Content uploaded by Esraah Alharris
Author content
All content in this area was uploaded by Esraah Alharris on Dec 23, 2019
Content may be subject to copyright.
Available via license: CC BY 3.0
Content may be subject to copyright.
Oncotarget45
www.oncotarget.com
Role of miRNA in the regulation of cannabidiol-mediated
apoptosis in neuroblastoma cells
Esraah Alharris1, Narendra P. Singh1, Prakash S. Nagarkatti1 and Mitzi Nagarkatti1
1Department of Pathology, Microbiology and Immunology, University of South Carolina School of Medicine, Columbia, SC
29209, USA
Correspondence to: Mitzi Nagarkatti, email: mitzi.nagarkatti@uscmed.sc.edu
Keywords: miRNA; cannabidiol; neuroblastoma; hsa-let-7a; hsa-miR-1972
Received: September 29, 2018 Accepted: December 13, 2018 Published: January 01, 2019
Copyright: Alharris et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License
3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and
source are credited.
ABSTRACT
Neuroblastoma (NBL) is one of the most common childhood cancers that originate
from the immature nerve cells of the sympathetic system. Studies with NBL cancers have
also shown that miRNAs are dysregulated and may play a critical role in pathogenesis.
Cannabidiol (CBD) is a non-psychoactive compound found in marijuana which has been
previously shown by our laboratory and others to induce apoptosis in cancer cells.
However, there are no studies reported to test if CBD mediates these effects through
regulation of miRNA. In the current study, therefore, we investigated if CBD induces
apoptosis in human NBL cell lines, SH SY5Y and IMR-32, and if it is regulated by miRNA.
Our data demonstrated that CBD induces apoptosis in NBL cells through activation
of serotonin and vanilloid receptors. We also found that caspase-2 and -3 played an
important role in the induction of apoptosis. CBD also significantly reduced NBL cell
migration and invasion in vitro. Furthermore, CBD blocked mitochondrial respiration
and caused a shift in metabolism towards glycolysis. CBD altered the expression
of miRNA specifically, down-regulating hsa-let-7a and upregulating hsa-mir-1972.
Downregulation of let-7a increased expression of target caspase-3, and growth arrest
specific-7 (GAS-7) genes. Upregulation of hsa-mir-1972 caused decreased expression of
BCL2L1 and SIRT2 genes. Together, our studies suggest that CBD-mediated apoptosis
in NBL cells is regulated by miRNA.
www.oncotarget.com Oncotarget, 2019, Vol. 10, (No. 1), pp: 45-59
INTRODUCTION
Neuroblastoma (NBL) is a tumor characterized by
heterogeneity and variable clinical outcomes arising from
premature sympathetic neurons, and is most commonly
encountered in infants and young children [1]. According
to the American Cancer Society, the 5-year survival rate
for NBL is less than 50% after treatment with surgery
followed by chemotherapy or radiotherapy. These
outcomes are likely due to both the relapse of tumor and
the cytotoxic side effects of intensive therapy. Although
variable treatment strategies have been established and
have been effective in treating the tumor, post-intervention
rates remain constant due to side effects of treatment [2].
Cannabidiol (CBD) is a member of a group of
compounds known as cannabinoids that are found in the
plant, Cannabis sativa [3]. Cannabinoids act primarily
through activation of CB1 or CB2 receptors [4]. Both
receptors are G-protein coupled receptor but the CB1
receptors are predominantly expressed in the neurons
whereas the CB2 receptors are mainly located in the immune
cells [3]. CBD is free of psychoactive effect because it
doesn’t have a significant affinity for both receptors [5].
Our laboratory was one of the first ones to demonstrate
that cannabinoids can induce apoptosis in cancer cells and
when injected into mice, could cause syngeneic tumor
rejection [6]. Since this seminal observation, a large number
of publications have confirmed and extended these studies
to a variety of tumors that express cannabinoid receptors.
Interestingly, we and others have shown that CBD can also
induce apoptosis in many types of cancers such as breast,
glioma, glioblastoma, and leukemia [7–11]. While different
signaling pathways have been identified that trigger
apoptosis in cancer cells following treatment with CBD,
whether such events are mediated by microRNA (miRNA)
has not been previously investigated.
Research Paper
Oncotarget46
www.oncotarget.com
miRNAs are small non-coding RNAs which are
involved in RNA silencing and post-transcriptional
regulation of gene expression. MiRNAs play a key role
in cancer biology and help determine the nature of the
tumor, prognosis and response to treatment. The first
report on role of miRNA in cancer was suggested by
identifying miR-15a/16-1 cluster deletion in human
chronic lymphocytic leukemia [12]. This deletion induced
overexpression of the anti-apoptotic B-cell lymphoma
2 (BCL2), which was a target of these miRNAs [12].
Specifically, studies with NBL cancers have also shown
that miRNAs are dysregulated and may play a critical role
in the pathogenesis. For example, the miRNA-17-5p-92
cluster was over-expressed in NB cells lines exhibiting
overexpression of MYCN [13]. Interestingly, in vitro or in
vivo treatment of MYCN-amplified and therapy-resistant
neuroblastoma cells with antagomir-17-5p led to inhibition
of growth of these cancer cells through activation of
apoptosis [13]. In addition, MYCN has been shown to
be regulated by histone deacetylases (HDAC) such as
HDAC5 and SIRT2 [14, 15]. MiRNA dysregulation has
also been associated with development of resistance
to therapies. For example, during the development of
resistance, cancer cells expressed decreased levels of
miRNAs, such as miRNA-200c and miRNA-579-3p, two
potent oncosuppressors [16, 17]. Thus, restoration of their
expression led to increased efficacy of drugs that targeted
MAPK pathway.
We previously showed that CBD can induce
apoptosis in human leukemic cells in vitro and when
injected into mice, cause syngeneic tumor regression
[11]. In this model, treatment of cancer cells with CBD
increased the levels of reactive oxygen species (ROS) and
NAD (P)H oxidases Nox4 and p22(phox), while causing a
decrease in the levels of p-p38 mitogen-activated protein
kinase [11]. Other studies have also shown that CBD
induces apoptosis via inhibition of Akt/mTOR pathway
[18] and this relates to the fact that Akt is overexpressed in
many human cancers and is responsible for their resistance
to apoptosis [19]. Despite such studies, no previous studies
have explored the role of miRNA in CBD-mediated
induction of apoptosis in cancer cells. To that end, in the
current study we identified miRNA that are modulated by
CBD and studied their potential role in inducing apoptosis
in NBL cells.
RESULTS
CBD induces apoptosis in NBL cell lines, SH
SY5Y and IMR-32, through activation of
caspase-2 and caspase-3
To examine the morphological effects of CBD
on SH SY5Y and IMR-32 NBL cell line, we visualized
them by bright field microscopy at 20× magnification.
Apoptotic signs were assessed for clumping, blebbing, and
shrinking. In contrast to the vehicle group, CBD-treated
cells displayed elevated apoptotic rates (Figure 1A).
DeadEnd Colormetric TUNEL assay showed a significant
increase in the number of positively stained (brown) cells
in 10 µM CBD-treated cells when compared to the vehicle
CBD-treated groups; p < 0.001 (Figure 1B and 1C). Flow
cytometry analysis of SH SY5Y and IMR-32 showed a
significant increase in the number of the cells stained
with AnnexinV (early apoptosis) and both Annexin-V and
PI (late apoptosis) in 5 and 10 group when compared to
vehicle controls (Figure 1D). Data from multiple flow
cytometric analyses similar to that presented in Figure 1D
have been expressed as Mean ± SEM of total (early+late)
apoptotic cells in Figure 1E and 1F panels.Also, 10 µM
CBD caused significantly higher apoptosis when
compared to 5 µM CBD treated cells (Figure 1D–1F).
Flow cytometry analysis was performed to investigate
which caspases mediate CBD-induced apoptosis.
Annexin-V-PI staining showed significant reduction in
apoptosis in cells incubated with CBD and pre-treated
with caspase-2 and caspase-3 inhibitors when compared
to CBD+vehicle controls (Figure 1G, 1H) In contrast,
Caspase 8 and 9 inhibitors failed to cause significant
inhibition in apoptosis.
Identification of receptors through which CBD
induces apoptosis
To determine which receptor plays a role in
CBD-induced apoptosis, we utilized several receptor
antagonists followed by staining and flow cytometric
analysis of apoptotic cells. A representative flow
experimental data has been presented in Figure 2A with
cells stained for AnnexinV only (early apoptosis) and
for both Annexin-V and PI (late apoptosis). Also, data
from multiple experiments have been shown as Mean ±
SEM of total (early+late) apoptotic cells in Figure 2B.
