First Viruses Infecting the Marine Diatom Guinardia delicatula

Abstract

The marine diatom Guinardia delicatula is a cosmopolitan species that dominates seasonal blooms in the English Channel and the North Sea. Several eukaryotic parasites are known to induce the mortality of this species. Here, we report the isolation and characterization of the first viruses that infect G. delicatula. Viruses were isolated from the Western English Channel (SOMLIT-Astan station) during the late summer bloom decline of G. delicatula. A combination of laboratory approaches revealed that these lytic viruses (GdelRNAV) are small tailless particles of 35–38 nm in diameter that replicate in the host cytoplasm where both unordered particles and crystalline arrays are formed. GdelRNAV display a linear single-stranded RNA genome of ~9 kb, including two open reading frames encoding for replication and structural polyproteins. Phylogenetic relationships based on the RNA-dependent-RNA-polymerase gene marker showed that GdelRNAV are new members of the Bacillarnavirus, a monophyletic genus belonging to the order Picornavirales. GdelRNAV are specific to several strains of G. delicatula. They were rapidly and largely produced (<12 h, 9.34 × 10⁴ virions per host cell). Our analysis points out the host's variable viral susceptibilities during the early exponential growth phase. Interestingly, we consistently failed to isolate viruses during spring and early summer while G. delicatula developed important blooms. While our study suggests that viruses do contribute to the decline of G. delicatula's late summer bloom, they may not be the primary mortality agents during the remaining blooms at SOMLIT-Astan. Future studies should focus on the relative contribution of the viral and eukaryotic pathogens to the control of Guinardia's blooms to understand the fate of these prominent organisms in marine systems.

Full text

ORIGINAL RESEARCH
published: 09 January 2019
doi: 10.3389/fmicb.2018.03235
Frontiers in Microbiology | www.frontiersin.org 1January 2019 | Volume 9 | Article 3235
Edited by:
Curtis A. Suttle,
University of British Columbia, Canada
Reviewed by:
Karen Dawn Weynberg,
The University of Queensland,
Australia
Yuji Tomaru,
National Research Institute of
Fisheries and Environment of Inland
Sea (FEIS), Japan
Marli Vlok,
University of British Columbia, Canada
*Correspondence:
Laure Arsenieff
larsenieff@sb-roscoff.fr
Specialty section:
This article was submitted to
Aquatic Microbiology,
a section of the journal
Frontiers in Microbiology
Received: 06 September 2018
Accepted: 12 December 2018
Published: 09 January 2019
Citation:
Arsenieff L, Simon N,
Rigaut-Jalabert F, Le Gall F,
Chaffron S, Corre E, Com E, Bigeard E
and Baudoux A-C (2019) First Viruses
Infecting the Marine Diatom Guinardia
delicatula. Front. Microbiol. 9:3235.
doi: 10.3389/fmicb.2018.03235
First Viruses Infecting the Marine
Diatom Guinardia delicatula
Laure Arsenieff 1
*, Nathalie Simon 1, Fabienne Rigaut-Jalabert 2, Florence Le Gall 1,
Samuel Chaffron 3, Erwan Corre 2, Emmanuelle Com 4,5 , Estelle Bigeard 1and
Anne-Claire Baudoux 1
1Sorbonne Université, CNRS UMR 7144, Diversity and Interactions in Oceanic Plankton - Station Biologique de Roscoff,
Roscoff, France, 2Sorbonne Université, CNRS Fédération de Recherche FR2424 - Station Biologique de Roscoff, Roscoff,
France, 3Laboratoire des Sciences du Numérique de Nantes (LS2N), CNRS UMR 6004 – Université de Nantes, Nantes,
France, 4Univ Rennes, Inserm, EHESP, Irset (Institut de recherche en santé, environnement et travail) - UMR_S 1085,
Rennes, France, 5Protim, Univ Rennes, Rennes, France
The marine diatom Guinardia delicatula is a cosmopolitan species that dominates
seasonal blooms in the English Channel and the North Sea. Several eukaryotic parasites
are known to induce the mortality of this species. Here, we report the isolation and
characterization of the first viruses that infect G.delicatula. Viruses were isolated from the
Western English Channel (SOMLIT-Astan station) during the late summer bloom decline
of G.delicatula. A combination of laboratory approaches revealed that these lytic viruses
(GdelRNAV) are small tailless particles of 35–38 nm in diameter that replicate in the host
cytoplasm where both unordered particles and crystalline arrays are formed. GdelRNAV
display a linear single-stranded RNA genome of ∼9 kb, including two open reading
frames encoding for replication and structural polyproteins. Phylogenetic relationships
based on the RNA-dependent-RNA-polymerase gene marker showed that GdelRNAV
are new members of the Bacillarnavirus, a monophyletic genus belonging to the order
Picornavirales. GdelRNAV are specific to several strains of G.delicatula. They were rapidly
and largely produced (<12 h, 9.34 ×104virions per host cell). Our analysis points
out the host’s variable viral susceptibilities during the early exponential growth phase.
Interestingly, we consistently failed to isolate viruses during spring and early summer
while G.delicatula developed important blooms. While our study suggests that viruses
do contribute to the decline of G.delicatula’s late summer bloom, they may not be the
primary mortality agents during the remaining blooms at SOMLIT-Astan. Future studies
should focus on the relative contribution of the viral and eukaryotic pathogens to the
control of Guinardia’s blooms to understand the fate of these prominent organisms in
marine systems.
Keywords: single-stranded RNA viruses, diatoms, genomics, host-virus dynamics, Western English Channel
INTRODUCTION
Diatoms are a major component of phytoplankton communities. They have a worldwide
distribution (Mann and Droop, 1996; Malviya et al., 2016), occurring in freshwaters and marine
habitats from the poles to the tropics (Takano, 1981; Kellogg and Kellogg, 1996; Sarno et al.,
2005; Hernández-Becerril et al., 2010; Balzano et al., 2017). They are responsible for 35–75% of

Arsenieff et al. Characterization of Guinardia delicatula Viruses
the marine primary production in the oceans (Nelson et al., 1995)
and they play a fundamental role in the transfer of carbon to
consumers (Armbrust, 2009). They are also important drivers
in the ocean’s export production due to their high sinking rate,
thus playing a key-role in the functioning of the biological
carbon pump (Falkowski et al., 1998; Smetacek, 1999). In nutrient
rich coastal ecosystems, diatoms produce recurrent seasonal
successions of species and blooms (Assmy and Smetacek, 2009;
Sommer et al., 2012). The marine diatom genus Guinardia is
described as a considerable contributor to micro-phytoplankton
assemblages along the Atlantic coasts, in the English Channel
(Grall, 1972; Gómez and Souissi, 2007; Guilloux et al., 2013),
North Sea (Wiltshire et al., 2010) and western Irish Sea (Gowen
et al., 1999). Especially, in the German Bight at Helgoland Roads
time series, the bloom-forming species Guinardia delicatula
is one of the most abundant diatom species, with highest
abundances in early summer and autumn. However, a trend
toward an earlier and wider period of development in response to
environmental variables has been detected (Wiltshire et al., 2010;
Schlüter et al., 2012). In the Western English Channel (WEC),
G.delicatula dominates the seasonal cycle production, where
its spring-summer development occurs commonly from May to
August/September (Grall, 1972; Guilloux et al., 2013; Simon et al.,
personal communication).
Decades of research have emphasized the decisive role of
physical factors (e.g., light, turbulence, and sedimentation),
nutrient limitations and predation by zooplankton in pacing
the seasonal development of marine diatoms (Smetacek, 1985;
Sarthou et al., 2005; Schlüter et al., 2012; Sommer et al., 2012).
Parasites have also been identified as potential primary agents
that could shape diatom population dynamics (Tillmann et al.,
1999; Gleason et al., 2015; Scholz et al., 2015). In the literature,
several eukaryotic parasites of the genera Pirsonia (Kühn et al.,
1996), Cryothecomonas (Drebes et al., 1996) and Rhizamoeba
(Kühn, 1996) were described associated with G.delicatula. More
recently, viruses have been identified as mortality agents involved
in the control of diatoms dynamics. Up to date, about 20 diatom
viruses have been described. They are separated into two groups:
the single-stranded RNA (ssRNA) viruses (Shirai et al., 2008;
Tomaru et al., 2009; Kimura and Tomaru, 2015) and the single-
stranded DNA (ssDNA) viruses (Toyoda et al., 2012; Tomaru
et al., 2013b; Kimura and Tomaru, 2015). Viruses of diatoms
are also highly specific to their hosts, with species-specificity
or even strain-specificity (Nagasaki et al., 2004; Tomaru et al.,
2008; Toyoda et al., 2012). Different viruses infecting the diatom
Chaetoceros tenuissimus can display variable environmental
optima suggesting a niche partitioning in the nature (Kimura and
Tomaru, 2017). As a consequence, viruses may control diatoms
over a broad environmental range and play a key role in species or
infra-specific groups successions. Nevertheless, more isolations
and characterizations are needed to better understand the role of
viruses in the regulation of host populations. To our knowledge,
no virus is known to infect G.delicatula.
In this study, we isolated four ssRNA viruses causing lysis
of G. delicatula from the long-term monitoring SOMLIT-Astan
station located off Roscoff (Western English Channel, WEC). The
host range, morphological features, lytic cycle, genome structure
and phylogenetic position of the representative GdelRNAV-
01 (G. delicatula ssRNA virus 01) were fully described. These
viruses are new members of the Bacillarnavirus genus within
the Picornavirales and share common features with other viruses
infecting diatoms. Due to the ecological importance of its host,
this discovery raises new questions about the contribution of
viruses and other parasites to the interaction network associated
with G.delicatula in the WEC.
EXPERIMENTAL PROCEDURES
Growth Conditions of Algal Cultures
The marine diatom G. delicatula RCC3083 has been used in this
study for the isolation of viruses. This xenic clonal strain was
provided by the Roscoff Culture Collection (RCC, http://roscoff-
culture-collection.org/) and was isolated the 19th September
2012 from surface water at the Roscoff Estacade station in the
Western English Channel (48:43:56 N, 3:58:58 W). G.delicatula
RCC3083 was maintained in sterile condition in K+Si medium
(Keller et al., 1987) at 18◦C, under a 12:12 h light:dark cycle of
100 µmol photons·m−2·s−1provided by a white fluorescent light
(Philips Master TL_D 18W/865). These culture conditions were
used for all the following experimentations.
Genetic Variations Among G.delicatula
Strains
Intraspecific variability within G. delicatula was examined in
the SSU-18S, ITS and partial LSU-28S rDNA genes markers.
