ArticlePDF Available

Abstract and Figures

The northern bobwhite quail (Colinus virginianus) is a popular gamebird in the Rolling Plains Ecoregion of West Texas. However, there has been a population decline in this area over recent decades. Consistent reports indicate a high prevalence of the eyeworm (Oxyspirura petrowi) and caecal worm (Aulonocephalus pennula), which may be of major influence on the bobwhite population. While research has suggested pathological consequences and genetic relatedness to other pathologically significant parasites, little is known about the influence of climate on these parasites. In this study, we examined whether seasonal temperature and precipitation influences the intensity of these parasites in bobwhite. We also analyzed quantitative PCR results for bobwhite feces and cloacal swabs against temperature and precipitation to identify climatic impacts on parasite reproduction in this region. Multiple linear regression analyses were used for parasite intensity investigation while binary logistic regression analyses were used for parasite reproduction studies. Our analyses suggest that caecal worm intensity, caecal worm reproduction, and eyeworm reproduction are influenced by temperature and precipitation. Temperature data was collected 15, 30, and 60 days prior to the date of collection of individual bobwhite and compared to qPCR results to generate a temperature range that may influence future eyeworm reproduction. This is the first preliminary study investigating climatic influences with predictive statistics on eyeworm and caecal worm infection of northern bobwhite in the Rolling Plains.
Content may be subject to copyright.
Contents lists available at ScienceDirect
IJP: Parasites and Wildlife
journal homepage: www.elsevier.com/locate/ijppaw
Predicting seasonal infection of eyeworm (Oxyspirura petrowi) and caecal
worm (Aulonocephalus pennula) in northern bobwhite quail (Colinus
virginianus) of the Rolling Plains Ecoregion of Texas, USA
Kendall R. Blanchard
a
, Aravindan Kalyanasundaram
a
, Cassandra Henry
a
, Matthew Z. Brym
a
,
James G. Surles
b
, Ronald J. Kendall
a,
a
The Wildlife Toxicology Laboratory, Texas Tech University, P.O. Box 43290, Lubbock, TX, 79409, USA
b
The Department of Mathematics and Statistics, P.O. Box 41042, Texas Tech University, Lubbock, TX, 79409, USA
ARTICLE INFO
Keywords:
Bobwhite
Caecal
Climate
Eyeworm
qPCR
ABSTRACT
The northern bobwhite quail (Colinus virginianus) is a popular gamebird in the Rolling Plains Ecoregion of West
Texas. However, there has been a population decline in this area over recent decades. Consistent reports indicate
a high prevalence of the eyeworm (Oxyspirura petrowi) and caecal worm (Aulonocephalus pennula), which may be
of major inuence on the bobwhite population. While research has suggested pathological consequences and
genetic relatedness to other pathologically signicant parasites, little is known about the inuence of climate on
these parasites. In this study, we examined whether seasonal temperature and precipitation inuences the in-
tensity of these parasites in bobwhite. We also analyzed quantitative PCR results for bobwhite feces and cloacal
swabs against temperature and precipitation to identify climatic impacts on parasite reproduction in this region.
Multiple linear regression analyses were used for parasite intensity investigation while binary logistic regression
analyses were used for parasite reproduction studies. Our analyses suggest that caecal worm intensity, caecal
worm reproduction, and eyeworm reproduction are inuenced by temperature and precipitation. Temperature
data was collected 15, 30, and 60 days prior to the date of collection of individual bobwhite and compared to
qPCR results to generate a temperature range that may inuence future eyeworm reproduction. This is the rst
preliminary study investigating climatic inuences with predictive statistics on eyeworm and caecal worm in-
fection of northern bobwhite in the Rolling Plains.
1. Introduction
The northern bobwhite quail (Colinus virginianus; hereafter bob-
white), a popular gamebird in the United States of America has been
experiencing a decline of > 4% per year (Sauer et al., 2013). This de-
cline remains apparent despite their typical 5-year boom and bust
cycle patterns (Hernández et al., 2007;Lusk et al., 2007). Much of this
decline has impacted the Rolling Plains Ecoregion of Texas, a location
considered as one of the last strongholds of bobwhite (Dunham and
Kendall, 2017). Reasons for the decline are relatively unclear, but ha-
bitat loss, habitat fragmentation, weather variations, and land-use have
previously been believed to be major inuences (Rollins, 2007;
Hernández et al., 2013). To investigate other contributors, a massive
collaborative eort ensued to reevaluate the role of disease, con-
taminants, and parasites in these quail populations in the Rolling Plains.
