No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Identification and characterization of phytocannabinoids as novel dual PPARα/γ agonists by a computational and in vitro experimental approach
Abstract
BACKGROUND:
The nuclear Peroxisome Proliferator Activated Receptors (PPARs) are ligand-activated transcription factors playing a fundamental role in energy homeostasis and metabolism. Consequently, functional impairment or dysregulation of these receptors lead to a variety of metabolic diseases. While some phytocannabinoids (pCBs) are known to activate PPARγ, no data have been reported so far on their possible activity at PPARα.
METHODS:
The putative binding modes of pCBs into PPARα/γ Ligand Binding Domains were found and assessed by molecular docking and molecular dynamics. Luciferase assays validated in silico predictions whereas the biological effects of such PPARα/γ ligands were assessed in HepG2 and 3T3L1 cell cultures.
RESULTS:
The in silico study identified cannabigerolic acid (CBGA), cannabidiolic acid (CBDA) and cannabigerol (CBG) from C. sativa as PPARα/γ dual agonists, suggesting their binding modes toward PPARα/γ isoforms and predicting their activity as full or partial agonists. These predictions were confirmed by luciferase functional assays. The resulting effects on downstream gene transcription in adipocytes and hepatocytes were also observed, establishing their actions as functional dual agonists.
CONCLUSIONS:
Our work broadens the activity spectrum of CBDA, CBGA and CBG by providing evidence that these pCBs act as dual PPARα/γ agonists with the ability to modulate the lipid metabolism.
GENERAL SIGNIFICANCE:
Dual PPARα/γ agonists have emerged as an attractive alternative to selective PPAR agonists to treat metabolic disorders. We identified some pCBs as dual PPARα/γ agonists, potentially useful for the treatment of dyslipidemia and type 2 diabetes mellitus
... Total RNA isolation, purification, and cDNA synthesis from RAW264.7 and/or HEK293 cells were performed following published procedures [21]. Quantitative PCR (qPCR) was carried out in a real-time PCR system CFX384 (Bio-Rad) using the SsoAdvanced SYBR Green supermix (cat. ...
... Also, each sample was amplified simultaneously in quadruplicate in a oneassay run with a non-template control blank for each primer pair to control for contamination or primer-dimer formation, and the cycle threshold (Ct) value for each experimental group was determined. A housekeeping gene (the ribosomal protein S16) was used to normalize the Ct values, using the 2^− ΔCt formula; differences in mRNA content between groups were expressed as 2^− ΔΔCt , as previously described [21]. The primer sequences used: human TLR4 forward: GATAGCGAGCCACGCATTCA; human TLR4 reverse: TGGATTTCACACCTCCACGC; murine TLR4 forward: ATGGCATGGCTTACAC-CACC; murine TLR4 reverse: GAGGCCAATTTTGTCTTCCACA. ...
... All compounds were dissolved in DMSO. Optical density values from vehicle-treated cells were defined as 100% of MTT-reducing activity and the treatment effects were measured as a percentage of the inhibition of control measurement [21]. ...
Toll-like receptors (TLRs) are key receptors through which infectious and non-infectious challenges act with consequent activation of the inflammatory cascade that plays a critical function in various acute and chronic diseases, behaving as amplification and chronicization factors of the inflammatory response. Previous studies have shown that synthetic analogues of lipid A based on glucosamine with few chains of unsaturated and saturated fatty acids, bind MD-2 and inhibit TLR4 receptors. These synthetic compounds showed antagonistic activity against TLR4 activation in vitro by LPS, but little or no activity in vivo. This study aimed to show the potential use of N-palmitoyl-D-glucosamine (PGA), a bacterial molecule with structural similarity to the lipid A component of LPS, which could be useful for preventing LPS-induced tissue damage or even peripheral neuropathies. Molecular docking and molecular dynamics simulations showed that PGA stably binds MD-2 with a MD-2/(PGA)3 stoichiometry. Treatment with PGA resulted in the following effects: (i) it prevented the NF-kB activation in LPS stimulated RAW264.7 cells; (ii) it decreased LPS-induced keratitis and corneal pro-inflammatory cytokines, whilst increasing anti-inflammatory cytokines; (iii) it normalized LPS-induced miR-20a-5p and miR-106a-5p upregulation and increased miR-27a-3p levels in the inflamed corneas; (iv) it decreased allodynia in peripheral neuropathy induced by oxaliplatin or formalin, but not following spared nerve injury of the sciatic nerve (SNI); (v) it prevented the formalin- or oxaliplatin-induced myelino-axonal degeneration of sciatic nerve. SIGNIFICANCE STATEMENT We report that PGA acts as a TLR4 antagonist and this may be the basis of its potent anti-inflammatory activity. Being unique because of its potency and stability, as compared to other similar congeners, PGA can represent a tool for the optimization of new TLR4 modulating drugs directed against the cytokine storm and the chronization of inflammation.
... In this view, natural products represent an invaluable source of bioactive molecules due to their high chemical diversity. Among them, phytocannabinoids (pCBs) deserve special interest, since their major compounds, Δ 9 -tetrahydrocannabinol (THC) and cannabidiol (CBD), show a rich polypharmacology [10][11][12][13] including PPARγ agonism [14,15]. However, when considering the diversity of the chemical space of phytocannabinoids [16], their pharmacological potential as PPARγ is still substantially untapped. ...
... Phytocannabinoids (pCBs) are a class of secondary metabolites isolated from C. sativa, counting more than 100 compounds with a still largely unexplored pharmacological potential [16]. THC and CBD, the most representative pCBs, have interesting therapeutic applications due to their complex pharmacological profile, and they are active on the PPARγ receptor, while a few other neutral and acidic pCBs were characterized as dual PPARα/γ agonists [15]. Due to its role in adipocyte differentiation, lipid metabolism, glucose homeostasis, insulin sensitivity, and, more recently, in inflammatory and immune responses, PPARγ represents an attractive pharmacological target to address metabolic disorders. ...
... Due to its role in adipocyte differentiation, lipid metabolism, glucose homeostasis, insulin sensitivity, and, more recently, in inflammatory and immune responses, PPARγ represents an attractive pharmacological target to address metabolic disorders. As part of our discovery program on nuclear receptor ligands from marine [24,25] and terrestrial sources [15], we focused on cannabimovone (CBM), a polar pCB characterized by a unique abeo-menthane terpenyl moiety isolated in 2010 from a non-psychotropic variety of C. sativa (Italian cultivar Carmagnola) [17]. The chemical structure of cannabimovone, including stereochemical details, was recently confirmed by total synthesis, which can also be considered as an alternative to the exploitation of the natural source [26]. ...
Phytocannabinoids (pCBs) are a large family of meroterpenoids isolated from the plant Cannabis sativa. Δ9-Tetrahydrocannabinol (THC) and cannabidiol (CBD) are the best investigated phytocannabinoids due to their relative abundance and interesting bioactivity profiles. In addition to various targets, THC and CBD are also well-known agonists of peroxisome proliferator-activated receptor gamma (PPARγ), a nuclear receptor involved in energy homeostasis and lipid metabolism. In the search of new pCBs potentially acting as PPARγ agonists, we identified cannabimovone (CBM), a structurally unique abeo-menthane pCB, as a novel PPARγ modulator via a combined computational and experimental approach. The ability of CBM to act as dual PPARγ/α agonist was also evaluated. Computational studies suggested a different binding mode toward the two isoforms, with the compound able to recapitulate the pattern of H-bonds of a canonical agonist only in the case of PPARγ. Luciferase assays confirmed the computational results, showing a selective activation of PPARγ by CBM in the low micromolar range. CBM promoted the expression of PPARγ target genes regulating the adipocyte differentiation and prevented palmitate-induced insulin signaling impairment. Altogether, these results candidate CBM as a novel bioactive compound potentially useful for the treatment of insulin resistance-related disorders.
... Interestingly, the phytocannabinoids, which encompass a large class of compounds identified and isolated from Cannabis sativa, have been proposed to interact with a variety of molecular targets that include, but are not limited to, CB 1 and CB 2 receptors, which can be directly activated or antagonised at physiologically achievable concentrations (in the nM range) by Δ 9 -tetrahydrocannabinol (THC) and Δ 9 -tetrahydrocannabivarin (THCV), respectively [32][33][34]. Also, phytocannabinoids have other ways of potentially and indirectly modifying, although at low micromolar concentrations, the activity of ECS enzymes or noncannabinoid receptors, such as the nuclear receptor superfamily PPARs (α, δ and γ) [22,29,35], which are key regulators of adipogenesis, lipid metabolism and glucose metabolism. By acting at these different targets, including metabotropic or intracellular receptors belonging or somehow related to the ECS, phytocannabinoids exert neuroprotective as well as anti-inflammatory actions in vivo [36][37][38][39]. ...
... Previous studies have shown that phytocannabinoid treatment, most notably THCV, increases murine BM-MSC colony formation with a committed osteogenic differentiation potential, mediated by CB 2 activity [40]. CBD (3 μM) promoted ex vivo MSC migration and osteoblastic differentiation in a manner reversed by AM630 (CB 2 antagonist) or O-1602 (a GPR55 agonist), leading the authors to suggest that these effects were mediated by CB2 activation or GPR55 inactivation; however, neither AM630 or O-1602 were tested on their own, and therefore caution must be applied in the interpretation of these data [41], particularly as CBD has also been suggested to restore adipogenic and chondrogenic in vitro differentiation capacity via PPARγ in debilitated MSCs with an induced inflammatory phenotype [35]. Finally, a 3 μM concentration of CBD, and its analogue CBDV, promoted the maturation of mesenchymal derived skeletal muscle precursors cells into functional myotubes in healthy and pathological conditions such as Duchenne's muscular dystrophy [42]. ...
... Cell viability was assessed by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay following published procedures [35]. Briefly, MSCs were seeded at 1 × 10 4 cells/cm 2 density in 96-well plastic plates. ...
The cellular microenvironment plays a critical role in the maintenance of bone marrow-derived mesenchymal
stem cells (BM-MSCs) and their subsequent cell lineage differentiation. Recent studies suggested that individuals with adipocyte-related metabolic disorders have altered function and adipogenic potential of adipose stem
cell subpopulations, primarily BM-MSCs, increasing the risk of heart attack, stroke or diabetes. In this study, we
explored the potential therapeutic effect of some of the most abundant non-euphoric compounds derived from
the Cannabis sativa plant (or phytocannabinoids) including tetrahydrocannabivarin (THCV), cannabidiol (CBD),
cannabigerol (CBG), cannabidiolic acid (CBDA) and cannabigerolic acid (CBGA), by analysing their pharmacological activity on the viability of endogenous BM-MSCs as well as their ability to alter BM-MSC proliferation and
differentiation into mature adipocytes. We provide evidence that CBD, CBDA, CBGA and THCV (5 µM) increase
the number of viable BM-MSCs; whereas only CBG (5 µM) and CBD (5 µM) alone or in combination promote maturation into adipocytes via distinct molecular mechanisms. These effects were revealed both in vitro
and in vivo. In addition, phytocannabinoids prevented the insulin signalling impairment induced by palmitate in
adipocytes differentiated from BM-MSCs. Our study highlights phytocannabinoids as a potential novel pharmacological tool to regain control of functional adipose tissue in unregulated energy homeostasis often occurring in metabolic disorders including type 2 diabetes mellitus (T2DM), aging and lipodystrophy
... Further studies suggest that CBG is a partial agonist of CB1 and CB2 [207][208][209]. CBG activates TRPV1, TRPV2, TRPV3, TRPV4, TRPA1, 5-HT 1a receptor, α2-adrenergic receptor, and PPARγ, while being a TRPM8 antagonist [210][211][212][213][214][215]. CBG has anti-inflammatory, anti-oxidative, and anti-nociceptive activities [117,209,213,216]. ...
... CBDA has low affinity for both CB1 and CB2 receptors, with moderate inhibition of adenylyl cyclase activity [209,229], and functions as an allosteric regulator on the 5-HT 1A receptor, resulting in anti-emetic effects [230][231][232][233]. In addition, it activates PPARα and PPARγ [212]. CBDA shows anti-nociceptive and anti-inflammatory effects that are in part mediated by COX-2 inhibition and activation of the TRPV1 channel [217,234,235]. ...
... Cannabigerolic Acid (CBGA) CBGA displays low affinity for both CB1 and CB2 receptors but causes a similar decrease in intracellular cAMP levels as ∆ 9 -THC [229]. Since CBGA can activate PPARs [212], it is expected to affect lipid metabolism [117]. A Cannabis sativa cultivar containing high levels of CBG and CBGA inhibited the activity of the aldose reductase enzyme, which catalyzes the reduction of glucose to sorbitol [239]. ...
Antibiotic resistance has become an increasing challenge in the treatment of various infectious diseases, especially those associated with biofilm formation on biotic and abiotic materials. There is an urgent need for new treatment protocols that can also target biofilm-embedded bacteria. Many secondary metabolites of plants possess anti-bacterial activities, and especially the phytocannabinoids of the Cannabis sativa L. varieties have reached a renaissance and attracted much attention for their anti-microbial and anti-biofilm activities at concentrations below the cytotoxic threshold on normal mammalian cells. Accordingly, many synthetic cannabinoids have been designed with the intention to increase the specificity and selectivity of the compounds. The structurally unrelated endocannabinoids have also been found to have anti-microbial and anti-biofilm activities. Recent data suggest for a mutual communication between the endocannabinoid system and the gut microbiota. The present review focuses on the anti-microbial activities of phytocannabinoids and endocannabinoids integrated with some selected issues of their many physiological and pharmacological activities.
... CBDA was reported to be 1,000 times more potent than CBD in stimulating ( 35 S)GTPγS binding at the 5-HT 1a receptor. Based on in silico docking experiments, it was predicted that CBDA, along with the cannabinoids CBGA and CBG, bind to PPARs (D'Aniello, et al., 2019). In vitro reporter assays carried out with CHO cells confirmed that all three minor cannabinoids activate PPARα and PPARγ (D'Aniello, et al., 2019). ...
... However, unlike Δ 9 -THC, it is not effective in recruiting βarr2 to the CB1 receptor (Navarro, et al., 2020). CBGA has important off target effects including activating PPARs (D'Aniello, et al., 2019). In addition, fractions of Cannabis sativa containing high amounts of CBG/CBGA inhibit the aldose reductase enzyme (Smeriglio, et al., 2018). ...
... While less in known about the therapeutic uses of CBGA compared with the other minor cannabinoids, it may play a role in controlling diabetes mellitus and preventing the cardiovascular complications that can accompany Type 2 diabetes (D'Aniello, et al., 2019). Through activation of PPARs, CBGA can improve lipid metabolism and reduce the accumulation of adipose tissue; thus reducing insulin resistance in the Type 2 patient (Gao, et al., 2015). ...