Panel C shows morphology of cells exposed to various
cultures conditions. There was a significant reduction
in the percentage of total apoptotic cells induced by
CBD in samples pre-treated with GPR55 antagonist
(ML-193), TRPV1 antagonist (A784168), or 5-HT2A
receptor antagonist (MDL100907) when compared to
CBD+vehicle group (Figure 2A–2C). However, CB1
antagonist (AM251), CB2 antagonist (SR144528), GPR-
55 (ML-193), or PPAR-γ antagonist (BADGE), failed to
inhibit CBD-mediated apoptosis. These data suggested
that CBD may induce apoptosis through activation of
5-HT2A and TRPV1 receptors.
Role of miRNA in the regulation of CBD-
mediated apoptosis
We performed miRNA array in CBD-treated SH
SY5Y cells to elucidate the role of miRNA in CBD-
induced apoptosis. Volcano plots and heat map showed
Oncotarget47
www.oncotarget.com
that CBD treatment induced changes in the miRNA
profile (Figure 3A and 3B). A Venn diagram demonstrated
that SH SY5Y cells treated with 10 µM CBD induced
upregulation of 50 miRNAs and downregulation of 85
miRNAs (Figure 3C). The dysregulated miRNAs with
fold change ≥2 or ≤–2 were uploaded to Ingenuity
Pathway Analysis (IPA) from Qiagen. IPA software
showed that hsa-let-7a was highly downregulated (-12
fold) and was targeting caspase-3, GAS-7, and DIABLO
genes (Figure 3D). In contrast, CBD treatment caused
upregulation of hsa-miRNA-1972 (>2 fold) that targeted
BCL2 and BCL2L1 genes (anti-apoptotic mitochondrial
proteins). Principal Component Analysis of 3 independent
samples showed distinct clustering of miRNA profiles in
vehicle- and CBD-treated groups (Figure 3E). Because
down-regulation of the expression of miRNA leads to
induction of the target gene while its upregulation leads
to gene silencing, our data suggested that the changes
in miRNA induced by CBD may collectively promote
apoptosis.
CBD induced alterations in miRNA expression and
their effect on target genes involved in apoptosis
We performed qRT-PCR for the validation of
miRNA and genes identified by IPA software. Gene
alignment software predicted that miRNA-hsa-let-7a
targeted Caspase-3 and GAS-7 genes while miRNA-
hsa-1972 targeted BCL2 and SIRT2 genes (Figure 4A).
We found that CBD treatment of cells led to significant
downregulation of miRNA-hsa-let-7a with consequent
increase in Caspase-3 and GAS-7 (Figure 4A). On
the other hand, hsa-miRNA-1972 was significantly
upregulated in CBD-treated group when compared to
the vehicle, and the related genes, BCL2L1, SIRT2
and MYCN were significantly downregulated in CBD-
treated group versus vehicle (Figure 4A). While most
of the miRNA regulated molecules that we studied
were associated with apoptosis, we did include other
molecules such as SIRT2 because SIRT2 was shown to
be upregulated by N-Myc in neuroblastoma cells and that
SIRT2 promoted cancer cell proliferation [14]. Also, GAS-
Figure 1: Treatment with CBD induces apoptosis in neuroblastoma cell lines. SH SY5Y and IMR-32 neuroblastoma cell
lines were treated with vehicle or CBD in serum-free medium for 24 hours. (A) Bright field image showing that CBD induces significant
morphological damage in neuroblastoma cells in a dose-dependent manner. (B) Tunnel assay for SH SY5Y after treatment with either
vehicle or CBD (1 or 10 µM). The arrows are pointing to the nuclei of the dead cells which are stained dark brown with HRP-labeled
streptavidin. (C) Bar diagram shows the number of apoptotic cells per field in B. (D) Flow cytometry analysis of SH SY5Y and IMR-32
cell lines after 24 hours treatment with either vehicle or CBD (5 or 10 µM). Cells in early apoptosis stain with Annexin-V only while
those in late apoptosis are double-stained with Annexin-V and PI. Panels (E) and (F) show the statistical analysis of data from multiple
experiments for SH SY5Y and IMR-32 cell lines, respectively as detailed in panel D. (G) Representative experiment in which SH SY5Y
cells were treated with vehicle or 10 µM CBD+vehicle or CBD+caspase inhibitors and cells analyzed for apoptosis using Annexin V
staining. (H) Data from panel G in multiple experiments plotted as Mean ± SEM. All experiments were repeated three times. Significance
(p < 0.05) for all experiments was calculated using one-way ANOVA and post-hoc Tukey’s test.
Oncotarget48
www.oncotarget.com
7 is involved in controlling growth arrest and apoptosis of
neuroblastoma cells in response to various stimuli [20].
To further validate the role of miRNA in the
regulation of aforesaid target genes, we performed
transfections of hsa-let-7a mimic or inhibitor in NBL
cell line. In this experiment, we found that transfection
of hsa-let-7a inhibitor significantly induced caspase-3
and GAS-7 expression when compared to mock control
(Figure 4B). Transfection of a hsa-miRNA-1972 mimic
caused significant downregulation of BCL2L1, MYCN
and SIRT2 when compared to mock control (Figure 4C).
Protein levels of caspase-3 using western blotting shows
that the expression of caspase-3 in the cells transfected
with hsa-let-7a inhibitor was 4.7 folds higher than the cells
transfected with the mock control (Figure 4D).
CBD targets genes involved in cell migration,
invasion, metabolism and apoptosis
We examined other potential genes that are regulated
by altered expression of miRNA and found that P53 and
AKT1 expression was significantly downregulated while
the expression of MDM2 and PTEN was significantly
higher in the CBD treated group when compared to
vehicle (Figure 5A). SDS-PAGE and subsequent western
blot were performed to validate gene expression data.
Our analysis on whole cell lysate demonstrated the
CBD-treated NBL cell line showed decreased AKT and
increased PTEN proteins when compared to the vehicle
control (Figure 5B).
CBD inhibits cell migration, invasion and
mitochondrial respiration of NBL cells
One important feature of recurrent malignant
diseases is their ability to migrate, invade, and shift their
metabolism. For this reason, we measured the ability of
CBD to inhibit cancer migration, invasion and metabolism.
We found that CBD was able to significantly inhibit
SH SY5Y (Figure 6A and 6B), IMR-32 cell migration
(Figure 6C and 6D) and invasion through matrigel (Figure
6E and 6F). Additionally, CBD altered mitochondrial
respiration, particularly maximal respiration, measured
via oxygen consumption rate (OCR), which was
significantly reduced after CBD treatment (Figure 7B).
On the other hand, extracellular acidification rate (ECAR)
that measures the rate of glycolysis, did not change
(Figure 7A). As a result, we believe that CBD treatment
inhibited the mitochondrial respiration and shifted the cell
metabolism towards the glycolysis pathway.
Figure 2: Identifying the receptors through which CBD induces apoptosis in SH SY5Y neuroblastoma cells. SH SY5Y
cells were plated overnight and then treated either with vehicle or receptor antagonist for 1 hour followed by 10 µM CBD. Next, the cells
were harvested and stained with Annexin-V- PI followed by ow cytometric analysis. The data from a representative experiment has been
shown (A) and data from multiple experiments have been plotted in the bar diagram (B). (C) shows morphology of cells exposed to cultures
as described in Panel A. Signicance (p < 0.05) for all experiments was determined using one-way ANOVA and post-hoc Tukey’s test.
Oncotarget49
www.oncotarget.com
DISCUSSION
Our laboratory was one of the first one to discover
that cannabnoids can induce apoptosis in cancer cells
through activation of cannabinoid receptors [6]. This has
led to additional studies on the effect of cannabinoids
in the treatment of cancer [21–28]. CBD is a non-
psychoactive cannabinoid that has been reported to have
the potential efficacy to treat breast, prostate, glioma,
lung and cervical cancers [8, 9, 27, 29]. Neuroblastoma
(NBL) constitutes one of the most common solid cancers
in children. While chemo, radiation, and immunotherapy
are used to treat NBL, children with this cancer have poor
outcomes. Also, while CBD has been shown to kill NBL
cells [21], the precise molecular pathways remain further
elucidation. Importantly, there are no previous studies
delineating the role of miRNA in the anti-cancer properties
of CBD. Such studies are important because they will also
help identify additional miRNA targets that can be used
to treat NBL.