During this collaboration and ongoing survey work by the Wildlife
Toxicology Laboratory, the eyeworm (Oxyspirura petrowi) and caecal
worm (Aulonocephalus pennula) were identied in high prevalence
throughout this ecoregion with 100% infection in at least one area of
the Rolling Plains (Henry et al., 2017).
The heteroxenous eyeworm is typically found under the nictitating
membrane, lacrimal ducts and glands, and the orbital cavity of the
bobwhite (Saunders, 1935;Addison and Anderson, 1969;Robel et al.,
2003;Dunham et al., 2014;Bruno et al., 2015;Dunham and Kendall,
2017). Pathological investigations by Dunham et al. (2016a) and Bruno
et al. (2015) found inammation in the lacrimal duct and lesions on the
Harderian gland. This is of great concern when considering these two
tissuesimportance to saturation of the eye (Holly and Lemp, 1977) and
immune response (Payne, 1994), respectively. Recent phylogenetic
analyses performed by Kalyanasundaram et al. (2018a) revealed its
close relation to the human eyeworm, Loa loa, and the human and
carnivore eyeworm, Thelazia callipaeda, which are both responsible for
https://doi.org/10.1016/j.ijppaw.2018.12.006
Received 16 November 2018; Received in revised form 21 December 2018; Accepted 22 December 2018
Corresponding author. Wildlife Toxicology Laboratory, P.O. Box 43290, Texas Tech University, Lubbock, TX, USA.
E-mail address: ron.kendall@ttu.edu (R.J. Kendall).
IJP: Parasites and Wildlife 8 (2019) 50–55
2213-2244/ © 2018 Published by Elsevier Ltd on behalf of Australian Society for Parasitology. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/BY-NC-ND/4.0/).
T
vision impairment and inammation in their hosts (Barua et al., 2005;
Nayak et al., 2016). Through PCR techniques developed by Almas et al.
(2018), the dierential grasshopper (Melanoplus dierentialis) was
identied as the primary carrier of the eyeworm though the infective
larva can be carried in a variety of grasshopper species.
First described by Chandler (1935), the caecal worm is a free-
oating, heteroxenous nematode of the caecum. Pathological analysis
performed by Dunham et al. (2017a) revealed that infected bobwhite
had reduced digesta available for nutrient absorption throughout the
caecum. This is concerning as the caecum is an essential organ for water
and nitrogen absorption, as well as immune response (Clench and
Mathias, 1995). Dunham et al. (2017a) also speculate that because of
their head shape and mouth parts (Inglis, 1958), higher infections en-
courage caecal worm attachment to the caecum walls. Phylogenetic
analyses on the caecal worm also reveal a close relation to the family
Anisakidae and Ascarididae, which contain species responsible for re-
duced energy levels, weight loss, and death in their hosts
(Kalyanasundaram et al., 2017). Similar to the eyeworm, the caecal
worm also uses an insect intermediate host in its lifecycle which was
identied as most grass-eating grasshopper species of the Rolling Plains
(Henry et al., 2018).
While experiments and data collection are continuing in an eort to
understand morbidity and mortality associated with these parasites
(Henry et al., 2017;Brym et al., 2018), further research on the role of
climate factors should also be heavily considered. The relationship
between climate and parasites has been of great interest over the last
several decades because of its eects on parasite transmission (Dobson
and Carper, 1992), larval development (Cattadori et al., 2005), inter-
mediate host abundance (Dunham et al., 2017b;Henry et al., 2018),
host populations (Hudson et al., 1998;Redpath et al., 2006), and ar-
rested development (Armour and Bruce, 1974;Michel et al., 1976,
1978), among other eects. Speculations have been made by several
researchers in the past about climatic eects on caecal worm and
eyeworm. Lehmann (1984) suggests that the caecal worm thrives in
drought conditions. Speculations by Dunham et al. (2017b) suggest that
an increase in precipitation coincides with an increase in infection of
both parasites throughout the Rolling Plains because of a higher
abundance of insect intermediate hosts. Similarly, Henry et al. (2018)
suggests that climate change also inuences insect intermediate host
populations and therefore, caecal worm transmission among bobwhite.
Yet, there are few studies centered on climatic eects on these species
of parasites.
Quantitative PCR (qPCR) can be used to indicate parasite re-
production based on parasite egg presence in fecal matter
(Kalyanasundaram et al., 2018b) whereas necropsies can provide worm
counts for parasite intensity. In this study, we use fecal samples, cloacal
swabs, and average worm counts per bobwhite collected between
March and October of 2014 through 2017 to perform predictive ana-
lyses on parasite reproduction and intensity in relation to temperature
and precipitation. Our research objectives include (1) identify trends
between temperature and precipitation in eyeworm and caecal worm
reproduction and intensity using qPCR and necropsy methods, and (2)
forecast potential infection spread based on these parasitesreproduc-
tion from qPCR results in relation to temperature and precipitation.