The medicinal use of Cannabis sativa L. can be traced back thousands of years to ancient China and Egypt. While marijuana has recently shown promise in managing chronic pain and nausea, scientific investigation of cannabis has been restricted due its classification as a schedule 1 controlled substance. A major breakthrough in understanding the pharmacology of cannabis came with the isolation and characterization of the phytocannabinoids trans -Δ ⁹ -tetrahydrocannabinol (Δ ⁹ -THC) and cannabidiol (CBD). This was followed by the cloning of the cannabinoid CB1 and CB2 receptors in the 1990s and the subsequent discovery of the endocannabinoid system. In addition to the major phytocannabinoids, Δ ⁹ -THC and CBD, cannabis produces over 120 other cannabinoids that are referred to as minor and/or rare cannabinoids. These cannabinoids are produced in smaller amounts in the plant and are derived along with Δ ⁹ -THC and CBD from the parent cannabinoid cannabigerolic acid (CBGA). While our current knowledge of minor cannabinoid pharmacology is incomplete, studies demonstrate that they act as agonists and antagonists at multiple targets including CB1 and CB2 receptors, transient receptor potential (TRP) channels, peroxisome proliferator-activated receptors (PPARs), serotonin 5-HT 1a receptors and others. The resulting activation of multiple cell signaling pathways, combined with their putative synergistic activity, provides a mechanistic basis for their therapeutic actions. Initial clinical reports suggest that these cannabinoids may have potential benefits in the treatment of neuropathic pain, neurodegenerative diseases, epilepsy, cancer and skin disorders. This review focuses on the molecular pharmacology of the minor cannabinoids and highlights some important therapeutic uses of the compounds.
... n. E1910 Promega, Milan, Italy) following published procedures [63]. ...
... The combination of the pivotal role played by PPARs in inflammation, lipidic and glycemic metabolism, and previously-observed interactions of eCBome-related congeners with PPARα and PPARγ [26,63] prompted us to perform an in silico study to evaluate whether 2-PG could act as a ligand at these nuclear receptors, using a combined approach of molecular docking and molecular dynamic (MD) simulations. As shown in Figure 4A,B, 2-PG in PPARα can recapitulate the polar interactions of a canonical agonist, involving a network of H-bonds with His440 (helix H10/11), Ser208 (Helix H3), and especially with Tyr464 (helix H12), a residue critical for PPAR full activation. ...
... Of note, 2-PG was inactive up to 25 µM on the human recombinant TRPV1 channel overexpressed in HEK-293 cells (data not shown), another reported target for 2-MAGs [78]. Nevertheless, our data regarding PPAR activation perfectly validate what was expected from the in silico analysis, and, therefore, also indirectly suggest that 1-PG, for which we could not find an enantiomerically pure commercial source to be tested in vitro, is also a likely PPARα agonist, for which, however, a possibly weaker activity at PPARγ could also be predicted (see also [63] as another example of how our in silico approach is usually perfectly validated by in vitro functional luciferase assays). These two compounds together were found here to have, in our cohort, circulating concentrations in the µM range, which is compatible with the concentrations needed for them to activate PPARα. ...
Akkermansia muciniphila is considered as one of the next-generation beneficial bacteria in the context of obesity and associated metabolic disorders. Although a first proof-of-concept of its beneficial effects has been established in the context of metabolic syndrome in humans, mechanisms are not yet fully understood. This study aimed at deciphering whether the bacterium exerts its beneficial properties through the modulation of the endocannabinoidome (eCBome). Circulating levels of 25 endogenous endocannabinoid-related lipids were quantified by liquid chromatography with tandem mass spectrometry (LC-MS/MS) in the plasma of overweight or obese individuals before and after a 3 months intervention consisting of the daily ingestion of either alive or pasteurized A. muciniphila. Results from multivariate analyses suggested that the beneficial effects of A. muciniphila were not linked to an overall modification of the eCBome. However, subsequent univariate analysis showed that the decrease in 1-Palmitoyl-glycerol (1-PG) and 2-Palmitoyl-glycerol (2-PG), two eCBome lipids, observed in the placebo group was significantly counteracted by the alive bacterium, and to a lower extent by the pasteurized form. We also discovered that 1- and 2-PG are endogenous activators of peroxisome proliferator-activated receptor alpha (PPARα). We hypothesize that PPARα activation by mono-palmitoyl-glycerols may underlie part of the beneficial metabolic effects induced by A. muciniphila in human metabolic syndrome.
... It is known that PPARs are ligand-dependent transcription factors that are involved in energy homeostasis and metabolism. They are expressed in tissues with high fatty acid catabolic activities, such as the heart, liver, kidneys and intestines, where they play a role in mediating fatty acid metabolism, gluconeogenesis and ketone body synthesis (D'Aniello et al. 2019). Since CBGA, CBD and CBG were found to be dual agonists of PPARa/c in a molecular docking study, these cannabinoids can potentially modulate lipid metabolism (D'Aniello et al. 2019). ...
... They are expressed in tissues with high fatty acid catabolic activities, such as the heart, liver, kidneys and intestines, where they play a role in mediating fatty acid metabolism, gluconeogenesis and ketone body synthesis (D'Aniello et al. 2019). Since CBGA, CBD and CBG were found to be dual agonists of PPARa/c in a molecular docking study, these cannabinoids can potentially modulate lipid metabolism (D'Aniello et al. 2019). The implication is that these cannabinoids can possibly be effective in the treatment of metabolic disorder, including conditions such as dyslipidaemia and Type 2 diabetes mellitus. ...
Cannabigerol (CBG) is one of the major phytocannabinoids present in Cannabis sativa L. but is presumed to be an artefact or degradation product of cannabigerolic acid (CBGA), the principal precursor of several cannabinoids. The growing interest in CBG has been attributed to its non-psychotropic properties, low cannabinoid receptor potency and relative abundance in some commercial Cannabis varieties. A broad pharmacological profile has been described, where CBG is reported to exhibit anti-inflammatory, anticancer, anti-oxidant, antimicrobial, neuroprotective and appetite-enhancing properties, among others. Previous reviews on CBG have been limited to either the pharmacological potential of the molecule, with little detail on the chemistry, or to advances in the analytical tools used to explore CBG content in a wide range of biological samples. The current review seeks to highlight the chemistry, biosynthesis, pharmacology and safety aspects of the molecule. Additionally, we provide new insights into, and critical evaluation of, the pharmacological interactions of CBG via different receptor sites based on in silico predictions, using retrieved 3D structures of alpha-2 adrenergic receptors from the Protein Data Bank (PDB). For the first time, a bibliometric overview of the literature was performed, and with the aid of scientometric tools it was possible to present a visual overview of the research trends over the years, assess research performance of countries, and delineate the research output trajectory, hotspots and voids. In-depth analysis of the published literature revealed that clinical trials establishing the efficacy, safety and side-effects of CBG therapy in specific disease conditions are limited, as well as industry-friendly quality control procedures for CBG-enriched cannabis extracts.
... Cannabinoids are known to interact or crosstalk with a family of peroxisome proliferated activator receptors (PPARs) including three distinct subtypes namely PPAR-α, PPAR-β/δ, and PPAR-γ that are encoded by distinct genes and are regulated by steroids and lipid metabolites and control lipid and glucose homeostasis and inflammatory responses [40,65,67,68]. The activation of CB2R on the surface of the cells triggers the intracellular signaling cascade that leads to the activation of PPARs [69]. ...
... Interestingly, BCP by activating CB2R as well as both of the PPAR isoforms (PPAR-α and PPAR-γ) offers a promising polypharmacological multitargeted approach for its pharmaceutical development and clinical application. Many studies demonstrated that dual agonist action on PPAR-α and PPAR-α are superior for metabolic control and dyslipidemia [68,72]. Considering the concerns and potential for the adverse effects with clinically available PPAR-γ agonists, BCP could be a safer alternative over synthetics being CB2R-selective agonist along with additional agonism on PPAR-α and PPAR-γ and being natural, non-toxicating, and devoid of the adverse effects of synthetics cannabinoids and PPAR activators. ...
Diabetes mellitus (DM), a metabolic disorder is one of the most prevalent chronic diseases worldwide across developed as well as developing nations. Hyperglycemia is the core feature of the type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM), following insulin deficiency and impaired insulin secretion or sensitivity leads insulin resistance (IR), respectively. Genetic and environmental factors attributed to the pathogenesis of DM and various therapeutic strategies are available for the prevention and treatment of T2DM. Among the numerous therapeutic approaches, the health effects of dietary/nutraceutical approach due to the presence of bioactive constituents, popularly termed phytochemicals are receiving special interest for pharmacological effects and therapeutic benefits. The phytochemicals classes, in particular sesquiterpenes received attention because of potent antioxidant, anti-inflammatory, and antihyperglycemic effects and health benefits mediating modulation of enzymes, receptors, and signaling pathways deranged in DM and its complications. One of the terpene compounds, β-caryophyllene (BCP), received enormous attention because of its abundant occurrence, non-psychoactive nature, and dietary availability through consumption of edible plants including spices. BCP exhibit selective full agonism on cannabinoid receptor type 2 (CB2R), an important component of endocannabinoid system, and plays a role in glucose and lipid metabolism and represents the newest drug target for chronic inflammatory diseases. BCP also showed agonist action on peroxisome proliferated activated receptor subtypes, PPAR-α and PPAR-γ, the main target of currently used fibrates and imidazolidinones for dyslipidemia and IR, respectively. Many studies demonstrated its antioxidant, anti-inflammatory, organoprotective, and antihyperglycemic properties. In the present review, the plausible therapeutic potential of BCP in diabetes and associated complications has been comprehensively elaborated based on experimental and a few clinical studies available. Further, the pharmacological and molecular mechanisms of BCP in diabetes and its complications have been represented using synoptic tables and schemes. Given the safe status, abundant natural occurrence, oral bioavailability, dietary use and pleiotropic properties modulating receptors and enzymes, BCP appears as a promising molecule for diabetes and its complications.
... A recent research work by D'Aniello and colleagues was aimed at investigating the interaction of cannabinoids with peroxisome proliferator-activated recep-tors (PPARs) using in silico and in vitro techniques [111]. This family of nuclear receptors is involved in the regulation of energy homeostasis and metabolism by interfering with fatty acid catabolism, gluconeogenesis and ketone body synthesis [112]. ...
... Even though CBD has been reported to be a PPARγ activator, according to the computed values, both D9-THC and CBDA appear to be favored in interacting with their target [117]. CBD was described as a "poor ligand" for PPARα, and this was confirmed by the estimated binding score [111]. More interestingly, concerning the activity on aldose reductase, Smeriglio and colleagues reported 1.49 and 1.37 µg/ml in vitro IC 50 values for CBD-rich and CBDArich extracts but no data were reported for D9-THC [110]. ...
Cannabidiol (CBD) is a non-psychotropic phytocannabinoid which represents one of the constituents of the “phytocomplex” of Cannabis sativa. This natural compound is attracting growing interest since when CBD-based remedies and commercial products were marketed. This review aims at exhaustively addressing the extractive and analytical approaches that have been developed for the isolation and quantification of CBD. Recent updates on cutting-edge technologies were critically examined in terms of yield, sensitivity, flexibility and performances in general, and are reviewed alongside original representative results. As an add-on to currently available contributions in the literature, the evolution of novel, efficient synthetic approaches for the preparation of CBD, a procedure which is appealing for the pharmaceutical industry, is also discussed. Moreover, given the increasing interest on the therapeutic potential of CBD and the limited understanding of the undergoing biochemical pathways, the reader will be updated about recent in silico studies on the molecular interactions of CBD towards several different targets attempting to fill this gap. Computational data retrieved from the literature have been integrated with novel in silico experiments, critically discussed to provide a comprehensive and updated overview on the undebatable potential of CBD and its therapeutic profile.
... In a computational approach, CBD was considered a poor ligand for the PPARα receptor type [206]. In the same study, the CBD derivatives cannabidiolic acid (CBDA; Figure 1), cannabigerolic acid (CBGA; Figure 1), and cannabigerol (CBG; Figure 1) were predicted dual PPARα/γ by performing MD simulations and docking using the crystallographic structures of PPARα and PPARγ, which was subsequently confirmed by luciferase reporter gene assays [206]. ...
... In a computational approach, CBD was considered a poor ligand for the PPARα receptor type [206]. In the same study, the CBD derivatives cannabidiolic acid (CBDA; Figure 1), cannabigerolic acid (CBGA; Figure 1), and cannabigerol (CBG; Figure 1) were predicted dual PPARα/γ by performing MD simulations and docking using the crystallographic structures of PPARα and PPARγ, which was subsequently confirmed by luciferase reporter gene assays [206]. Recently, Rock et al. [125] showed that the anti-nausea effect of another phytocannabinoid, THCA, was blocked by a PPARα antagonist, whereas the effect of CBDA was mediated by the 5-HT 1a . ...
Cannabinoids have shown to exert their therapeutic actions through a variety of targets. These include not only the canonical cannabinoid receptors CB1R and CB2R but also related orphan G protein-coupled receptors (GPCRs), ligand-gated ion channels, transient receptor potential (TRP) channels, metabolic enzymes, and nuclear receptors. In this review, we aim to summarize reported compounds exhibiting their therapeutic effects upon the modulation of CB1R and/or CB2R and the nuclear peroxisome proliferator-activated receptors (PPARs). Concomitant actions at CBRs and PPARα or PPARγ subtypes have shown to mediate antiobesity, analgesic, antitumoral, or neuroprotective properties of a variety of phytogenic, endogenous, and synthetic cannabinoids. The relevance of this multitargeting mechanism of action has been analyzed in the context of diverse pathologies. Synergistic effects triggered by combinatorial treatment with ligands that modulate the aforementioned targets have also been considered. This literature overview provides structural and pharmacological insights for the further development of dual cannabinoids for specific disorders.
... Natural compounds represent an invaluable source of bioactive compounds potentially able to act on multiple-related targets due to their versatile scaffolds and functional groups. By continuing our search for multiligand agents from natural sources [16][17][18], we focused our attention in this work on compounds potentially able to bind and activate nuclear receptors such as RXRα, RARα, and PPARα/γ, because they may have therapeutical potential for the treatment of neurological diseases such as Alzheimer's disease. With this aim, we used a ligand-based approach [19] to screen and identify possible candidates in our in house-developed database StOrMoDB (Structurally Oriented Molecular DataBase) of marine natural compounds and found (−)-Muqubilin A (Muq) as a potential hit. ...