In the current study, we used serum-free medium
to investigate the effect of CBD on SH SY5Y and IMR-
32 NBL cell lines. This was because fetal bovine serum
contains endocannabinoids which can interfere with the
action of CBD on various receptors [30, 31]. It was for
this reason that in our previous studies as well, we used
serum-free medium to test the ability of CBD to induce
apoptosis in Jurkat human leukemic cells [11]. In the
current study, we used caspase inhibitors (caspase-2,
-3, -8, and -9) to explore the role of caspases and found
that apoptosis in NBL cells was dependent on caspase-2
and 3 but not 8 and 9. Caspase 8 is known to regulate
death cell receptor (extrinsic) pathway, while Caspase-9
controls the mitochondrial pathway [32]. Interestingly,
when we looked at the role of Caspase-2, which is
similar to caspase-9 in structure, we found that inhibition
of Caspase-2 attenuated CBD-induced apoptosis. This
finding is consistent with previous studies in which it was
shown that Caspase-2 may play a key role in apoptosis
induced by metabolic imbalance, DNA damage, and
endoplasmic reticulum (ER) stress [33]. Previous studies
have shown that apoptosis induced by indoles is also
mediated by Caspase-2 but independent of Caspase-8
and -9 [34]. Caspase-2 is one of the most evolutionarily
conserved caspases, and whether or not Caspase-2 fits the
role of a traditional initiator or effector caspase, or both,
remains to be established. However, Caspase-2 can engage
the mitochondrial pathway to trigger apoptosis involving
Figure 3: miRNA profile in SH SY5Y neuroblastoma cells following CBD treatment. Microarray analysis was done by using
an Affymetrix array to identify miRNA in CBD-treated cells compared to vehicle controls. (A) Volcano plot for up- and down-regulated
miRNAs following treatment either with DMSO (vehicle) or 10 µM CBD (CBD). The upregulated miRNAs appear in red color while the
down-regulated are shown in green dots using TAC software from Affymetrix. (B) Heat map for dysregulated miRNA following treatment
with CBD (TAC software). The red color represents the upregulated miRNAs while the blue color represents the downregulated ones.
(C) Venn diagram shows differentially regulated miRNA in the two groups. (D) Ingenuity Pathway Analysis displaying the relationship
between the dysregulated miRNA and different target genes related to apoptosis. The panel shows how miRNA hsa-let-7a (green) and
hsa-miRNA-1972 (red) may target apoptotic pathways. (E) Principal Component Analysis of 3 independent samples showing distinct
clustering of miRNA profiles in vehicle- and CBD-treated groups.
Oncotarget50
www.oncotarget.com
caspase-independent death effectors apoptosis-inducing
factor (AIF) and endonuclease G [35] Such a mechanism
can explain how CBD can engage Caspase-2 in the
induction of the mitochondrial pathway, independent
of caspase-9. Caspase-2 is also the sole caspase known
to translocate from the cytosol to the nucleus, thereby
suggesting that it is involved in cellular processes other
than apoptosis [36].
CBD does not have much affinity towards CB1 and
CB2 receptors because of which it is not psychoactive.
In the current study, we also noted that CBD-mediated
apoptosis was not blocked by CB1 and CB2 antagonists.
However, we noted that CBD may induce apoptosis
through activation of 5-HT2A and TRPV1 receptors,
based on blocking studies. CBD is well established
to bind and function primarily through activation of
TRPV1 or vanilloid receptors [37]. Researchers have
also documented that CBD uses vanilloid and 5-hydroxy
tryptamine receptors to induce autophagy or prevent
cancer growth [23–25]. Activation of the TRPV1 receptor
has been shown to increase Ca
++
in the cytoplasm followed
by ER stress and apoptosis in gliomas [38] and in prostate
cancer [39]. GPR-55 is an orphan G-protein coupled
receptor expressed in the brain and in cell cultures, and
is known to bind to certain cannabinoid ligands [40].
However, the role of GPR-55 in CBD functions remains
unclear. In an earlier study, we found that CBD could
induce apoptosis in human leukemic cells. CBD increased
reactive oxygen species (ROS) production as well as
NAD(P)H oxidases Nox4 and p22(phox) [11]. CBD also
caused a decrease in the levels of p-p38 mitogen-activated
protein kinase, which could be blocked by treatment with
a CB2-selective antagonist or ROS scavenger [11]. These
data and the current study suggested that CBD-mediated
apoptosis in cancer cells may involve different pathways
and receptors.
Gene expression is regulated by different
mechanisms including miRNA regulation, which
constitute small protein non-coding, 20–25 nucleotides
long [41]. Comparisons of miRNA expression in
malignant and normal cells highlight the importance of
cancer-related miRNAs. Additionally, miRNAs may
function as oncogenes or tumor-suppressor genes [42].
Previous studies have shown that miRNAs have a critical
role in cell growth, differentiation, and apoptosis [43].
We found that let-7a was significantly down-regulated
Figure 4: Validation of miRNA and their potential targets. (A) SHSY 5Y cells were cultured with either DMSO or 10 µM CBD
as described in Figure 1 legend. Next, qPCR was performed for the genes of interest according to Ingenuity Pathway Analysis map. (B) SH
SY5Y cells were treated with either mock, hsa-let-7a-mimic or hsa-let-7a inhibitor for 24 hours. Next, qPCR was performed. We validated
that hsa-let-7a transfection was successful as shown in the first panel. The next two panels show the levels of expression of caspase-3 and
GAS7. (C) SH SY5Y cells were treated with mock, hsa-miRNA-1972 mimic or hsa-miRNA-1972 inhibitor. Next, qPCR was performed.
First panel shows validation that hsa-miRNA-1972 transfection was successful. The next three panels show the levels of expression of
BCL2L1, Sirt-2, and MYCN. (D) After transfecting SH SY5Y with hsa-let-7a mimic and inhibitor, protein was obtained and western blot
was done to detect the level of caspase-3. The level of caspase-3 protein was 4.7 folds higher than the mock control. Significance (p < 0.05)
for Panel A was performed by using Student’s t-test and for Panel B and C was determined using one-way ANOVA and post-hoc Tukey’s test.
Oncotarget51
www.oncotarget.com
Figure 5: Effect of CBD on target genes involved in cell migration, invasion, metabolism and apoptosis. SH SY5Y cells
treated with vehicle or 10 µM CBD were used to perform (A) qPCR or (B) Western Blots for the genes of interest according to Ingenuity
Pathway Analysis map. In Panel A, signicance (p < 0.05) was determined using Student’s t–test.
Figure 6: CBD inhibits cell migration, invasion and mitochondrial respiration of neuroblastoma cells. (A) SH SY5Y
cells (C) IMR-32 cells were cultured with vehicle, 5 µM, or 10 µM CBD and stained with Vybrant CFDA. Live cells were seeded per
oroblock inserts of a 24-well plate. Cells were allowed to migrate for 24-hour. Next, cells were visualized using Cytation 5 microscope.
Panel A and C show data from a representative experiment while (Panel B and D) show data from multiple experiments, respectively. (E)
SH SY5Y cells were cultured as in Panel A with vehicle, 5 µM, or 10 µM CBD and live cells were seeded in matrigel-coated inserts for
24-well plate. Cells were allowed to migrate for 24-hour. Then cells were visualized using Cytation 5 microscope. Panel E shows data
from a representative experiment while (Panel F) shows data from multiple experiments. Signicance (p < 0.05) for all experiments was
determined using one-way ANOVA and post-hoc Tukey’s test. Each experiment was repeated three times.
Oncotarget52
www.oncotarget.com
in CBD treated cells versus vehicle. It has been shown
that let-7a is a tumor suppressor in colon [44] and prostate
cancer [45]. Other studies reported that let-7a targets
caspase-3 and thus, down-regulation of let-7a increases
drug-induced apoptosis [46]. In the current study, we
found that downregulation of hsa-let-7a could upregulate
caspase-3 gene expression in CBD-treated SH SY5Y cells.
