ArticlePDF Available

Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell Lines

Authors:

Abstract and Figures

Klotho is an anti-aging protein that is mostly secreted by the kidneys, the brain, and the thyroid. It plays a significant role in regulating kidney function and vascular health. Klotho gene is named after "the Spinner" (Clotho from Greek mythology), the goddess who spins the thread of life. Klotho is a transmembrane protein known to be a co-receptor for Fibroblast Growth Factor-23. Klotho gene is expressed in a variety of tissues changes in the levels are associated with many diseases. Klotho is a tumor suppressor in breast cancer and its expression is reduced in human pancreatic adenocarcinoma, and treatment with klotho inhibits the growth of pancreatic cancer cells in vitro and in vivo. Growing evidence suggests that an increase in KL expression may be beneficial for age-related diseases such as arteriosclerosis and diabetes. It remains a challenge today to induce Klotho expression. Herein we show that treating pancreatic cancer cells PANC1, MIAPACA and COLO-205 with Metadichol® a novel food based lipid emulsion of long chain alcohols at picogram/ml, concentration led to a 4-10 fold increase in Klotho expression as seen quantitative RT-PCR. These results suggest the use of Metadichol® given its constituents that are present in foods we consume every day is a novel therapeutic intervention for pancreatic cancer and other diseases.
Open Access
Research Article
Raghavan, J Cancer Sci Ther 2018, 10:11
DOI: 10.4172/1948-5956.1000567
J Cancer Sci Ther, an open access journal
ISSN: 1948-5956 Volume 10(11) 351-359 (2018) - 351
Journal of
Cancer Science & Therapy
J
o
u
r
n
a
l
o
f
C
a
n
c
e
r
S
c
i
e
n
c
e
&
T
h
e
r
a
p
y
ISSN: 1948-5956
*Corresponding author: Palayakotai R Raghavan, Nanorx Inc., PO Box 131,
Chappaqua, NY 10514, USA, Tel: +1-914-671-0224; E-mail: raghavan@nanorxinc.com
Received October 11, 2018; Accepted November 08, 2018; Published November
10, 2018
Citation: Raghavan PR (2018) Metadichol® a Novel Agonist of the Anti-aging Klotho
Gene i n Canc er Cel l Line s. J Cancer Sci Ther 10: 351-357. doi: 10.4172/1948-
5956.1000567
Copyright: © 2018 Raghavan PR. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and
source are credited.
Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell
Lines
Palayakotai R Raghavan*
Nanorx Inc., PO Box 131, Chappaqua, NY 10514, USA
Keywords: VDR; Metadichol; Klotho; Inverse agonist; Protean
agonist; Constitutive receptors; Pancreatic cancer; FGF-23; Diabetes;
Anti-aging; PANC1; COLO-205; MIAPACA; Long chain alcohols
Introduction
e Greek goddess whose name is associated with Klotho protein
spins life’s thread and is associated with reversing aging in mammals.
In Greek Mythology, Klotho has two siblings, Lachesis and Atropos,
and one determines the length of the thread of life and the other cuts the
thread. Klotho (KL), which was named aer one of the three goddesses
of fate who controlled aging in Greek mythology, was initially identied
in 1997 as the gene responsible for early aging-like symptoms in mice
[1], and in several other tissues [2]. It acts as a coreceptor with broblast
growth factor receptor-1 (FGFR1)to bind broblast growth factor 23
(FGF23) and mediate phosphaturia to correct the hyperphosphatemia
arising from 1,25-dihydroxy vitamin D (calcitriol or 1,25D) Stimulation
of intestinal calcium and phosphate absorption.1,25D regulates the
expression of both membrane and soluble klotho forms in multiple kidney
cell types to support FGF23 phosphaturic and vitamin D counter-regulatory
actions at the kidney, possibly exerting antiaging eects [3].
e observation that Klotho inhibits insulin/IGF-1 signalling has
ramications for therapeutic intervention in cancer as well. Activation
of the IGF receptor has been implicated in the etiology of carcinomas
[4]. ere is a growing body of evidence implicating Klotho as a tumour
suppressor [5]. In particular cervical, colorectal, gastric and lung
carcinoma, pancreatic, hepatocellular carcinoma and breast cancer
amongst a few [6]. In general, Higher Klotho expression was associated
with smaller tumor size and Klotho treatment slowed the progression
of cancer. Klotho is signicantly down regulated in all cancer types
including brain malignancies [7]. Down regulation of Klotho (Table
1) was observed across the dierent cancer types. e role of Klotho
in cancer as a tumor suppressor mentioned by Wolf I [8] showed how
Klotho putative tumor suppressor in breast cancer.
e available data indicate that Klotho acts as a universal tumor
suppressor and that there may be a role for Klotho cancer treatment.
Currently, there are no Klotho-based treatments available, although a
number of commonly used compounds do either directly up-regulate
Klotho in vitro, like PPARγ agonists [9], vitamin D [10], Testosterone
[11] and Resveratrol [12], or otherwise up-regulate or at least inhibit
down-regulation of Klotho in vivo. Recent data indicate that Klotho
has extensive eects over the entire spectrum of human diseases [13]
as shown in Table 1.
Abstract
Klotho is an anti-aging protein that is mostly secreted by the kidneys, the brain, and the thyroid. It plays a
signicant role in regulating kidney function and vascular health. Klotho gene is named after "the Spinner" (Clotho
from Greek mythology), the goddess who spins the thread of life. Klotho is a transmembrane protein known to be a
co-receptor for Fibroblast Growth Factor-23. Klotho gene is expressed in a variety of tissues changes in the levels
are associated with many diseases. Klotho is a tumor suppressor in breast cancer and its expression is reduced
in human pancreatic adenocarcinoma, and treatment with klotho inhibits the growth of pancreatic cancer cells in
vitro and in vivo.
Growing evidence suggests that an increase in KL expression may be benecial for age-related diseases
such as arteriosclerosis and diabetes. It remains a challenge today to induce Klotho expression. Herein we show
that treating pancreatic cancer cells PANC1, MIAPACA and COLO-205 with Metadichol® a novel food based lipid
emulsion of long chain alcohols at picogram/ml, concentration led to a 4-10 fold increase in Klotho expression as
seen quantitative RT-PCR. These results suggest the use of Metadichol® given its constituents that are present in
foods we consume every day is a novel therapeutic intervention for pancreatic cancer and other diseases.
Acetylcholine and Nitric Oxide
Dysregulation Aging (highly
accelerated)
Bone Loss (such as osteoporosis
and low bone mass)
All-cause mortality Cancer
Anemia Cataracts
Anorexia Chronic stress
Atherosclerosis (as well as calcication of
the arteries) Depression
Growth hormone deciency Diabetes
Kidney disease (such as CKD and
electrolyte imbalances) Kidney transplant Glaucoma
Hyperphosphatemia Multiple system atrophy
Hyperparathyroidism Pseudoexfoliation syndrome
Hypertension Rheumatoid arthritis
Impaired cognition (such as Alzheimer's
Disease) Sarcopenia
Inammatory bowel disease Skin atrophy (such as scleroderma)
Lung damage Vascular disease (such as coronary
artery disease)
Stroke --
Table 1: Klotho effects over the entire spectrum of human diseases
Citation: Raghavan PR (2018) Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell Lines. J Cancer Sci Ther 10: 351-357. doi:
10.4172/1948-5956.1000567
J Cancer Sci Ther, an open access journal
ISSN: 1948-5956 Volume 10(11) 351-359 (2018) - 352
Sample Cell culture condition Treatment
Metadichol MIAPACA COLO-205, PANC-1 cells
(1 × 106) grown in P35 dish were treated with test compound
Control (Media)
1 pg/ml
100 pg/ml
1 ng/ml
100 ng/ml
1 µg/ml
Table 2: Treatment protocol.