The nuclear receptors (NRs) RARα, RXRα, PPARα, and PPARγ represent promising pharmacological targets for the treatment of neurodegenerative diseases. In the search for molecules able to simultaneously target all the above-mentioned NRs, we screened an in-house developed molecular database using a ligand-based approach, identifying (−)-Muqubilin (Muq), a cyclic peroxide norterpene from a marine sponge, as a potential hit. The ability of this compound to stably and effectively bind these NRs was assessed by molecular docking and molecular dynamics simulations. Muq recapitulated all the main interactions of a canonical full agonist for RXRα and both PPARα and PPARγ, whereas the binding mode toward RARα showed peculiar features potentially impairing its activity as full agonist. Luciferase assays confirmed that Muq acts as a full agonist for RXRα, PPARα, and PPARγ with an activity in the low- to sub-micromolar range. On the other hand, in the case of RAR, a very weak agonist activity was observed in the micromolar range. Quite surprisingly, we found that Muq is a positive allosteric modulator for RARα, as both luciferase assays and in vivo analysis using a zebrafish transgenic retinoic acid (RA) reporter line showed that co-administration of Muq with RA produced a potent synergistic enhancement of RARα activation and RA signaling.
... As previously mentioned, accumulating evidence indicates that most cannabinoid (both endo and phyto) molecules interact with PPARs by directly binding to these nuclear receptors, by the catabolism of cannabinoids to PPAR-activating chemicals or by indirectly activating PPARs via distinct molecular signaling pathways (reviewed in [62]). It was even suggested that non-D 9 -tetrahydrocannbidiol (THC) phytocannabinoids, such as cannabigerolic acid (CBGA), cannabidiolic acid (CBDA), and cannabigerol (CBG), directly activate PPARa, modulate its target genes associated with lipid metabolism, and reduce lipid accumulation in hepatocytes [63]. Herein, we report that AM6545 neither binds nor activates (directly or allosterically) PPARa, suggesting that its effect in modulating PPARa expression and activity is mediated via blocking the CB 1 R in hepatocytes. ...
Objective:
The endocannabinoid (eCB) system is increasingly recognized as being of crucial importance in obesity-related hepatic steatosis. eCBs, via activation of the hepatic cannabinoid-1 receptor (CB1R), modulate lipogenesis and fatty acid oxidation. However, the underlying molecular mechanisms are largely unknown.
Methods:
We combined unbiased bioinformatics techniques, mouse genetic manipulations, multiple pharmacological, molecular and cellular biology approaches, and genomic sequencing to systematically decipher the role of hepatic CB1R in modulating fat utilization in the liver, and explored the downstream molecular mechanisms.
Results:
Using an unbiased normalized phylogenetic profiling analysis, we found that CB1R evolutionarily coevolves with peroxisome proliferator-activated receptor-alpha (PPARα), a key regulator of hepatic lipid metabolism. In diet-induced obese (DIO) mice, peripheral CB1R blockade (using AM6545) induced the reversal of hepatic steatosis and improved liver injury in WT, but not in PPARα-/- mice. The antisteatotic effect, mediated by AM6545 in WT DIO mice, was accompanied by increased hepatic expression and activity of PPARα as well as elevated hepatic levels of the PPARα-activating eCB-like molecules, oleoylethanolamine and palmitoylethanolamide. Moreover, AM6545 was unable to rescue hepatic steatosis in DIO mice lacking liver sirtuin 1 (SIRT1), an upstream regulator of PPARα. Both of these signaling molecules were modulated by CB1R, as measured in hepatocytes exposed to lipotoxic conditions or treated with CB1R agonists in the absence/presence of AM6545. Furthermore, using microRNA transcriptomic profiling, we found that CB1R regulated the hepatic expression, acetylation, and transcriptional activity of p53, resulting in the enhanced expression of miR-22, which was found to specifically target SIRT1 and PPARα.
Conclusions:
We provide a strong evidence for a functional role of the p53/miR-22/SIRT1/PPARα signaling pathway in potentially mediating the antisteatotic effect of peripherally restricted CB1R blockade.
... PPARγ receptors in its role on neuroinflammation. In 2019, in vitro modeling of phytocannabinoids suggested CBG as a dual PPARα/γ agonist first through computer modeling and prediction, and then confirmation in HepG2 (human liver epithelial-like) and 3T3L1 (mouse embryo fibroblast) cell lines(D'Aniello et al., 2019). ...
Medical cannabis and individual cannabinoids, such as tetrahydrocannabinol (THC) and cannabidiol (CBD), are receiving growing attention in both the media and the scientific literature. The Cannabis plant, however, produces over 100 different cannabinoids, and cannabigerol (CBG) serves as the precursor molecule for the most abundant phytocannabinoids. CBG exhibits affinity and activity characteristics between THC and CBD at the cannabinoid receptors, but appears to be unique in its interactions with alpha-2 adrenoceptors and 5-HT1A Studies indicate that CBG may have therapeutic potential in treating neurological disorders (e.g., Huntington's Disease, Parkinson's Disease, and multiple sclerosis), inflammatory bowel disease, as well as having antibacterial activity. There is growing interest in the commercial use of this unregulated phytocannabinoid. This review focuses on the unique pharmacology of CBG, our current knowledge of its possible therapeutic utility, and its potential toxicological hazards. Significance Statement Cannabigerol (CBG) is currently being marketed as a dietary supplement and, as with cannabidiol (CBD) before, many claims are being made about its benefits. Unlike CBD, however, little research has been performed on this unregulated molecule, and much of what is known warrants further investigation to identify potential areas of therapeutic uses and hazards.
... NAEs and 2-MAGs are not the only eCB-like mediators to have been discovered to date, and other families of long-chain fatty acid amide families, in some cases sharing catabolic enzymes with NAEs, and molecular targets with cannabinoids and NAEs, have come to the limelight. These include: (i) the primary fatty acid amides, such as the sleep-inducing factor, oleamide, a FAAH substrate that was suggested to activate CB1 (Leggett et al. 2004), and, like some unsaturated NAEs, to antagonize the TRPV2 channel; (ii) the N-acylated aminoacids, or lipoaminoacids, such as N-oleoyl-and N-arachidonoylglycine, which, like some cannabinoids, have been suggested to act via GPR18, peroxisome proliferator activated receptor α (PPARα) and glycine receptors (Burstein 2018;D'Aniello et al. 2019;Donvito et al. 2019) and are inactivated by FAAH (and hence may inhibit AEA inactivation by substrate competition, thereby indirectly activating cannabinoid receptors) (Bradshaw et al. 2009;Donvito et al. 2019), whereas other members of this family have been found to activate TRPV1-4 channels (Raboune et al. 2014); (iii) the N-acyl-taurines, which activate GPR119 as well as, like several cannabinoids, TRPV1 and TRPV4 channels, and are again inactivated by FAAH (Saghatelian et al. 2006;Grevengoed et al. 2019); (iv) N-acylated neurotransmitters, such as N-oleoyl-and N-arachidonoylserotonin, which antagonise TRPV1 and/or inhibit FAAH (Ortar et al. 2007;Verhoeckx et al. 2011), or N-oleoyland N-arachidonoyl-dopamine, which instead activate CB1 and/or TRPV1 (Bisogno et al. 2000Chu et al. 2003), and were recently shown to also act as inverse agonists at GPR6 (Shrader and Song 2020), a property shared by CBD and CBDV (Laun et al. 2018(Laun et al. , 2019; and (v) the enzymatic oxygenation products of the polyunsaturated homologues of some of the long chain fatty acid derivatives listed above; these are, in particular (a) lipoxygenase (LOX) and cytochrome p450 oxygenase products-the molecular targets of which still include CB1, CB2 and TRPV1, in the case of AEA and 2-AG derivatives (Rouzer and Marnett 2011), and (b) cyclooxygenase-2 (COX-2) and prostaglandin synthase products of AEA and 2-AG, known as prostamides and prostaglandin glycerol esters, respectively, which instead act at non-cannabinoid (and non-prostanoid) receptors (Rouzer and Marnett 2011;Urquhart et al. 2015). The complex signaling apparatus including all these eCB-like mediators, the eCBs, and their often redundant receptors and metabolic enzymes, is now referred to as the "expanded eCB system" or "endocannabinoidome" (eCBome). ...
The full understanding of the real therapeutic potential of cannabis preparations and of the dangers that their recreational use pose can only stem from the assessment of the chemical composition of such preparations and the knowledge of the pharmacology of their main components, the cannabinoids. Much in the same way cannabis is not just one plant, cannabinoids were not made all equal, and profound differences exist between the pharmacological properties of Δ9-tetrahydrocannabinol (Δ9-THC), the most abundant euphoric and psychotropic cannabinoid, and the other over one hundred natural products belonging to the same class of compounds. So far, only the bioactivity of Δ9-THC, the main component of marijuana, and a handful of cannabinoids, including cannabidiol (CBD), the most abundant cannabinoid in industrial varieties of cannabis, has been thoroughly investigated. While pharmacological studies on Δ9-THC led to the discovery of cannabinoid receptors, endocannabinoids (eCBs) and the endocannabinoid (eCB) system, which underlie most of the effects of this compound in mammals, the mechanisms of action of CBD and other non-euphoric cannabinoids are much more complex and are based on several molecular targets, including, but not limited to, the proteins (receptors and enzymes) of the “expanded eCB system,” or “endocannabinoidome” (eCBome), and hence on their capability of modulating the actions or tissue concentrations of eCB-related lipid mediators. In this article, we discuss to what extent the pharmacology of cannabinoids, and of Δ9-THC and CBD in particular, can be explained by the existence of the eCB system and the eCBome.
... After incubation with D-luciferin at 37°C for 10 min, luciferase activity was measured in each well using Spectramax M3 (Molecular devices, USA). Rosiglitazone and luteolin have been reported as a strong agonist of PPARs (D'Aniello et al., 2019) and AhR (Koper et al., 2019), repectively, which were used as positive control in the present experiments. ...
UDP-glucuronosyltransferase 1A1 (UGT1A1) is an essential enzyme in mammals that is responsible for detoxification and metabolic clearance of the endogenous toxin bilirubin and a variety of xenobiotics, including some crucial therapeutic drugs. Discovery of potent and safe UGT1A1 inducers will provide an alternative therapy for ameliorating hyperbilirubinaemia and drug-induced hepatoxicity. This study aims to find efficacious UGT1A1 inducer(s) from natural flavonoids, and to reveal the mechanism involved in up-regulating of this key conjugative enzyme by the flavonoid(s) with strong UGT1A1 induction activity. Among all the tested flavonoids, neobavaisoflavone (NBIF) displayed the most potent UGT1A1 induction activity, while its inductive effects were confirmed by both western blot and glucuronidation activity assays. A panel of nuclear receptor reporter assays demonstrated that NBIF activated PPARα and PPARγ in a dose-dependent manner. Meanwhile, we also found that NBIF could up-regulate the expression of PPARα and PPARγ in hepatic cells, suggesting that the induction of UGT1A1 by NBIF was mainly mediated by PPARs. In silico simulations showed that NBIF could stably bind on pocket II of PPARα and PPARγ. Collectively, our results demonstrated that NBIF is a natural inducer of UGT1A1, while this agent induced UGT1A1 mainly via activating and up-regulating PPARα and PPARγ. These findings suggested that NBIF can be used as a promising lead compound for the development of more efficacious UGT1A1 inducers to treat hyperbilirubinaemia and UGT1A1-associated drug toxicities.
... Cell viability was assessed by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Cat. M2003 Sigma Aldrich) assay following published procedures [41]. ...
Neuropathic pain (NP) remains an untreatable disease due to the complex pathophysiology that involves the whole pain neuraxis including the forebrain. Sensory dysfunctions such as allodynia and hyperalgesia are only part of the symptoms associated with neuropathic pain that extend to memory and affectivity deficits. The development of multi-target molecules might be a promising therapeutic strategy against the symptoms associated with NP. 2-pentadecyl-2-oxazoline (PEA-OXA) is a plant-derived agent, which has shown effectiveness against chronic pain and associated neuropsychiatric disorders. The molecular mechanisms by which PEA-OXA exerts its effects are, however, only partially known. In the current study, we show that PEA-OXA, besides being an alpha2 adrenergic receptor antagonist, also acts as a modulator at histamine H3 receptors, and report data on its effects on sensory, affective and cognitive symptoms associated with the spared nerve injury (SNI) model of neuropathic pain in mice. Treatment for 14 days with PEA-OXA after the onset of the symptoms associated with neuropathic pain resulted in the following effects: (i) allodynia was decreased; (ii) affective/cognitive impairment associated with SNI (depression, spatial, and working memories) was counteracted; (iii) long-term potentiation in vivo in the lateral entorhinal cortex-dentate gyrus (perforant pathway, LPP) was ameliorated, (iv) hippocampal glutamate, GABA, histamine, norepinephrine and dopamine level alterations after peripheral nerve injury were reversed, (v) expression level of the TH positive neurons in the Locus Coeruleus were normalized. Thus, a 16-day treatment with PEA-OXA alleviates the sensory, emotional, cognitive, electrophysiological and neurochemical alterations associated with SNI-induced neuropathic pain.
... In addition, a very relevant finding is that phytocannabinoids activate nuclear receptors such as those of the PPAR family. While the binding of acidic phytocannabinoids to PPAR-γ was initially discovered [154], recent data show that phytocannabinoids may be dual PPAR-γ/PPAR-alpha agonists [193]. ...
While natural Δ⁹-tetrahidrocannabinol (Δ⁹THC), cannabidiol (CBD), and their therapeutic potential have been extensively researched, some cannabinoids have not been widely investigated. The present article compiles data from the literature that highlights research on and the therapeutic possibilities of lesser known phytocannabinoids, which we have divided into varinic, acidic, and “minor” (i.e., cannabinoids that are not present in high quantities in common varieties of Cannabis sativa L). A growing interest in these compounds, which are enriched in some cannabis varieties, has already resulted in enough preclinical information to show that they are promising therapeutic agents for a variety of diseases. Each phytocannabinoid has a “preferential” mechanism of action, and often target the cannabinoid receptors CB1 and/or CB2. The recent resolution of the structure of cannabinoid receptors demonstrates the atypical nature of cannabinoid binding, and that different binding modes depend on the agonist or partial agonist/inverse agonist, which allows for differential signaling, even acting on the same cannabinoid receptor. In addition, other players and multiple signaling pathways may be targeted/engaged by phytocannabinoids, thereby expanding the mechanistic possibilities for therapeutic use.
... In this regard, it has been demonstrated that synthetic and plant-derived cannabinoids attenuate neuroinflammation and neurodegeneration in animal models of acute or chronic neurodegenerative disorders through activation of cannabinoid receptors and PPARγ pathway [81][82][83][84]. While natural and synthetic phytocannabinoids including ∆ 9 -tetrahydrocannabinol (∆ 9 -THC), Cannabidiol (CBD), ∆9-THC acid, ajulemic acid, quinone derivatives [85][86][87][88][89], and the recently identified cannabimovone [90] are PPARγ agonists, the acidic derivatives cannabigerolic and cannabidiolic acids exhibit a dual agonist profile [91] (Figure 4). The endocannabinoid anandamide (AEA) activates both PPARα [92] and PPARγ [93], albeit its efficacy and potency toward PPARα are higher in comparison to PPARγ. ...