Furthermore, hsa-let-7a inhibition led to induction of GAS-
7, a member of protein family known as PCH (Pombe Cdc
15 homology) which is mainly localized in neurons and is
responsible for differentiation and survival [47, 48]. The
potential role of GAS-7 in cancer or apoptosis remains to
be determined. In addition to let-7a downregulation, we
found that CBD caused upregulation of hsa-miRNA-1972,
which based on gene alignment scores, was predicted to
bind Sirt-2 and BCL2L1 genes. Downregulation of Sirt-2
reduces MYCN gene expression and results in apoptosis
in a neuroblastoma cell line [14, 15]. Therefore, we
propose that upregulation of hsa-miRNA-1972 resulted
in the downregulation of both genes and induced death
in NBL cells. Both genes have been extensively studied
in cancer and have shown to be regulated by several
miRNA [49–52]. To confirm our finding that CBD caused
a shift in miRNA expression, we transfected let-7a mimic
and inhibitor into NBL cell lines. Our data showed that
gene expression of CASP3 and GAS-7 was significantly
higher in the cells transfected with hsa-let-7a-inhibitor
when compared to those transfected with let-7a mimic.
In addition, caspase-3 protein expression was higher in
SH SY5Y cells transfected with hsa-let-7a inhibitor as
compared to those transfected with mock control.
The reduced expression of MYCN and P53 genes
(the latter could be as a result of MDM2 gene upregulation
since it is the negative regulator of p53 could play an
important role in reducing NBL cells survival [53, 54].
Also, PTEN tumor suppressor protein inhibits activation
of Akt [55], which restricts MDM2 to the cytoplasm.
Associations between MYCN and p53 were recently
confirmed [56]. Our western blot analysis showed
that the protein expression of PTEN was significantly
upregulated in the CBD-treated group while that of Akt
was significantly downregulated when compared to the
vehicle. We also found that following CBD treatment,
there was significant inhibition of SH SY5Y cell migration
and invasion, and this may be mediated through AKT-
signaling. PTEN activity has been shown to inhibit cell
migration and invasion [57–59]. Additionally, PTEN may
play a major role in apoptosis as well by inhibiting AKT
signaling [60–62]. Our findings suggest that CBD induces
apoptosis in NBL cell line by inhibition of Akt protein
mediated by PTEN upregulation.
In the current study, we also found that CBD
inhibited cell migration, invasion and caused alterations
in metabolism. This is consistent with previous studies
demonstrating that cannabinoids were able to inhibit
cancer migration, invasion and metabolism in various
cancers [28, 63, 64]. Seahorse XFp analysis for SH
SY5Y cells detected a shift towards glycolysis to skip the
effects of CBD on their metabolism, an effect known as
Warburg effect [65]. The Warburg effect is the ability of
cancer cells to shift the generation of ATP from oxidative
phosphorylation to glycolysis and can be regulated by the
AKT/mTOR pathway [66, 67]. Our data suggested the
metabolic dysfunction in CBD-treated cells is through the
AKT-dependent mechanism. In addition, downregulation
of MYCN expression has been shown to be responsible for
shutting down glycolysis [68]. Early response of SH SY5Y
by significant reduction of mitochondrial respiration has
been noted before with other neurotoxins [69].
There is growing evidence that miRNAs can
regulate glycolysis directly by regulating the expression
of genes encoding for glycolysis pathway or indirectly
by controlling the expression of oncogenes and tumor
suppressor genes involved in glycolysis. Hsa-let-7a has
Figure 7: CBD alters mitochondrial respiration in neuroblastoma cells. SH SY5Y cells were cultured overnight in a Sea-horse
Analyzer plate. The following day, the cells were treated with either vehicle or 10 µM CBD, washed with Seahorse-specic medium, and
placed in a Seahorse analyzer. (A) Analysis of glycolysis by ECAR determination. (B) Analysis of mitochondrial respiration by OCR
analysis. Signicance (p < 0.05) for all experiments was done using Student’s t-test. Each experiment was repeated three times.
Oncotarget53
www.oncotarget.com
been shown to regulate glycolysis in various cancers
[70–72]. In addition, SIRT2, which was downregulated by
hsa-miRNA-1972 has been shown to be a potent regulator
of glycolysis [73]. Thus, the alterations caused by CBD
in miRNA may also be responsible for changes in cell
metabolism. Together, the current study suggests that CBD
alters the expression of several miRNA that target critical
signaling pathways implicated in apoptosis, migration and
invasion, and metabolic functions in NBL cells.
MATERIALS AND METHODS
Cell lines and reagents
Human NBL cell lines SH SY5Y and IMR-32
were purchased from ATCC (American Type Culture
Collection, Manassas VA) and were grown in DMEM;
Dulbecco’s Modified Eagle’s Medium (ThermoFisher
Life Technologies, Grand Island, NY, USA) supplemented
with 10% heat-inactivated fetal bovine serum (Atlanta
Biologicals, Lawrenceville, GA), 100 units/ml
penicillin, 100 μg/ml streptomycin, in 5 mM Glutamine
(ThermoFisher Life Technologies, Grand Island, NY,
USA). Cell cultures were maintained in a humidified
incubator set to 37° C and 5% CO
2
. CBD was purchased
from Cayman Chemicals, reconstituted in DMSO at a
concentration of 20 mg/ml, aliquoted and stored in –20° C.
Immediately before adding CBD to cells, it was
diluted in serum-free DMEM at a concentration of 5 and
10 µM. The vehicle group received DMSO at the same
dilution. Caspase inhibitors: caspase-2 (Z-VDVAD-FMK-
cat.no.FMK003), caspase-3 (Z-DEVD-FMK-cat.no.
FMK004), caspase-8 (Z-IETD-FMK-cat.no.FMK007),
and caspase-9(Z-LEHD-FMK-cat.no.FMK008) were
purchased from R&D system (Minneapolis, MN, USA).
They were reconstituted in DMSO, aliquoted and stored at
−20° C at a concentration of 100 µM. Just before treatment
of the cells, each one of caspase inhibitors was diluted in
complete DMEM at a concentration of 50 µM. Receptor
antagonists SR144528 (CB2), AM251 (CB1), ML-193
(GPR-55), A784168 (TRPV1), BADGE (PPAR-γ), and
MDL100907 (5-HT2A) were purchased from TOCRIS
(Minneapolis, MN, USA) and were reconstituted in DMSO
and stored according to manufacturers’ recommendations.
DeadEnd Colorimetric TUNEL kit (Cat. no. G7360)
was purchased from Promega (Madison, WI, USA).
Floroblock inserts (Cat.no. 351158) were purchased from
Corning (Tewksbury, MA, USA). Matrigel coated invasion
chambers were purchased from VWR (Randor, PA, USA).
Seahorse plates and media were purchased from Agilent
Technologies (Santa Clara, CA, USA).
Light microscopy analysis
NBL cells were seeded in a 6-well plate (Corning,
Tewksbury, MA, USA) overnight to allow them to
adhere to the bottom of the plate. Next day, the medium
was replaced by a serum-free medium containing either
DMSO (vehicle), 5 or 10 µM CBD. After 24 h, the cells
were visualized for cell morphology and viability under
the light microscope Olympus SZX2 stereo microscope
(Center Valley, PA).
DeadEnd™ colorimetric TUNEL system
NBL cells were plated in a 6-well plate, treated
with either DMSO (vehicle) or 1 µM or 10 µM CBD in
a serum-free medium for 24 h. Following manufacturer
protocol, cells were washed with PBS, fixed with 4%
paraformaldehyde, and permeablized with 0.2% Triton
X100. Cells were then equilibrated and labelled with
Terminal deoxyneocleotidyl Transferase (TdT), and the
reaction stopped by blocking buffer (supplied with the
kit). Cells were stained with HRP-labelled streptavidin to
be visualized under bright field conditions using Cytation
5 (Bio-Tek). Dead cells that stained brown were counted
by Cytation 5 software and expressed as apoptotic cell
number/field.
Annexin-PI and flow cytometry
We assessed the level of apoptosis by using the
FITC Annexin-V Apoptosis Detection Kit with PI from
Biolegend (San Diego, CA). Cells were plated in a 12-well
plate at a density of 2.5 × 106 cells/well. The following day,
cells were treated for 24 h either with DMSO, 5 or 10 µM
CBD in serum-free medium. Cells then were stained with
Annexin-V and PI and analyzed using a FC500 Beckman
Coulter flow cytometer (Indianapolis, IN, USA). For
caspase inhibition, cells were treated with either DMSO
(vehicle), 5 or 10 µM CBD in a serum-free medium. Cells
were treated by 50 µM of caspase-2, caspase-3, caspase-8
or caspase-9 inhibitors in complete medium for one hour
prior to treatment with CBD in serum-free medium. Cells
then were harvested, washed, and stained for Annexin-V-
PI for flow cytometry analysis.