Klotho levels are decreased in certain types of human tumor cells/
tissues, and reduced levels are associated with decreased survival [14].
Animal studies show that Klotho can improve survival rates [15] reduce
metastasis and reduce cancer cell resistance to chemotherapeutic agents
[16]. Abramovitz [17] showed in studies on pancreatic adenocarcinoma
cell lines that Klotho expression is reduced, and treatment with Klotho
eectively slows growth of pancreatic cancer cells in vitro and in
vivo. Biao Xie also have shown that Klotho is a tumor suppressor in
gastric cancer [18]. Injection of secreted Klotho protein suppressed
metastasis and improved survival in mice transplanted with human
lung cancer cells [19]. Long-term administration of KL to mice shows
a favorable toxicity prole. As klotho is an endogenous hormone, its
administration is potentially feasible and may serve as a novel therapy
for pancreatic, as well as other cancers.
Metadichol® nano-emulsion of long chain alcohols is an inverse
agonist of VDR (Vitamin D receptor) that is non- toxic. We tested it in
the pancreatic cell lines PANC1, COLO-205 and MIAPACA cell lines
and the results show that it enhances Klotho expression and thus would
pave the way for use a therapeutic in diseases where increased Klotho
levels are required.
Experimental
e experimental work was outsourced and carried out by Skanda
Life Sciences Private Limited of Bangalore India. e cell lines were
purchased from ATCC, USA and primers from Eurons India. PCR
and qPCR Method Standardization. For each of target gene the PCR
conditions viz, Tm, Amplicon specicity & size were optimized using
in-house established and validated methods/reagents.
qPCR
Instruments used CFX96 real time PCR, Bio-Rad. Gene regulation
of KLOTHO genes in MiaPaca, Colo-205, Panc-1 cells treated with
metadichol.
Cell lines
COLO 205 (ATCC® CCL-222™), MIA PaCa-2 (ATCC® CRL-1420™),
PANC-1 (ATCC® CRL-1469™) (Table 2).
Sample Preparation and RNA Isolation
Total RNA from the cells was extracted using TRizol Reagent
(Invitrogen) according to manufacturer’s instruction. Cells were
washed twice with PBS and centrifuged at 2000rpm for 5min. To the
cell pellet, 1ml of TRIzol (per p35 dish) was added in 1.5ml Eppendrof
tube and vortexed. Samples were allowed to stand for 5 minutes at room
temperature. To the reaction mixture 0.2 ml of chloroform is added
and vigorously mixed for 15 seconds. e tube was allowed to stand
at room temperature for 5 minutes, centrifuged the resulting mixture
at 10,000rpm for 15min at 40 C. Upper aqueous phase is transferred
to a new clean Eppendorf tube and treated with 0.5ml of isopropanol.
e resultant mixture is mixed gently by inverting the sample 5 times
and incubated at room temperature for 5 minutes. Samples were
centrifuged at 10,000 rpm for 10 minutes at 40 C. Supernatant liquid
was discarded and the RNA pellet was washed by adding 1ml of 70%
ethanol. Mix the sample gently by inverting few times. Centrifuged for
5min at 14,000rpm at 40 C. Supernatant was discarded by inverting the
tube on a clean tissue paper. Later, the pellet was dried by incubating in
a dry bath for 5min at 550 C. e pellet was then resuspended in 25 µl
of DEPC treated water.
RT-PCR
A semi quantitative reverse transcriptase polymerase chain reaction
(RT-PCR) was carried out using Techno Prime system to determine
the levels of Klotho and β-Actin mRNA expressions. e cDNA was
synthesized from 2 µg of RNA using the Verso cDNA synthesis kit
(ermo Fischer Scientic) with oligo dT primer according to the
manufacturer’s instructions. e reaction volume was set to 20μl and
cDNA synthesis was performed at 42o C for 60 min, followed by RT
inactivation at 85o C for 5 min (Table 3).
PCR
e PCR mixture (nal volume of 20 µL) contained 1 µL of
cDNA, 10 µL of Red Taq Master Mix 2x (Amplicon) and 1µM of
each complementary primer specic for Klotho and β-Actin (internal
control) sequence. e samples were denatured at 94o C for 5 minutes
and amplied using 35 cycles of 94o C for 30 seconds, 53o C for 30
seconds, and 72o C for 1 minute for KLOTHO renaturation was
set to 49o C and for β-Actin the renaturation was set to 55o C for 30
seconds followed by a nal elongation at 72o C for 10 minutes. e
optimal numbers of cycles have been selected for amplication of this
genes experimentally so that amplications were in the exponential
range and had not reached a plateau. Ten microliters of the nal
amplication product were run on a 2% ethidium-stained agarose gel
and photographed. Quantication of the results was accomplished by
measuring the optical density of the bands, using the computerized
imaging program Image J. e values were normalized to β-Actin
intensity levels (Figure 1-10).
Gene Primer pair Sequence Tm Product size (bp)
Β-Actin FP TCCTCCTGAGCGCAAGTACTCT 62.1 153
RP GCTCAGTAACAGTCCGCCTAGAA 62.4
Klotho FP GGGAGGTCAGGTGTCCATTG 55.88 152
RP TGCTCTCGGGATAGTCACCA 53.83
Table 3: Primer details.
Citation: Raghavan PR (2018) Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell Lines. J Cancer Sci Ther 10: 351-357. doi:
10.4172/1948-5956.1000567
J Cancer Sci Ther, an open access journal
ISSN: 1948-5956 Volume 10(11) 351-359 (2018) - 353
Figure 2: Amplication of Klotho gene in MIAPACA cell (Lane 1-Ladder; Lane 2-Control; Lane 3-1 pg/mL; Lane 4-100 pg/mL; Lane 5-1 ng/ml; Lane 6-100 ng/
ml; Lane 7-1 µg/mL).
Figure 3: Amplication of β-Actin gene in COLO-205 (Lane 1- Ladder; Lane 2-Control; Lane 3-1 ng/mL; Lane 4-100 ng/mL; Lane 5-1 pg/ml; Lane 6-100 pg/ml;
Lane 7-1 µg/mL).
Figure 1: Amplication of β-Actin gene in MIAPACA (Lane 1-Ladder; Lane 2-Control; Lane 3-1 pg/mL; Lane 4-100 pg/mL; Lane 5-1 ng/ml; Lane 6-100 ng/ml;
Lane 7-1 µg/mL).
Citation: Raghavan PR (2018) Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell Lines. J Cancer Sci Ther 10: 351-357. doi:
10.4172/1948-5956.1000567
J Cancer Sci Ther, an open access journal
ISSN: 1948-5956 Volume 10(11) 351-359 (2018) - 354
Figure 4: Amplication of Klotho gene in COLO-205 cell (Lane 1- Ladder; Lane 2-Control; Lane 3-1 ng/mL; Lane 4-100 ng/mL; Lane 5-1 pg/ml; Lane 6-100 pg/
ml; Lane 7-1 µg/mL).