The primers used were 63F (ACGCTTGTCTCAAAGATTA)
and 1818R (ACGGAAACCTTGTTACGA) (Lepere et al., 2011)
for the 18S, 329F (GTGAACCTGCRGAAGGATCA) (Guillou
et al., 2004) and D1R-R (TATGCTTAAATTCAGCGGGT)
(Lenaers et al., 1989) for the ITS, and D1R-F
(ACCCGCTGAATTTAAGCATA) (Lenaers et al., 1989) and
D3Ca (ACGAACGATTTGCACGTCAG) (Orsini et al., 2002)
for the partial 28S D1-D3 region. Briefly, aliquots (2.25 µL) of G.
delicatula cultures (Table 1) were submitted to 95◦C for 5 min.
The reaction mixture (30 µL final volume) was then added:
Phusion Master Mix (1×final concentration, Thermo Scientific),
3% DMSO and 0.25 µM of each primer. PCR amplifications were
performed with the following conditions: an initial incubation
step at 95◦C for 5 min, followed by 35 or 40 cycles (respectively
for 18S−28S and ITS genes) of denaturation at 95◦C for 1 min,
annealing step for 30 s at 55, 52, and 57◦for the amplifications
of the SSU, ITS, and LSU, respectively, and extension at 72◦C for
1 min 30. The cycles were followed by a final extension step at
72◦C for 10 min. PCR products were sent for Sanger sequencing
to GATC Biotech (https://www.gatc-biotech.com/en/index.html,
Constance, Germany). Sequences were analyzed and aligned
using Geneious 9.1.3.
Temporal Dynamics of G. delicatula
Seasonal variations in abundance of the diatom G.delicatula at
the long-term monitoring station SOMLIT-Astan off Roscoff
(48:46:18 N, 3:58:6 W) were obtained from microscopic counts
data (RESOMAR-Pelagos database, http://abims.sb-roscoff.fr/
pelagos). Briefly, surface seawater (1 meter depth) collected
Frontiers in Microbiology | www.frontiersin.org 2January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
TABLE 1 | Host range of GdelRNAV viral strains: lytic activity recorded within the species Guinardia delicatula and for other phytoplankton species.
Phylum Class Species Strain code Origin of isolation Date of isolation Lysis by
GdelRNAV-01
Lysis by
GdelRNAV-02
Lysis by
GdelRNAV-03
Lysis by
GdelRNAV-04
Bacillariophyta Coscinodiscophyceae Guinardia delicatula RCC3083 Roscoff Estacade, EC 19/09/2012 ++ ++ ++ ++
RCC4834 Penzé estuary, EC 24/05/2015 – – – –
RCC5777 Roscoff-Astan, EC 21/10/2015 – – – –
RCC5778 Roscoff-Astan, EC 21/10/2015 – – – –
RCC5779 Roscoff-Astan, EC 21/10/2015 – – – –
RCC5780 Roscoff-Astan, EC 21/10/2015 – – – –
RCC5781 Roscoff-Astan, EC 21/10/2015 – – – –
RCC5782 Roscoff-Astan, EC 04/11/2015 ++++
RCC5783 Roscoff-Astan, EC 29/04/2016 + + ++ ++
RCC5784 Roscoff-Astan, EC 13/05/2016 ++++
RCC5785 Roscoff-Astan, EC 13/05/2016 +–––
RCC5787 Roscoff-Astan, EC 23/09/2016 ++ ++ ++ ++
RCC5788 Roscoff-Astan, EC 24/10/2016 – – – –
RCC5789 Roscoff-Astan, EC 19/05/2017 – – – –
RCC5790 Roscoff-Astan, EC 02/06/2017 – – – –
Guinardia flaccida RCC3093 Roscoff-Astan, EC 19/09/2012 – – – –
Guinardia striata RCC5792 Roscoff-Astan, EC 09/09/2016 – – – –
RCC5793 Roscoff-Astan, EC 23/09/2016 – – – –
Rhizosolenia sp. RA170220 Roscoff-Astan, EC 20/02/2017 – – – –
Mediophyceae Thalassiosira punctigera RCC4667 Roscoff-Astan, EC 21/10/2015 – – – –
Thalassiosira curviseriata RCC5154 Roscoff-Astan, EC 26/05/2015 – – – –
Thalassiosira sp. RCC4659 Roscoff-Astan, EC 26/05/2015 – – – –
Minidiscus variabilis RCC4657 Roscoff-Astan, EC 26/05/2015 – – – –
Minidiscus comicus RCC4660 Roscoff-Astan, EC 26/05/2015 – – – –
Detonula pumila RCC5794 Roscoff-Astan, EC 13/07/2016 – – – –
Chaetoceros peruvianus RCC2023 Roscoff-Astan, EC 01/09/2010 – – – –
Bacillariophyceae Nitzschia sp. RCC80 Roscoff Estacade, EC 01/06/1997 – – – –
Pseudo-Nitzschia sp. RCC3101 Bay of Concarneau 12/06/2012 – – – –
Miozoa Dinophyceae Prorocentrum micans RCC3046 Penzé estuary, EC 01/01/2006 – – – –
Haptophyta Prymnesiophyceae Phaeocystis sp. RCC1000 MAR4, Marquesas islands 29/10/2004 – – – –
In bold, host strain used for the isolation of GdelRNAV strains. EC, English Channel; RCC, Roscoff culture collection; ++, complete lysis; +, partial lysis (healthy host cells still present after 14 days of inoculation); –, no lysis.
Frontiers in Microbiology | www.frontiersin.org 3January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
bi-monthly was preserved in acidic Lugol’s iodine solution.
After sedimentation in Utermöhl chambers, cell counts
and identifications were performed under an inverted light
microscope (Guilloux et al., 2013).
Isolation of Viruses
Samplings were conducted every fortnight between October 2015
and October 2016 at SOMLIT-Astan station. This station is
representative of the permanently mixed water column of the
Western English Channel (Wafar et al., 1983; L’Helguen et al.,
1996). Seawater samples of 3L were collected at 1 m depth
using a 5 L Niskin bottle. Back in the laboratory, samples were
immediately pre-filtered through a 150 µm pore-size nylon filter
to remove most of the micro- and mesozooplankton. 250 mL
of pre-filtered samples were enriched with F/2 medium (10%
v/v) and 5 mL of culture of G.delicatula RCC3083. After 2
weeks of incubation, the enriched samples were successively
filtered through a GF/F filter (Whatman) and 0.22 µm PES filter
(Whatman) to isolate the viral community.
Aliquot (0.5 mL) of the 0.22 µm-filtered samples were
inoculated into 1.5 mL exponentially growing host culture in 24-
multiwell plates under the host culture conditions as described
above. Untreated host cultures served as controls.
Cultures were inspected by light microscopy 2 weeks after
inoculation. If algal lysis was observed, 3 extinction dilution
cycles were carried out to clone the pathogens (Suttle, 1993).
Briefly, 100 µL aliquots of the lysates were serially diluted in 10-
fold increment in 900 µL of exponentially growing culture of G.
delicatula RCC3083 (900 µL). Lysates in the last dilution before
extinction were transferred to another exponentially growing
culture of G.delicatula RCC3083 and a new filtration on 0.22 µm
was repeated to verify the transferability.
From this procedure, 4 clonal viral isolates lytic to G.delicatula
strain RCC3083 have been obtained: GdelRNAV-01 (RCC5809),
GdelRNAV-02 (RCC5810), GdelRNAV-03 (RCC5811), and
GdelRNAV-04 (RCC5812). They were isolated from natural
samples collected respectively on the 23th September, 26th
August, 09th September, and 24th October 2016. They were
maintained in culture by bimonthly transfers in G.delicatula
RCC3083 under the host culture conditions described previously.
Host Ranges
To study the host ranges of GdelRNAV-01, GdelRNAV-02,
GdelRNAV-03, and GdelRNAV-04, the viral suspensions were
filtered on 0.45 µm PES filter (Whatman) and were added to
29 exponentially growing phytoplankton cultures (10% vol/vol),
including 27 diatom cultures (Table 1). Untreated phytoplankton
cultures served as controls. The experiment has been carried out
in triplicate.
Algal growth and lysis were monitored after 7 and 14 days
post-inoculation (dpi) under light microscopy. After 2 weeks
incubation, phytoplanktonic cultures where no lysis was detected
were not considered as susceptible hosts for these clonal viruses.
Transmission Electronic Microscopy (TEM)
To inspect the replication site of GdelRNAV-01, an exponential
culture of G.delicatula RCC3083 host strain was inoculated with
a fresh 0.45 µm filtered virus lysate (5% vol/vol). Uninfected host
served as control. Aliquots of the cell suspensions were sampled
every 12 h post-inoculation (hpi), and the algal abundances in
the control and infected cultures were monitored by optical
microscopy (Sedgewick Rafter, Hausser Scientific, USA). 10mL
of the aliquots were fixed with 1% glutaraldehyde and stored at
4◦C until treatment. Pluronic F68 (final concentration 0.01%,
Gibco) was added and cells were pelleted by centrifugation.
Samples were rinsed twice in K+Si medium and 0.2 M cacodylate
buffer (pH =7.53) containing 2% of NaCl were added. Samples
were then fixed with 1% OsO4 for 1 h at 4◦C. After three
washings with the cacodylate buffer, samples were progressively
dehydrated in ethanol series (from 30 to 100%). Samples
were embedded in Spurr’s epoxy resin (Low viscosity, Electron
Microscopy Sciences) and were polymerized over a week-end at
60◦C. Thin sections (40–70 nm) were cut using a Leica ultracut
UCT microtome and mounted on copper grids. Sections were
stained with 0.4% uranyl acetate and viewed with a JEOL-JEM
1400 electron microscope (JEOL Ltd., Tokyo, Japan) operating at
80 kV.
Morphological features of the virions were also determined
by TEM. Briefly, a fresh viral lysate of each four viral strains
was filtered through 0.22 µm pore size filter and concentrated by
centrifugation (Vivaspin 50 kDa, Sartorius). Concentrated viral
suspension was negative stained for 40 s using uranyl acetate
(2% w/v) on a copper grid. Appropriate controls (filtrates from
uninfected hosts) have also been examined by TEM.
Growth Experiment
In order to study the virus growth kinetics, triplicates of
exponentially growing cultures of G.delicatula RCC3083 were
inoculated with a fresh 0.1 µm filtered suspension of GdelRNAV-
01 (10% v/v, with a multiplicity of infection of 359.5). An
untreated culture of G.delicatula RCC3083 served as control.
Samples were taken every 12 h for 8 days to monitor host
and virus parameters. Diatom counts were obtained using
a Sedgewick Rafter cell (Hausser Scientific, USA) on an
inverted microscope. Epifluorescence microscopy (U-MNB2
filter, Olympus BX51, Tokyo, Japan) was used to monitor
morphological changes occurring in chloroplasts (using the
fluorescence of Chl a) and in PicoGreen stained nuclei
(Picogreen, final concentration 1×, Molecular Probes).