In order to detect receptors through which CBD acts,
we plated SH SY5Y cells (1 × 10
5
cell/well) in a 24-well
plate overnight. Next, cells were treated for one hour with
10 µM of AM251 (CB1 receptor antagonist), SR144528
(CB2 receptor antagonist), BADGE (PPAR-γ receptor
antagonist), ML-193 (GPR-55 receptor antagonist),
A784168 (TRPV1 receptor antagonist), or MDL 100907
(5-HT2A receptor antagonist) followed by 10 µM CBD
in serum-free medium for 24 h. Cells then were collected,
washed, and stained with AnnexinV-PI for flow cytometry
analysis.
Microarray and miRNA pathway analysis
Microarray analysis was done by using an
Affymetrix array version 4.0, in order to show the
integrated mature miRNA in CBD-treated cells compared
to the vehicle ones, as detailed in our previous report [74].
Oncotarget54
www.oncotarget.com
According to manufacturer’s recommendation, 60 ng/µl
of mature miRNA was purified and HSR hybridized with
biotinylated Flash Tag (Affymetrix, Santa Clara, CA).
The log intensity values were measured by Affymetrix
system and files were analyzed using genome expression
console. The files were uploaded to Transcriptome
Analysis Console (TAC) from Affymetrix in order to
determine miRNA fold changes and p values. Fold
change threshold for up- or downregulated miRNA was
set to ≥2 or −2 and selected for further analysis using
Ingenuity Pathway Analysis (IPA) from Qiagen. The
Venn diagram for the assigned miRNAs was done using
the Venn diagram maker (http://bioinfogp.cnb.csic.es/
tools/venny/).
Quantitative real-time PCR (qRT-PCR)
qRT-PCR analysis was performed as detailed
previously [75]. Total RNA was collected from SH
SY5Y cells using the miRNeasy kit (Qiagen) per the
manufacturer’s guidelines. Complementary DNA (cDNA)
was reverse transcribed by using the miScript cDNA
synthesis kit (Bio Rad) following the manufacturer’s
recommended protocol. SSO SYBR Green (BioRad) was
used on CFX context (BioRad) to perform qPCR. Human
GAPDH was used as a control gene. Primers were designed
in IDT DNA technologies according to the sequences found
in Primers Bank (Harvard Medical School). We performed
the PCR on the following protocol: 39 cycles for PCR as
follows: 30 sec 98° C (denaturation step), 60 sec at 60° C
(annealing step) and 60 sec at 72° C (extension step,
followed by incubation for 10 minutes at 72° C.
We assessed the expression of target miRNAs and
the results were normalized to Snord 96A miRNA using a
SYBR Green PCR kit from Qiagen. Primer sequences are
given in the following Table 1.
miRNA- mimics and inhibitor transfections
Studies using miRNA mimics and inhibitors were
performed as detailed in our previous studies [34, 76–77].
SH SY5Y cells were plated at a concentration of 4 × 10
5
cells/well in 24-well plates overnight. The next day, cells
were treated with mock, hsa-let-7a-mimic, or hsa-let-7a
inhibitor for 24 h. The total RNA was collected from
SH SY5Y cells using the miRNeasy kit (Qiagen) per the
manufacturer’s guidelines. cDNA was synthesized using
miScript cDNA synthesis kit (BioRad) followed by qPCR
for genes of interest identified by Ingenuity Pathway
Analysis map (IPA). After 24 h, RNA was collected for
further analysis of miRNA and gene expression by qPCR
as described.
Table 1: Primer sequences for qPCR analysis of genes and miRNA in SH SY5Y cells (5ʹ–3ʹ)
Casp-3 forward GAAATTGTGGAATTGATGCGTGA
Casp-3 reverse CTACAACGATCCCCTCTGAAAAA
GAS-7 forward CATCGCCAAGCAAAAAGCAGA
GAS-7 reverse AGCCCAGAAGTAGTCGCAGT
BCL2L1 forward GACTGAATCGGAGATGGAGACC
BCL2L1 reverse GCAGTTCAAACTCGTCGCCT
SIRT2 forward TGCGGAACTTATTCTCCCAGA
SIRT2 reverse GAGAGCGAAAGTCGGGGAT
p53 forward GAGGTTGGCTCTGACTGTACC
p53 reverse TCCGTCCCAGTAGATTACCAC
MYCN forward ACCCGGACGAAGATGACTTCT
MYCN reverse CAGCTCGTTCTCAAGCAGCAT
PTEN forward TTTGAAGACCATAACCCACCAC
PTEN reverse ATTACACCAGTTCGTCCCTTTC
AKT1 forward TCCTCCTCAAGAATGATGGCA
AKT1 reverse GTGCGTTCGATGACAGTGGT
MDM2 forward GAATCATCGGACTCAGGTACATC
MDM2 reverse TCTGTCTCACTAATTGCTCTCCT
GAPDH forward GGAGCGAGATCCCTCCAAAAT
GAPDH reverse GGCTGTTGTCATACTTCTCATGG
Hsa-let-7a CUAUACAAUCUACUGUCUUUC
Hsa-miR-1972 UCAGGCCAGGCACAGUGGCUCA
Oncotarget55
www.oncotarget.com
Western blot
SH SY5Y cells were plated at a density of 2.5 × 105
cells/well in a 6-well plate overnight. The next day, cells
were treated either with DMSO (vehicle) or CBD 10 µM
in serum free medium for 6 h. Cells then were harvested,
washed with PBS, and the proteinwas isolated using RIPA
(radioimmunoprecipitation) lysis buffer (Santa Cruz).
Twenty-five micrograms of the protein was loaded on
10% Tris-Glycine gels (Bio Rad) subjected to SDS-PAGE
separation at 50V for 1 h and then at 80V for 2 h. The
protein was transferred to nitrocellulose paper using iBlot2
from Invitrogen (Grand Island, NY, USA) at voltages: 20V
for 1 minute, 23V for 4 minutes and 25V for 4 minutes.
The membrane was blocked in 5% nonfat dry milk in
TBS. The membrane was then labelled with antihuman
PTEN and Akt antibodies from Santa Cruz (diluted 1:100).
Secondary HRP-conjugated antibodies (Cat.no. ab6721)
(Abcam) were diluted 1:1000. GAPDH (Santa Cruz)
served as a reference protein diluted at 1:2000 in 5% nonfat
dry milk in TBS. ECL substrate (Thermo fisher) was added
to nitrocellulose paper for 3 minutes on the shaker and then
photographed using an X-ray film developer. The density
was measured by ImageJ from NIH.
Protein was collected from SH SY5Y cells
transfected with hsa-let-7a 48 h, the level of caspase-3
protein (1:500) (Abcam), γ-tubulin (Cell Signaling)
(1:2000) served as a reference protein in this experiment
using the protocol described above. Secondary HRP-
conjugated antibody was bought from (Abcam) and was
used in a concentration of 1:2000. Cellulose membrane was
stained with WesternSure Chemiluminescent substrate (LI-
COR). Then, protein images were detected using C-Digit
scanner (LI-COR). Image J software was used for analysis
of the results, and the quantity of protein was measured
after subtraction of the background by normalization to
the housekeeping gene. The protein level of caspase-3 was
calculated relative to corresponding mock level.
Migration and invasion assays
Migration of NBL cells was evaluated by trans-well
chambers with floro-block inserts (Corning, Tewksbury
MA, USA). According to the manufacturer’s guidelines,
the chambers were inserted in a 24-well cell culture
plates. The cells were stained with CFDA (ThermoFisher
Life Technologies, Grand Island, NY, USA). NBL cells
were treated with DMSO or 10 µM CBD in a serum-free
medium for 6 h. Treated cells were harvested, washed,
and counted. Cells (3.5 × 105) in 200 µl of serum-free
medium were added to each chamber. We added 750 µl
of the complete medium to the bottom of the plate. Cells
were incubated for 24 h to assess cell migration through
the membrane. The inserts were then washed, cells on the
upper membrane were removed by swab and the remaining
cells of the bottom of the insert were then visualized and
counted by Cytation 5 (Bio-Tek, Winooski, VT, US).
Cell invasion was assessed using matrigel
coated Corning inserts (Tewksbury MA, USA), per the
manufacturer’s recommendation. Cells were plated in 24-well
plates, stained with CFDA (ThermoFisher Life Technologies,
Grand Island, NY, USA), washed with PBS, and treated with
either DMSO or 10 µM CBD in serum-free medium for 6 h.
Cells were then harvested, washed, and counted to be plated
at a density of 3.5 × 105 cells/well in 350 µl of the serum-
free medium. 750 µl of the complete medium was added in
each well. Cells were incubated for 24 h at 37° C. The inserts
were washed, swabbed to remove the non-invading cells and
visualized by the Cytation 5 inverted fluorescent microscope
(BioTek, Winooski, VT, US).