Peroxisome proliferator-activated receptors (PPARs) are a family of nuclear receptors including PPARα, PPARγ, and PPARβ/δ, acting as transcription factors to regulate the expression of a plethora of target genes involved in metabolism, immune reaction, cell differentiation, and a variety of other cellular changes and adaptive responses. PPARs are activated by a large number of both endogenous and exogenous lipid molecules, including phyto- and endo-cannabinoids, as well as endocannabinoid-like compounds. In this view, they can be considered an extension of the endocannabinoid system. Besides being directly activated by cannabinoids, PPARs are also indirectly modulated by receptors and enzymes regulating the activity and metabolism of endocannabinoids, and, vice versa, the expression of these receptors and enzymes may be regulated by PPARs. In this review, we provide an overview of the crosstalk between cannabinoids and PPARs, and the importance of their reciprocal regulation and modulation by common ligands, including those belonging to the extended endocannabinoid system (or “endocannabinoidome”) in the control of major physiological and pathophysiological functions.
... Obesity is a chronic disease affecting human populations worldwide over the past several decades, accompanied by metabolic syndromes (D'Aniello et al., 2019). Numerous drugs have been permitted for treating metabolic syndromes associated with obesity. ...
To investigate the effects of dietary supplementation of WGBR on lipid metabolism, C57BL/6J mice were fed a normal chow diet, a high-fat diet based on corn starch, a high-fat diet based on white rice, and low or high dosage of black rice for 12 weeks. WGBR alleviated high-fat diet-induced increase in body weight and visceral weight; reduced serum TC, TG, and non-HDL-C/HDL-C levels; and increased fecal sterols and fat excretion. Furthermore, WGBR decreased hepatic TG and TC contents through the pathway of AMPK. This, in turn, decreased PPARγ, SREBP-1c, FASN, ACC, and HMGCOR-A and increased LXRα, PPARα, and CPT1α at the gene level. Further, it lowered PPARγ and elevated PPARα, p-ACC/ACC, and p-AMPKα/AMPKα at the protein level. Additionally, WGBR treatment decreased gene expression of NPC1L1, ACAT2, MTTP, which regulated lipid absorption in the intestine and preserved CYP7A1, ABCG5/8 that transported cholesterol from the liver and enterocytes to the intestinal lumen.
... Cell viability assay was performed as described in [51] on Hek-293 and Caco2 cells using βG16P 0.25 and 0.5 mM for 18 h. ...
A large number of mutations causing PMM2-CDG, which is the most frequent disorder of glycosylation, destabilize phosphomannomutase2. We looked for a pharmacological chaperone to cure PMM2-CDG, starting from the structure of a natural ligand of phosphomannomutase2, α-glucose-1,6-bisphosphate. The compound, β-glucose-1,6-bisphosphate, was synthesized and characterized via 31P-NMR. β-glucose-1,6-bisphosphate binds its target enzyme in silico. The binding induces a large conformational change that was predicted by the program PELE and validated in vitro by limited proteolysis. The ability of the compound to stabilize wild type phosphomannomutase2, as well as frequently encountered pathogenic mutants, was measured using thermal shift assay. β-glucose-1,6-bisphosphate is relatively resistant to the enzyme that specifically hydrolyses natural esose-bisphosphates.
... The study established that they act as full or partial agonists on PPARα/γ isoforms. Effects on downstream gene transcription in adipocytes and hepatocytes were also noted, further certifying their roles as functional dual agonists [80]. It is already known that peroxisome proliferator-activated receptor agonists such as rosiglitazone and pioglitazone are used to treat diabetes to improve the pathogenesis of insulin resistance and hyperglycemia; therefore, CBGA can be considered a good candidate for the treatment of diabetes complications [127]. ...
The most important discoveries in pharmacology, such as certain classes of analgesics or chemotherapeutics, started from natural extracts which have been found to have effects in traditional medicine. Cannabis, traditionally used in Asia for the treatment of pain, nausea, spasms, sleep, depression, and low appetite, is still a good candidate for the development of new compounds. If initially all attention was directed to the endocannabinoid system, recent studies suggest that many of the clinically proven effects are based on an intrinsic chain of mechanisms that do not necessarily involve only cannabinoid receptors. Recent research has shown that major phytocannabinoids and their derivatives also interact with non-cannabinoid receptors such as vanilloid receptor 1, transient receptor ankyrin 1 potential, peroxisome proliferator-activated receptor-gamma or glitazone receptor, G55 protein-coupled receptor, and nuclear receptor, producing pharmacological effects in diseases such as Alzheimer’s, epilepsy, depression, neuropathic pain, cancer, and diabetes. Nonetheless, further studies are needed to elucidate the precise mechanisms of these compounds. Structure modulation of phytocannabinoids, in order to improve pharmacological effects, should not be limited to the exploration of cannabinoid receptors, and it should target other courses of action discovered through recent research.
... In general, the ability of rare pCBs to activate CB 2 may have a major impact on anti-inflammatory and immunomodulatory processes [54,55]. Regarding other eCB-binding receptors, there is growing evidence to suggest that pCBs modulate the activity of GPR55, PPARs and TRPs [56,57], the latter of which are deeply involved in skin sensation, homeostasis and inflammation [58]. Consistent with this evidence, CBG and THCV were shown to have a high effectiveness in human TRPV1 that was over-expressed by HEK-293 cells, as did CBC, albeit to a lesser extent [41]. ...
The decriminalization and legalization of cannabis has paved the way for investigations into the potential of the use of phytocannabinoids (pCBs) as natural therapeutics for the treatment of human diseases. This growing interest has recently focused on rare (less abundant) pCBs that are non-psychotropic compounds, such as cannabigerol (CBG), cannabichromene (CBC), Δ9-tetrahydrocannabivarin (THCV) and cannabigerolic acid (CBGA). Notably, pCBs can act via the endocannabinoid system (ECS), which is involved in the regulation of key pathophysiological processes, and also in the skin. In this study, we used human keratinocytes (HaCaT cells) as an in vitro model that expresses all major ECS elements in order to systematically investigate the effects of CBG, CBC, THCV and CBGA. To this end, we analyzed the gene and protein expression of ECS components (receptors: CB1, CB2, GPR55, TRPV1 and PPARα/γ/δ; enzymes: NAPE-PLD, FAAH, DAGLα/β and MAGL) using qRT-PCR and Western blotting, along with assessments of their functionality using radioligand binding and activity assays. In addition, we quantified the content of endocannabinoid(-like) compounds (AEA, 2-AG, PEA, etc.) using UHPLC-MS/MS. Our results demonstrated that rare pCBs modulate the gene and protein expression of distinct ECS elements differently, as well as the content of endocannabinoid(-like) compounds. Notably, they all increased CB1/2 binding, TRPV1 channel stimulation and FAAH and MAGL catalytic activity. These unprecedented observations should be considered when exploring the therapeutic potential of cannabis extracts for the treatment of human skin diseases.
... Since the ligand binding domains among PPARs are 60-70% identical (100), phytochemicals may act as dual agonists for PPARs or as pan agonists. For example, D'Aniello et al. identified cannabigerolic acid, cannabidiolic acid and cannabigerol from C. sativa as PPARα/γ dual agonists (101). Amorfrutin has binding affinities for PPARα, PPARβ, and PPARγ (66). ...
The consumption of phytochemicals, bioactive compounds in fruits and vegetables, has been demonstrated to ameliorate obesity and related metabolic symptoms by regulating specific metabolic pathways. This review summarizes the progress made in our understanding of the potential of phytochemicals as metabolic signals: we discuss herein selected molecular mechanisms which are involved in the occurrence of obesity that may be regulated by phytochemicals. The focus of our review highlights the regulation of transcription factors toll like receptor 4 (TLR4), nuclear factor (erythroid-derived 2)-like 2 (Nrf2), the peroxisome proliferator-activated receptors (PPARs), fat mass and obesity-associated protein (FTO) and regulation of microRNAs (miRNA). In this review, the effect of phytochemicals on signaling pathways involved in obesity were discussed on the basis of their chemical structure, suggesting molecular mechanisms for how phytochemicals may impact these signaling pathways. For example, compounds with an isothiocyanate group or an α, β-unsaturated carbonyl group may interact with the TLR4 signaling pathway. Regarding Nrf2, we examine compounds possessing an α, β-unsaturated carbonyl group which binds covalently with the cysteine thiols of Keap1. Additionally, phytochemical activation of PPARs, FTO and miRNAs were summarized. This information may be of value to better understand how specific phytochemicals interact with specific signaling pathways and help guide the development of new drugs to combat obesity and related metabolic diseases.
... Δ 9 -THCA was found to activate PPARγ-dependent pathway and prevent 3nitropropionic acid (a mitochondrial toxin) induced striatal degradation, astrogliosis, microgliosis, and increased proinflammatory markers while improving motor functions in mice [124]. Other in silico studies have identified phytocannabinoids like cannabidiolic acid, cannabigerolic acid and cannabigerol as dual agonists of PPARα/γ with an ability to modulate lipid metabolism and protect metabolic diseases [125]. ...
The intense research interests have been observed in establishing PPAR gamma as a therapeutic target for diabetes. However, PPARγ is also emerging as an important therapeutic target for varied diseased states other than type2 diabetes like neurodegenerative disorders, cancer, spinal cord injury, asthma, and cardiovascular problems. Furthermore, glistazones, the synthetic thiazolidinediones, also known as insulin sensitizers are the largely studied PPARγ agonist and the only one approved for the treatment of type 2 diabetes. However, they are loaded with side effects like fluid retention, obesity, hepatic failure, bone fractures and cardiac failure; which restricted their clinical application. Medicinal plants used traditionally are the sources of bioactive compounds to be used for the development of successful drugs and many structurally diverse natural molecules are already established as PPARγ agonists. These natural partial agonists when compared to full agonists synthetic thiazolidinediones led to weaker PPARγ activation with lesser side effects but are not thoroughly investigated. Their thorough characterization and elucidation of mechanistic activity might prove beneficial for counteracting diseases by modulating PPARγ activity through dietary changes. We aim to review the therapeutic significance of PPARγ for ailments other than diabetes and to highlight natural molecules with potential PPARγ agonistic activity.
... Relevant for this paper is the physiologically-relevant interaction discovered for the two cannabinoid receptors, because they are able to form heteromers (CB 1/ 2 RHets) [8,9]. Other possible targets that have already been described are vanilloid cell surface channels and peroxisome proliferator-activated receptor gamma (PPARγ) [10][11][12]. Orphan GPCRs that share homology with cannabinoid receptors and/or are in vitro modulated by cannabinoids are also potential targets of phytocannabinoids; two relevant examples are GPR55 and GPR18 [13][14][15][16][17][18]. A nice account of the complex scenario due to both the variety of potential targets of phytocannabinoids and the fact that a given compound may act in different targets is provided in [19]. ...
Background
Recent approved medicines whose active principles are Δ⁹Tetrahidrocannabinol (Δ⁹-THC) and/or cannabidiol (CBD) open novel perspectives for other phytocannabinoids also present in Cannabis sativa L. varieties. Furthermore, solid data on the potential benefits of acidic and varinic phytocannabinoids in a variety of diseases are already available. Mode of action of cannabigerol (CBG), cannabidiolic acid (CBDA), cannabigerolic acid (CBGA), cannabidivarin (CBDV) and cannabigerivarin (CBGV) is, to the very least, partial.
Hypothesis/Purpose
Cannabinoid CB1 or CB2 receptors, which belong to the G-protein-coupled receptor (GPCR) family, are important mediators of the action of those cannabinoids. Pure CBG, CBDA, CBGA, CBDV and CBGV from Cannabis sativa L. are differentially acting on CB1 or CB2 cannabinoid receptors.
Study Design
Determination of the affinity of phytocannabinoids for cannabinoid receptors and functional assessment of effects promoted by these compounds when interacting with cannabinoid receptors.
Methods
A heterologous system expressing the human versions of CB1 and/or CB2 receptors was used. Binding to membranes was measured using radioligands and binding to living cells using a homogenous time resolved fluorescence resonance energy transfer (HTRF) assay. Four different functional outputs were assayed: determination of cAMP levels and of extracellular-signal-related-kinase phosphorylation, label-free dynamic mass redistribution (DMR) and ß-arrestin recruitment.
Results
Affinity of cannabinoids depend on the ligand of reference and may be different in membranes and in living cells. All tested phytocannabinoids have agonist-like behavior but behaved as inverse-agonists in the presence of selective receptor agonists. CBGV displayed enhanced potency in many of the functional outputs. However the most interesting result was a biased signaling that correlated with differential affinity, i.e. the overall results suggest that the binding mode of each ligand leads to specific receptor conformations underlying biased signaling outputs.
Conclusion
Results here reported and the recent elucidation of the three-dimensional structure of CB1 and CB2 receptors help understanding the mechanism of action that might be protective and the molecular drug-receptor interactions underlying biased signaling.
Rationale
This study evaluated the potential of combined cannabis constituents to reduce nausea.
Objectives
Using the lithium chloride (LiCl)-induced conditioned gaping model of nausea in male rats, we aimed to:
1) Determine effective anti-nausea doses of cannabidiol (CBD)
2) Determine effectiveness and the mechanism of action of combined subthreshold doses of CBD and Δ⁹-tetrahydrocannabinol (THC)
3) Determine effective doses of synthetic cannabidiolic acid (CBDA)
4) Determine effective doses of synthetic tetrahydrocannabinolic acid (THCA)
5) Determine the mechanism of action for THCA
6) Determine effectiveness and the mechanism of action of combined subthreshold doses of CBDA and THCA
Results
CBD (0.5–5 mg/kg, intraperitoneal [i.p.]) reduces LiCl-induced conditioned gaping (but 0.1, 20, 40 mg/kg are ineffective). Combined subthreshold doses of CBD (0.1 mg/kg, i.p.) and THC (0.1 mg/kg, i.p.) produce suppression of conditioned gaping, and this effect is blocked by administration of either WAY100635 (a serotonin 1A [5-HT1A]) receptor antagonist or SR141716 (SR; a CB1 receptor antagonist). THCA (0.01 mg/kg, i.p.) reduces conditioned gaping and administration of MK886 (a peroxisome proliferator-activated receptor alpha [PPARα] antagonist) blocked THCA’s anti-nausea effect. Combined subthreshold doses of CBDA (0.00001 mg/kg, i.p.) and THCA (0.001 mg/kg, i.p.) produce suppression of conditioned gaping, and this effect is blocked by administration of WAY100635 or MK886.
