and variations in them were analyzed by DNA sequencing. Based on the analysis of 24 Tianfu black rabbits, 24 Sichuan white rabbits, 24 Sichuan gray rabbits, and 24 Fujian yellow rabbits, two indels in MC1R, three SNPs in MITF, five SNPs (single nucleotide polymorphisms) in TYR, one SNP in TYRP1, and three SNPs in MLPH were discovered. These variations have low-to-moderate polymorphism, and there are significant differences in their distribution among the different breeds (p < 0.05). These results provide more information regarding the genetic background of these native rabbit breeds and reveal their high-quality genetic resources.
Réflexions éthiques sur la dignité et le bien-être des chevaux et autres équidés - Pistes pour une meilleure protection
Book
Full-text available
  • Jun 2022
The notion of ethics undoubtedly plays an important role in our society. It evolves and differs according to the sensitivity of the environment, but doesn’t bringing together virtuous principles aimed at an ideal and absolute harmony, which we know is impossible to achieve. Even so, it behoves us – and it is our moral responsibility – to question the choices we make through our freedom to do right or wrong. Moreover, legal rules evolve along with the mores of a society and do not, themselves, have a moral character. Should we therefore only apply the laws of the moment and consider that anything that is not forbidden remains implicitly allowed? Or, on the contrary, are we capable of going beyond mere legality and asking ourselves: if we want to do what’s right, or avoid doing what’s wrong, how can we adjust our behaviour? If we know what consequences a decision may have on the interests of those around us (humans and equids), what should we do or not do? Is it worse to not do what we should do, compared to doing what we should not? The Swiss Horse Industry Council and Administration, COFICHEV (formerly the Swiss Horse Industry Administration, OFiChev), instigated a discussion concerning the most essential ethical requirements. These discussions led to the realisa-tion that there was a significant need for information and communication on such topics. For this reason, the COFICHEV analysed a number of current ethical issues and published an initial status overview as well as future perspectives (Poncet et al, 2011a, 2011b). Ten years later, that report has now been updated, taking into account the most recent relevant scientific publications (Poncet et al, 2022). This Summary Report covers the full text’s structure and its most notable points. Readers interested in more in-depth knowledge may consult the full version and delve into the details of the conclusions and recommendations. There, they will also find all necessary bibliographical references for understanding these complex subjects, as well as illustrations. In general, the editors use the term “horse” to refer to the various breeds and types of domestic horses and ponies belong-ing to the species Equus caballus. The terms equids and equine refer to all modern, domestic members of the genus Equus, including horses, donkeys, and hybrids. Inclusive language has been used as much as possible. However, in order to make an already difficult scientific and specialised subject intelligible and easier to read, the editors have retained the style rule that permits the generic masculine gender (he/him/his) to refer to both sexes. To further avoid complicating the text, they have also opted to not include any doublets, typographical symbols, or marks that interrupt standard words of the language.
Congenital, familial, and genetic disorders
Chapter
  • May 2022
These diseases are presented together here because there is a proven, suspected or possible relationship with the patients’ genotype, even though in utero insults can be responsible for some of the syndromes. Thus most diseases are acquired or inherited and congenital, or are early or late delayed and inherited. As the full nucleic and mitochondrial genomes for our large animal species are unravelled more consistent and precise genetic coding can be applied to the diagnosis of these disorders through genetic screening that is more widely available nowdays. The diseases are ordered to follow the anatomic groupings: diffuse brain, forebrain, brainstem, cerebellum, spinal cord, peripheral nerves, neuromuscular junction, muscle.
Identification of W13 in the American Miniature Horse and Shetland Pony Populations
Article
Full-text available
  • Dec 2021
Coat color is a trait of economic significance in horses. Variants in seven genes have been documented to cause white patterning in horses. Of the 34 variants that have been identified in KIT proto-oncogene, receptor tyrosine kinase (KIT), 27 have only been reported in a single individual or family and thus not all are routinely offered for genetic testing. Therefore, to enable proper use of marker-assisted selection, determining breed specificity for these alleles is warranted. Screening 19 unregistered all-white Shetland ponies for 16 white patterning markers identified 14 individuals whose phenotype could not be explained by testing results. In evaluating other known dominant white variants, 14 horses were heterozygous for W13. W13 was previously only reported in two quarter horses and a family of Australian miniature horses. Genotyping known white spotting variants in 30 owner-reported white animals (25 Miniature Horses and five Shetland ponies) identified two additional W13/N American Miniature Horses. The estimated allele frequency of W13 in the American Miniature Horse was 0.0063 (79 N/N, 1 W13/N) and the allele was not detected in a random sample (n = 59) of Shetland ponies. No homozygous W13 individuals were identified and W13/N ponies had a similar all-white coat with pink skin phenotype, regardless of the other white spotting variants present, demonstrating that W13 results in a Mendelian inherited dominant white phenotype and homozygosity is likely lethal. These findings document the presence of W13 in the American Miniature Horse and Shetland pony populations at a low frequency and illustrate the importance of testing for this variant in additional breeds.