Metabolic assay for determination of
extracellular acidification rate (ECAR) and
oxygen consumption rate (OCR)
SH SY5Y cell lines were plated in 8-well
Seahorse XFp Analyzer plates and allowed to adhere
overnight. Cells were then treated either with DMSO
(Vehicle) or 10 µM CBD in a serum-free DMEM for
6 h and are washed with XF medium per manufacturer’s
recommendations. The Seahorse XFP was used to analyze
the results of glycolytic stress and mitochondrial stress.
Statistical analysis of data
Differential (upregulated or downregulated)
expression of miRNAs was analyzed using 2-sample
t-test method as described [78]. The microarray data were
analyzed for significance using Kaplan-Meier method.
Student’s t-test was used for comparing the CBD-treated
group to vehicle controls. Multiple comparisons were
made using ANOVA (one-way analysis of variance) test
and post-hoc Tukey’s test. p < 0.05 was considered to be
statistically significant. All experiments were repeated at
least twice.
CONFLICTS OF INTEREST
The authors declare that they do not have any
conflicts of interest.
FUNDING
These studies were supported in part by NIH
grants P01AT003961, R01AT006888, R01AI123947,
R01AI129788, R01MH094755, P20GM103641 to MN
and PN, as well as MOHESR fellowship to EA.
REFERENCES
1. Colon NC, Chung DH. Neuroblastoma. Adv Pediatr. 2011;
58:297–311. https://doi.org/10.1016/j.yapd.2011.03.011.
Oncotarget56
www.oncotarget.com
2. Laverdiere C, Liu Q, Yasui Y, Nathan PC, Gurney JG,
Stovall M, Diller LR, Cheung NK, Wolden S,
Robison LL, Sklar CA. Long-term outcomes in survivors
of neuroblastoma: a report from the Childhood Cancer
Survivor Study. J Natl Cancer Inst. 2009; 101:1131–40.
https://doi.org/10.1093/jnci/djp230.
3. Pertwee RG, Ross RA. Cannabinoid receptors and their
ligands. Prostaglandins Leukot Essent Fatty Acids. 2002;
66:101–21. https://doi.org/10.1054/plef.2001.0341.
4. Iversen L. Cannabis and the brain. Brain. 2003;
126:1252–70.
5. Thomas A, Baillie GL, Phillips AM, Razdan RK, Ross RA,
Pertwee RG. Cannabidiol displays unexpectedly high
potency as an antagonist of CB1 and CB2 receptor agonists
in vitro. Br J Pharmacol. 2007; 150:613–23. https://doi.
org/10.1038/sj.bjp.0707133.
6. McKallip RJ, Lombard C, Fisher M, Martin BR, Ryu S,
Grant S, Nagarkatti PS, Nagarkatti M. Targeting CB2
cannabinoid receptors as a novel therapy to treat malignant
lymphoblastic disease. Blood. 2002; 100:627–34. https://
doi.org/10.1182/blood-2002-01-0098.
7. Guzman M. Cannabinoids: potential anticancer agents.
Nat Rev Cancer. 2003; 3:745–55. https://doi.org/10.1038/
nrc1188.
8. Ligresti A, Moriello AS, Starowicz K, Matias I, Pisanti S,
De Petrocellis L, Laezza C, Portella G, Bifulco M, Di
Marzo V. Antitumor activity of plant cannabinoids with
emphasis on the effect of cannabidiol on human breast
carcinoma. J Pharmacol Exp Ther. 2006; 318:1375–87.
https://doi.org/10.1124/jpet.106.105247.
9. Massi P, Vaccani A, Ceruti S, Colombo A, Abbracchio
MP, Parolaro D. Antitumor effects of cannabidiol, a
nonpsychoactive cannabinoid, on human glioma cell lines.
J Pharmacol Exp Ther. 2004; 308:838–45. https://doi.
org/10.1124/jpet.103.061002.
10. Massi P, Solinas M, Cinquina V, Parolaro D. Cannabidiol as
potential anticancer drug. Br J Clin Pharmacol. 2013; 75:303–
12. https://doi.org/10.1111/j.1365-2125.2012.04298.x.
11. McKallip RJ, Jia W, Schlomer J, Warren JW, Nagarkatti PS,
Nagarkatti M. Cannabidiol-induced apoptosis in human
leukemia cells: A novel role of cannabidiol in the regulation
of p22phox and Nox4 expression. Mol Pharmacol. 2006;
70:897–908. https://doi.org/10.1124/mol.106.023937.
12. Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S,
Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti
L, Kipps T, Negrini M, et al. Frequent deletions and down-
regulation of micro- RNA genes miR15 and miR16 at 13q14
in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A.
2002; 99:15524–9. https://doi.org/10.1073/pnas.242606799.
13. Fontana L, Fiori ME, Albini S, Cifaldi L, Giovinazzi S,
Forloni M, Boldrini R, Donfrancesco A, Federici V,
Giacomini P, Peschle C, Fruci D. Antagomir-17-5p
abolishes the growth of therapy-resistant neuroblastoma
through p21 and BIM. PLoS One. 2008; 3:e2236. https://
doi.org/10.1371/journal.pone.0002236.
14. Liu PY, Xu N, Malyukova A, Scarlett CJ, Sun YT,
Zhang XD, Ling D, Su SP, Nelson C, Chang DK, Koach J,
Tee AE, Haber M, et al. The histone deacetylase SIRT2
stabilizes Myc oncoproteins. Cell Death Differ. 2013;
20:503–14. https://doi.org/10.1038/cdd.2012.147.
15. Sun Y, Liu PY, Scarlett CJ, Malyukova A, Liu B,
Marshall GM, MacKenzie KL, Biankin AV, Liu T. Histone
deacetylase 5 blocks neuroblastoma cell differentiation by
interacting with N-Myc. Oncogene. 2014; 33:2987–94.
https://doi.org/10.1038/onc.2013.253.
16. Fattore L, Mancini R, Acunzo M, Romano G, Lagana A,
Pisanu ME, Malpicci D, Madonna G, Mallardo D, Capone
M, Fulciniti F, Mazzucchelli L, Botti G, et al. miR-579-3p
controls melanoma progression and resistance to target
therapy. Proc Natl Acad Sci U S A. 2016; 113:E5005-13.
https://doi.org/10.1073/pnas.1607753113.
17. Liu S, Tetzlaff MT, Cui R, Xu X. miR-200c inhibits
melanoma progression and drug resistance through down-
regulation of BMI-1. Am J Pathol. 2012; 181:1823–35.
https://doi.org/10.1016/j.ajpath.2012.07.009.
18. Scheid MP, Woodgett JR. Unravelling the activation
mechanisms of protein kinase B/Akt. FEBS Lett. 2003;
546:108–12.
19. Luo J, Manning BD, Cantley LC. Targeting the PI3K-Akt
pathway in human cancer: rationale and promise. Cancer
Cell. 2003; 4:257–62.
20. Hung FC, Chao CC. Knockdown of growth-arrest-specific
gene 7b (gas7b) using short-hairpin RNA desensitizes
neuroblastoma cells to cisplatin: Implications for preventing
apoptosis of neurons. J Neurosci Res. 2010; 88:3578–87.
https://doi.org/10.1002/jnr.22504.
21. Fisher T, Golan H, Schiby G, PriChen S, Smoum R,
Moshe I, Peshes-Yaloz N, Castiel A, Waldman D, Gallily
R, Mechoulam R, Toren A. In vitro and in vivo efficacy
of non-psychoactive cannabidiol in neuroblastoma. Curr
Oncol. 2016; 23:S15-22.
22. Romano B, Borrelli F, Pagano E, Cascio MG, Pertwee RG,
Izzo AA. Inhibition of colon carcinogenesis by a
standardized Cannabis sativa extract with high content of
cannabidiol. Phytomedicine. 2014; 21:631–9. https://doi.
org/10.1016/j.phymed.2013.11.006.
23. Nabissi M, Morelli MB, Amantini C, Liberati S, Santoni M,
Ricci-Vitiani L, Pallini R, Santoni G. Cannabidiol stimulates
Aml-1a-dependent glial differentiation and inhibits glioma
stem-like cells proliferation by inducing autophagy in a
TRPV2-dependent manner. Int J Cancer. 2015; 137:1855–
69. https://doi.org/10.1002/ijc.29573.