Conclusion
Combinations of very low doses of CBD + THC or CBDA + THCA robustly reduce LiCl-induced conditioned gaping. Clinical trials are necessary to determine the efficacy of using single or combined cannabinoids as adjunct treatments with existing anti-emetic regimens to manage chemotherapy-induced nausea.
Background and purpose:
Chronic neuropathic pain (NEP) is associated with growing therapeutic cannabis use. To promote quality of life without psychotropic effects, cannabinoids other than Δ9-tetrahydrocannabidiol, including cannabidiol and its precursor cannabidiolic acid (CBDA), are being evaluated. Due to its instability, CBDA has been understudied, particularly as an anti-nociceptive agent. Adding a methyl ester group (CBDA-ME) significantly enhances its stability, facilitating analyses of its analgesic effects in vivo. This study examines early treatment efficacy of CBDA-ME in a rat model of peripherally induced NEP and evaluates sex as a biological variable.
Experimental approach:
After 14 consecutive days of intraperitoneal CBDA-ME administration at 0.01, 0.1, and 1 μg/kg, commencing one day after surgically implanting a sciatic nerve-constricting cuff to induce NEP, the anti-nociceptive efficacy of this cannabinoid was assessed in male and female Sprague-Dawley rats relative to vehicle-treated counterparts. In females, 2 and 4 μg/kg daily doses of CBDA-ME were also evaluated. Behavioural tests were performed for hind paw mechanical and thermal withdrawal thresholds once a week for eight weeks. At endpoint, in vivo electrophysiological recordings were obtained to characterize soma threshold changes in primary sensory neurons.
Key results:
In males, CBDA-ME elicited a significant concentration-dependent chronic anti-hyperalgesic effect, also influencing both nociceptive and non-nociceptive mechanoreceptors, which were not observed in females at any of the concentrations tested.
Conclusion and implications:
Initiating treatment of a peripheral nerve injury with CBDA-ME at an early stage post-surgery provides anti-nociception in males, warranting further investigation into potential sexual dimorphisms underlying this response.
The peroxisome proliferator-activated receptor gamma (PPARG, also called NR1C3) is a nuclear receptor of the peroxisome proliferator-activated receptor family (PPAR). PPARs are involved in the regulation of apoptosis, cell cycle, estradiol and progesterone synthesis, and metabolism. However, the role of PPARs and their regulation during follicular development and ovulation in monovular species remain poorly understood. In this study, a well-established intrafollicular injection model was used to investigate if the PPARG participates in the regulation of dominant follicle development and ovulation in cattle. Findings from this study revealed that the relative mRNA abundance of PPARG was similar between dominant and subordinate follicles around follicle deviation, decreased after the LH surge, and increased before ovulation. In addition, a quadratic correlation was found between PPARG mRNA levels in granulosa cells and progesterone concentration in the follicular fluid. Intrafollicular injection of 50 μM Troglitazone (TGZ; a PPARG agonist) inhibited follicular growth and decreased CYP19A1 mRNA abundance in granulosa cells. These findings indicate that PPARG is involved in the regulation of steroidogenesis, follicle growth and ovulation in cattle.
The seaweed Caulerpa cylindracea (Sonder) is one of the most successful marine bioinvaders worldwide. Caulerpa cylindracea can influence the quantity and biochemical composition of sedimentary organic matter (OM). However, it is still unknown if the effects of C. cylindracea on both OM and small metazoans (i.e. meiofauna) can change according to different sediment deposition rates. To provide insights on this, we investigated the biochemical composition of sediments along with the abundance and composition of meiofaunal assemblages in sediments colonized and not-colonized by the seaweed C. cylindracea under different regimes of sediment deposition. Our results show that the presence of the invasive alga C. cylindracea could alter quantity, biochemical composition, and nutritional quality of organic detritus and influence the overall functioning of the benthic system, but also that the observed effects could be context-dependent. In particular, we show that the presence of C. cylindracea could have a positive effect on meiofaunal abundance wherever the sediment deposition rates are low, whereas the contextual presence of high to medium sedimentation rates can provoke an accumulation of sedimentary organic matter, less favourable bioavailability of food for the benthos, and consequent negative effects on meiofauna.
Despite the very large number of phytocannabinoids isolated from Cannabis (Cannabis sativa L.), bioactivity studies have long remained focused on the so called “Big Four” [Δ9-THC (1), CBD (2), CBG (3) and CBC (4)] because of their earlier characterization and relatively easy availability via isolation and/or synthesis. Bioactivity information on the chemical space associated with the remaining part of the cannabinome, a set of ca 150 compounds traditionally referred to as “minor phytocannabinoids”, is scarce and patchy, yet promising in terms of pharmacological potential. According to their advancement stage, we sorted the bioactivity data available on these compounds, better referred to as the “dark cannabinome”, into categories: discovery (in vitro phenotypical and biochemical assays), preclinical (animal models), and clinical. Strategies to overcome the availability issues associated with minor phytocannabinoids are discussed, as well as the still unmet challenges facing their development as mainstream drugs.
Aims: Cannabidiolic acid (CBDA) is one of the most abundant phytocannabinoid acids in the Cannabis Sativa plant. It has been shown it is able to exert some therapeutic effects such as antiemetic, anti-inflammatory, anxiolytic or antidepressant, although some of them remain under debate. In the present study we aim to assess the potential effects of CBDA on different behaviours and on the modulation of neuroinflammatory markers in the prefrontal cortex (PFC).
Main methods: the effects of acute and/or chronic CBDA (0.001-1 mg/kg i.p.) treatment were evaluated on cognitive, emotional, motivational and nociceptive behaviours in male CD1 mice. For this, Y-maze and elevated plus maze paradigms, spontaneous locomotor activity, social interaction, hot-plate, formalin and tail suspension tests were used. We also studied the effects of CBDA on the rewarding responses of cocaine in the conditioned place preference (CPP) paradigm. PFC was dissected after acute and chronic CBDA treatments to evaluate inflammatory markers.
Key findings: acute CBDA treatment induced antinociceptive responses in the hot-plate test. A 10-day chronic CBDA treatment reduced despair-like behaviour in the tail suspension test. CBDA did not alter the remaining behavioural tests assayed, including cocaine-induced reward in the CPP. Regarding the biochemical analysis, chronic CBDA treatment diminished peroxisome proliferator-activated receptor gamma (PPAR-γ) and increased interleukin-6 (IL-6) protein levels in PFC.
Significance: these results show that CBDA has limited in vivo effects modulating mice behaviour, highlighting the current disagreement regarding its therapeutic potential.
Aims
Cannabidiolic acid (CBDA) is one of the most abundant phytocannabinoid acids in the Cannabis sativa plant. It has been shown that it is able to exert some therapeutic effects such as antiemetic, anti-inflammatory, anxiolytic or antidepressant, although some of them remain under debate. In the present study we aim to assess the potential behavioural effects of CBDA as well as its modulation of neuroinflammatory markers in the prefrontal cortex (PFC).
Main methods
The effects of acute and repeated CBDA (0.001–1 mg/kg i.p.) treatments were evaluated on cognitive, emotional, motivational and nociceptive behaviours in male CD1 mice. For this, Y-maze and elevated plus maze paradigms, spontaneous locomotor activity, social interaction, hot-plate, formalin and tail suspension tests were used. We also studied the effects of CBDA on the rewarding responses of cocaine in the conditioned place preference (CPP) paradigm. Finally, PFC was dissected after acute and repeated CBDA treatments to evaluate inflammatory markers.
Key findings
Acute CBDA treatment induced antinociceptive responses in the hot-plate test. A 10-day CBDA treatment reduced despair-like behaviour in the tail suspension test. CBDA did not alter the results of the remaining behavioural tests assayed, including cocaine-induced reward in the CPP. Regarding the biochemical analysis, repeated CBDA treatment diminished the level of peroxisome proliferator-activated receptor gamma (PPAR-γ) and increased that of interleukin-6 (IL-6) protein in PFC.
Significance
These results show that CBDA has limited in vivo effects on the modulation of mice behaviour, supporting the current skepticism regarding its therapeutic potential.
The endocannabinoid system is widely expressed in the limbic system, prefrontal cortical areas, and brain structures regulating neuroendocrine stress responses, which explains the key role of this system in the control of emotions. In this review, we update recent advances on the function of the endocannabinoid system in determining the value of fear-evoking stimuli and promoting appropriate behavioral responses for stress resilience. We also review the alterations in the activity of the endocannabinoid system during fear, stress, and anxiety, and the pathophysiological role of each component of this system in the control of these protective emotional responses that also trigger pathological emotional disorders. In spite of all the evidence, we have not yet taken advantage of the therapeutic implications of this important role of the endocannabinoid system, and possible future strategies to improve the treatment of these emotional disorders are discussed.
.
The endocannabinoid (eCB) system encompasses the eCBs anandamide and 2-arachidonoylglycerol, their anabolic/catabolic enzymes, and the cannabinoid CB1 and CB2 receptors. Its expansion to include several eCB-like lipid mediators, their metabolic enzymes, and their molecular targets, forms the endocannabinoidome (eCBome). This complex signaling system is deeply involved in the onset, progress, and symptoms of major neuropsychiatric disorders and provides a substrate for future therapeutic drugs against these diseases. Such drugs may include not only THC, the major psychotropic component of cannabis, but also other, noneuphoric plant cannabinoids. These compounds, unlike THC, possess a wide therapeutic window, possibly due to their capability of hitting several eCBome and non-eCBome receptors. This is particularly true for cannabidiol, which is one of the most studied cannabinoids and shows promise for the treatment of a wide range of mental and mood disorders. The eCBome plays a role also in the microbiota-gut-brain axis, which is emerging as an important actor in the control of affective and cognitive functions and in their pathological alterations.
.
(1) Background: In addition to the major phytocannabinoids, trans-Δ9-tetrahydrocannabinol (Δ9-THC) and cannabidiol (CBD), the cannabis plant (Cannabis sativa L.) synthesizes over 120 additional cannabinoids that are known as minor cannabinoids. These minor cannabinoids have been proposed to act as agonists and antagonists at numerous targets including cannabinoid type 1 (CB1) and type 2 (CB2) receptors, transient receptor potential (TRP) channels and others. The goal of the present study was to determine the agonist effects of the minor cannabinoids: cannabinol (CBN), cannabigerol (CBG), cannabichromene (CBC), cannabitriol (CBT) and cannabidivarin (CBDV) at the CB1 receptor. In addition, the CB1 receptor antagonist effects of Δ9-tetrahydrocannabivarin (Δ9-THCV) were compared with its isomer Δ8-tetrahydrocannabivarin (Δ8-THCV). (2) Methods: CB1 receptor activity was monitored by measuring cannabinoid activation of G protein-gated inward rectifier K+ (GIRK) channels in AtT20 pituitary cells using a membrane potential-sensitive fluorescent dye assay. (3) Results: When compared to the CB1 receptor full agonist WIN 55,212-2 and the partial agonist Δ9-THC, none of the minor cannabinoids caused a significant activation of Gi/GIRK channel signaling. However, Δ9-THCV and Δ8-THCV antagonized the effect of WIN 55,212-2 with half-maximal inhibitory concentrations (IC50s) of 434 nM and 757 nM, respectively. Δ9-THCV antagonism of the CB1 receptor was “ligand-dependent”; Δ9-THCV was more potent in inhibiting WIN 55,212-2 and 2-arachidonoylglycerol (2-AG) than Δ9-THC. (4) Conclusions: While none of the minor cannabinoids caused Gi/GIRK channel activation, Δ9-THCV antagonized the CB1 receptor in an isomer- and ligand-dependent manner.
The endocannabinoid system (ECS), a conserved physiological system emerged as a novel pharmacological target for its significant role and potential therapeutic benefits ranging from neurological diseases to cancer. Among both, CB1 and CB2R types, CB2R have received attention for its pharmacological effects as antioxidant, anti-inflammatory, immunomodulatory and antiapoptotic that can be achieved without causing psychotropic adverse effects through CB1R. The ligands activate CB2R are of endogenous, synthetic and plant origin. In recent years, β-caryophyllene (BCP), a natural bicyclic sesquiterpene in cannabis as well as non-cannabis plants, has received attention due to its selective agonist property on CB2R. BCP has been well studied in a variety of pathological conditions mediating CB2R selective agonist property. The focus of the present manuscript is to represent the CB2R selective agonist mediated pharmacological mechanisms and therapeutic potential of BCP. The present narrative review summarizes insights into the CB2R-selective pharmacological properties and therapeutic potential of BCP such as cardioprotective, hepatoprotective, neuroprotective, nephroprotective, gastroprotective, chemopreventive, antioxidant, anti-inflammatory, and immunomodulator. The available evidences suggest that BCP, can be an important candidate of plant origin endowed with CB2R selective properties that may provide a pharmacological rationale for its pharmacotherapeutic application and pharmaceutical development like a drug. Additionally, given the wide availability in edible plants and dietary use, with safety, and no toxicity, BCP can be promoted as a nutraceutical and functional food for general health and well-being. Further, studies are needed to explore pharmacological and pharmaceutical opportunities for therapeutic and preventive applications of use of BCP in human diseases.
Background: Phenolic compounds are secondary metabolites with wide biological activities, and their biological activity is inseparable from their interactions with proteins. Phenolic-protein interactions will occur at the moment they are mixed, and this interaction will continue during food processing, handling, ingestion, digestion, metabolism and bioutilization, leading to a profound impact on the structure and properties of phenols and proteins.
Scope and approach: This review summarizes current knowledge of the contributions of phenolic-protein interactions to the bioactivities and functional mechanism of phenolic-containing foods. We firstly provide a comprehensive review of the interactions between phenolic ingredients and dietary proteins, and the multi-step interactions between ingested phenolics or derived phenolic products and functional proteins (like enzymes, transporters, receptors and transcription factors (TFs)) inside the human body, along with the involved intermolecular forces. In addition, we have proposed the use of molecular docking for predicting such interactions, and demonstrated some docking results of dietary phenolics (or their derived metabolites) with human TFs.
Key finding and conclusions: The phenolic-protein interactions in foods and post ingestion may function as multi-switches empowering health outcomes. This review asserts the need for increasing the knowledge of the interactions between the ingested phenolics or their derived products and all the protein biomolecules inside the human body.
Cannabis sativa L. plant is currently attracting increasing interest in cosmetics and dermatology. In this review, the biologically active compounds of hemp are discussed. Particularly the complex interactions of cannabinoids with the endocannabinoid system of the skin to treat various conditions (such as acne, allergic contact dermatitis, melanoma, and psoriasis) with clinical data. Moreover, the properties of some cannabinoids make them candidates as cosmetic actives for certain skin types. Hemp seed oil and its minor bioactive compounds such as terpenes, flavonoids, carotenoids, and phytosterols are also discussed for their added value in cosmetic formulation.