100 bp
100 bp
Figure 5: Amplication of β-Actin gene in PANC1 (Lane 1- Ladder; Lane 2-Control; Lane 3-1 ng/mL; Lane 4-100 ng/mL; Lane 5-1 pg/ml; Lane 6-100 pg/ml; Lane
7-1 µg/mL).
Figure 6: Amplication of Klotho gene in PANC1 cell (Lane 1- Ladder; Lane 2-Control; Lane 3-1 ng/mL; Lane 4-100 ng/mL ; Lane 5-1 pg/ml; Lane 6-100 pg/ml;
Lane 7-1 µg/mL).
Citation: Raghavan PR (2018) Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell Lines. J Cancer Sci Ther 10: 351-357. doi:
10.4172/1948-5956.1000567
J Cancer Sci Ther, an open access journal
ISSN: 1948-5956 Volume 10(11) 351-359 (2018) - 355
Figure 7: Raw data of MIAPACA cell line.
Citation: Raghavan PR (2018) Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell Lines. J Cancer Sci Ther 10: 351-357. doi:
10.4172/1948-5956.1000567
J Cancer Sci Ther, an open access journal
ISSN: 1948-5956 Volume 10(11) 351-359 (2018) - 356
Figure 8: Raw data COLO-205 cell line.
Results
ree dierent cell lines were individually treated with Metadichol
at various concentrations to assess the expression of Klotho gene. e
maximum up regulation of Klotho gene expression is seen at lowest
concentration treated, i.e., 1pg/ml in both MIAPACA and PANC-1
cells up 10.34 and 3.66-fold, whereas, in COLO 205 the expression at
1µg/ml was maximum up 6.36-fold compared to control. Overall, the
Up regulation of Klotho gene expression level is dose dependent in
MIAPACA cells from highest to lowest treatment concentrations from
1µg/ml to 1pg/ml.
Citation: Raghavan PR (2018) Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell Lines. J Cancer Sci Ther 10: 351-357. doi:
10.4172/1948-5956.1000567
J Cancer Sci Ther, an open access journal
ISSN: 1948-5956 Volume 10(11) 351-359 (2018) - 357
Figure 9: Raw data PANC1 cell line.
Citation: Raghavan PR (2018) Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell Lines. J Cancer Sci Ther 10: 351-357. doi:
10.4172/1948-5956.1000567
J Cancer Sci Ther, an open access journal
ISSN: 1948-5956 Volume 10(11) 351-359 (2018) - 358
Discussion
King have identied small molecules that elevated Klotho
expression, but the increase was only in the range of 20-50% at micro
molar (uM) concentrations and with compounds whose toxicity is not
known in humans [20].
Marco [21] suggested that Orally-available, transcriptional factors
like D-alpha-tocopherol [22], and vitamin D receptors (VDR) agonists
such as cholecalciferol [23,24] and lithocholic acid [25] can increase
Klotho expression. ey suggested that, or a combination of these
molecules would result in increased expression of endogenous, human
Klotho through transcriptional activation.
R.E. Forster [26] have postulated that the liganded VDR up
regulates Klotho gene via Vitamin D response elements (VDRE). e
actions of 1,25 dihydroxyvitamin D3 (1,25 D3) on phosphorus are
opposed via the combined eects of FGF23 and Klotho, which is up
regulated by the liganded vitamin D receptor.
1,25D3 acting on VDR induces FGF23 in osteocytes to increase
circulating FGF23 [27], which protects against hyperphosphatemia
[28]. FGF23 also increases 1,25D3 degradation [29].
Metadichol® a nanoemulsion of long-chain binds to VDR Receptor
as an inverse agonist, and the formulation contains D-alpha-tocopherol
[30]. Inverse agonists bind to the same binding site as the agonists
in case of VDR it is 1,25 dihydroxy Vitamin D3. ey induce a
pharmacological response dierent and distinct when compared to that
of the agonist. Metadichol in our human subjects [31] behaves more
likely a Protean agonist as it exhibits dual properties like, e.g. Increasing
Insulin Secretion (type 1) and reducing Insulin (type 2). Protean
agonists behave as both positive and negative agonists on the same
receptor, depending on the degree of constitutive activity. If there is no
constitutive activity, the agonist would be a positive agonist [32]. When
constitutive activity is present, the Protean agonist would be an inverse
agonist. Metadichol an extract of sugar cane wax exhibits properties
that could also be considered as an Adaptogens [33] which are unique
in their ability to balance endocrine hormones and the immune system
[34-37]. Adaptogens help maintain optimal homeostasis in the body.
Adaptogens are proposed to have a normalizing in the body eect
on the body and have the ability to toning down the activity of hyper
functioning systems in case of constitutive receptors or strengthening
the operation of hypo-functioning systems like an agonist. Given the
precedence of VDR and its role in regulating Klotho genes it is not
surprising that Metadichol® actions on VDR have a similar outcome
and as a hormone, it shows activity at picogram levels. Also, Metadichol
is nontoxic [38-40] as compared to other solutions in literature to
enhance the use of Klotho as a therapeutic target.
Conclusion
Klotho has been shown to have a wide range of roles in many
pathologies. Changes in the levels of Klotho are associated with many
diseases. It could be useful as a potential biomarker. However, also
has a future as a safe therapeutic in mitigating various diseases where
Kloo as a sgncan role.
References
1. Kuro-o M, Matsumura Y, Aizawa H, Kawaguchi H, Suga T, et al. (1997)
Mutation of the mouse klotho gene leads to a syndrome resembling aging.
Nature 390: 45-51.
2. Kuro-o M (2010) Klotho. Pugers Arch 459: 333-343.
3. Haussler MR, Haussler CA, Whiteld GK, Hsieh JC, Thompson PD, et
al. (2010) The nuclear vitamin D receptor controls the expression of genes
encoding factors which feed the ‘‘Fountain of Youth’’ to mediate healthy aging.
J Steroid Biochem Mol Biol 121: 88-97.
4. Pollak MN, Schernhammer ES, Hankinson SE (2004) Insulin-like growth
factors and neoplasia. Nat Rev Cancer 4: 505-518.
Figure 10: Summary of results Q-RT-PCR of Meta-dichol treated cells.
Citation: Raghavan PR (2018) Metadichol® a Novel Agonist of the Anti-aging Klotho Gene in Cancer Cell Lines. J Cancer Sci Ther 10: 351-357. doi:
10.4172/1948-5956.1000567
J Cancer Sci Ther, an open access journal
ISSN: 1948-5956 Volume 10(11) 351-359 (2018) - 359
5. Zhou X, Wang X (2014) Klotho: A novel biomarker for cancer. J Cancer Res
Clin Oncol 141: 961-969.
6. Kurosu H, Kuro OM (2009) The klotho gene family as a regulator of endocrine
broblast growth factors. Mol Cell Endocrinol 299: 72-78.
7. Chen CD, Li H, Liang J, Hixson K, Zeldich E, et al. (2014) The anti-aging
and tumor suppressor protein klotho enhances differentiation of a human
oligodendrocytic hybrid cell line. J Mol Neurosci 55: 76-90.
8. Wolf I, Laitman Y, Rubinek T, Abramovitz L, Novikov I, et al. (2009) Functional
variant of klotho: A breast cancer risk modier among BRCA1 mutation carriers
of Ashkenazi origin. Oncogene 29: 26-33.
9. Zhang H, Li Y, Fan Y, Wu J, Zhao B, et al. (2008) Klotho is a target gene of
PPAR-gamma. Kidney Int 74: 732-739.