24. Morelli MB, Offidani M, Alesiani F, Discepoli G, Liberati S,
Olivieri A, Santoni M, Santoni G, Leoni P, Nabissi M. The
effects of cannabidiol and its synergism with bortezomib in
multiple myeloma cell lines. A role for transient receptor
potential vanilloid type-2. Int J Cancer. 2014; 134:2534–46.
https://doi.org/10.1002/ijc.28591.
25. Elbaz M, Nasser MW, Ravi J, Wani NA, Ahirwar DK,
Zhao H, Oghumu S, Satoskar AR, Shilo K, Carson WE 3rd,
Oncotarget57
www.oncotarget.com
Ganju RK. Modulation of the tumor microenvironment
and inhibition of EGF/EGFR pathway: novel anti-
tumor mechanisms of Cannabidiol in breast cancer.
Mol Oncol. 2015; 9:906–19. https://doi.org/10.1016/j.
molonc.2014.12.010.
26. Lombard C, Nagarkatti M, Nagarkatti PS. Targeting
cannabinoid receptors to treat leukemia: role of cross-
talk between extrinsic and intrinsic pathways in Delta9-
tetrahydrocannabinol (THC)-induced apoptosis of Jurkat
cells. Leuk Res. 2005; 29:915–22. https://doi.org/10.1016/j.
leukres.2005.01.014.
27. Lukhele ST, Motadi LR. Cannabidiol rather than Cannabis
sativa extracts inhibit cell growth and induce apoptosis in
cervical cancer cells. BMC Complement Altern Med. 2016;
16:335. https://doi.org/10.1186/s12906-016-1280-0.
28. Chakravarti B, Ravi J, Ganju RK. Cannabinoids as
therapeutic agents in cancer: current status and future
implications. Oncotarget. 2014; 5:5852–72. https://doi.
org/10.18632/oncotarget.2233.
29. Majumder PK, Febbo PG, Bikoff R, Berger R, Xue Q,
McMahon LM, Manola J, Brugarolas J, McDonnell TJ,
Golub TR, Loda M, Lane HA, Sellers WR. mTOR
inhibition reverses Akt-dependent prostate intraepithelial
neoplasia through regulation of apoptotic and HIF-1-
dependent pathways. Nat Med. 2004; 10:594–601. https://
doi.org/10.1038/nm1052.
30. Marazzi J, Kleyer J, Paredes JM, Gertsch J.
Endocannabinoid content in fetal bovine sera - unexpected
effects on mononuclear cells and osteoclastogenesis.
J Immunol Methods. 2011; 373:219–28. https://doi.
org/10.1016/j.jim.2011.08.021.
31. Opitz CA, Rimmerman N, Zhang Y, Mead LE, Yoder MC,
Ingram DA, Walker JM, Rehman J. Production of the
endocannabinoids anandamide and 2-arachidonoylglycerol
by endothelial progenitor cells. FEBS Lett. 2007; 581:4927–
31. https://doi.org/10.1016/j.febslet.2007.09.032.
32. Do Y, McKallip RJ, Nagarkatti M, Nagarkatti PS.
Activation through cannabinoid receptors 1 and 2 on
dendritic cells triggers NF-kappaB-dependent apoptosis:
novel role for endogenous and exogenous cannabinoids in
immunoregulation. J Immunol. 2004; 173:2373–82.
33. Pauletto M, Milan M, Huvet A, Corporeau C, Suquet M,
Planas JV, Moreira R, Figueras A, Novoa B, Patarnello T,
Bargelloni L. Transcriptomic features of Pecten maximus
oocyte quality and maturation. PLoS One. 2017;
12:e0172805. https://doi.org/10.1371/journal.pone.0172805.
34. Busbee PB, Nagarkatti M, Nagarkatti PS. Natural indoles,
indole-3-carbinol (I3C) and 3,3'-diindolylmethane
(DIM), attenuate staphylococcal enterotoxin B-mediated
liver injury by downregulating miR-31 expression and
promoting caspase-2-mediated apoptosis. PLoS One. 2015;
10:e0118506. https://doi.org/10.1371/journal.pone.0118506.
35. Mohan J, Gandhi AA, Bhavya BC, Rashmi R,
Karunagaran D, Indu R, Santhoshkumar TR. Caspase-2
triggers Bax-Bak-dependent and -independent cell death
in colon cancer cells treated with resveratrol. J Biol
Chem. 2006; 281:17599–611. https://doi.org/10.1074/jbc.
M602641200.
36. Bouchier-Hayes L, Green DR. Caspase-2: the orphan
caspase. Cell Death Differ. 2012; 19:51–7. https://doi.
org/10.1038/cdd.2011.157.
37. Bisogno T, Hanus L, De Petrocellis L, Tchilibon S,
Ponde DE, Brandi I, Moriello AS, Davis JB, Mechoulam R,
Di Marzo V. Molecular targets for cannabidiol and its
synthetic analogues: effect on vanilloid VR1 receptors
and on the cellular uptake and enzymatic hydrolysis of
anandamide. Br J Pharmacol. 2001; 134:845–52. https://
doi.org/10.1038/sj.bjp.0704327.
38. Amantini C, Mosca M, Nabissi M, Lucciarini R,
Caprodossi S, Arcella A, Giangaspero F, Santoni G.
Capsaicin-induced apoptosis of glioma cells is mediated
by TRPV1 vanilloid receptor and requires p38 MAPK
activation. J Neurochem. 2007; 102:977–90. https://doi.
org/10.1111/j.1471-4159.2007.04582.x.
39. Sanchez AM, Sanchez MG, Malagarie-Cazenave S, Olea N,
Diaz-Laviada I. Induction of apoptosis in prostate tumor
PC-3 cells and inhibition of xenograft prostate tumor
growth by the vanilloid capsaicin. Apoptosis. 2006; 11:89–
99. https://doi.org/10.1007/s10495-005-3275-z.
40. Ryberg E, Larsson N, Sjogren S, Hjorth S, Hermansson NO,
Leonova J, Elebring T, Nilsson K, Drmota T, Greasley PJ.
The orphan receptor GPR55 is a novel cannabinoid
receptor. Br J Pharmacol. 2007; 152:1092–101. https://doi.
org/10.1038/sj.bjp.0707460.
41. Ambros V. microRNAs: tiny regulators with great potential.
Cell. 2001; 107:823–6.
42. Zhang B, Pan X, Cobb GP, Anderson TA. microRNAs as
oncogenes and tumor suppressors. Dev Biol. 2007; 302:1–
12. https://doi.org/10.1016/j.ydbio.2006.08.028.
43. Cheng AM, Byrom MW, Shelton J, Ford LP. Antisense
inhibition of human miRNAs and indications for an
involvement of miRNA in cell growth and apoptosis.
Nucleic Acids Res. 2005; 33:1290–7. https://doi.
org/10.1093/nar/gki200.
44. Akao Y, Nakagawa Y, Naoe T. let-7 microRNA functions as
a potential growth suppressor in human colon cancer cells.
Biol Pharm Bull. 2006; 29:903–6.
45. Dong Q, Meng P, Wang T, Qin W, Qin W, Wang F, Yuan J,
Chen Z, Yang A, Wang H. MicroRNA let-7a inhibits
proliferation of human prostate cancer cells in vitro and
in vivo by targeting E2F2 and CCND2. PLoS One. 2010;
5:e10147. https://doi.org/10.1371/journal.pone.0010147.
46. Tsang WP, Kwok TT. Let-7a microRNA suppresses
therapeutics-induced cancer cell death by targeting
caspase-3. Apoptosis. 2008; 13:1215–22. https://doi.
org/10.1007/s10495-008-0256-z.
47. Dent EW, Gertler FB. Cytoskeletal dynamics and transport
in growth cone motility and axon guidance. Neuron. 2003;
40:209–27.
Oncotarget58
www.oncotarget.com
48. Zhang Z, Zheng F, You Y, Ma Y, Lu T, Yue W, Zhang D.
Growth arrest specific gene 7 is associated with
schizophrenia and regulates neuronal migration and
morphogenesis. Mol Brain. 2016; 9:54. https://doi.
org/10.1186/s13041-016-0238-y.
49. Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M,
Shimizu M, Wojcik SE, Aqeilan RI, Zupo S, Dono M,
Rassenti L, Alder H, Volinia S, et al. miR-15 and miR-
16 induce apoptosis by targeting BCL2. Proc Natl Acad
Sci U S A. 2005; 102:13944–9. https://doi.org/10.1073/
pnas.0506654102.