Comprehensive characterization of horse genome variation by whole‐genome sequencing of 88 horses
Article
Full-text available
  • Dec 2018
Whole‐genome sequencing studies are vital to gain a thorough understanding of genomic variation. Here, we summarize the results of a whole‐genome sequencing study comprising 88 horses and ponies from diverse breeds at 19.1× average coverage. The paired‐end reads were mapped to the current EquCab3.0 horse reference genome assembly, and we identified approximately 23.5 million single nucleotide variants and 2.3 million short indel variants. Our dataset included at least 7 million variants that were not previously reported. On average, each individual horse genome carried ∼5.7 million single nucleotides and 0.8 million small indel variants with respect to the reference genome assembly. The variants were functionally annotated. We provide two examples for potentially deleterious recessive alleles that were identified in a heterozygous state in individual genome sequences. Appropriate management of such deleterious recessive alleles in horse breeding programs should help to improve fertility and reduce the prevalence of heritable diseases. This comprehensive dataset has been made publicly available, will represent a valuable resource for future horse genetic studies and supports the goal of accelerating the rates of genetic gain in domestic horse.
Evidence for a Retroviral Insertion in TRPM1 as the Cause of Congenital Stationary Night Blindness and Leopard Complex Spotting in the Horse
Article
Full-text available
Leopard complex spotting is a group of white spotting patterns in horses caused by an incompletely dominant gene (LP) where homozygotes (LP/LP) are also affected with congenital stationary night blindness. Previous studies implicated Transient Receptor Potential Cation Channel, Subfamily M, Member 1 (TRPM1) as the best candidate gene for both CSNB and LP. RNA-Seq data pinpointed a 1378 bp insertion in intron 1 of TRPM1 as the potential cause. This insertion, a long terminal repeat (LTR) of an endogenous retrovirus, was completely associated with LP, testing 511 horses (χ(2)=1022.00, p<0.0005), and CSNB, testing 43 horses (χ(2)=43, p<0.0005). The LTR was shown to disrupt TRPM1 transcription by premature poly-adenylation. Furthermore, while deleterious transposable element insertions should be quickly selected against the identification of this insertion in three ancient DNA samples suggests it has been maintained in the horse gene pool for at least 17,000 years. This study represents the first description of an LTR insertion being associated with both a pigmentation phenotype and an eye disorder.
Novel variants in the KIT and PAX3 genes in horses with white-spotted coat colour phenotypes
Article
Full-text available
Variants in the EDNRB, KIT, MITF, PAX3 and TRPM1 genes are known to cause white spotting phenotypes in horses, which can range from the common white markings up to completely white horses. In this study, we investigated these candidate genes in 169 horses with white spotting phenotypes not explained by the previously described variants. We identified a novel missense variant, PAX3:p.Pro32Arg, in Appaloosa horses with a splashed white phenotype in addition to their leopard complex spotting patterns. We also found three novel variants in the KIT gene. The splice site variant c.1346+1G>A occurred in a Swiss Warmblood horse with a pronounced depigmentation phenotype. The missense variant p.Tyr441Cys was present in several part-bred Arabians with sabino-like depigmentation phenotypes. Finally, we provide evidence suggesting that the common and widely distributed KIT:p.Arg682His variant has a very subtle white-increasing effect, which is much less pronounced than the effect of the other described KIT variants. We termed the new KIT variants W18-W20 to provide a simple and unambiguous nomenclature for future genetic testing applications.
Integrative genomics viewer
Article
Rapid improvements in sequencing and array-based platforms are resulting in a flood of diverse genome-wide data, including data from exome and whole-genome sequencing, epigenetic surveys, expression profiling of coding and noncoding RNAs, single nucleotide polymorphism (SNP) and copy number profiling, and functional assays. Analysis of these large, diverse data sets holds the promise of a more comprehensive understanding of the genome and its relation to human disease. Experienced and knowledgeable human review is an essential component of this process, complementing computational approaches. This calls for efficient and intuitive visualization tools able to scale to very large data sets and to flexibly integrate multiple data types, including clinical data. However, the sheer volume and scope of data pose a significant challenge to the development of such tools.
De novo mutation of KIT discovered as a result of a nonhereditary white coat color pattern
Article
SummaryA new dominant white allele was suspected when two Thoroughbred horses with minimal white marking on the coat produced a colt with a large amount of coat depigmentation. Because of its association with similar patterns in other horses, the KIT gene was selected as a candidate gene, and all 21 exons were sequenced in the colt. A novel 5-bp deletion was discovered in exon 3 and was confirmed with allele-specific PCR. The mutation introduced a pre-mature stop codon, resulting in truncation of the protein. The deletion was not present in either parent and is suspected to be responsible for the extensive white coat colour in the colt. Additionally, a previously described missense mutation was detected in exon 14 of both the colt and sire but is not believe to be causative. Parentage testing was conducted as required by The Jockey Club for Thoroughbred registration, and the foal qualified for the stated parentage. This novel deletion in exon 3 is the 12th discovered dominant white allele in the horse.
Review and Update of Mutations Causing Waardenburg Syndrome
Article
Waardenburg syndrome (WS) is characterized by the association of pigmentation abnormalities, including depigmented patches of the skin and hair, vivid blue eyes or heterochromia irides, and sensorineural hearing loss. However, other features such as dystopia canthorum, musculoskeletal abnormalities of the limbs, Hirschsprung disease, or neurological defects are found in subsets of patients and used for the clinical classification of WS. Six genes are involved in this syndrome: PAX3 (encoding the paired box 3 transcription factor), MITF (microphthalmia-associated transcription factor), EDN3 (endothelin 3), EDNRB (endothelin receptor type B), SOX10 (encoding the Sry bOX10 transcription factor), and SNAI2 (snail homolog 2), with different frequencies. In this review we provide an update on all WS genes and set up mutation databases, summarize molecular and functional data available for each of them, and discuss the applications in diagnostics and genetic counseling. Hum Mutat 31, 1–16, 2010. © 2010 Wiley-Liss, Inc.