10. Forster RE, Jurutka PW, Hsieh JC, Haussler CA, Lowmiller CL, et al. (2011)
Vitamin D receptor controls the expression of the anti-aging klotho gene in
mouse and human renal cells. Biochem Biophys Res Commun 414: 557-562.
11. Hsu SC, Huang SM, Lin SH, Ka SM, Chen A, et al. (2014) Testosterone
increases renal anti-aging klotho gene expression via the androgen receptor-
mediated pathway. Biochem J 464: 221-229.
12. Hsu SC, Huang SM, Chen A, Sun CY, Lin SH, et al. (2014) Resveratrol
increases anti-aging Klotho gene expression via the activating transcription
factor 3/c- Jun complex-mediated signaling pathway. Int J Biochem Cell Biol
53: 361-371.
13. Sopjani M (2014) Relevance of the aging suppressor protein Klotho in health
and disease: Introduction, cellular signaling, mechanisms, clinical relevance,
conclusions, and perspectives. Lap Lambert Academic Publishing 2: 1.
14. Tang X, Wang Y, Fan Z, Ji G, Wang M, et al. (2016) Klotho: A tumor suppressor
and modulator of the Wnt/β-catenin pathway in human hepatocellular
carcinoma. Lab Invest 96: 197-205.
15. Ligumsky H, Rubinek T, Merenbakh-Lamin K, Yeheskel A, Sertchook R, et
al. (2015) Tumor suppressor activity of klotho in breast cancer is revealed by
structure-function analysis. Mol Cancer Res 13: 1398-1407.
16. Wang Y, Chen L, Huang G, He D, He J, et al. (2013) Klotho sensitizes human
lung cancer cell line to cisplatin via PI3k/Akt pathway. PLOS One 8: e57391.
17. Abramovitz L, Rubinek T, Ligumsky H, Bose S, Barshack I, et al. (2012) KL1
internal repeat mediates klotho tumor suppressor activities and inhibits bFGF
and IGF-1 signaling in pancreatic cancer. Clin Cancer Res 17: 4254-4266.
18. Xie B, Zhou J, Shu G, Liu DC, Zhou J, et al. (2013) Restoration of klotho gene
expression induces apoptosis and autophagy in gastric cancer cells: tumor
suppressive role of klotho in gastric cancer. Cancer Cell Int 13: 18.
19. Doi S, Zou Y, Togao O, Pastor JV, John GB, et al. (2011) Klotho inhibits
transforming growth factor-beta1 (TGF-beta1) signaling and suppresses renal
brosis and cancer metastasis in mice. J Biol Chem 286: 8655-8665.
20. King GD, Chen C, Huang MM, Zeldich E, Brazee PL, et al. (2012) Identication of
novel small molecules that elevate Klotho expression. Biochem J 441: 453-461.
21. Marco R (2017) A novel approach to klotho aimed at delaying and reversing
aging. BAOJ HIV 3: 029.
22. Xuan NT, Trang PT, Phong NV, Toan NL, Trung DM, et al. (2016) Klotho
sensitive regulation of dendritic cell functions by vitamin E. Biol Res 49: 45.
23. Haussler MR, Whiteld GK, Haussler CA, Sabir MS, Khan Z, et al. (2016) 1,
25-Dihydroxyvitamin D and Klotho: A tale of two renal hormones coming of age.
Vitam Horm 100: 165-230.
24. Lau WL, Leaf EM, Hu MC, Takeno MM, Kuro OM, et al. (2012) Vitamin D
receptor agonists increase klotho and osteopontin while decreasing aortic
calcication in mice with chronic kidney disease fed a high phosphate diet.
Kidney Int 82: 1261-1270.
25. Kollitz EM, Zhang G, Hawkins MB, Whiteld GK, Reif DM, et al. (2016)
Evolutionary and functional diversication of the vitamin D receptor-Lithocholic
acid partnership. PLoS ONE 11: e0168278.
26. Forster RE, Jurutka PW, Hsieh JC, Haussler CA, Lowmiller CL, et al. (2011)
Vitamin D receptor controls expression of the anti-aging klotho gene in mouse
and human renal cells. Biochem Biophys Res Commun 414: 557-562.
27. Kolek OI, Hines ER, Jones MD, LeSueur LK, Lipko MA, et al. (2005) 1 alpha,
25-Dihydroxyvitamin D3 upregulates FGF23 gene expression in bone: The nal
link in a renal-gastrointestinal-skeletal axis that controls phosphate transport.
Am J Physiol Gastrointest Liver Physiol 289: G1036-G1042.
28. Gattineni J, Twombley K, Goetz R, Mohammadi M, Baum M, et al. (2011)
Regulation of serum 1, 25 (OH)2 Vitamin D3 levels by broblast growth factor
23 is mediated by FGF receptors 3 and 4. Am J Physiol Renal Physiol 301:
F371-377.
29. Raghavan PR (2014) U.S Patent 8: 722.
30. Raghavan PR (2015) U.S Patent 9: 006.
31. Neubig RR (2007) Missing links: Mechanisms of protean agonism. Mol
Pharmacol 71: 200-1202.
32. Panossian A, Wikman G (2009) Evidence-based efcacy of adaptogens in
fatigue, and molecular mechanisms related to their stress-protective activity.
Current Clin Pharmacol 4: 198-219.
33. Raghavan PR (2017) Metadichol: A novel ROR gamma inverse agonist and its
applications in psoriasis. J Clin Exp Dermatol Res 8: 433.
34. Raghavan PR (2017) Metadichol® and vitamin C increase in vivo, an open-label
study. Vitam Miner 6: 163.
35. Raghavan PR (2017) Rheumatoid arthritis and osteoporosis: A case study. J
Arthritis 6: 240.
36. Raghavan PR (2017) Systolic and diastolic BP control in metabolic syndrome
patients with Metadichol® a novel nano emulsion lipid. J Cardiol & Cardiovasc
Ther 5: 555660.
37. Alemán CL, Más R, Hernández C, Rodeiro I, Cerejido E, et al. (1994) A
12-month study of policosanol oral toxicity in Sprague Dawley rats. Toxicol Lett
70: 77-87.
38. Alemán CL, Más Ferreiro R, Noa Puig M, Rodeiro Guerra I, Hernández Ortega
C, et al. (1994) Carcinogenicity of policosanol in Sprague-Dawley rats: A
24-month study. Teratog Carcinog Mutagen 14: 239-249.
39. Alemán CL, Puig MN, Elías EC, Ortega CH, Guerra IR, et al. (1995)
Carcinogenicity of policosanol in mice: An 18-month study. Food Chem Toxicol
33: 573-578.
40. Georgiou A, Lisacek-Kiosoglous A, Yiallouris A, Stephanou A, Patrikios I (2017)
Klotho: The protein of faith. EC Neurology 75: 189-223.
... Additionally, Metadichol® targets selectively cancer cells in this case Caco-2 cells. In a previous study 22 of Klotho gene expression in the cancer cell lines Mia-Paca, Colo 205, and Panc1, Metadichol was seen to be toxic to cell lines above 1 µg/ml. It is also toxic at 10 µg/ml in leukaemia cancer cells 24 3 Metadichol also inhibits TMPRSS2 ( ...