Viral titer was measured using the extinction dilution method
(Suttle, 1993) and was estimated with the software Most Probable
Number (MPN; version 2.0, Avineon, U.S Environmental
Protection Agency). This experiment was performed in duplicate.
Viral latent period was calculated as the period of time
between the viral inoculation and the first increase in viral titer.
Burst size (number of viral progenies produced per one host cell
lysed) was estimated from the ratio between the increase in viral
titer and the decline in host cell concentration for a given period
(from 72 to 96 h in our case), as:
BS =Vmax −Vmin
Hmax −Hmin
Frontiers in Microbiology | www.frontiersin.org 4January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
where Vmax and Vmin are the maximal and minimal viral
concentrations, respectively, and Hmax and Hmin the maximal
and minimal host abundances.
Virions Thermal Stability
The stability of the virions to temperature was determined by
incubating 0.5 mL of a 0.2 µm filtered GdelRNAV-01 suspension
at −196, −80, −20, 4, 10, 18, 25, 30, 40, 50, and 60◦C. After
24 h, samples were thawed or cooled down for 30 min at room
temperature and inoculated with G.delicatula RCC3083 (10%
v/v) in triplicates in 48-multiwell plates. Cultures were inspected
by light microscopy at 7 and 14 days dpi to detect lysis.
Sensitivity to Chloroform
In order to determine whether GdelRNAV-01 is enveloped by
a lipid membrane, 10% and 50% (v/v) of chloroform were
added to aliquots (1.5 mL) of 0.2 µm filtered lysate. The mixtures
were vigorously homogenized by inversion and incubated for
60 min at room temperature. Chloroform was removed by
centrifugation, 2,200 ×gfor 20 min at room temperature and
the aqueous layers, containing the virions, were transferred
to new tubes. Samples were left overnight for evaporation to
remove any chloroform contamination. Negative controls of
K+Si medium were included. Samples were inoculated with
G.delicatula RCC3083 (10% v/v) in triplicates in 48-multiwell
plates. Cultures were inspected by light microscopy at 7 and 14
days dpi.
Virus Purification
A freshly produced GdelRNAV-01 lysate (500 mL) was filtered
through 0.45 and 0.1 µm PES filters to remove cellular debris
and bacteria. Polyethylene glycol 6000 (PEG, Sigma Aldrich)
was added to the filtrate (final concentration 10% wt/v) and
stored at 4◦C overnight as described in Tomaru et al. (2004).
The mixture was centrifuged at 30,100 ×g, 4◦C, for 2h15
(Avanti J-26XP, Beckman Coulter) and the pellet containing
the viruses was washed with 10 mM phosphate buffer (10 mM
KH2PO4and 10 mM Na2HPO4, pH 7.2). The suspension was
transferred to a Falcon tube (polypropylene) and an equal volume
of chloroform was added. The sample was vigorously vortexed
and centrifuged at 2,200 ×g, for 20 min at room temperature.
The aqueous layer was recovered and the chloroform procedure
was repeated 7 times. After ultracentrifugation (207,870 ×
g, 4 h, 4◦C, 70 Ti rotor, Optima XPN-80, Beckman Coulter)
of the last aqueous phase, the viral pellet was collected
and resuspended in 500 µL of Nuclease-Free Water (Life
Technologies). This purified virus sample was used for analysis
of nucleic acids, genome sequencing and analyses of structural
proteins.
Viral Nucleic Acids
The nucleic acids (300 µL) of the four viral strain suspensions
were extracted using the Kit MasterPure complete DNA and
RNA purification (Epicenter) according to the manufacturer’s
instructions. This extraction was performed on a purified viral
suspension for GdelRNAV-01 and on non-purified suspensions
of GdelRNA-02, GdelRNA-03 and GdelRNA-04. Around 50 mL
of lysates were filtered through 0.45 µm and 0.1 µm PES filters
and concentrated by centrifugation (Vivaspin 50 kDa, Sartorius).
To determine the nature of viral nucleic acids, enzymatic
digestions of nucleic acids extracts were conducted. Aliquots
of 4 µL were digested with DNase I (final concentration
0.05 U·µL−1, Epicenter) at 37◦C for 1h, with RNase A (final
concentration 0.025 µg·µL−1, Epicenter) or with S1 nuclease
(final concentration 0.03 U·µL−1, Promega) that degrades single
stranded nucleic acids, for 30 min at room temperature. An
untreated aliquot was kept on ice to serve as control. After
incubation, samples were resolved on 1.2% agarose gel, stained
with ethidium bromide and electrophoresed at 100 V for 50 min.
The gel was visualized on Imagequant LAS4000 (GE Healthcare,
Waukesha, WI, USA).
FIGURE 1 | Temporal dynamics of Guinardia delicatula (solid line) and all diatoms (dash line) at SOMLIT-Astan station (Western English Channel) during the September
2015–October 2016 period. All along this period a protocol designed for the isolation of viruses lytic to G. delicatula was applied to seawater samples collected every
fortnight. The arrows point to sampling dates on which the virus strains GdelRNAV-01 to 04 were successfully isolated.
Frontiers in Microbiology | www.frontiersin.org 5January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
The ssRNA viral nucleic acids were converted to cDNA
using the SuperScript III Reverse Transcriptase (Invitrogen)
with random primers (Hexamers, 250 ng/µL) following the
manufacturer’s protocol.
Viral Genome Sequencing and Analyses
The complete viral genome of GdelRNAV-01 was obtained from
a 2 ×150 bp paired-end run sequencing on an Illumina NextSeq
platform performed by Fasteris (https://www.fasteris.com/dna/,
Plan-les-Ouates, Switzerland). A total of 42,872,641 paired reads
of 150 nt were quality trimmed using Trimmomatic v. 0.33
with default parameters (Bolger et al., 2014) and normalized
using the Diginorm script accessible in the Trinity assembler
package (Grabherr et al., 2011). The 443,025 remaining reads
were de novo assembled into scaffolds with SPAdes version 3.11.0
FIGURE 2 | Aspect of healthy cultures of G. delicatula RCC3083 (A,C) and
infected cultures by GdelRNAV-01 (B,D) that show disintegration of host cells.
(A,B) Pictures of the flasks, (C,D) Light microscopy micrographs showing
heathy cells with golden brown plastids (C) or cells totally degraded (D). All
pictures were taken 14 days post-infection. Scale bars on pictures (C,D)
50 µm.
using a combination of Kmer size 21, 33, 55 and 77 (Bankevich
et al., 2012). Scaffolds sequences larger than 8,000 nucleotides
were analyzed by megablast against nr database (release February
2018) and blastx against viral section of nr database (release
February 2018) leading to the detection of a unique scaffold of
9,233 nucleotides matching viral sequences. Genes prediction
was performed using NCBI ORFfinder (https://www.ncbi.nlm.
nih.gov/orffinder/) and validated by NCBI SmartBLAST (http://
blast.ncbi.nlm.nih.gov/smartblast/).
Viral Proteins
An aliquot of purified viral suspension (75 µL) was boiled
in 4×Laemmli buffer (25 µL) for 5 min and incubated on
ice for 30 min. The mixture was then resolved on SDS-PAGE
gel (NuPAGE 4–12% Bis-Tris Protein Gel, Life Technologies)
using an XCell SureLock Mini-Cell (Invitrogen, Carlsbad, CA,
USA) at 200 V for 45 min. After migration, the gel was rinsed
3 times in MilliQ water and stained overnight with ProSieve
EX Safe Stain (Lonza Rockland, Inc). The gel was destained
in MilliQ water baths and visualized with a white light table.
Bands were excised and digested with trypsin for analysis
by mass spectrometry using an Orbitrap instrument (LTQ-
OrbitrpXL, Thermo Scientific) on Protim platform (https://
www.protim.eu/, Rennes, France) as previously described
(Lavigne et al., 2012) (see Supplementary Material). The
mass spectrometry proteomics data have been deposited to
the ProteomeXchange Consortium via the PRIDE (Vizcaíno
et al., 2016) partner repository with the dataset identifier
PXD010967 (project accession) and 10.6019/PXD010967
(project DOI).
Phylogenetic Analysis of ssRNA Viruses
In order to determine the taxonomic position of GdelRNAV-01,
its closest relatives were searched in NCBI non-redundant
database (release 01 February 2018) using the helicase,
RdRp and ORF2 amino acid sequences as query with the
BLASTP tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The
phylogenetic position of GdelRNAV-01 was inferred from
comparative analyses of amino acid sequences encoding the
RNA dependent RNA polymerase (RdRp) domain of the
replicase polyprotein. The sequence of the GdelRNAV-01
RdRp domain was retrieved from the whole genome sequence
using the Basic Local Alignment Search Tool (BLAST, https://
blast.ncbi.nlm.nih.gov/Blast.cgi). RdRp domain sequences of a
selection of Picornavirales that are representative of different
families (International Committee on Taxonomy of Viruses,
ICTV, https://talk.ictvonline.org/) were selected. The sequence
alignment was generated by the MAFFT version 7 program and
the E-INS-I iterative refinement method (https://mafft.cbrc.jp/
alignment/server/, Katoh et al., 2017). A phylogenetic tree was
constructed by maximum likelihood with PhyML 3.0 (http://
www.atgc-montpellier.fr/phyml/, Guindon et al., 2010) with the
automatic model selection by SMS (Lefort et al., 2017) and 1,000
bootstrap replicates. MEGA7 (Kumar et al., 2016) was used to
visualize the final tree.
Frontiers in Microbiology | www.frontiersin.org 6January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
Comparative Analyses of the RdRp Gene
Sequences Between G. delicatula Viruses
Degenerated primers, RdRp_F (TCTTCGTATGCCAGCACA
ACT) and RdRp_R (WAGAGCTCCATGAATCATYCC), were
designed based on the RdRp regions of GdelRNAV-01 and
of Csp03RNAV that infects Chaetoceros sp. strain SS08-C03
(AB639040), using Geneious 9.1.3 (Biomatters Ltd, NZ). These
primers were used to amplify about 500 bp of the RdRp
domains of GdelRNA-02, GdelRNA-03 and GdelRNA-04. The
PCR reaction mixture (25 µL final volume) consisted of 1×
Platinum Taq buffer (final concentration, Invitrogen), 2 mM
MgCl2, 0.2 mM dNTP, 1 µM of each primer, 2U of Platinum Taq
and 1 µL of cDNA. PCR amplifications were performed with the
following conditions: an initial incubation step at 94◦C for 75 s,
followed by 40 cycles of denaturation at 94◦C for 45 s, annealing
step at 56◦C for 45 s and extension at 72◦C for 1 min. The 40
cycles were followed by a final extension step at 72◦C for 9 min.