50. Tang Y, Zheng J, Sun Y, Wu Z, Liu Z, Huang G.
MicroRNA-1 regulates cardiomyocyte apoptosis by
targeting Bcl-2. Int Heart J. 2009; 50:377–87.
51. Yang J, Cao Y, Sun J, Zhang Y. Curcumin reduces the
expression of Bcl-2 by upregulating miR-15a and miR-16
in MCF-7 cells. Med Oncol. 2010; 27:1114–8. https://doi.
org/10.1007/s12032-009-9344-3.
52. Lai XJ, Cheng XY, Hu LD. microRNA 421 induces
apoptosis of c-33a cervical cancer cells via down-
regulation of Bcl-xL. Genet Mol Res. 2016; 15. https://doi.
org/10.4238/gmr15048853.
53. Gamble LD, Kees UR, Tweddle DA, Lunec J. MYCN
sensitizes neuroblastoma to the MDM2-p53 antagonists
Nutlin-3 and MI-63. Oncogene. 2012; 31:752–63. https://
doi.org/10.1038/onc.2011.270.
54. Slack A, Chen Z, Tonelli R, Pule M, Hunt L, Pession A,
Shohet JM. The p53 regulatory gene MDM2 is a direct
transcriptional target of MYCN in neuroblastoma. Proc Natl
Acad Sci U S A. 2005; 102:731–6. https://doi.org/10.1073/
pnas.0405495102.
55. Bellacosa A, Kumar CC, Di Cristofano A, Testa JR.
Activation of AKT kinases in cancer: implications for
therapeutic targeting. Adv Cancer Res. 2005; 94:29–86.
https://doi.org/10.1016/S0065-230X(05)94002-5.
56. Chen L, Iraci N, Gherardi S, Gamble LD, Wood KM,
Perini G, Lunec J, Tweddle DA. p53 is a direct
transcriptional target of MYCN in neuroblastoma. Cancer
Res. 2010; 70:1377–88. https://doi.org/10.1158/0008-5472.
CAN-09-2598.
57. Tamura M, Gu J, Matsumoto K, Aota S, Parsons R,
Yamada KM. Inhibition of cell migration, spreading, and
focal adhesions by tumor suppressor PTEN. Science. 1998;
280:1614–7.
58. Raftopoulou M, Etienne-Manneville S, Self A, Nicholls S,
Hall A. Regulation of cell migration by the C2 domain of
the tumor suppressor PTEN. Science. 2004; 303:1179–81.
https://doi.org/10.1126/science.1092089.
59. Liliental J, Moon SY, Lesche R, Mamillapalli R, Li D,
Zheng Y, Sun H, Wu H. Genetic deletion of the Pten tumor
suppressor gene promotes cell motility by activation of
Rac1 and Cdc42 GTPases. Curr Biol. 2000; 10:401–4.
60. Yuan XJ, Whang YE. PTEN sensitizes prostate cancer cells
to death receptor-mediated and drug-induced apoptosis
through a FADD-dependent pathway. Oncogene. 2002;
21:319–27. https://doi.org/10.1038/sj.onc.1205054.
61. Weng L, Brown J, Eng C. PTEN induces apoptosis and
cell cycle arrest through phosphoinositol-3-kinase/Akt-
dependent and -independent pathways. Hum Mol Genet.
2001; 10:237–42.
62. Wu Y, Karas M, Dupont J, Zhao H, Toyoshima Y, Le
Roith D. Multiple signaling pathways are involved in the
regulation of IGF-I receptor inhibition of PTEN-enhanced
apoptosis. Growth Horm IGF Res. 2004; 14:52–8.
63. Sledzinski P, Zeyland J, Slomski R, Nowak A. The
current state and future perspectives of cannabinoids in
cancer biology. Cancer Med. 2018; 7:765–75. https://doi.
org/10.1002/cam4.1312.
64. Velasco G, Sanchez C, Guzman M. Anticancer mechanisms
of cannabinoids. Curr Oncol. 2016; 23:S23-32.
65. Schwartz L, Supuran CT, Alfarouk KO. The Warburg Effect
and the Hallmarks of Cancer. Anticancer Agents Med
Chem. 2017; 17:164–70.
66. den Hollander B, Sundstrom M, Pelander A, Siltanen A,
Ojanpera I, Mervaala E, Korpi ER, Kankuri E.
Mitochondrial respiratory dysfunction due to the conversion
of substituted cathinones to methylbenzamides in SH-SY5Y
cells. Sci Rep. 2015; 5:14924. https://doi.org/10.1038/
srep14924.
67. DeBerardinis RJ, Lum JJ, Hatzivassiliou G, Thompson CB.
The biology of cancer: metabolic reprogramming fuels
cell growth and proliferation. Cell Metab. 2008; 7:11–20.
https://doi.org/10.1016/j.cmet.2007.10.002.
68. Tateishi K, Iafrate AJ, Ho Q, Curry WT, Batchelor TT,
Flaherty KT, Onozato ML, Lelic N, Sundaram S,
Cahill DP, Chi AS, Wakimoto H. Myc-Driven Glycolysis
Is a Therapeutic Target in Glioblastoma. Clin Cancer Res.
2016; 22:4452–65. https://doi.org/10.1158/1078-0432.
CCR-15-2274.
69. Ruiz-Perez MV, Medina MA, Urdiales JL, Keinanen TA,
Sanchez-Jimenez F. Polyamine metabolism is sensitive to
glycolysis inhibition in human neuroblastoma cells. J Biol
Chem. 2015; 290:6106–19. https://doi.org/10.1074/jbc.
M114.619197.
70. Yao A, Xiang Y, Si YR, Fan LJ, Li JP, Li H, Guo W, He
HX, Liang XJ, Tan Y, Bao LY, Liao XH. PKM2 promotes
glucose metabolism through a let-7a-5p/Stat3/hnRNP-A1
regulatory feedback loop in breast cancer cells. J Cell
Biochem. 2018 Oct 28. [Epub ahead of print]. https://doi.
org/10.1002/jcb.27947.
71. Nguyen LH, Zhu H. Lin28 and let-7 in cell metabolism
and cancer. Transl Pediatr. 2015; 4:4–11. https://doi.
org/10.3978/j.issn.2224-4336.2015.01.05.
72. Arora A, Singh S, Bhatt AN, Pandey S, Sandhir R,
Dwarakanath BS. Interplay Between Metabolism
and Oncogenic Process: Role of microRNAs. Transl
Oncogenomics. 2015; 7:11–27. https://doi.org/10.4137/
TOG.S29652.
Oncotarget59
www.oncotarget.com
73. Kwon OS, Han MJ, Cha HJ. Suppression of SIRT2 and
altered acetylation status of human pluripotent stem cells:
possible link to metabolic switch during reprogramming.
BMB Rep. 2017; 50:435–6.
74. Miranda K, Yang X, Bam M, Murphy EA, Nagarkatti PS,
Nagarkatti M. MicroRNA-30 modulates metabolic
inflammation by regulating Notch signaling in adipose
tissue macrophages. Int J Obes (Lond). 2018; 42:1140–
1150. https://doi.org/10.1038/s41366-018-0114-1.
75. Sido JM, Jackson AR, Nagarkatti PS, Nagarkatti M.
Marijuana-derived Delta-9-tetrahydrocannabinol suppresses
Th1/Th17 cell-mediated delayed-type hypersensitivity
through microRNA regulation. J Mol Med (Berl). 2016;
94:1039–51. https://doi.org/10.1007/s00109-016-1404-5.
76. Rao R, Rieder SA, Nagarkatti P, Nagarkatti M.
Staphylococcal enterotoxin B-induced microRNA-155
targets SOCS1 to promote acute inflammatory lung injury.
Infect Immun. 2014; 82:2971–9. https://doi.org/10.1128/
IAI.01666-14.
77. Singh NP, Miranda K, Singh UP, Nagarkatti P,
Nagarkatti M. Diethylstilbestrol (DES) induces autophagy
in thymocytes by regulating Beclin-1 expression through
epigenetic modulation. Toxicology. 2018; 410:49–58.
https://doi.org/10.1016/j.tox.2018.08.012.
78. Singh NP, Singh UP, Nagarkatti PS, Nagarkatti M. Prenatal
exposure of mice to diethylstilbestrol disrupts T-cell
differentiation by regulating Fas/Fas ligand expression
through estrogen receptor element and nuclear factor-
kappaB motifs. J Pharmacol Exp Ther. 2012; 343:351–61.
https://doi.org/10.1124/jpet.112.196121.