Preprint
Full-text available
New pathogenic virus outbreaks, occurring with increasing regularity, are leading us to explore novel approaches, which will reduce the reliance on time-consuming vaccine modes to halt the outbreaks. The requirement is to find a universal approach to disarm any new and as yet unknown viruses as they appear. A promising approach could be targeting lipid membranes, which are common to all viruses and bacteria. The ongoing pandemic of severe acute respiratory syndrome-coronavirus 2 (SARS-COV-2) has reaffirmed the importance of interactions between components of the host cell plasma membrane and the virus envelope as a critical mechanism of infection. Metadichol®, a nano lipid emulsion, has been examined and shown to be a strong candidate to help stop the proliferation of SARS-COV-2. Naturally derived substances, such as long-chain saturated lipid alcohols, reduce the infectivity of various types of viruses, including coronaviruses such as SARS-COV-2, by modifying lipid-dependent attachment to human host cells. SARS-COV-2 uses the receptor ACE2 for entry and the serine protease TMPRSS2 for S protein priming. Metadichol®, a nano lipid formulation of long-chain alcohols, has been shown to inhibit TMPRSS2 (EC50 96 ng/ml). Compared to the inhibitor camostat mesylate (EC50 26000 ng/ml), it is 270 times more potent. Additionally, Metadichol® is also a extremely weak inhibitor of ACE2 at 31 µg/ml. Further a live virus assay in Caco2 cells, Metadichol® inhibited SARS-CoV-2 replication with an EC90 of 0.16 µg/ml.
... Additionally, Metadichol® targets selectively cancer cells in this case Caco-2 cells. In a previous study 22 of Klotho gene expression in the cancer cell lines Mia-Paca, Colo 205, and Panc1, Metadichol was seen to be toxic to cell lines above 1 µg/ml. It is also toxic at 10 µg/ml in leukaemia cancer cells 24 3 Metadichol also inhibits TMPRSS2 ( Table 6 gure 1,2) and is 270-fold more potent than CM 24 Metadichol moderately inhibits ACE2 ( Table 7, ...
Preprint
Full-text available
New pathogenic virus outbreaks, occurring with increasing regularity, are leading us to explore novel approaches, which will reduce the reliance on time-consuming vaccine modes to halt the outbreaks. The requirement is to find a universal approach to disarm any new and as yet unknown viruses as they appear. A promising approach could be targeting lipid membranes, which are common to all viruses and bacteria. The ongoing pandemic of severe acute respiratory syndrome-coronavirus 2 (SARS-COV-2) has reaffirmed the importance of interactions between components of the host cell plasma membrane and the virus envelope as a critical mechanism of infection. Metadichol®, a nano lipid emulsion, has been examined and shown to be a strong candidate to help stop the proliferation of SARS-COV-2. Naturally derived substances, such as long-chain saturated lipid alcohols, reduce the infectivity of various types of viruses, including coronaviruses such as SARS-COV-2, by modifying lipid-dependent attachment to human host cells. SARS-COV-2 uses the receptor ACE2 for entry and the serine protease TMPRSS2 for S protein priming. Metadichol®, a nano lipid formulation of long-chain alcohols, has been shown to inhibit TMPRSS2 (EC50 96 ng/ml). Compared to the inhibitor camostat mesylate (EC50 26000 ng/ml), it is 270 times more potent. Additionally, Metadichol® is also a extremely weak inhibitor of ACE2 at 31 µg/ml. Further a live virus assay in Caco2 cells, Metadichol® inhibited SARS-CoV-2 replication with an EC90 of 0.16 µg/ml.
... Additionally, Metadichol® targets selectively cancer cells in this case Caco-2 cells. In a previous study [22] of Klotho gene (KL) expression in the cancer cell lines Mia-Paca, Colo 205, and Panc1, Metadichol was seen to be toxic to cell lines above 1 µg/ml. It is also toxic at 10 µg/ml in leukaemia cancer cells [3,23]. ...
Preprint
Full-text available
Background New pathogenic virus outbreaks, occurring with increasing regularity, are leading us to explore novel approaches, which will reduce the reliance on time-consuming vaccine modes to halt the outbreaks. The requirement is to find a universal approach to disarm any new and as yet unknown viruses as they appear. A promising approach could be targeting lipid membranes, which are common to all viruses and bacteria.The ongoing pandemic of severe acute respiratory syndrome-coronavirus 2 (SARS-COV-2) has reaffirmed the importance of interactions between components of the host cell plasma membrane and the virus envelope as a critical mechanism of infection. Metadichol®, a nano lipid emulsion, has been examined and shown to be a strong candidate to help stop the proliferation of SARS-COV-2.Naturally derived substances, such as long-chain saturated lipid alcohols, reduce the infectivity of various types of viruses, including coronaviruses such as SARS-COV-2, by modifying lipid-dependent attachment to human host cells. SARS-COV-2 uses the receptor ACE2 for entry and the serine protease TMPRSS2 for S protein priming. Methods Metadichol was tested against TMPRSS2 ana ACE2 invitro using commercial available kits. Also it was tested against the live virus in Caco2 cells to test for inhibition of viral replication of SARS-COV-2.ResultsMetadichol®, a nano lipid formulation of long-chain alcohols, has been shown to inhibit TMPRSS2 (EC50 96 ng/ml). Compared to the inhibitor camostat mesylate (EC50 26000 ng/ml), it is 270 times more potent. Additionally, Metadichol® is also a weak inhibitor of ACE2 at 31 µg/ml. Further a live virus assay in Caco2 cells, Metadichol® inhibited SARS-CoV-2 replication with an EC90 of 0.16 µg/ml.Conclusions Metadichol inhibits SARS-COV-2 virus and since it a non toxic molecule can be easily tested in humans and as it has LD 50 of over 5000 mg/kilo and could help mitigate the crisis facing the world today.
... The sialidase activity was found to be higher at 16 We could not compare activity at higher concentration with Metadichol as it is toxic to the cancer cell lines. We have documented that pancreatic cancer cell line, express klotho genes on Metadichol treatment at picogram levels as Klotho gene blocks cancer cell growth [25]. Metadichol increases CD33 expression of 400 fold. ...
Article
Full-text available
Humans face a constant threat from pathogens like influenza varieties H1N1, H5N1, and others and there is a need to prevent these from epidemics. The pathogens depend on successful colonization of the host in order to reproduce and multiply. Sialidases are known as neuraminidases are a group of enzymes, the most abundant of these being the exo-sialidases that can catalyze the cleavage of sialic acids from carbohydrates, glycoproteins or glycolipids. Sialidases have been thoroughly studied since their discovery 75 years ago and their occurrence in bacteria and viruses is widespread. They are found in diverse virus families and bacteria and other microbes. Moreover, sialic acids serve as a receptor for various pathogens. This allows bacteria like H1N1 or other influenza viruses, to enter the host cell. There is a need to block sialidases as they release sialic acid that serves as nutrition for the microbes and as well allows them to bind and invade the host cell where they can proliferate. This makes sialidases an interesting target to control pathogenic activity. Metadichol ® is nanoemulsion of long-chain lipid alcohols derived from food ingredients. In rats, it has an LD50 of 5000 mg/kilo and its ingredients are present in many foods we consume on a daily basis. It has antiviral and antibacterial and anti-parasitic properties. We studied inhibition of Sialidases by inducing it with Lipopolysaccharide (LPS) using THP1 cells. Metadichol showed inhibition at 1 picogram per ml to 1 nanogram per/ml. Compared to Prednisone. It is 100 times more active. Previous studies on Metadichol ® showed that it is toxic to cancer cells at higher concentrations. Since it is safer, it has the potential of being directly tested on humans without side effects and could have a potential role in mitigating the pathogens that a burden on the Public health system.