The constant search for new pharmacologically active compounds, especially those that do not exhibit toxic effects, intensifies the interest in plant-based ingredients and their potential use in pharmacotherapy. One of the plants that has great therapeutic potential is Cannabis sativa L., a source of the psychoactive Δ9-tetrahydrocannabinol (Δ9-THC), namely cannabidiol (CBD), which exhibits antioxidant and anti-inflammatory properties, and cannabigerol (CBG)—a biologically active compound that is present in much smaller quantities. CBG is generated during the non-enzymatic decarboxylation of cannabigerolic acid, a key compound in the process of biosynthesis of phytocannabinoids and consequently the precursor to various phytocannabinoids. By interacting with G-protein-coupled receptors, CBG exhibits a wide range of biological activities, inter alia, anti-inflammatory, antibacterial and antifungal activities, regulation of the redox balance, and neuromodulatory effects. Due to the wide spectrum of biological activities, CBG seems to be a very promising compound to be used in the treatment of diseases that require multidirectional pharmacotherapy. Moreover, it is suggested that due to the relatively rapid metabolism of cannabigerol, determination of the concentration of the phytocannabinoid in blood or oral fluid can be used to determine cannabis use. Therefore, it seems obvious that new therapeutic approaches using CBG can be expected.
Most of our current understanding of the neuromolecular mechanisms of Cannabis action focusses on two plant cannabinoids, THC and CBD. THC acts primarily through presynaptic CB cannabinoid receptors to regulate neurotransmitter release in the brain, spinal cord and peripheral nerves. CBD action, on the other hand, is probably mediated through multiple molecular targets.
Purpose:
To evaluate whether aleglitazar (Ale), a dual PPARα/γ agonist, has additive effects on myocardial protection against ischemia-reperfusion injury.
Methods:
Human cardiomyocytes (HCMs), cardiomyocytes from cardiac-specific PPARγ knockout (MCM-PPARγ (CKO) ) or wild type (MCM-WT) mice were incubated with different concentrations of Ale, and subjected to simulated ischemia-reperfusion (SIR) or normoxic conditions (NSIR). Cell viability, apoptosis and caspase-3 activity were determined. HCMs were transfected with siRNA against PPARα (siPPARα) or PPARγ (siPPARγ) followed by incubation with Ale. PPARα/γ DNA binding capacity was measured. Cell viability, apoptosis and levels of P-AKT and P-eNOS were assessed. Infarct size following 30 min coronary artery occlusion and 24 h reperfusion were assessed in WT and db/db diabetic mice following 3-day pretreatment with vehicle, Ale or glimeperide.
Results:
Ale (at concentrations of 150-600 nM) increased cell viability and reduced apoptosis in HCMs, MCM-WT and MCM-PPAR (CKO) exposed to SIR. In HCM, the protective effect was partially blocked by siPPARα alone or siPPARγ alone, and completely blocked by siPPARα+siPPARγ. Ale increased P-Akt/P-eNOS in HCMs. P-Akt or P-eNOS levels were decreased when PPARα alone, PPARγ alone and especially when both were knocked down. Peritoneal GTTs revealed that db/db mice had developed impaired glucose tolerance and insulin sensitivity, which were normalized by Ale or glimepiride treatment. Ale, but not glimepiride, limited infarct size in both WT and diabetic mice after ischemia-reperfusion.
Conclusions:
Ale protects against myocardial apoptosis caused by hypoxia-reoxygenation in vitro and reduces infarct size in vivo.
Peroxisome proliferator-activated receptors (PPARs) are members of the nuclear hormone receptor superfamily that can be activated by various xenobiotics and natural fatty acids. These transcription factors primarily regulate genes involved in lipid metabolism and also play a role in adipocyte differentiation. We present the expression patterns of the PPAR subtypes in the adult rat, determined by in situ hybridization using specific probes for PPAR-alpha, -beta and -gamma, and by immunohistochemistry using a polyclonal antibody that recognizes the three rat PPAR subtypes. In numerous cell types from either ectodermal, mesodermal, or endodermal origin, PPARs are coexpressed, with relative levels varying between them from one cell type to the other. PPAR-alpha is highly expressed in hepatocytes, cardiomyocytes, enterocytes, and the proximal tubule cells of kidney. PPAR-beta is expressed ubiquitously and often at higher levels than PPAR-alpha and -gamma. PPAR-gamma is expressed predominantly in adipose tissue and the immune system. Our results suggest new potential directions to investigate the functions of the different PPAR subtypes.
Thiazolidinediones (TZDs) are one of the major classes of antidiabetic drugs that are used widely. TZDs improve insulin resistance by activating peroxisome proliferator-activated receptor gamma (PPARγ) and ameliorate diabetic and other nephropathies, at least, in experimental animals. However, TZDs have side effects, such as edema, congestive heart failure, and bone fracture, and may increase bladder cancer risk. Edema and heart failure, which both probably originate from renal sodium retention, are of great importance because these side effects make it difficult to continue the use of TZDs. However, the pathogenesis of edema remains a matter of controversy. Initially, upregulation of the epithelial sodium channel (ENaC) in the collecting ducts by TZDs was thought to be the primary cause of edema. However, the results of other studies do not support this view. Recent data suggest the involvement of transporters in the proximal tubule, such as sodium-bicarbonate cotransporter and sodium-proton exchanger. Other studies have suggested that sodium-potassium-chloride cotransporter 2 in the thick ascending limb of Henle and aquaporins are also possible targets for TZDs. This paper will discuss the recent advances in the pathogenesis of TZD-induced sodium reabsorption in the renal tubules and edema.
Described since long as a member of the nuclear receptor super family, peroxisome proliferator-activated receptors (PPARs) regulate the gene expression of proteins involved in glucose and lipid metabolism. PPARs indeed regulate several physiologic processes, including lipid homeostasis, adipogenesis, inflammation, and wound healing. PPARs bind natural or synthetic PPAR ligands do function as cellular sensors to regulate the gene transcription. Dyslipidemia, and type 2 diabetes mellitus (T2DM) with insulin resistance are treated using agonists of PPARα and PPARγ, respectively. The PPARγ is a key regulator of insulin sensitization and glucose metabolism, and therefore is considered as an imperative pharmacological target to combat diabetic metabolic disease and insulin resistance. Of note, currently available PPARγ full agonists like rosiglitazone display serious adverse effects such as fluid retention/oedema, weight gain, and increased incidence of cardiovascular events. On the other hand, PPARγ partial agonists are being suggested to devoid or having less incidence of these undesirable events, and are under developmental stages. Current research is on the way for the development of novel PPARγ partial agonists with enhanced therapeutic efficacy and reduced adverse effects. This review sheds lights on the current status of development of PPARγ partial agonists, for the management of T2DM, having comparatively less or no adverse effects to that of PPARγ full agonists.
Copyright © 2015. Published by Elsevier B.V.
Peroxisome proliferator-activated receptor gamma (PPARγ) has been the focus of intense research because ligands for this receptor have emerged as potent insulin sensitizers used in the treatment of type 2 diabetes. There have been described three PPAR isotypes α, δ and γ which have an integrated role in controlling the expression of genes playing key roles in the storage and mobilization of lipids, in glucose metabolism, in morphogenesis and inflammatory response. Recent advances include the discovery of novel genes that are regulated by PPARγ, which helps to explain how activation of this adipocyte predominant transcription factor regulates glucose and lipid homeostasis. Increased levels of circulating free fatty acids and lipid accumulation in non-adipose tissue have been implicated in the development of insulin resistance. This situation is improved by PPARγ ligands, which promotes fatty acid storage in fat deposits and regulates the expression of adipocyte-secreted hormones that impacts on glucose homeostasis. So the net result of the pleiotropic effects of PPARγ ligands is improvement of insulin sensitivity. This review highlights the roles that PPAR gamma play in the regulation of gene expression of multiple diseases including obesity, diabetes and cancer and highlights the gene isolation transformation role. Further studies are needed for the transformation of PPAR gamma gene in plants and evaluate in animals for the treatment of type 2 diabetes.
Non-alcoholic fatty liver disease (NAFLD) is characterized by hepatic triglyceride accumulation, ranging from steatosis to steatohepatitis and cirrhosis. NAFLD is a risk factor for cardiovascular diseases and is associated with metabolic syndrome. Antihyperlipidemic drugs are recommended as part of the treatment for NAFLD patients. Although fibrates activate peroxisome proliferator-activated receptor α (PPARα), leading to the reduction of serum triglyceride levels, the effects of these drugs on NAFLD remain controversial. Clinical studies have reported that PPARα activation does not improve hepatic steatosis. In the present study, we focused on exploring the effect and mechanism of PPARα activation on hepatic triglyceride accumulation and hepatic steatosis. Male C57BL/6J mice, Pparα-null mice and HepG2 cells were treated with fenofibrate, one of the most commonly used fibrate drugs. Both low and high doses of fenofibrate were administered. Hepatic steatosis was detected through oil red O staining and electron microscopy. Notably, in fenofibrate-treated mice, the serum triglyceride levels were reduced and the hepatic triglyceride content was increased in a dose-dependent manner. Oil red O staining of liver sections demonstrated that fenofibrate-fed mice accumulated abundant neutral lipids. Fenofibrate also increased the intracellular triglyceride content in HepG2 cells. The expression of sterol regulatory element-binding protein 1c (SREBP-1c) and the key genes associated with lipogenesis were increased in fenofibrate-treated mouse livers and HepG2 cells in a dose-dependent manner. However, the effect was strongly impaired in Pparα-null mice treated with fenofibrate. Fenofibrate treatment induced mature SREBP-1c expression via the direct binding of PPARα to the DR1 motif of the SREBP-1c gene. Taken together, these findings indicate the molecular mechanism by which PPARα activation increases liver triglyceride accumulation and suggest an adverse effect of fibrates on the pathogenesis of hepatic steatosis.
Peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer binding protein α (C/EBPα) are key activators of adipogenesis.
They mutually induce the expression of each other and have been reported to cooperate in activation of a few adipocyte genes.
Recently, genome-wide profiling revealed a high degree of overlap between PPARγ and C/EBPα binding in adipocytes, suggesting
that cooperativeness could be mediated through common binding sites. To directly investigate the interplay between PPARγ and
C/EBPα at shared binding sites, we established a fibroblastic model system in which PPARγ and C/EBPα can be independently
expressed. Using RNA sequencing, we demonstrate that coexpression of PPARγ and C/EBPα leads to synergistic activation of many
key metabolic adipocyte genes. This is associated with extensive C/EBPα-mediated reprogramming of PPARγ binding and vice versa
in the vicinity of these genes, as determined by chromatin immunoprecipitation combined with deep sequencing. Our results
indicate that this is at least partly mediated by assisted loading involving chromatin remodeling directed by the leading
factor. In conclusion, we report a novel mechanism by which the key adipogenic transcription factors, PPARγ and C/EBPα, cooperate
in activation of the adipocyte gene program.
Nuclear receptor activation in liver leads to coordinated alteration of the expression of multiple gene products with attendant phenotypic changes of hepatocytes. Peroxisome proliferators including endogenous fatty acids, environmental chemicals, and drugs induce a multi-enzyme metabolic response that affects lipid and fatty acid processing. We studied the signaling network for the peroxisome proliferator-associated receptor alpha (PPARα) in primary human hepatocytes using the selective PPARα ligand, GW7647. We measured gene expression over multiple concentrations and times and conducted ChIP-seq studies at 2 and 24h to assess genomic binding of PPARα. Over all treatments there were 192 genes differentially expressed. Of these only 51% showed evidence of PPARα binding–either directly at PPARα response elements or via alternative mechanisms. Almost half of regulated genes had no PPARα binding. We then developed two novel bioinformatics methods to visualize the dose-dependent activation of both the transcription factor circuitry for PPARα and the downstream metabolic network in relation to functional annotation categories. Available databases identified several key transcription factors involved with the non-genomic targets after GW7647 treatment, including SP1, STAT1, ETS1, ERα, and HNF4α. The linkage from PPARα binding through gene expression likely requires intermediate protein kinases to activate these transcription factors. We found enrichment of functional annotation categories for organic acid metabolism and cell lipid metabolism among the differentially expressed genes. Lipid transport processes showed enrichment at the highest concentration of GW7647 (10μM). While our strategy for mapping transcriptional networks is evolving, these approaches are necessary in moving from toxicogenomic methods that derive signatures of activity to methods that establish pathway structure, showing the coordination of the activated nuclear receptor with other signaling pathways.
Adipogenesis is the differentiation of preadipocytes to adipocytes which is marked by the accumulation of lipid droplets. Adipogenic differentiation of 3T3-L1 cells is achieved by exposing the cells to Insulin, Dexamethasone and IBMX for 5–7 days. Thiazolidinedione drugs, like rosiglitazone are potent insulin sensitizing agents and have been shown to enhance lipid droplet formation in 3T3-L1 cells, a model cell line for preadipocyte differentiation. Guggulsterone is a natural drug extracted from the gum resin of tree Commiphora
mukul. Guggulsterone has been shown to inhibit adipogenesis and induce apoptosis in 3T3-L1 cells. In this study we treated the 3T3-L1 preadipocytes with rosiglitazone and guggulsterone and assessed the protein expression profile using 2D gel electrophoresis-based proteomics to find out differential target proteins of these drugs. The proteins that were identified upon rosiglitazone treatment generally regulate cell proliferation and/or exhibit anti-inflammatory effect which strengthens its differentiation-inducing property. Guggulsterone treatment resulted in the identification of the apoptosis-inducing proteins to be up regulated which rightly is in agreement with the apoptosis-inducing property of guggulsterone in 3T3-L1 cells. Some of the proteins identified in our proteomic screen such as Galectin1, AnnexinA2 & TCTP were further confirmed by Real Time qPCR. Thus, the present study provides a better outlook of proteins being differentially regulated/expressed upon treatment with rosiglitazone and guggulsterone. The detailed study of the differentially expressed proteins identified in this proteomic screen may further provide the better molecular insight into the mode of action of these anti-diabetic drugs rosiglitazone and guggulsterone.