PCR products were sent to Fasteris (https://www.fasteris.com/
dna/, Plan-les-Ouates, Switzerland) for an enzymatic purification
and for Sanger Sequencing using the degenerated primers
RdRp_F and RdRp_R. The sequence alignment was generated
by the MAFFT version 7.222 available on Geneious 9.1.3
(Biomatters Ltd, NZ).
Biogeography of GdelRNAV-01 in Natural
Environments
To determine the distribution of GdelRNAV-01, environmental
sequences data were downloaded from public databases and
bioinformatics workflows were designed under Galaxy instance
of the ABIMS platform: http://galaxy3.sb-roscoff.fr (Giardine
et al., 2005) in order to search for homologs of GdelRNAV-
01 genome sequences. Briefly, when necessary, data were
trimmed and quality filtered and reads were mapped against
GdelRNAV-01 genome using the Bowtie2 tool with default
parameters (Langmead and Salzberg, 2012). In some cases, the
GdelRNAV-01 genome or RdRp domain was directly blasted
against environmental sequences using Geneious 9.1.3. This was
the case for sequences obtained by Culley et al. (2003, 2006,
2007) and Culley and Steward (2007) with data volume <200
sequences.
Accession Numbers
The nucleotide sequences of the GdelRNAV-01 genome,
GdelRNAV-02, GdelRNAV-03, and GdelRNAV-04 RdRp
domains were deposited in the NCBI database under accession
number MH706768, MH706769, MH706770 and MH706771,
respectively.
FIGURE 3 | Ultrathin sections of Guinardia delicatula RCC3083 and negatively stained GdelRNAV-01 particles obtained by TEM. (A) Healthy control. (B–E) G.
delicatula infected by GdelRNAV-01 at 72 hpi. (C) Crystalline arrays and dispersed viral particles accumulated in the host cytoplasm. (D) Higher magnification of panel
C of GdelRNAV-01 in the host cytoplasm. (E) Negatively stained GdelRNAV-01 particles. Arrows: Crystalline arrays. F, frustule; G, Golgi apparatus; M, mitochondrion;
N, nucleus, CH, chloroplast.
Frontiers in Microbiology | www.frontiersin.org 7January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
Sequences obtained from the eukaryotic nuclear rRNA/ITS for
G. delicatula strains were also deposited in the NCBI database:
RCC3083 (MH712327), RCC4834 (MH712328), RCC5777–
RCC5789 (MH712329–MH712341) for the 18S, RCC3083
(MH712342), RCC4834 (MH712343), RCC5777–RCC5787
(MH712344–MH712354) for the partial 28S and RCC3083
(MH714686), RCC4834 (MH714687), RCC5777–RCC5788
(MH714688–MH714699) for the ITS gene marker.
RESULTS
In situ G. delicatula Dynamics and Cultural
Diversity
During the sampling course (Sept 2015–Oct 2016), we
recorded several blooming episodes of G. delicatula. A
first small peak (2,560 cells·L−1) was detected in October
2015 (Figure 1). In 2016, the diatom bloom that occurred
FIGURE 4 | Infection kinetic of Guinardia delicatula RCC3083 by
GdelRNAV-01. Abundances of diatom hosts in the control culture (black
circles) and in infected cultures (open triangles) were obtained using optical
microscopy. Viral titers (open hexagons) were estimated using the MPN
method. Error bars were estimated based on counts obtained in triplicates of
infected cultures. Gray rectangles represent the dark phases. Pictures
obtained using transmitted-light and epifluorescence microscopy illustrate the
morphology of G. delicatula cells in control and infected cultures at T0 and
Tfinal. With epifluorescence microscopy the red natural fluorescence of
chloroplasts and green fluorescence of PicoGreen stained nucleic acids are
observed. At Tfinal, the green fluorescence is due to the presence of bacteria.
Scale bars: 20 µm.
mid-June was dominated by G.delicatula (86,960 cells·L−1,
84.7% of the total diatom counts) while two smaller
peaks were observed during the end of summer (12,540
cells·L−1on the 28th of July, 8,500 cells·L−1on the 26th of
August).
During the sampling period, a total of 13 new G.delicatula
strains were successfully isolated and maintained in culture
(RCC5777-RCC5790, Table 1). Sequencing of the SSU-18S,
ITS, and partial LSU-28S gene markers revealed very low
variability among strains. For the 18S rDNA gene, the
1,655 bp alignment of the 14 strains indicated 100% of
identity between sequences. The ITS gene sequences (646
bp) of 11 of the strains studied were identical while the
TABLE 2 | GdelRNAV-01 sensitivity to thermal and solvent treatments.
Treatments Sensitivity
TEMPERATURE (◦C)
−196 –
−80 –
−20 –
4 –
10 –
18 –
25 –
30 –
40 –
45 –
50 +/–
55 +
60 +
CHLOROFORM (%)
10 –
50 –
–, no loss of viral infectivity; +, loss of infectivity; +/–, partial loss of infectivity (healthy host
cells still present in the wells 14 days post-inoculation).
FIGURE 5 | Nucleic acids type of GdelRNAV-01 after extraction. Extracts were
treated with DNase treatment, with RNase treatment, or with S1 nuclease
treatment.
Frontiers in Microbiology | www.frontiersin.org 8January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
sequences of RCC4834 (MH714687) and 5783 (MH714694)
differed respectively by 2 and 1 position. Concerning the
28S D1-D3 region, 11 strains had identical sequences (833
bp) while a deletion was detected in the RCC5780 sequence
(MH712347). The 28S D1-D3 region of strains RCC5788
and RCC5789 were not sequenced (strains lost). Strain
RCC5790 was lost before amplification by all three gene
markers.
Viral Isolation
Viruses lytic to G. delicatula RCC3083 were isolated between end
August 2016 and end October 2016. During this period, four
clonal viral strains were successfully isolated and maintained in
culture. The inoculation of these viral isolates into fresh host
cultures caused the clearance of infected cultures after 2 weeks
and led to complete cell degradations (Figure 2).
Host Ranges
Cross infection experiments, using 15 phytoplankton species,
indicated that G.delicatula was the only species lysed by the four
viral isolates. However, all viruses showed clear strain specificity
patterns (Table 1). Besides their isolation host (RCC3083), the
4 viruses infected strains RCC5782, RCC5783, RCC5784, and
RCC5787 (isolated between October 2015 and September 2016).
FIGURE 6 | Schematic genome organization of GdRNAV-01 (9,233 nt). 5′UTR: 5′untranslated region (1,008 nt), 3′UTR: 3′untranslated region (367 nt). The yellow
box indicates the replication polyprotein with Hel: Helicase and RdRp: RNA-dependent RNA polymerase. The gray box represents the capsid proteins (CP) with
domains corresponding to the Rhv_like superfamily interspaced by the Dicistro_VP4, and the CRPV_capsid superfamily. The green box indicates the possible ORFan.
P1 to P5: structural proteins. Segments corresponding to P1 to P5 are not scaled on the genome sequence.
TABLE 3 | Best hits from BLASTP results showing significant alignments with the helicase and RdRp domains and the ORF-2 of GdelRNAV-01.
Score Query cover E-value Identity Accession number
HELICASE BLASTP BEST HITS
Beihai picorna-like virus 4 225 100% 4E-66 98% YP_009333566.1
Chaetoceros sp. RNA virus 3 225 100% 4E-66 98% BAK40203.1
Wenzhou picorna-like virus 50 190 100% 8E-54 76% APG78567.1
Marine RNA virus JP-A 182 100% 4E-51 71% YP_001429581.1
Beihai picorna-like virus 1 176 100% 7E-49 72% YP_009333509.1
RdRp BLASTP BEST HITS
Chaetoceros sp. RNA virus 03 585 100% 0 93% BAK40203.1
Beihai picorna-like virus 4 582 100% 0 92% YP_009333566.1
Wenzhou picorna-like virus 50 490 100% 2E-158 76% APG78567.1
Beihai picorna-like virus 1 491 100% 5E-158 76% YP_009333509.1
Marine RNA virus JP-A 481 100% 1E-154 74% YP_001429581.1
Chaetoceros tenuissimus RNA virus
type-II, isolate SS10-45V
411 95% 8E-129 68% BAP99822.1
Chaetoceros tenuissimus RNA virus
type-II, isolate SS10-39V
411 95% 9E-129 68% BAP99820.1
Chaetoceros tenuissimus RNA virus
type-II, isolate SS10-16V
411 95% 1E-128 68% YP_009111336.1
ORF2 BLASTP BEST HITS
Beihai picorna-like virus 4 1,088 97% 0 70% YP_009333567.1
Chaetoceros sp. RNA virus 03 1,034 89% 0 73% BAK40204.1
Marine RNA virus JP-A 904 99% 0 55% YP_001429582.1
CtenRNAV type-II 894 100% 0 58% YP_009111337.1
CtenRNAV SS10-39V 893 100% 0 58% BAP99821.1
CtenRNAV SS10-45V 892 100% 0 58% BAP99823.1
Beihai picorna-like virus 1 820 90% 0 57% YP_009333510.1
Frontiers in Microbiology | www.frontiersin.org 9January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
GdelRNAV-01 was the only virus able to cause lysis of G.
delicatula RCC5785 (isolated in May 2016). For some host-virus
combinations, lysis was not complete (cells with plastids observed
in addition to empty frustules 14 dpi). Due to a boarder host
range, GdelRNAV-01 that was isolated on the 23rd of September
2016, was chosen for detailed morphological, physiological and
genetic characterization.
Morphological Features of Infected Cells
and GdelRNAV Particles
Thin sections of G.delicatula cells showed clear signs of
degradation of the cell ultrastructure (few remaining organelles,
dispersed traces of cytoplasm) 72 h after the inoculation of
GdelRNAV-01 compared to a healthy host (Figures 3A,B).
GdelRNAV-01 accumulates in the host cytoplasm where it
forms both crystalline arrays and unordered groups of particles
(Figures 3C,D). No viral particle was observed in the control
(Figure 3A).
The TEM examination of GdelRNAV-01 progenies revealed
untailed particles of 35 ±2 nm in diameter (n=173) with a
hexagonal outline suggesting an icosahedral symmetry and the
absence of outer membrane (Figure 3E).
Virions of GdelRNAV-02, GdelRNAV-03, and GdelRNAV-04
displayed the same morphological features as GdelRNAV-01 with
particles diameter of 38 ±2 nm (n=98), 36 ±2 nm (n=105)
and 38 ±1.5 nm (n=97), respectively (data not shown).