Article
Full-text available
Increasing outbreaks of new pathogenic viruses have promoted the exploration of novel alternatives to time-consuming vaccines. Thus, it is necessary to develop a universal approach to halt the spread of new and unknown viruses as they are discovered. One such promising approach is to target lipid membranes, which are common to all viruses and bacteria. The ongoing severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic has reaffirmed the importance of interactions between the virus envelope and the host cell plasma membrane as a critical mechanism of infection. Metadichol®, a nanolipid emulsion of long-chain alcohols, has been demonstrated as a strong candidate that inhibits the proliferation of SARS-CoV-2. Naturally derived substances, such as long-chain saturated lipid alcohols, reduce viral infectivity, including that of coronaviruses (such as SARS-CoV-2) by modifying their lipid-dependent attachment mechanism to human host cells. The receptor ACE2 mediates the entry of SARS-CoV-2 into the host cells, whereas the serine protease TMPRSS2 primes the viral S protein. In this study, Metadichol® was found to be 270 times more potent an inhibitor of TMPRSS2 (EC50=96 ng/mL) than camostat mesylate (EC50=26000 ng/mL). Additionally, it inhibits ACE with an EC50 of 71 ng/mL, but it is a very weak inhibitor of ACE2 at an EC50 of 31 μg/mL. Furthermore, the live viral assay performed in Caco-2 cells revealed that Metadichol® inhibits SARS-CoV-2 replication at an EC90 of 0.16 μg/mL. Moreover, Metadichol® had an EC90 of 0.00037 μM, making it 2081 and 3371 times more potent than remdesivir (EC50=0.77 μM) and chloroquine (EC50=1.14 μM), respectively.
Preprint
Full-text available
New pathogenic virus outbreaks, occurring with increasing regularity, are leading us to explore novel approaches, which will reduce the reliance on time-consuming vaccine modes to halt the outbreaks. The requirement is to find a universal approach to disarm any new and as yet unknown viruses as they appear. A promising approach could be targeting lipid membranes, which are common to all viruses and bacteria. The ongoing pandemic of severe acute respiratory syndrome-coronavirus 2 (SARS-COV-2) has reaffirmed the importance of interactions between components of the host cell plasma membrane and the virus envelope as a critical mechanism of infection. Metadichol®, a nano lipid emulsion, has been examined and shown to be a strong candidate to help stop the proliferation of SARS-COV-2. Naturally derived substances, such as long-chain saturated lipid alcohols, reduce the infectivity of various types of viruses, including coronaviruses such as SARS-COV-2, by modifying lipid-dependent attachment to human host cells. SARS-COV-2 uses the receptor ACE2 for entry and the serine protease TMPRSS2 for S protein priming. Metadichol®, a nano lipid formulation of long-chain alcohols, has been shown to inhibit TMPRSS2 (EC50 96 ng/ml). Compared to the inhibitor camostat mesylate (EC50 26000 ng/ml), it is 270 times more potent. Additionally, Metadichol® is also a weak inhibitor of ACE2 at 31 µg/ml. Further a live virus assay in Caco2 cells, Metadichol® inhibited SARS-CoV-2 replication with an EC90 of 0.16 µg/ml.
Preprint
Full-text available
New pathogenic virus outbreaks, occurring with increasing regularity, are leading us to explore novel approaches, which will reduce the reliance on time-consuming vaccine modes to halt the outbreaks. The requirement is to find a universal approach to disarm any new and as yet unknown viruses as they appear. A promising approach could be targeting lipid membranes, which are common to all viruses and bacteria. The ongoing pandemic of severe acute respiratory syndrome-coronavirus 2 (SARS-COV-2) has reaffirmed the importance of interactions between components of the host cell plasma membrane and the virus envelope as a critical mechanism of infection. Metadichol®, a nano lipid emulsion, has been examined and shown to be a strong candidate to help stop the proliferation of SARS-COV-2. Naturally derived substances, such as long-chain saturated lipid alcohols, reduce the infectivity of various types of viruses, including coronaviruses such as SARS-COV-2, by modifying lipid-dependent attachment to human host cells. SARS-COV-2 uses the receptor ACE2 for entry and the serine protease TMPRSS2 for S protein priming. Metadichol®, a nano lipid formulation of long-chain alcohols, has been shown to inhibit TMPRSS2 (EC50 96 ng/ml). Compared to the inhibitor camostat mesylate (EC50 26000 ng/ml), it is 270 times more potent. Additionally, Metadichol® is also a weak inhibitor of ACE2 at 31 µg/ml. Further a live virus assay in Caco2 cells, Metadichol® inhibited SARS-CoV-2 replication with an EC90 of 0.16 µg/ml.
Article
New pathogenic virus outbreaks, occurring with increasing regularity, are leading us to explore novel approaches, which will reduce the reliance on time-consuming vaccine modes to halt the outbreaks. The requirement is to find a universal approach to disarm any new and as yet unknown viruses as they appear. A promising approach could be targeting lipid membranes, which are common to all viruses and bacteria. The ongoing pandemic of severe acute respiratory syndrome-coronavirus 2 (SARS-COV-2) has reaffirmed the importance of interactions between components of the host cell plasma membrane and the virus envelope as a critical mechanism of infection. Metadichol®, a nano lipid emulsion, has been examined and shown to be a strong candidate to help stop the proliferation of SARS-COV-2. Naturally derived substances, such as long-chain saturated lipid alcohols, reduce the infectivity of various types of viruses, including coronaviruses such as SARS-COV-2, by modifying lipid-dependent attachment to human host cells. SARS-COV-2 uses the receptor ACE2 for entry and the serine protease TMPRSS2 for S protein priming. Metadichol®, a nano lipid formulation of long-chain alcohols, has been shown to inhibit TMPRSS2 (EC50 96 ng/ml). Compared to the inhibitor camostat mesylate (EC50 26000 ng/ml), it is 270 times more potent. Additionally, Metadichol® is also a weak inhibitor of ACE2 at 31 µg/ml. Further a live virus assay in Caco2 cells, Metadichol® inhibited SARS-CoV-2 replication with an EC90 of 0.16 µg/ml. Keywords: Coronavirus, SARS-COV-2, COVID-19, ACE2, TMPRSS2, VDR, Metadichol
Preprint
Full-text available
New pathogenic virus outbreaks with increasing regularity are leading us to explore novel approaches, which will reduce the reliance on a time-consuming vaccine mode to halt the strike. The requirement is to find a universal approach to disarm any new and as yet unknown viruses as they appear. A promising approach could be by targeting the lipids membranes, common to all viruses and bacteria. The ongoing pandemic of the SARS-coronavirus 2 (SARS-CoV-2) has restated the importance of interactions between components of the host cell plasma membrane and the virus envelope as a critical mechanism of infection. Metadichol ®, a nano lipid emulsion, has been examined and shown to be a strong candidate to help stop the proliferation of the SARS-COV-2. Naturally derived substances, such long chain saturated lipid alcohols reduce the infectivity of various types of viruses, including the coronavirus like SARS-COV-2, by modifying the lipid-dependent attachment to human host cells. SARS-COV-2 uses the receptor ACE2 for entry and the serine protease TMPRSS2 for S protein priming. Metadichol®, a nano lipid formulation of long-chain alcohols, has been shown to inhibit TMPRSS2 (EC50 of 96 ng/ml). Compared to the inhibitor Camostat Mesylate (26000 ng/ml), it is 270 times more potent. Also, Metadichol ® is a moderate inhibitor of ACE2 @ 31 µg/ml. In the SARS-COV2 antiviral assay using CACO2 cells, it has an EC90 of 0.16 µg/ml.