Phytocannabinoids like ∆(9)-tetrahydrocannabinol (THC) and cannabidiol (CBD) show a beneficial effect on neuroinflammatory and neurodegenerative processes through cell membrane cannabinoid receptor (CBr)-dependent and -independent mechanisms. Natural and synthetic cannabinoids also target the nuclear receptor peroxisome proliferator-activated receptor-gamma (PPARγ), an attractive molecular target for the treatment of neuroinflammation. As part of a study on the SAR of phytocannabinoids, we have investigated the effect of the oxidation modification in the resorcinol moiety of cannabigerol (CBG) on CB(1), CB(2) and PPARγ binding affinities, identifying cannabigerol quinone (VCE-003) as a potent anti-inflammatory agent. VCE-003 protected neuronal cells from excitotoxicity, activated PPARγ transcriptional activity and inhibited the release of pro-inflammatory mediators in LPS-stimulated microglial cells. Theiler's murine encephalomyelitis virus (TMEV) model of multiple sclerosis (MS) was used to investigate the anti-inflammatory activity of this compound in vivo. Motor function performance was evaluated and the neuroinflammatory response and gene expression pattern in brain and spinal cord were studied by immunostaining and qRT-PCR. We found that VCE-003 ameliorated the symptoms associated to TMEV infection, decreased microglia reactivity and modulated the expression of genes involved in MS pathophysiology. These data lead us to consider VCE-003 to have high potential for drug development against MS and perhaps other neuroinflammatory diseases.
Asthma is a chronic inflammatory airway disease influenced by genetic and environmental factors that affects ~300 million people worldwide, leading to ~250,000 deaths annually. Glucocorticoids (GCs) are well-known therapeutics that are used extensively to suppress airway inflammation in asthmatics. The airway epithelium plays an important role in the initiation and modulation of the inflammatory response. While the role of GCs in disease management is well understood, few studies have examined the holistic effects on the airway epithelium.
Gene expression data were used to generate a co-transcriptional network, which was interrogated to identify modules of functionally related genes. In parallel, expression data were mapped to the human protein-protein interaction (PPI) network in order to identify modules with differentially expressed genes. A common pathways approach was applied to highlight genes and pathways functionally relevant and significantly altered following GC treatment.
Co-transcriptional network analysis identified pathways involved in inflammatory processes in the epithelium of asthmatics, including the Toll-like receptor (TLR) and PPAR signaling pathways. Analysis of the PPI network identified RXRA, PPARGC1A, STAT1 and IRF9, among others genes, as differentially expressed. Common pathways analysis highlighted TLR and PPAR signaling pathways, providing a link between general inflammatory processes and the actions of GCs. Promoter analysis identified genes regulated by the glucocorticoid receptor (GCR) and PPAR pathways as well as highlighted the interferon pathway as a target of GCs.
Network analyses identified known genes and pathways associated with inflammatory processes in the airway epithelium of asthmatics. This workflow illustrated a hypothesis generating experimental design that integrated multiple analysis methods to produce a weight-of-evidence based approach upon which future focused studies can be designed. In this case, results suggested a mechanism whereby GCs repress TLR-mediated interferon production via upregulation of the PPAR signaling pathway. These results highlight the role of interferons in asthma and their potential as targets of future therapeutic efforts.
Peroxisome proliferator-activated receptor (PPAR)γ may be a key regulator of connective tissue deposition and remodeling in vivo. PPARγ expression is reduced in dermal fibroblasts isolated from fibrotic areas of scleroderma patients; PPARγ agonists suppress the persistent fibrotic phenotype of this cell type. Previously, we showed that loss of PPARγ expression in fibroblasts resulted in enhanced bleomycin-induced skin fibrosis. However, whether loss of PPARγ expression in skin fibroblasts affects cutaneous tissue repair or homeostasis is unknown.
Mice deleted for PPARγ in skin fibroblasts show an enhanced rate of dermal wound closure, concomitant with elevated phosphorylation of Smad3, Akt and ERK, and increased expression of proliferating cell nuclear antigen (PCNA), collagen, α-smooth muscle actin (α-SMA) and CCN2. Conversely, dermal homeostasis was not appreciably affected by loss of PPARγ expression.
PPARγ expression by fibroblasts suppresses cutaneous tissue repair. In the future, direct PPARγ antagonists and agonists might be of clinical benefit in controlling chronic wounds or scarring, respectively.
Peroxisome proliferator-activated receptor-γ (PPARγ) has been reported to be involved in the etiology of pathological features of Alzheimer's disease (AD). Cannabidiol (CBD), a Cannabis derivative devoid of psychomimetic effects, has attracted much attention because of its promising neuroprotective properties in rat AD models, even though the mechanism responsible for such actions remains unknown. This study was aimed at exploring whether CBD effects could be subordinate to its activity at PPARγ, which has been recently indicated as its putative binding site. CBD actions on β-amyloid-induced neurotoxicity in rat AD models, either in presence or absence of PPAR antagonists were investigated. Results showed that the blockade of PPARγ was able to significantly blunt CBD effects on reactive gliosis and subsequently on neuronal damage. Moreover, due to its interaction at PPARγ, CBD was observed to stimulate hippocampal neurogenesis. All these findings report the inescapable role of this receptor in mediating CBD actions, here reported.
The expression of several genes involved in intra- and extracellular lipid metabolism, notably those involved in peroxisomal
and mitochondrial β-oxidation, is mediated by ligand-activated receptors, collectively referred to as peroxisome proliferator-activated
receptors (PPARs). To gain more insight into the control of expression of carnitine palmitoyltransferase (CPT) genes, which
are regulated by fatty acids, we have examined the transcriptional regulation of the human MCPT I gene. We have cloned by
polymerase chain reaction the 5′-flanking region of this gene and demonstrated its transcriptional activity by transfection
experiments with the CAT gene as a reporter. We have also shown that this is a target gene for the action of PPARs, and we
have localized a PPAR responsive element upstream of the first exon. These results show that PPAR regulates the entry of fatty
acids into the mitochondria, which is a crucial step in their metabolism, especially in tissues like heart, skeletal muscle
and brown adipose tissue in which fatty acids are a major source of energy.
The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.
It is now well established that the development and progression of a variety of human malignancies are associated with dysregulated activity of the insulin-like growth factor (IGF) system. In this regard, promising drugs have been developed to target the IGF-I receptor or its ligands. These therapies are limited by the development of insulin resistance and compensatory hyperinsulinemia, which in turn, may stimulate cancer growth. Novel therapeutic approaches are, therefore, required. Synthetic PPAR-γ agonists, such as thiazolidinediones (TZDs), are drugs universally used as antidiabetic agents in patients with type 2 diabetes. In addition of acting as insulin sensitizers, PPAR-γ agonists mediate in vitro and in vivo pleiotropic anticancer effects. At least some of these effects appear to be linked with the downregulation of the IGF system, which is induced by the cross-talk of PPAR-γ agonists with multiple components of the IGF system signaling. As hyperinsulinemia is an emerging cancer risk factor, the insulin lowering action of PPAR-γ agonists may be expected to be also beneficial to reduce cancer development and/or progression.
In light of these evidences, TZDs or other PPAR-γ agonists may be exploited in those tumors “addicted” to the IGF signaling and/or in tumors occurring in hyperinsulinemic patients.
The nuclear receptor peroxisome proliferator-activated receptor gamma (PPARgamma) is a key regulator of adipocyte differentiation in vivo and ex vivo and has been shown to control the expression of several adipocyte-specific genes. In this study, we used chromatin immunoprecipitation combined with deep sequencing to generate genome-wide maps of PPARgamma and retinoid X receptor (RXR)-binding sites, and RNA polymerase II (RNAPII) occupancy at very high resolution throughout adipocyte differentiation of 3T3-L1 cells. We identify >5000 high-confidence shared PPARgamma:RXR-binding sites in adipocytes and show that during early stages of differentiation, many of these are preoccupied by non-PPARgamma RXR-heterodimers. Different temporal and compositional patterns of occupancy are observed. In addition, we detect co-occupancy with members of the C/EBP family. Analysis of RNAPII occupancy uncovers distinct clusters of similarly regulated genes of different biological processes. PPARgamma:RXR binding is associated with the majority of induced genes, and sites are particularly abundant in the vicinity of genes involved in lipid and glucose metabolism. Our analyses represent the first genome-wide map of PPARgamma:RXR target sites and changes in RNAPII occupancy throughout adipocyte differentiation and indicate that a hitherto unrecognized high number of adipocyte genes of distinctly regulated pathways are directly activated by PPARgamma:RXR.
Peroxisome proliferators cause a rapid and coordinated transcriptional activation of genes encoding the enzymes of the peroxisomal beta-oxidation pathway in rats and mice. Cis-acting peroxisome proliferator responsive elements (PPREs) have been identified in the 5'-flanking region of H202-producing rat acyl-CoA oxidase (ACOX) gene and in other genes inducible by peroxisome proliferators. To gain more insight into the purported nonresponsiveness of human liver cells to peroxisome volume density and in the activity of the beta-oxidation enzyme system, we have previously cloned the human ACOX gene, the first and rate-limiting enzyme of the peroxisomal beta-oxidation system. We now present information on a regulatory element for the peroxidase proliferator-activated receptor (PPAR)/retinoid X receptor (RXR) heterodimers. The PPRE, consists of AGGTCA C TGGTCA, which is a direct repeat of hexamer half-sites interspaced by a single nucleotide (DR1 motif). It is located at -1918 to -1906 base pairs upstream of the transcription initiation site of this human ACOX gene. This PPRE specifically binds to baculovirus-expressed recombinant rat PPAR alpha/RXR alpha heterodimers. In transient transfection experiments, the maximum induction of luciferase expression by ciprofibrate and/or 9-cis-retinoic acid is dependent upon cotransfection of expression plasmids for PPAR alpha and RXR alpha. The functionally of this human ACOX promoter was further demonstrated by linking it to a beta-galactosidase reporter gene or to a rat urate oxidase cDNA and establishing stably transfected African green monkey kidney (CV1) cell lines expressing reporter protein. The human ACOX promoter has been found to be responsive to peroxisome proliferators in CV1 cells stably expressing PPAR alpha, whereas only a basal level of promoter activity is detected in stably transfected cells lacking PPAR alpha. The presence of a PPRE in the promoter of this human peroxisomal ACOX gene and its responsiveness to peroxisome proliferators suggests that factors other than the PPRE in the 5'-flanking sequence of the human ACOX gene may account for differences, if any, in the pleiotropic responses of humans to peroxisome proliferators.
Peroxisome proliferator-activated receptor alpha (PPARalpha) is a member of the steroid/nuclear receptor superfamily and mediates the biological and toxicological effects of peroxisome proliferators. To determine the physiological role of PPARalpha in fatty acid metabolism, levels of peroxisomal and mitochondrial fatty acid metabolizing enzymes were determined in the PPARalpha null mouse. Constitutive liver beta-oxidation of the long chain fatty acid, palmitic acid, was lower in the PPARalpha null mice as compared with wild type mice, indicating defective mitochondrial fatty acid catabolism. In contrast, constitutive oxidation of the very long chain fatty acid, lignoceric acid, was not different between wild type and PPARalpha null mice, suggesting that constitutive expression of enzymes involved in peroxisomal beta-oxidation is independent of PPARalpha. Indeed, the PPARalpha null mice had normal levels of the peroxisomal acyl-CoA oxidase, bifunctional protein (hydratase + 3-hydroxyacyl-CoA dehydrogenase), and thiolase but lower constitutive expression of the D-type bifunctional protein (hydratase + 3-hydroxyacyl-CoA dehydrogenase). Several mitochondrial fatty acid metabolizing enzymes including very long chain acyl-CoA dehydrogenase, long chain acyl-CoA dehydrogenase, short chain-specific 3-ketoacyl-CoA thiolase, and long chain acyl-CoA synthetase are also expressed at lower levels in the untreated PPARalpha null mice, whereas other fatty acid metabolizing enzymes were not different between the untreated null mice and wild type mice. A lower constitutive expression of mRNAs encoding these enzymes was also found, suggesting that the effect was due to altered gene expression. In wild type mice, both peroxisomal and mitochondrial enzymes were induced by the peroxisome proliferator Wy-14,643; induction was not observed in the PPARalpha null animals. These data indicate that PPARalpha modulates constitutive expression of genes encoding several mitochondrial fatty acid-catabolizing enzymes in addition to mediating inducible mitochondrial and peroxisomal fatty acid beta-oxidation, thus establishing a role for the receptor in fatty acid homeostasis.
Insulin is a potent adipogenic hormone that triggers an induction of a series of transcription factors governing differentiation of pre-adipocytes into mature adipocytes. However, the exact link between the insulin signaling cascade and the intrinsic cascade of adipogenesis remains incompletely understood. Herein we demonstrate that inhibition of prenylation of p21ras and Rho-A arrests insulin-stimulated adipogenesis. Inhibition of farnesylation of p21ras also blocked the ability of insulin to activate mitogen-activated protein (MAP) kinase and cyclic AMP response element-binding (CREB) protein. Expression of two structurally different inducible constitutively active CREB constructs rescued insulin-stimulated adipocyte differentiation from the inhibitory influence of prenylation inhibitors. Constitutively active CREB constructs induced expression of PPARgamma2, fatty acid synthase, GLUT-4, and leptin both in control and prenylation inhibitors-treated cells. It appears that insulin-stimulated prenylation of the Ras family GTPases assures normal phosphorylation and activation of CREB that, in turn, triggers the intrinsic cascade of adipogenesis.
The transcription factor CCAAT enhancer binding protein alpha (C/EBPalpha) is expressed at high levels in liver and adipose tissue. Cell culture studies show that C/EBPalpha is sufficient to trigger differentiation of preadipocytes into mature adipocytes, suggesting a central role for C/EBPalpha in the development of adipose tissue. C/EBPalpha knockout mice die within 7-12 h after birth. Defective gluconeogenesis of the liver and subsequent hypoglycemia contribute to the early death of these animals. This short life span impairs investigation of the development of adipose tissue in these mice. To improve the survival of C/EBPalpha-/- animals, we generated a transgenic line that expresses C/EBPalpha under the control of the albumin enhancer/promoter. This line was bred into the knockout strain to generate animals that express C/EBPalpha in the liver but in no other tissue. The presence of the transgene improved survival of C/EBPalpha-/- animals almost 3-fold. Transgenic C/EBPalpha-/- animals at 7 days of age show an absence of s.c., perirenal, and epididymal white fat despite excess lipid substrate in the serum, whereas brown adipose tissue is somewhat hypertrophied and shows minimal biochemical alterations. Interestingly, mammary gland fat tissue is present and exhibits normal morphology. The absence of white adipose tissue in many depots in the presence of high serum lipid levels shows that C/EBPalpha is required for the in vivo development of this tissue. In contrast, brown adipose tissue differentiation is independent of C/EBPalpha expression. The presence of lipid in brown adipose tissue serves as an internal nutritional control, indicating that neither nutritional intake nor lipoprotein composition is likely responsible for the absence of white fat.