Infection Dynamic of GdelRNAV-01
After inoculation of GdelRNAV-01 in cultures of G. delicatula
strain RCC3083, infected cells grew exponentially as in
control cultures until 72 h post-inoculation (5,344 cell·mL−1
in infected cultured, Figure 4). Cell morphology was similar
in infected and control cultures (cells forming colonies
with amoeboid-shaped chloroplasts) (Figure 4, optical
and epifluorescence micrographs). Then, diatom cell
abundance decreased rapidly in infected cultures, with a
stabilization step between night and day measurements. At
the end of the experiment (168 h), diatom abundance in
infected cultures reached 860 cell·mL−1(mean of the three
replicates) and was lower than at T0 (2,140 cell·mL−1).
Nuclei and chloroplasts showed signs of degradation
(rounded-shaped chloroplasts), and broken frustules heavily
colonized by bacteria were observed (Figure 4, optical and
epifluorescence pictures). In comparison, diatom cells in
control culture exhibited an exponential growth during all the
experiment.
The first increase of viral titer occurred at 12 hpi, suggesting
that the latent period is shorter than 12 h. Periods of increase
in virus titer alternated with periods of stagnation suggesting
multiple cycles in spite of the high MOI (multiplicity of
infection).
The burst size, calculated as the number of viral particles
produced per host cell, for a given period, was estimated to be
9.34 ×104infectious units·cell−1.
Stability of the Viral Particles
The viral suspension of GdelRNAV-01 has been exposed during
24 h to a broad range of temperatures (Table 2). The virus
remained infectious from −196 to 45◦C showing a high thermal
stability. No viral lysis was recorded above 50◦C.
GdelRNAV-01 was not susceptible to chloroform since no
loss of viral infectivity was reported regardless of the chloroform
concentration (Table 2).
GdelRNAV-01 Genome
Gel electrophoresis of purified GdelRNAV-01 nucleic acids and
enzymatic digestions tests with DNase, RNase, and S1 Nuclease,
indicated that GdelRNAV-01 possesses a single-stranded RNA
FIGURE 7 | Analysis of the structural proteins of GdelRNAV-01 using
SDS-PAGE. Lane Marker: Novex sharp unstained protein standard marker
(kDa). Lane GdelRNAV-01: Denatured proteins of purified GdelRNAV-01. P1 to
P5 represent the proteins 1 to 5.
Frontiers in Microbiology | www.frontiersin.org 10 January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
FIGURE 8 | Phylogenetic rooted tree based on RdRp sequences of
representative viruses from the Picornavirales order. Caliciviridae viruses were
taken as outgroup. The star indicates the position of GdelRNAV-01 in the
genus Bacillarnavirus. The Maximum Likelihood tree was generated using
PhyML 3.0 with 1,000 replications and a LG +G+I+F substitution model
according to the SMS analyses. Bootstraps values (%) >80 are shown. Scale
bar indicates the number of substitutions per site. Virus abbreviations: ABPV,
acute bee paralysis virus NC_002548.1; AiV, Aichi virus, AB010145;
AglaRNAV, Asterionellopsis glacialis RNA virus NC_024489; AuRNAV,
Aurantiochytrium single-stranded RNA virus), BAE47143; BoCV, Bovine
enteric calicivirus, AJ011099; BBW, broad bean wilt virus 1 NC_005289.1;
CsfrRNAV, Chaetoceros socialis f. radians RNA virus, AB469874; Csp03RNAV,
Chaetoceros sp. number03 RNA virus, AB639040; CtenRNAV type-I,
Chaetoceros tenuissimus RNA virus, AB375474; CtenRNAV type-II,
AB971661; CtenRNAV_SS10V-39V, AB971662; CtenRNAV_SS10V-45V,
AB971663; CRLV, cherry rasp leaf virus, NC_006271.1; CPSMV, cowpea
severe mosaic virus, NC_003545; CrPV, cricket paralysis virus, NC_003924;
DWV, deformed wing virus, NC_004830; HaRNAV, Heterosigma akashiwo
RNA virus, NC_005281; HplV-81, Hubei picorna-like virus 81 strain
CJLX25805, KX884540.1; HplV-82, Hubei picorna-like virus 82 KX883688.1;
PV, human poliovirus 1 Mahoney, V01149; IFV, infectious flacherie virus
NC_003781.1; NV, Norwalk virus, M87661; PYFV, Parsnip yellow fleck virus,
D14066; RsRNAV, Rhizosolenia setigera RNA virus, AB243297; RTSV, rice
tungro spherical virus, AAA66056; SBV, sacbrood virus, NC_002066; SDV,
Satsuma dwarf virus RNA 1 NC_003785.2; SINV-2, Solenopsis invicta virus 2
EF428566.1; TRSV, tobacco ringspot virus RNA 1 NC_005097.1; ToTV,
tomato torrado virus RNA 1 NC_009013.1; TrV, triatoma virus, NC_003783.
genome of about 9 kb (Figure 5). Comparable results were
obtained for GdelRNAV-02, GdelRNAV-03 and GdelRNAV-04
(data not shown), implying that these viruses possess a single-
stranded RNA genomes of 9 kb.
The assembled genome of GdelRNAV-01 was 9,233 nt in
length, excluding a poly(A) tail. The adenine, cytosine, guanine
and uracil richness were estimated to be 30.1, 17.6, 19.3, and 33%,
respectively.
The GdelRNAV-01 genome consisted of a 5′untranslated
region (UTR, 1,008 nt), two ORFS separated by an intergenic
region (IGR, 574 nt) and a 3′UTR of 367 nt (Figure 6). The
size 5′and 3′UTR may not be completed as we did not do
RACE. The first ORF was 4,959 nt long, representing 53.7% of
the whole genome. It clustered two replication-related proteins:
a helicase domain (110 amino acids) and a RNA-dependent
RNA polymerase (RdRp) domain (291 amino acids) (Figure 6).
The BLAST searches (Table 3) revealed that both proteins were
closely related to Chaetoceros sp. RNA virus 03, Chaetoceros
tenuissimus RNA virus type-II, to Marine RNA virus JP-A (Culley
et al., 2007), and to Beihai picorna-like viruses and Wenzhou
picorna-like virus 50, that infect invertebrates (Shi et al., 2016).
The second ORF (2325 nt, 25.2% of the viral genome) encoded
for putative structural proteins of the capsid based on the
detection of 4 conserved capsid domains. This ORF contained
two domains that belong to the Picornavirus capsid protein
domain_like (Rhv1 and 2), one to the Cricket paralysis virus
VP4 domain from the Dicistroviridae family (Dicistro_VP4) and
the last domain shared significant homology with the cricket
paralysis virus (CRPV) capsid protein like (Figure 6). As with
the first ORF, best hits of ORF2 using BLASTP (774 amino acids)
corresponded to sequences of ssRNA viruses (Table 3).
In the IGR, a small conserved region was detected (360
nt, 4% of the whole genome). BLASTn searches revealed two
hits belonging to Chaetoceros sp. RNA virus 03 (E-value: 2e-
88) and Beihai picorna-like virus 4 (E-value: 5e-54). However,
no statistically significant matching protein sequence was found
using BLASTP searches (119 amino acids).
Structural Proteins
The SDS PAGE showed five proteins of variable staining intensity
(Figure 7). Four proteins of respectively 33.9, 29.8, 27, and 6.8
kDa (P2, P3, P4, and P5, respectively) were intensively stained
while the largest protein of 38.6 kDa (P1) had a weaker intensity
(Figure 7). The amino acid sequences of each protein analyzed by
mass spectrometry (MS) were found in the predicted sequence
of the ORF2 (Figure 6 and Tables S1,S2). The smallest protein
(P5) (6.8 kDa predicted from the gel and 4.7 kDa from the amino
acid sequence) corresponded to the Dicistro_VP4 domain. The
predicted peptides of P2 (33.9 kDa on the SDS-PAGE gel, 16.8
kDa based on the amino acid sequence) matched the C-ter region
of the CRPV domain. The protein P4 was more central and
peptides analyzed by MS corresponded to the N-terminal region
of Rhv2 domain. MS analysis of P3 peptides revealed that they
matched the upstream region of ORF2 up to Rhv1 domain. The
largest protein P1 (38.6, 51.7 kDa predicted) encompassed VP4,
Rhv2, and CRPV domains.
Frontiers in Microbiology | www.frontiersin.org 11 January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
Phylogenetic Analysis of the Picornavirales
Phylogenetic reconstructions based on the analysis of the
RdRp amino acid sequences of a selection of Picornavirales
revealed that GdelRNAV-01 clusters among the monophyletic
genus Bacillarnavirus (Figure 8). Sequences of these viruses, that
infect diatom species, gathered in a clade supported by a high
bootstrap value (98%). GdelRNAV-01 was most closely related
to Chaetoceros sp. number03 RNA virus (Csp03RNAV), a virus
infecting the marine diatom Chaetoceros sp. (Tomaru et al.,
2013a).
Intraspecific Comparison of GdelRNAV
Viruses
Nucleotide partial sequences of the RNA-dependent RNA
polymerase (RdRp) of GdelRNAV-01, GdelRNAV-02,
GdelRNAV-03 and GdelRNAV-04 were highly similar, with
474 identical sites on 478 bp, representing 99.2% of identity
(Figure S1). The slight differences between these four RdRp
sequences are shown Figure S1 in red frames.
Distribution of GdelRNAV-01 in Natural
Environments
Environmental surveys allowed us to study the natural
distribution of GdelRNAV-01 across marine and fresh water
environments (Table 4). In total, 18,858 homologous reads (488.2
bp on average) mapped against the GdelRNAV-01 RdRp gene
marker. They were exclusively found in temperate coastal water
stations off British Columbia. At these stations, deep-sequencing
of the RdRp has been carried out to assess the diversity and
composition of the ssRNA viral community (Gustavsen et al.,
2014).
DISCUSSION
The marine diatom G. delicatula is a cosmopolitan species that
dominates seasonal blooms in the English Channel and the North
Sea. In the environment, this species is known to be infected by
several eukaryotic parasites. In this study, we described for the
first time viruses that infect G.delicatula, and probably contribute
to the control of its bloom dynamics.
Morphological and genomic analyses indicated that the new
G.delicatula viruses isolated during this study belong to the
unassigned genus Bacillarnavirus within the order Picornavirales
(Tomaru et al., 2015). This genus includes ssRNA viruses that
infect diatoms and includes three species to date (ICTV).
Like other members of the unassigned genus Bacillarnavirus,
virions are small naked particles (35 nm in diameter) with a
hexagonal outline, suggesting an icosahedral symmetry, and
TABLE 4 | Results of the mapping of the GdelRNAV-01 genome or gene sequences onto environmental data.