Conference Paper
Metadichol ® is a food derived nano emulsion that is effective against many viruses ( over 17 of them) . It acts on viruses through multiple pathway most likely through disruption of the protective lipid membrane layer than viruses. In case of COVID 19 we present data that it blocks optimally ACE2 and Nuclear Androgen receptor which controls expression of TMPRSS2. Both TMPRSS2 and ACE 2 are need for viral entry. Optimal blocking is necessary as both ACE2 and AR are needed for other functions in the body to maintain Homeostasis. In addition Metadichol binds to VDR as an inverse agonist the only one known and VDR activation is necessary for a anti viral response. Metadichol also endogenously increases Vitamin C that leads to IgA,IgG and IgM and also Interferons that are needed to mount a anti viral response
Article
Full-text available
Klotho (Klotho) is a transmembrane protein that was initially thought to be expressed only in a limited number of tissues, most importantly the kidney, parathyroid gland and choroid plexus. Klotho is also known to be a co-receptor for Fibroblast Growth Factor -23. Recent data has now demonstrated that Klotho is more widely expressed in a variety of tissues. Klotho has been shown in various studies to have wide biological effects and be implicated in a variety of pathological diseases. However, its role in these conditions have yet to be elucidated, including neurodegenerative diseases such as multiple sclerosis (MS), Alzheimer's, cardiovascular diseases, diabetes, cancer and obesity. In the present review, we evaluate the recent literature and provide evidence on tissue source of soluble Klotho, and how changes in the levels of Klotho may be associated in a variety of diseases.
Article
Full-text available
Psoriasis affects 3% of the population worldwide, and there is no known cure. Psoriasis is associated with an increased risk of psoriatic arthritis, lymphomas, cardiovascular disease, and Crohn’s disease. Psoriasis treatments today include steroid and vitamin D3 cream, ultraviolet light, and immune systemsuppressing medications such as methotrexate. The T cells responsible for psoriasis are Th1 and Th l7 cells. IL-22, produced by Th17 cells, is crucial for the proliferation of keratinocytes. IL-22 with the help of IL-17 can induce the critical events of psoriasis. To maintain Th17 cells, IL-23 is required, and it is released from tumor necrosis factor-alpha (TNF-alpha) induced pathways. The pathophysiology of psoriasis involves RORC (retinoic acid receptor-related orphan nuclear receptor gamma) as a critical transcription factor for the development of Th17 cells. FDA has approved an antibody Secukinumab® targeting TNF-α for the treatment of psoriasis. Other FDA approved drugs are Tremfya® targeting IL23 for treatment of moderate to severe plaque psoriasis and Taltz® that blocks IL17 for treatment of plaque psoriasis. Metadichol® a nanoformulation of long-chain lipid alcohols derived from food is a TNF-alpha inhibitor and also binds to Vitamin D receptor (VDR) that could have beneficial effects on Psoriasis. VDR modulates Th1-mediated inflammatory disease like psoriasis. We now present evidence that Metadichol is an inverse agonist of RORγt and AHR (Aryl Hydrocarbon Receptor) thus controlling Th17, IL17 and IL22. Being a TNF-alpha inhibitor, it can control IL23 thus blocking the significant pathways that exacerbate psoriasis. We present case studies of 7 patients afflicted with psoriasis and skin related conditions and how treatment with Metadichol resolved the underlying disease. Metadichol® has properties that allow its use as a safe nontoxic solution to combating the growing number of psoriasis cases
Article
Full-text available
Metadichol® a nano formulation and mixture of long chain alcohols that is present in many foods like rice and sugar cane. It is derived from the waste of the sugar cane industry and therefore, it is a renewable resource. Most of the clinical data in the literature are from non-nano formulations either in a tablet or a capsule form which has not shown any efficacy. Given its safety profile, we carried out a small open label pilot study on 14 diabetic patients with hypertension. These patients had co-morbidities such as dyslipidemia, obesity and hypertension, but were not on any hypertensive medication. In this open label study, we treated the patients with 20mg of Metadichol per day for 60 weeks. The results showed that it is possible to bring about improvements in Systolic and Diastolic blood pressure in addition to CRP, VLDL, HDL, Triglycerides, waist circumference reduction, and reduction in insulin resistance. Interestingly, the average Vitamin C level for this study group also doubled. This study showed a vast improvement over existing therapies and with no reported side effects (minor or major).
Article
Full-text available
Vitamin C, also known as ascorbic acid, is a water-soluble antioxidant. Today we meet our requirements of vitamin C through consumption of fruits and vegetables or by supplementation. Homo sapiens cannot produce vitamin C like many other species that can convert glucose to vitamin C. The gene for enzyme production is dormant in humans. The gene, GULO, that we all carry converts glucose to Vitamin C. in other species but not in humans and primates. The open-label study showed Metadichol ® raised levels of vitamin C by 3 fold, endogenously without supplementation of Vitamin C. Possible mechanisms for the increased Vitamin C levels through antioxidant pathways are presented. Metadichol ® [1] is a nano-formulation of long chain alcohols derived from sugar cane. In addition to increased Vitamin C levels reduction in Potassium and uric acid, and decreased blood pressure and improvement in quality of life issues were also observed.
Article
Full-text available
Metadichol® is a Nano emulsion of long-chain alcohols called as Policosanol and is present in foods such as rice, sugar cane, wheat, and peanuts. Metadichol® acts on Nuclear Vitamin D receptors (VDR) that are present in cells throughout the body to stimulate the immune system and inhibit a variety of disease processes, resulting from inflammation to infection [1]. We present a case study of a patient with Rheumatoid arthritis with the high levels of RF antibodies, CRP and ESR levels, and low bone mineral density leading to osteoporosis. The case report shows how Metadichol® by its actions on the VDR has affected key biomarkers and mitigated the disease conditions without any side effects. Also, his bone density improved dramatically. Metadichol® is safe because it consists of natural components of conventional foods and has no known adverse side effects. Its constituents are present in many foods that we consume every day. Metadichol® has the potential to serve as a novel, safe solution to help patients with RA and other autoimmune diseases that confront the world today.
Article
Full-text available
The evolution, molecular behavior, and physiological function of nuclear receptors are of particular interest given their diverse roles in regulating essential biological processes. The vitamin D receptor (VDR) is well known for its canonical roles in calcium homeostasis and skeletal maintenance. Additionally, VDR has received an increased amount of attention due to the discovery of numerous non-calcemic functions, including the detoxification of lithocholic acid. Lithocholic acid is a toxic metabolite of chenodeoxycholic acid, a primary bile acid. The partnership between the VDR and lithocholic acid has been hypothesized to be a recent adaptation that evolved to mediate the detoxification and elimination of lithocholic acid from the gut. This partnership is speculated to be limited to higher vertebrates (birds and mammals), as lower vertebrates do not synthesize the parent compound of lithocholic acid. However, the molecular functions associated with the observed insensitivity of basal VDRs to lithocholic acid have not been explored. Here we characterize canonical nuclear receptor functions of VDRs from select species representing key nodes in vertebrate evolution and span a range of bile salt phenotypes. Competitive ligand binding assays revealed that the receptor’s affinity for lithocholic acid is highly conserved across species, suggesting that lithocholic acid affinity is an ancient and non-adaptive trait. However, transient transactivation assays revealed that lithocholic acid-mediated VDR activation might have evolved more recently, as the non-mammalian receptors did not respond to lithocholic acid unless exogenous coactivator proteins were co-expressed. Subsequent functional assays indicated that differential lithocholic acid-mediated receptor activation is potentially driven by differential protein-protein interactions between VDR and nuclear receptor coregulator proteins. We hypothesize that the vitamin D receptor-lithocholic acid partnership evolved as a by-product of natural selection on the ligand-receptor partnership between the vitamin D receptor and the native VDR ligand: 1α,25-dihydroxyvitamin D3, the biologically active metabolite of vitamin D3.