Syndrome X, typified by obesity, insulin resistance (IR), dyslipidemia, and other metabolic abnormalities, is responsive to antidiabetic thiazolidinediones (TZDs). Peroxisome proliferator-activated receptor (PPAR) gamma, a target of TZDs, is expressed abundantly in adipocytes, suggesting an important role for this tissue in the etiology and treatment of IR. Targeted deletion of PPARgamma in adipose tissue resulted in marked adipocyte hypocellularity and hypertrophy, elevated levels of plasma free fatty acids and triglyceride, and decreased levels of plasma leptin and ACRP30. In addition, increased hepatic glucogenesis and IR were observed. Despite these defects, blood glucose, glucose and insulin tolerance, and insulin-stimulated muscle glucose uptake were all comparable to those of control mice. However, targeted mice were significantly more susceptible to high-fat diet-induced steatosis, hyperinsulinemia, and IR. Surprisingly, TZD treatment effectively reversed liver IR, whereas it failed to lower plasma free fatty acids. These results suggest that syndrome X may be comprised of separable PPARgamma-dependent components whose origins and therapeutic sites may reside in distinct tissues.
PPARalpha is a nuclear receptor that regulates liver and skeletal muscle lipid metabolism as well as glucose homeostasis. Acting as a molecular sensor of endogenous fatty acids (FAs) and their derivatives, this ligand-activated transcription factor regulates the expression of genes encoding enzymes and transport proteins controlling lipid homeostasis, thereby stimulating FA oxidation and improving lipoprotein metabolism. PPARalpha also exerts pleiotropic antiinflammatory and antiproliferative effects and prevents the proatherogenic effects of cholesterol accumulation in macrophages by stimulating cholesterol efflux. Cellular and animal models of PPARalpha help explain the clinical actions of fibrates, synthetic PPARalpha agonists used to treat dyslipidemia and reduce cardiovascular disease and its complications in patients with the metabolic syndrome. Although these preclinical studies cannot predict all of the effects of PPARalpha in humans, recent findings have revealed potential adverse effects of PPARalpha action, underlining the need for further study. This Review will focus on the mechanisms of action of PPARalpha in metabolic diseases and their associated vascular pathologies.
Fibrates are a unique hypolipidemic drugs that lower plasma triglyceride and cholesterol levels through their action as peroxisome proliferator-activated receptor alpha (PPARalpha) agonists. The activation of PPARalpha leads to a cascade of events that result in the pharmacological (hypolipidemic) and adverse (carcinogenic) effects in rodent liver.
To understand the molecular mechanisms responsible for the pleiotropic effects of PPARalpha agonists, we treated mouse primary hepatocytes with three PPARalpha agonists (bezafibrate, fenofibrate, and WY-14,643) at multiple concentrations (0, 10, 30, and 100 microM) for 24 hours. When primary hepatocytes were exposed to these agents, transactivation of PPARalpha was elevated as measured by luciferase assay. Global gene expression profiles in response to PPARalpha agonists were obtained by microarray analysis. Among differentially expressed genes (DEGs), there were 4, 8, and 21 genes commonly regulated by bezafibrate, fenofibrate, and WY-14,643 treatments across 3 doses, respectively, in a dose-dependent manner. Treatments with 100 muM of bezafibrate, fenofibrate, and WY-14,643 resulted in 151, 149, and 145 genes altered, respectively. Among them, 121 genes were commonly regulated by at least two drugs. Many genes are involved in fatty acid metabolism including oxidative reaction. Some of the gene changes were associated with production of reactive oxygen species, cell proliferation of peroxisomes, and hepatic disorders. In addition, 11 genes related to the development of liver cancer were observed.
Our results suggest that treatment of PPARalpha agonists results in the production of oxidative stress and increased peroxisome proliferation, thus providing a better understanding of mechanisms underlying PPARalpha agonist-induced hepatic disorders and hepatocarcinomas.
The thiazolidinedione (TZD) rosiglitazone is a peroxisome proliferator-activated receptor-gamma agonist that induces adipocyte differentiation and, hence, lipid accumulation. This is in apparent contrast to the long-term glucose-lowering, insulin-sensitising effect of rosiglitazone. We tested whether the action of rosiglitazone involves specific effects on mature adipocytes, which are different from those on preadipocytes.
Differentiated mature 3T3-L1 adipocytes were used as an in vitro model. Transcriptomics, proteomics and assays of metabolism were applied to assess the effect of rosiglitazone in different insulin and glucose conditions.
Rosiglitazone does not induce an increase, but rather a decrease in the lipid content of mature adipocytes. Analysis of transcriptome data, confirmed by quantitative RT-PCR and measurements of lipolysis, indicates that an altered energy metabolism may underlie this change. The pathway analysis shows a consistent picture dominated by lipid catabolism. In addition, we confirmed at both mRNA level and protein level that rosiglitazone represses adipokine expression and production, except for genes encoding adiponectin and apolipoprotein E. Moreover, transcriptome changes indicate that a general repression of genes encoding secreted proteins occurs.
Our findings suggest that the change of adiposity as seen in vivo reflects a shift in balance between the different effects of TZDs on preadipocytes and on mature adipocytes, while the changes in circulating adipokine levels primarily result from an effect on mature adipocytes.
Rosiglitazone is widely used to treat patients with type 2 diabetes mellitus, but its effect on cardiovascular morbidity and mortality has not been determined.
We conducted searches of the published literature, the Web site of the Food and Drug Administration, and a clinical-trials registry maintained by the drug manufacturer (GlaxoSmithKline). Criteria for inclusion in our meta-analysis included a study duration of more than 24 weeks, the use of a randomized control group not receiving rosiglitazone, and the availability of outcome data for myocardial infarction and death from cardiovascular causes. Of 116 potentially relevant studies, 42 trials met the inclusion criteria. We tabulated all occurrences of myocardial infarction and death from cardiovascular causes.
Data were combined by means of a fixed-effects model. In the 42 trials, the mean age of the subjects was approximately 56 years, and the mean baseline glycated hemoglobin level was approximately 8.2%. In the rosiglitazone group, as compared with the control group, the odds ratio for myocardial infarction was 1.43 (95% confidence interval [CI], 1.03 to 1.98; P=0.03), and the odds ratio for death from cardiovascular causes was 1.64 (95% CI, 0.98 to 2.74; P=0.06).
Rosiglitazone was associated with a significant increase in the risk of myocardial infarction and with an increase in the risk of death from cardiovascular causes that had borderline significance. Our study was limited by a lack of access to original source data, which would have enabled time-to-event analysis. Despite these limitations, patients and providers should consider the potential for serious adverse cardiovascular effects of treatment with rosiglitazone for type 2 diabetes.
Background and purpose:
Phytocannabinoids are produced in Cannabis sativa L. in acidic form and are decarboxylated upon heating, processing, and storage. While the biological effects of decarboxylated cannabinoids such as Δ(9) -tetrahydrocannabinol (Δ(9) -THC) have been extensively investigated, the bioactivity of Δ(9) -THCA is largely unknown, despite its occurrence in different Cannabis preparations. The aim of this study was to determine whether Δ(9) -THCA modulates the PPARγ pathway and has neuroprotective activity EXPERIMENTAL APPROACH: The effects of six phytocannabinoids on PPARγ binding and transcriptional activity were investigated. The effect of Δ(9) -THCA on mitochondrial biogenesis and PGC-1α expression was investigated in N2a cells. The neuroprotective effect was analysed in STHdh(Q111/Q111) cells expressing a mutated form of the huntingtin protein, and in N2a cells infected with an adenovirus carrying human huntingtin containing 94 polyQ repeats (mHtt-q94). In vivo neuroprotective activity of Δ(9) -THCA was investigated in mice intoxicated with the mitochondrial toxin 3-nitropropionic acid (3-NP).
Key results:
Cannabinoid acids bind and activate PPARγ with higher potency than their decarboxylated products. Δ(9) -THCA increases mitochondrial mass in neuroblastoma N2a cells, and prevents cytotoxicity induced by serum deprivation in STHdh(Q111/Q111) cells and by mutHtt-q94 in N2a cells. Δ(9) -THCA, through a PPARγ-dependent pathway, was neuroprotectant in mice intoxicated with 3-NP, improving motor deficits and preventing striatal degeneration. In addition, Δ(9) -THCA attenuated microgliosis, astrogliosis and the upregulation of proinflammatory markers induced by 3-NP.
Conclusion and implications:
Δ(9) -THCA shows potent neuroprotective activity, worth consideration for the treatment of Huntington´s Disease and possibly other neurodegenerative and neuroinflammatory diseases.
For centuries, hashish and marihuana, both derived from the Indian hemp Cannabis sativa L., have been used for their medicinal, as well as, their psychotropic effects. These effects are associated with the phytocannabinoids which are oxygen containing C21 aromatic hydrocarbons found in Cannabis sativa L. To date, over 120 phytocannabinoids have been isolated from Cannabis. For many years, it was assumed that the beneficial effects of the phytocannabinoids were mediated by the cannabinoid receptors, CB1 and CB2. However, today we know that the picture is much more complex, with the same phytocannabinoid acting at multiple targets. This contribution focuses on the molecular pharmacology of the phytocannabinoids, including Δ9-THC and CBD, from the prospective of the targets at which these important compounds act.
Isolation of genes encoding the receptors for steroids, retinoids, vitamin D, and thyroid hormone and their structural and functional analysis revealed an evolutionarily conserved template for nuclear hormone receptors. This discovery sparked identification of numerous genes encoding related proteins, termed orphan receptors. Characterization of these orphan receptors and, in particular, of the retinoid X receptor (RXR) positioned nuclear receptors at the epicenter of the "Big Bang" of molecular endocrinology. This Review provides a personal perspective on nuclear receptors and explores their integrated and coordinated signaling networks that are essential for multicellular life, highlighting the RXR heterodimer and its associated ligands and transcriptional mechanism.
AutoDock Vina, a new program for molecular docking and virtual screening, is presented. AutoDock Vina achieves an approximately two orders of magnitude speed-up compared with the molecular docking software previously developed in our lab (AutoDock 4), while also significantly improving the accuracy of the binding mode predictions, judging by our tests on the training set used in AutoDock 4 development. Further speed-up is achieved from parallelism, by using multithreading on multicore machines. AutoDock Vina automatically calculates the grid maps and clusters the results in a way transparent to the user.
We present parametrizations for the nonaqueous solvents dimethyl sulfoxide, ethanol, CCl4, CHCl3, and CH2Cl2 that are compatible with the recent AMBER force field by Cornell et al. (J. Am. Chem. Soc. 1995, 117, 5179−5197). With the general procedure for generating new parameters and the RESP approach to obtain the atomic charges, we achieve flexible all-atom solvent models whose density, heat of vaporization, diffusion constant, and rotational correlation times areespecially for a generic force fieldin good agreement with available experimental data.
Parameterization and test calculations of a reduced protein model with new energy terms are presented. The new energy terms retain the steric properties and the most significant degrees of freedom of protein side chains in an efficient way using only one to three virtual atoms per amino acid residue. The energy terms are implemented in a force field containing predefined secondary structure elements as constraints, electrostatic interaction terms, and a solvent-accessible surface area term to include the effect of solvation. In the force field the main-chain peptide units are modeled as electric dipoles, which have constant directions in α-helices and β-sheets and variable conformation-dependent directions in loops. Protein secondary structures can be readily modeled using these dipole terms. Parameters of the force field were derived using a large set of experimental protein structures and refined by minimizing RMS errors between the experimental structures and structures generated using molecular dynamics simulations. The final average RMS error was 3.7 Å for the main-chain virtual atoms (Cα atoms) and 4.2 Å for all virtual atoms for a test set of 10 proteins with 58–294 amino acid residues. The force field was further tested with a substantially larger test set of 608 proteins yielding somewhat lower accuracy. The fold recognition capabilities of the force field were also evaluated using a set of 27,814 misfolded decoy structures. © 2001 John Wiley & Sons, Inc. J Comput Chem 22: 1229–1242, 2001
A molecular mechanics force field implemented in the Sybyl program is described along with a statistical evaluation of its efficiency on a variety of compounds by analysis of internal coordinates and thermodynamic barriers. The goal of the force field is to provide good quality geometries and relative energies for a large variety of organic molecules by energy minimization. Performance in protein modeling was tested by minimizations starting from crystallographic coordinates for three cyclic hexapeptides in the crystal lattice with rms movements of 0.019 angstroms, 2.06 degrees, and 6.82 degrees for bond lengths, angles, and torsions, respectively, and an rms movement of 0.16 angstroms for heavy atoms. Isolated crambin was also analyzed with rms movements of 0.025 angstroms, 2.97 degrees, and 13.0 degrees for bond lengths, angles, and torsions respectively, and an rms movement of 0.42 angstroms for heavy atoms. Accuracy in calculating thermodynamic barriers was tested for 17 energy differences between conformers, 12 stereoisomers, and 15 torsional barriers. The rms errors were 0.8, 1.7, and 1.13 kcal/mol, respectively, for the three tests. Performance in general purpose applications was assessed by minimizing 76 diverse complex organic crystal structures, with and without randomization by coordinate truncation, with rms movements of 0.025 angstroms, 2.50 degrees, and 9.54 degrees for bond lengths, angles and torsions respectively, and an average rms movement of 0.192 angstroms for heavy atoms.
We present an implementation of generalized Born implicit solvent all-atom classical molecular dynamics (MD) within the AMBER program package that runs entirely on CUDA enabled NVIDIA graphics processing units (GPUs). We discuss the algorithms that are used to exploit the processing power of the GPUs and show the performance that can be achieved in comparison to simulations on conventional CPU clusters. The implementation supports three different precision models in which the contributions to the forces are calculated in single precision floating point arithmetic but accumulated in double precision (SPDP), or everything is computed in single precision (SPSP) or double precision (DPDP). In addition to performance, we have focused on understanding the implications of the different precision models on the outcome of implicit solvent MD simulations. We show results for a range of tests including the accuracy of single point force evaluations and energy conservation as well as structural properties pertainining to protein dynamics. The numerical noise due to rounding errors within the SPSP precision model is sufficiently large to lead to an accumulation of errors which can result in unphysical trajectories for long time scale simulations. We recommend the use of the mixed-precision SPDP model since the numerical results obtained are comparable with those of the full double precision DPDP model and the reference double precision CPU implementation but at significantly reduced computational cost. Our implementation provides performance for GB simulations on a single desktop that is on par with, and in some cases exceeds, that of traditional supercomputers.
Dyslipidemia, especially elevated serum levels of cholesterol, is causally related to cardiovascular disease. The specific role of triglycerides has long been controversial. In this article we discuss the role of serum triglycerides in relation to the risk of cardiovascular disease. First, the (patho)physiology of triglycerides is described, including the definition and a short summary of the primary and secondary causes of hypertriglyceridemia. Furthermore, we will give an overview of the published epidemiological studies concerning hypertriglyceridemia and cardiovascular disease to support the view that triglyceride-rich lipoproteins are an independently associated risk factor. Finally, treatment strategies and treatment targets are discussed. This article is part of a Special Issue entitled Triglyceride Metabolism and Disease.