References Database Accession number RdRp amplicons/
Metagenomes
Sampling site Region Number of positive
reads mapping
Length (bp)
min–mean–max
Culley et al., 2003 GenBank AY285747–AY285767 RdRp domain British Columbia,
Canada
Pacific
temperate
coastal waters
0 0
Culley et al., 2006 NCBI BioProject PRJNA17367 Genome British Columbia,
Canada
Pacific
temperate
coastal waters
0 0
Culley et al., 2007 GenBank NC_009756–
NC_009758
Genome British Columbia,
Canada
Pacific
temperate
coastal waters
0 0
Culley and
Steward, 2007
GenBank EF591792–EF591815 RdRp domain Hawaii and
California, USA
Pacific
subtropical
waters
0 0
Rosario et al.,
2009
NCBI BioProject PRJNA36649 Genome Manatee County,
Florida, USA
Reclaimed
waters
0 0
Djikeng et al.,
2009
MetaVir 1,153 and 1,154 Genome Maryland, USA Lake,
freshwaters
0 0
Culley et al., 2014 GenBank KC620972–KC621051 RdRp domain Hawaii, USA Pacific tropical
waters
0 0
Culley et al., 2014 iMicrobes CAM_SMPL_000815
and
CAM_SMPL_000824
Genome Hawaii, USA Pacific tropical
waters
0 0
Gustavsen et al.,
2014
NCBI BioProject PRJNA267690 RdRp domain British Columbia,
Canada
Pacific
temperate
coastal waters
18,858 241–488, 2–508
Lõpez-Bueno
et al., 2015
Metavir 4,488–4,490 Genome Livingston
Island, Antarctic
Lake,
freshwaters
0 0
Miranda et al.,
2016
NCBI BioProject PRJNA266680 Genome Western
Antarctic
Peninsula
Antarctic polar
waters
0 0
Frontiers in Microbiology | www.frontiersin.org 12 January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
they contain a positive-sense ssRNA genome. During the
infection, viral progenies accumulate in the host cytoplasm,
where they form both crystalline arrays and unordered particles,
before their release by cell lysis. The genome architecture
of GdelRNAV-01 is similar to that of other Picornavirales
(Koonin et al., 2008). The 9 kb genome of GdelRNAV-01
comprises 2 ORFs, coding respectively for replication and
structural polyproteins with best hits to sequences of ssRNA
viruses of the diatom Chaetoceros spp., as well as marine
environmental virus genomes (Culley et al., 2007) and viral
sequences assembled from transcriptomics (Shi et al., 2016).
More precisely, the first ORF includes domains coding for
the RNA-dependent RNA-polymerase (RdRp) as well as a
helicase. The RdRp is traditionally used as a diversity marker
for RNA viruses (Koonin et al., 1993; Culley et al., 2003).
The sequencing of this gene showed low genetic variability
between the four GdelRNAV isolates, suggesting that the four
strains belong to the same virus. The second ORF encodes
for the structural polyprotein showing the same conserved
protein domains (Rhv_like, Dicistro_VP4, CRPV_capsid) and
architecture as the other diatom viruses. According to our
proteomic analyses, a large protein (P1), whose amino acid
sequence appeared to overlap that of the three protein domains,
was detected. This protein may correspond to an immature
form associated to provirions. It is likely that this precursor
capsid protein cleaves into smaller proteins after a maturation
process as described or speculated for other members of the order
Picornavirales (Lang et al., 2004; Mullapudi et al., 2016). Apart
from this putative immature protein, our MS results suggest that
GdelRNAV virions are constituted of four structural proteins that
matched with each of the four conserved domains predicted in
the genome sequence. Interestingly, other known members of
Bacillarnavirus display only three structural proteins (Tomaru
et al., 2015).
The functional characterization showed that GdelRNAV is
strain specific, virions are produced rapidly (in our case,
latent period <12 h) and infection ultimately induced host
mortality through cell lysis, as reported for other algal viruses
including both RNA and dsDNA viruses (for review see
Brussaard and Martínez, 2008 and reference therein). For
GdelRNAV, the estimated burst size reached 9.34 ×104
virions per host cell, which is higher than reported values
for other ssRNA viruses [<100–104virions per cell (Tomaru
et al., 2015)]. One divergent feature of ssRNA diatom viruses
compared to known algal viruses is the simultaneous increase
in host and viral concentrations during the first days of
incubation (72 h in our case) and the occurrence of multiple
viral cycles (Shirai et al., 2008; Tomaru et al., 2009, 2011b,
2014; Kimura and Tomaru, 2013). A theoretical calculation
suggests that only 3.3% of G.delicatula cells produced viral
progenies at the initial time of the kinetics and that the
percentage of permissive cells increases along the growth
curve (see Table S3). It is thus likely that the host cell
culture, although clonal, exhibited different degrees of viral
susceptibility.
Diverse mechanisms of host resistance to viral infection
have been described in marine microalgae. For example, in
the picoeukaryote Ostreococcus tauri, some proteins encoded
in chromosome 19 were shown to be involved in the host
defense against viral attack (Yau et al., 2016). Unfortunately, G.
delicatula’s genome sequence is not available to speculate on
similar mechanisms operating in our virus-host model system.
However, previous studies demonstrated that the physiological
status of diatom host cells can also determine the outcome of
viral infection. Chaetoceros host population generally became
more permissive to viral infection with the progression of
the stationary growth (Tomaru et al., 2014). This led to the
hypothesis that diatoms with a high growth rate may tolerate
viral infection while cells with less vigorous growth rate undergo
rapid lysis and do not participate to the bloom formation
(Tomaru et al., 2015). Interestingly, we attempted to isolate
G.delicatula viruses throughout the year but isolations were
successful only with samples collected in late summer. We
cannot rule out that the host strain used for viral isolation was
not permissive to the spring and summer viral populations.
Yet, the amplitude of G.delicatula late summer bloom is
consistently lower compared to spring and early summer blooms
at SOMLIT-Astan (our study and RESOMAR Pelagos database).
It is tempting to speculate that the late summer environmental
conditions were less favorable for the growth of G.delicatula,
which, in turn, may have been more vulnerable to viral attack.
G.delicatula is also known to be infected by diverse parasites,
such as Pirsonia (Kühn et al., 1996) and Cryothecomonas (Drebes
et al., 1996). G.delicatula blooms may thus be controlled by
a complex network of pathogens, among which viruses may
not be the primary cause of bloom disintegration, as already
reported for Chaetoceros spp. (Tomaru et al., 2011a, 2018). In
any case, variability in viral susceptibility of the host is probably
contributing to the sustainability of these diatom bloom events in
natural habitats.
Isolating and characterizing new viruses infecting ecologically
relevant hosts is a prerequisite to advance our understanding
of the large amount of environmental sequences collected
worldwide. Data-mining of RNA viromes that are publicly
available showed that the genome of GdelRNAV-01 recruited
homologs in environments where G.delicatula is known to
develop [based on Ocean Biogeographic Information System
(OBIS) database and Hobson and McQuoid (1997)]. Although
very few RNA viromes are available, these preliminary results
suggest that GdelRNAV occur in different temperate coastal
waters. Seasonal metagenomic monitoring in the Western
English Channel should be considered to investigate the
composition, the prevalence and the temporal dynamics of
this relevant virus–host model system. It will contribute to
have a closer look at the relative contribution of the different
pathogens to the control of diatom blooms, necessary to
understand the fate of these prominent organisms in marine
systems.
AUTHOR CONTRIBUTIONS
LA designed and conducted the experiments and analyses and
wrote the manuscript. NS designed the study, contributed
Frontiers in Microbiology | www.frontiersin.org 13 January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
to the experiments, wrote the manuscript. FR-J helped for
sampling and for kinetic experiments, and carried out taxonomic
counts in the frame of the Roscoff SOMLIT-Astan time
series. FL isolated Guinardia hosts, performed the PCR
and participated to the analyses of the eukaryotic gene
marker. SC designed the genome recruitment analysis. ErC
assembled the viral genome. EmC performed and analyzed
the proteomics data. EB provided technical support. A-CB
designed the study, contributed to the experiments, wrote the
manuscript.
FUNDING
This study was supported by PhD fellowships from the
Université Pierre et Marie Curie (Sorbonne Universités)
and the Région Bretagne (ARED), the ANR CALYSPO
(ANR-15-CE01-0009) and the CNRS-INSU EC2CO CYCLOBS
project.
ACKNOWLEDGMENTS
The authors would like to thank the crew of the Neomysis ship for
their help during the samplings at SOMLIT-Astan station. We are
also grateful to Sophie Le Panse from the microscopy platform,
for the transmission electron micrographs, to the RCC for the
phytoplankton strains provided and also to Sarah Romac for her
assistance with molecular biology. Yuji Tomaru who provided
protocols and advices on viral purification is acknowledged.
Laurianne Gerin is thanked for her English proofreading. We
thank the three reviewers for their comments on a previous
version of this manuscript.
SUPPLEMENTARY MATERIAL
The Supplementary Material for this article can be found
online at: https://www.frontiersin.org/articles/10.3389/fmicb.
2018.03235/full#supplementary-material
REFERENCES
Armbrust, E. V. (2009). The life of diatoms in the world’s oceans. Nature 459,
185–192. doi: 10.1038/nature08057
Assmy, P., and Smetacek, V. (2009). “Algal blooms,” in Encyclopedia of
Microbiology, ed M. Schaechter (Oxford: Elsevier), 27–41.
Balzano, S., Percopo, I., Siano, R., Gourvil, P., Chanoine, M., Marie, D., et al.
(2017). Morphological and genetic diversity of Beaufort Sea diatoms with high
contributions from the Chaetoceros neogracilis species complex. J. Phycol. 53,
161–187. doi: 10.1111/jpy.12489
Bankevich, A., Nurk, S., Antipov, D., Gurevich, A. A., Dvorkin, M., Kulikov,
A. S., et al. (2012). SPAdes: a new genome assembly algorithm and
its applications to single-cell sequencing. J. Comput. Biol. 19, 455–477.
doi: 10.1089/cmb.2012.0021
Bolger, A. M., Lohse, M., and Usadel, B. (2014). Trimmomatic: A flexible
trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120.
doi: 10.1093/bioinformatics/btu170
Brussaard, C. P. D., and Martínez, J. (2008). Algal bloom viruses. Plant Viruses
2, 1–10. Available online at: http://www.globalsciencebooks.info/JournalsSup/
08PV_2_1.html
Culley, A. I., Lang, A. S., and Suttle, C. A. (2003). High diversity of
unknown picorna-like viruses in the sea. Nature 424, 1054–1057.
doi: 10.1038/nature01886
Culley, A. I., Lang, A. S., and Suttle, C. A. (2006). Metagenomic analysis of coastal
RNA virus communities. Science 312, 1795–1798. doi: 10.1126/science.1127404
Culley, A. I., Lang, A. S., and Suttle, C. A. (2007). The complete genomes of three
viruses assembled from shotgun libraries of marine RNA virus communities.