Article
Full-text available
Background Dendritic cells (DCs) are the most potent professional antigen-presenting cells for naive T cells to link innate and acquired immunity. Klotho, an anti-aging protein, participates in the regulation of Ca²⁺ dependent migration in DCs. Vitamin E (VitE) is an essential antioxidant to protect cells from damage and elicits its inhibitory effects on NF-κB-mediated inflammatory response. However, the roles of VitE on mouse DC functions and the contribution of klotho to those effects both are unknown. The present study explored the effects of VitE on klotho expression, maturation, ROS production and migration in DCs. Methods The mouse bone marrow cells were isolated and cultured with GM-CSF to attain bone marrow-derived DCs (BMDCs). Cells were stimulated with LPS (100 ng/ml) in the presence or absence of VitE (500 µM). RT-PCR and immunoprecipitation methods were employed to determine klotho expression, ELISA to determine cytokine release, flow cytometry to analyze number of CD86⁺CD11c⁺ cells, the intracellular expression of cytokines and reactive oxygen species (ROS) production and a transwell migration assay to trace migration. Results Klotho transcript level and this hormone secretion in DC supernatant were enhanced by VitE treatment and further increased in the presence of NF-κB inhibitor Bay 11-7082 (10 µM). Moreover, VitE treatment inhibited IL-12p70 protein expression of, ROS accumulation in and CCL21-dependent migration of LPS-triggered mature DCs, these effects were reversed following klotho silencing. Conclusion The up-regulation of klotho by VitE could contribute to the inhibitory effects of VitE on NF-κB-mediated DC functional maturation. The events might contribute to immunotherapeutic effect of VitE on the pathophysiology of klotho-related disease.
Chapter
Full-text available
1,25-Dihydroxyvitamin D3 (1,25D) is the renal metabolite of vitamin D that signals through binding to the nuclear vitamin D receptor (VDR). The ligand-receptor complex transcriptionally regulates genes encoding factors stimulating calcium and phosphate absorption plus bone remodeling, maintaining a skeleton with reduced risk of age-related osteoporotic fractures. 1,25D/VDR signaling exerts feedback control of Ca/PO4 via regulation of FGF23, klotho, and CYP24A1 to prevent age-related, ectopic calcification, fibrosis, and associated pathologies. Vitamin D also elicits xenobiotic detoxification, oxidative stress reduction, neuroprotective functions, antimicrobial defense, immunoregulation, anti-inflammatory/anticancer actions, and cardiovascular benefits. Many of the healthspan advantages conferred by 1,25D are promulgated by its induction of klotho, a renal hormone that is an anti-aging enzyme/coreceptor that protects against skin atrophy, osteopenia, hyperphosphatemia, endothelial dysfunction, cognitive defects, neurodegenerative disorders, and impaired hearing. In addition to the high-affinity 1,25D hormone, low-affinity nutritional VDR ligands including curcumin, polyunsaturated fatty acids, and anthocyanidins initiate VDR signaling, whereas the longevity principles resveratrol and SIRT1 potentiate VDR signaling. 1,25D exerts actions against neural excitotoxicity and induces serotonin mood elevation to support cognitive function and prosocial behavior. Together, 1,25D and klotho maintain the molecular signaling systems that promote growth (p21), development (Wnt), antioxidation (Nrf2/FOXO), and homeostasis (FGF23) in tissues crucial for normal physiology, while simultaneously guarding against malignancy and degeneration. Therefore, liganded-VDR modulates the expression of a "fountain of youth" array of genes, with the klotho target emerging as a major player in the facilitation of health span by delaying the chronic diseases of aging.
Article
Klotho, an anti-aging gene, has recently been shown to contribute to human hepatic tumorigenesis. In addition, it is known that Wnt signaling is antagonized by the protein klotho. Because augmented Wnt signaling has an important role in tumorigenesis of human hepatocellular carcinoma (HCC), we studied the relationship of klotho expression and activity to the Wnt pathway in this malignancy. Immunohistochemical analysis performed on tissue arrays revealed that klotho expression levels were significantly lower in HCC than in adjacent noncancerous tissues, while klotho staining was inversely correlated with clinical stage and histologic grade. Patients with klotho-expressing tumors had longer survival periods than did those with klotho-negative tumors. Overexpression of klotho as well as treatment with soluble klotho protein reduced hepatoma cell growth in vitro and in vivo, whereas klotho silencing enhanced cellular proliferation. Moreover, forced expression of klotho inhibited Wnt/β-catenin signaling, as confirmed by reduced expression of β-catenin, inhibition of translocation of β-catenin from the cytoplasm to the nucleus, and reduced expression of c-myc and cyclin D1, two known target genes of the Wnt/β-catenin pathway. In contrast, activation of the Wnt/β-catenin pathway was enhanced when klotho was silenced by inhibitory RNAs. Furthermore, serum levels of soluble klotho in patients with malignant tumors were studied, and results suggested a significant increase in these levels in HCC patients. These data suggest that klotho acts as a tumor suppressor and an inhibitor of the Wnt/β-catenin pathway in HCC, and moreover, that soluble klotho is a potential serum biomarker for HCC.Laboratory Investigation advance online publication, 3 August 2015; doi:10.1038/labinvest.2015.86.
Article
Klotho is a transmembrane protein containing two internal repeats, KL1 and KL2, both display significant homology to members of the beta-glycosidase family. Klotho is expressed in the kidney, brain and various endocrine tissues, but can also be cleaved and act as a circulating hormone. Klotho is an essential cofactor for binding of fibroblast growth factor 23 (FGF23) to the FGF receptor and can also inhibit the insulin-like growth factor-1 (IGF-1) pathway. Data from a wide array of malignancies indicate klotho as a tumor suppressor; however, the structure-function relationships governing its tumor suppressor activities have not been deciphered. Here the tumor suppressor activities of the KL1 and KL2 domains were examined. Overexpression of either klotho or KL1, but not of KL2, inhibited colony formation by MCF-7 and MDA-MB-231 cells. Moreover, in vivo administration of KL1 was not only well tolerated but significantly slowed tumor formation in nude mice. Further studies indicated that KL1, but not KL2, interacted with the IGF-1R and inhibited the IGF-1 pathway. Based on computerized structural modeling, klotho constructs were generated in which critical amino acids have been mutated. Interestingly, the mutated proteins retained their tumor suppressor activity but showed reduced ability to modulate FGF23 signaling. These data indicate differential activity of the klotho domains, KL1 and KL2, in breast cancer, and reveal that the tumor suppressor activities of klotho can be dissected from its physiologic activities. These findings pave the way for a rational design of safe klotho-based molecules for the treatment of breast cancer. Copyright © 2015, American Association for Cancer Research.