Virol. J. 4, 69. doi: 10.1186/1743-422X-4-69
Culley, A. I., Mueller, J. A., Belcaid, M., Wood-charlson, E. M., Poisson, G.,
and Steward, G. F. (2014). The characterization of RNA viruses in tropical
seawater using targeted PCR and metagenomics. MBio 5, e01210–e01214.
doi: 10.1128/mBio.01210-14
Culley, A. I., and Steward, G. F. (2007). New genera of RNA viruses in subtropical
seawater, inferred from polymerase gene sequences. Appl. Environ. Microbiol.
73, 5937–5944. doi: 10.1128/AEM.01065-07
Djikeng, A., Kuzmickas, R., Anderson, N. G., and Spiro, D. J. (2009).
Metagenomic analysis of RNA viruses in a fresh water lake. PLoS ONE 4:e7264.
doi: 10.1371/journal.pone.0007264
Drebes, G., Kühn, S. F., Gmelch, A., and Schnepf, E. (1996). Cryothecomonas
aestivalis sp. nov., a colourless nanoflagellate feeding on the marine centric
diatom Guinardia delicatula (Cleve) Hasle. Helgoländ. Meeresuntersuchung. 50,
497–515. doi: 10.1007/BF02367163
Falkowski, P. G., Barber, R. T., and Smetacek, V. (1998). Biogeochemical controls
and feedbacks on ocean primary production. Sci. New Ser. 281, 200–206.
doi: 10.1126/science.281.5374.200
Giardine, B., Riemer, C., Hardison, R. C., Burhans, R., Elnitski, L., Shah, P., et al.
(2005). Galaxy: a platform for interactive large-scale genome analysis. Genome
Res. 15, 1451–1455. doi: 10.1101/gr.4086505
Gleason, F. H., Jephcott, T. G., Küpper, F. C., Gerphagnon, M., Sime-Ngando,
T., Karpov, S. A., et al. (2015). Potential roles for recently discovered chytrid
parasites in the dynamics of harmful algal blooms. Fungal Biol. Rev. 29, 20–33.
doi: 10.1016/j.fbr.2015.03.002
Gómez, F., and Souissi, S. (2007). Unusual diatoms linked to climatic
events in the northeastern English Channel. J. Sea Res. 58, 283–290.
doi: 10.1016/j.seares.2007.08.002
Gowen, R. J., McCullough, G., Kleppel, G. S., Houchin, L., and Elliott, P. (1999).
Are copepods important grazers of the spring phytoplankton bloom in the
western Irish Sea? J. Plankton Res. 21, 465–483. doi: 10.1093/plankt/21.3.465
Grabherr, M. G., Haas, B. J., Yassour, M., Levin, J. Z., Thompson, D. A., Amit, I.,
et al. (2011). Full-length transcriptome assembly from RNA-Seq data without a
reference genome. Nat. Biotechnol. 29, 644–652. doi: 10.1038/nbt.1883
Grall, J. R. (1972). Développement “printanier” de la Diatomée Rhizosolenia
delicatula près de Roscoff. Mar.Biol. 16, 41–48.
Guillou, L., Eikrem, W., Chrétiennot-Dinet, M.-J., Le Gall, F., Massana, R., Romari,
K., et al. (2004). Diversity of picoplanktonic prasinophytes assessed by direct
nuclear SSU rDNA sequencing of environmental samples and novel isolates
retrieved from oceanic and coastal marine ecosystems. Protist 155, 193–214.
doi: 10.1078/143446104774199592
Guilloux, L., Rigaut-Jalabert, F., Jouenne, F., Ristori, S., Viprey, M., Not, F., et al.
(2013). An annotated checklist of Marine Phytoplankton taxa at the SOMLIT-
Astan time series off Roscoff (Western English Channel, France): data collected
from 2000 to 2010. Cah.Biol.Mar. 54, 247–256.
Guindon, S., Dufayard, J. F., Lefort, V., Anisimova, M., Hordijk, W., and Gascuel,
O. (2010). New algorithms and methods to estimate maximum-likelihood
phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321.
doi: 10.1093/sysbio/syq010
Gustavsen, J. A., Winget, D. M., Tian, X., and Suttle, C. A. (2014). High temporal
and spatial diversity in marine RNA viruses implies that they have an important
role in mortality and structuring plankton communities. Front. Microbiol.
5:703. doi: 10.3389/fmicb.2014.00703
Hernández-Becerril, D. U., Herrera-Hernández, P., Pérez-Mendoza, A.,
and Gerardo A Ceballos-Corona, J. (2010). Marine planktonic diatoms of
the order Rhizosoleniales (Bacillariophyta) From the tropical Mexican pacific.
Vie Milieu Life Environ. 60, 95–107.
Frontiers in Microbiology | www.frontiersin.org 14 January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
Hobson, L. A., and McQuoid, M. R. (1997). Temporal variations among planktonic
diatom asseblages in a turbulent environment of the southern Strait of
Georgia, British Columbia, Canada. Mar. Ecol. Prog. Ser. 150, 263–274.
doi: 10.3354/meps150263
Katoh, K., Rozewicki, J., and Yamada, K. D. (2017). MAFFT online service:
multiple sequence alignment, interactive sequence choice and visualization.
Brief. Bioinform. bbx108. doi: 10.1093/bib/bbx108
Keller, M. D., Seluin, R. C., Claus, W., and Guillard, R. R. L. (1987). Media
for the culture of oceanic ultraphytoplankton. J. Phycol. 23, 633–638.
doi: 10.1016/0198-0254(88)92621-0
Kellogg, D. E., and Kellogg, T. B. (1996). Diatoms in South Pole ice: implications
for eolian contamination of Sirius Group deposits. Geology 24, 115–118. doi: 10.
1130/0091-7613(1996)024<0115:DISPII>2.3.CO;2
Kimura, K., and Tomaru, Y. (2013). Isolation and characterization of
a single-stranded DNA virus infecting the marine diatom Chaetoceros
sp. strain SS628-11 isolated from western Japan. PLoS ONE 8:e82013.
doi: 10.1371/journal.pone.0082013
Kimura, K., and Tomaru, Y. (2015). Discovery of two novel viruses expands the
diversity of single-stranded DNA and single-stranded RNA viruses infecting
a cosmopolitan marine diatom. Appl. Environ. Microbiol. 81, 1120–1131.
doi: 10.1128/AEM.02380-14
Kimura, K., and Tomaru, Y. (2017). Effects of temperature and salinity on
diatom cell lysis by DNA and RNA viruses. Aquat. Microb. Ecol. 79, 79–83.
doi: 10.3354/ame01818
Koonin, E. V, Wolf, Y. I., Nagasaki, K., and Dolja, V. V (2008). The Big Bang of
picorna-like virus evolution antedates the radiation of eukaryotic supergroups.
Nat. Rev. Microbiol. 6, 925–939. doi: 10.1038/nrmicro2030
Koonin, E. V., Dolja, V. V., and Morris, T. J. (1993). Evolution and
taxonomy of positive-strand RNA viruses: implications of comparative analysis
of amino acid sequences. Crit. Rev. Biochem. Mol. Biol. 28, 375–430.
doi: 10.3109/10409239309078440
Kühn, S. F. (1996). Rhizamoeba schnepfii sp. nov, a naked amoeba feeding
on marine diatoms (North Sea, German Bight). Arch. Fur Protistenkd. 147,
277–282. doi: 10.1016/S0003-9365(97)80054-1
Kühn, S. F., Drebes, G., and Schnepf, E. (1996). Five new species of
the nanoflagellate Pirsonia in the German Bight, North Sea, feeding
on planktonic diatoms. Helgoländ. Meeresuntersuchung. 50, 205–222
doi: 10.1007/BF02367152
Kumar, S., Stecher, G., and Tamura, K. (2016). MEGA7: Molecular Evolutionary
Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874.
doi: 10.1093/molbev/msw054
Lang, A. S., Culley, A. I., and Suttle, C. A. (2004). Genome sequence and
characterization of a virus (HaRNAV) related to picorna-like viruses that infects
the marine toxic bloom-forming alga Heterosigma akashiwo.Virology 320,
206–217. doi: 10.1016/j.virol.2003.10.015
Langmead, B., and Salzberg, S. L. (2012). Fast gapped-read alignment with Bowtie
2. Nat. Methods 9, 357–359. doi: 10.1038/nmeth.1923.Fast
Lavigne, R., Becker, E., Liu, Y., Evrard, B., Lardenois, A., Primig, M., et al. (2012).
Direct iterative protein profiling (DIPP)–an innovative method for large-
scale protein detection applied to budding yeast mitosis. Mol. Cell. Proteomics
11:M111.012682. doi: 10.1074/mcp.M111.012682
Lefort, V., Longueville, J. E., and Gascuel, O. (2017). SMS: smart model selection
in PhyML. Mol. Biol. Evol. 34, 2422–2424. doi: 10.1093/molbev/msx149
Lenaers, G., Maroteaux, L., Michot, B., and Herzog, M. (1989). Dinoflagellates in
evolution. A molecular phylogenetic analysis of large subunit ribosomal RNA.
J. Mol. Evol. 29, 40–51. doi: 10.1007/BF02106180
Lepere, C., Demura, M., Kawachi, M., Romac, S., Probert, I., and
Vaulot, D. (2011). Whole-genome amplification (WGA) of marine
photosynthetic eukaryote populations. FEMS Microbiol. Ecol. 76, 513–523.
doi: 10.1111/j.1574-6941.2011.01072.x
L’Helguen, S., Madec, C., and Le Corre, P. (1996). Nitrogen uptake in permanently
well-mixed temperate coastal waters. Estuar. Coast. Shelf Sci. 42, 803–818.
doi: 10.1006/ecss.1996.0051
Lõpez-Bueno, A., Rastrojo, A., Peirõ, R., Arenas, M., and Alcamí, A. (2015).
Ecological connectivity shapes quasispecies structure of RNA viruses in an
Antarctic lake. Mol. Ecol. 24, 4812–4825. doi: 10.1111/mec.13321
Malviya, S., Scalco, E., Audic, S., Vincent, F., Veluchamy, A., Poulain,
J., et al. (2016). Insights into global diatom distribution and diversity
in the world’s ocean. Proc. Natl. Acad. Sci. U.S.A. 113, 1516–1525.
doi: 10.1073/pnas.1509523113
Mann, D. G., and Droop, S. J. M. (1996). 3. Biodiversity, biogeography and
conservation of diatoms. Hydrobiologia 336, 19–32. doi: 10.1007/BF00010816
Miranda, J. A., Culley, A. I., Schvarcz, C. R., and Steward, G. F. (2016). RNA
viruses as major contributors to Antarctic virioplankton. Environ. Microbiol.
18, 3714–3727. doi: 10.1111/1462-2920.13291
Mullapudi, E., Pridal, A., Pálková, L., de Miranda, J. R., and Plevka, P. (2016).
Virion structure of Israeli acute bee paralysis virus. J. Virol. 90, 8150–8159.
doi: 10.1128/JVI.00854-16
Nagasaki, K., Tomaru, Y., Katanozaka, N., Shirai, Y., Nishida, K., Itakura, S.,
et al. (2004). Isolation and characterization of a novel single-stranded RNA
virus infecting the bloom-forming diatom Rhizosolenia setigera.Appl. Environ.
Microbiol. 70, 704–711. doi: 10.1128/AEM.70.2.704
Nelson, D. M., Tréguer, P., Brzezinski, M. A., Leynaert, A., and Quéguiner, B.
(1995). Production and dissolution of biogenic silica in the ocean: revised
global estimates, comparison with regional data and relationship to biogenic
sedimentation. Global Biogeochem. Cycles 9, 359–372. doi: 10.1029/95GB01070
Orsini, L., Sarno, D., Procaccini, G., Poletti, R., Dahlmann, J., and Montresor,
M. (2002). Toxic Pseudo-nitzschia multistriata (Bacillariophyceae)
from the Gulf of Naples: morphology, toxin analysis and phylogenetic
relationships with other Pseudo-nitzschia species. Eur. J. Phycol. 37, 247–257.
doi: 10.1017/S0967026202003608
Rosario, K., Nilsson, C., Lim, Y. W., Ruan, Y., and Breitbart, M. (2009).
Metagenomic analysis of viruses in reclaimed water. Environ. Microbiol. 11,
2806–2820. doi: 10.1111/j.1462-2920.2009.01964.x
Sarno, D., Kooistra, W. H. C. F., Medlin, L. K., Percopo, I., and Zingone, A. (2005).
Diversity in the genus Skeletonema (Bacillariophyceae). II. An assessment of the
taxonomy of S. costatum-like species with the description of four new species.
J. Phycol. 41, 151–176. doi: 10.1111/j.1529-8817.2005.04067.x
Sarthou, G., Timmermans, K. R., Blain, S., and Tréguer, P. (2005). Growth
physiology and fate of diatoms in the ocean: a review. J. Sea Res. 53, 25–42.
doi: 10.1016/j.seares.2004.01.007
Schlüter, M. H., Kraberg, A., and Wiltshire, K. H. (2012). Long-term changes in the
seasonality of selected diatoms related to grazers and environmental conditions.
J. Sea Res. 67, 91–97. doi: 10.1016/j.seares.2011.11.001
Scholz, B., Guillou, L., Marano, A. V., Neuhauser, S., Sullivan, B. K., Karsten, U.,
et al. (2015). Zoosporic parasites infecting marine diatoms – a black box that
needs to be opened. Fungal Ecol. 19, 59–76. doi: 10.1016/j.funeco.2015.09.002
Shi, M., Lin, X. D., Tian, J. H., Chen, L. J., Chen, X., Li, C. X., et al.
(2016). Redefining the invertebrate RNA virosphere. Nature 540, 539–543.
doi: 10.1038/nature20167
Shirai, Y., Tomaru, Y., Takao, Y., Suzuki, H., Nagumo, T., and Nagasaki, K. (2008).
Isolation and characterization of a single-stranded RNA virus infecting the
marine planktonic diatom Chaetoceros tenuissimus Meunier. Appl. Environ.
Microbiol. 74, 4022–4027. doi: 10.1128/AEM.00509-08
Smetacek, V. (1999). Diatoms and the ocean carbon cycle. Protist 150, 25–32.
doi: 10.1016/S1434-4610(99)70006-4
Smetacek, V. S. (1985). Role of sinking in diatom life-history cycles:
ecological, evolutionary and geological significance. Mar. Biol. 84, 239–251.
doi: 10.1007/BF00392493
Sommer, U., Adrian, R., De Senerpont Domis, L., Elser, J. J., Gaedke, U.,
Ibelings, B., et al. (2012). Beyond the Plankton Ecology Group (PEG) model:
mechanisms driving plankton succession. Annu. Rev. Ecol. Evol. Syst. 43,
429–448. doi: 10.1146/annurev-ecolsys-110411-160251
Suttle, C. A. (1993). “Enumeration and isolation of viruses,” in Handbook of
Methods in Aquatic Microbial Ecology, eds P. F. Kemp, B. F. Sherr, E. B. Sherr,
and J. J. Cole (Boca Raton, FL: Lewis Publisher), 121–137.
Takano, H. (1981). New and rare diatoms from Japanese marine waters – VI. Three
new species in Thalassiosiraceae. Bull.Tokai Reg.Fish.Res.Lab. 105, 31–43.
Tillmann, U., Hesse, K. J., and Tillmann, A. (1999). Large-scale parasitic
infection of diatoms in the Northfrisian Wadden Sea. J. Sea Res. 42, 255–261.
doi: 10.1016/S1385-1101(99)00029-5
Tomaru, Y., Fujii, N., Oda, S., Toyoda, K., and Nagasaki, K. (2011a). Dynamics of
diatom viruses on the western coast of Japan. Aquat. Microb. Ecol. 63, 223–230.
doi: 10.3354/ame01496
Tomaru, Y., Katanozaka, N., Nishida, K., Shirai, Y., Tarutani, K., Yamaguchi, M.,
et al. (2004). Isolation and characterization of two distinct types of HcRNAV , a
Frontiers in Microbiology | www.frontiersin.org 15 January 2019 | Volume 9 | Article 3235

Arsenieff et al. Characterization of Guinardia delicatula Viruses
single-stranded RNA virus infecting the bivalve-killing microalga Heterocapsa
circularisquama.Aquat. Microb. Ecol. 34, 207–218. doi: 10.3354/ame034207
Tomaru, Y., Kimura, K., and Yamaguchi, H. (2014). Temperature alters algicidal
activity of DNA and RNA viruses infecting Chaetoceros tenuissimus.Aquat.
Microb. Ecol. 73, 171–183. doi: 10.3354/ame01713
Tomaru, Y., Shirai, Y., Suzuki, H., Nagumo, T., and Nagasaki, K. (2008). Isolation
and characterization of a single-stranded DNA virus infecting the marine
planktonic diatom Chaetoceros debilis.Aquat. Microb. Ecol. 50, 103–112.
doi: 10.3354/ame01170
Tomaru, Y., Takao, Y., Suzuki, H., Nagumo, T., Koike, K., and Nagasaki,
K. (2011b). Isolation and characterization of a single-stranded DNA virus
infecting Chaetoceros lorenzianus Grunow. Appl. Environ. Microbiol. 77,
5285–5293. doi: 10.1128/AEM.00202-11
Tomaru, Y., Takao, Y., Suzuki, H., Nagumo, T., and Nagasaki, K. (2009). Isolation
and characterization of a single-stranded RNA virus infecting the bloom-
forming diatom Chaetoceros socialis.Appl. Environ. Microbiol. 75, 2375–2381.
doi: 10.1128/AEM.02580-08
Tomaru, Y., Toyoda, K., and Kimura, K. (2015). Marine diatom viruses and their
hosts: resistance mechanisms and population dynamics. Perspect. Phycol. 2,
69–81. doi: 10.1127/pip/2015/0023
Tomaru, Y., Toyoda, K., and Kimura, K. (2018). Occurrence of the planktonic
bloom-forming marine diatom Chaetoceros tenuissimus Meunier and
its infectious viruses in western Japan. Hydrobiologia 805, 221–230.
doi: 10.1007/s10750-017-3306-0
Tomaru, Y., Toyoda, K., Kimura, K., Takao, Y., Sakurada, K., Nakayama, N., et al.
(2013a). Isolation and characterization of a single-stranded RNA virus that
infects the marine planktonic diatom Chaetoceros sp. (SS08-C03). Phycol.Res.
61, 27–36. doi: 10.1111/j.1440-1835.2012.00670.x
Tomaru, Y., Toyoda, K., Suzuki, H., Nagumo, T., Kimura, K., and Takao,
Y. (2013b). New single-stranded DNA virus with a unique genomic
structure that infects marine diatom Chaetoceros setoensis.Sci. Rep. 3, 3337.
doi: 10.1038/srep03337
Toyoda, K., Kimura, K., Hata, N., Nakayama, N., Nagasaki, K., and Tomaru, Y.
(2012). Isolation and characterization of a single-stranded DNA virus infecting
the marine planktonic diatom Chaetoceros sp. (strain TG07-C28). Plankt.
Benthos Res. 7, 20–28. doi: 10.3800/pbr.7.20
Vizcaíno, J. A., Csordas, A., Del-Toro, N., Dianes, J. A., Griss, J., Lavidas, I., et al.
(2016). 2016 update of the PRIDE database and its related tools. Nucleic Acids
Res. 44, D447–D456. doi: 10.1093/nar/gkv1145
Wafar, M. V. M., Le Corre, P., and Birrien, J. L. (1983). Nutrients and primary
production in permanently well-mixed temperate coastal waters. Estuar. Coast.
Shelf Sci. 17, 431–446. doi: 10.1016/0272-7714(83)90128-2
Wiltshire, K. H., Kraberg, A., Bartsch, I., Boersma, M., Franke, H.-D., Freund, J.,
et al. (2010). Helgoland Roads, North Sea: 45 years of change. Estuaries Coasts
33, 295–310. doi: 10.1007/s12237-009-9228-y
Yau, S., Hemon, C., Derelle, E., Moreau, H., Piganeau, G., and Grimsley, N. (2016).
A viral immunity chromosome in the marine picoeukaryote, Ostreococcus tauri.
PLoS Pathog. 12:e1005965. doi: 10.1371/journal.ppat.1005965
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
Copyright © 2019 Arsenieff, Simon, Rigaut-Jalabert, Le Gall, Chaffron, Corre, Com,
Bigeard and Baudoux. This is an open-access article distributed under the terms
of the Creative Commons Attribution License (CC BY). The use, distribution or
reproduction in other forums is permitted, provided the original author(s) and the
copyright owner(s) are credited and that the original publication in this journal
is cited, in accordance with accepted academic practice. No use, distribution or
reproduction is permitted which does not comply with these terms.
Frontiers in Microbiology | www.frontiersin.org 16 January 2019 | Volume 9 | Article 3235