2. Materials and methods
2.1. Ethics statement
All quail were trapped and handled accorded to Texas Parks and
Wildlife permit SRP-1098-984 and SPR-0715-095 and Texas Tech
University Animal Care and Use protocol 13066-08 and 16071-08.
2.2. Study area and sample collection
Bobwhite were collected between March and October of 20142017
from a 12,000ha privately owned cattle ranch in Mitchell County,
Texas. Walk-in double funnel traps (91.4 × 60.9 × 20 cm) were baited
with milo (Sorghum bicolor), covered with vegetation, and monitored
two times per day to capture bobwhite as described in Dunham et al.
(2014). All bobwhite individuals were transported to The Institute of
Environmental and Human Health (TIEHH) aviary at Texas Tech where
they were weighed, sexed, aged, cloacal swabbed, and a feces sample
collected (Dunham et al., 2017b). Cloacal swabs and feces were col-
lected upon capture and daily until necropsy to assess the reproductive
activity of eyeworm and caecal worm based on presence of parasite
eggs via quantitative PCR. For this study, samples collected on or within
12 days of capture were used in the analyses.
2.3. Necropsy and parasite collection
Euthanasia and necropsies were performed as described in Dunham
et al. (2014). Eyeworms were extracted from the eyes by removing the
eyeball and associated tissues into a petri dish as outlined in Dunham
et al. (2016a). Caecal worm collection followed protocols described in
Dunham et al. (2017b) where caeca were removed and placed in a 20-
mesh sieve, then cut into smaller sections to assess caecal worm count.
2.4. DNA extraction and qPCR
Feces samples weighing 0.180.22 g and cloacal swabs were snap-
frozen in liquid nitrogen and then extracted using the QIAamp DNA
Stool Mini Kit (Germany) following manufacturer's protocol as outlined
in Kistler et al. (2016a) with a nal elution step of 50 μL per sample
followed from Kalyanasundaram et al. (2018b). Quantitative PCR
techniques also followed Kalyanasundaram et al. (2018b) methods with
20 μL mastermix volumes as follows: 10 μL Taqman Fast Advanced
Mastermix (Applied Biosystems), 0.4 μL of forward and reverse eye-
worm primers and eyeworm probe, 0.2 μL of forward and reverse caecal
worm primers and caecal worm probe, 0.2 μL of forward and reverse
quail primers and quail probe, 0.1 μLbovine serum albumin (BSA), and
7.66 μL of molecular-grade water. Primer and probe sequences used in
this study are outlined in Table 1.
Table 1
Primer and probe sequences used in qPCR methods.
Primer/Probe Sequence Target Product Size
Oxy2448F GTTTCCTCATGTGATTTCATTTTGT Eyeworm ITS2 (Kistler et al., 2016a) 149bp
Oxy2597R ATAAACGTTATTGTTGCCATATGCT
Oxy_Probe_1 FAM-AAAGAAAGGTAATTCATCTGGT-MGB
Apen F1 GGGTTGTGGTACTAGGTGGGT Caecal Worm COX1 (Kalyanasundaram et al., 2018b) 120bp
Apen R1 GCACCCAAAATAGAACTCACCCC
Apen_Probe_1 VIC-GGTCATCCTGGTAGAAGCGTTG-MGB
ND2_70F CAACCACTGAATCATAGCCTGAAC Northern Bobwhite NADH2 (Kistler et al., 2016a) 79bp
ND2_149R GGTGGTGGGATTTTGAAATGAG
Quail_ND2_Probe1 NED-AGGAACCACAATCAC-MGB
K.R. Blanchard et al. IJP: Parasites and Wildlife 8 (2019) 50–55
51
2.5. Data analysis
Daily mean temperature and precipitation data was accessed for
Sterling City, TX (31°504.92N, 100°5857.72W) from the National
Oceanic and Atmospheric Administration (NOAA) (2018). This site was
chosen because of its proximity to the study area and the consistency in
which temperature and precipitation data was collected by the selected
weather station. Temperature and precipitation values were converted
to metric units and then grouped and averaged by season and year from
2014 to 2017 as spring (MarchMay), summer (JuneAugust), and fall
(SeptemberOctober). Eyeworm and caecal worm counts among bob-
white between 2014 and 2017 were grouped and averaged in the same
manner. The seasonally averaged data for temperature, precipitation,
and worm counts were compared to better understand climatic inu-
ences on eyeworm and caecal worm intensities in bobwhite. Positive
qPCR results per individual bobwhite were also totaled and then
grouped by season and year. These results were then compared with
seasonally averaged temperature and precipitation to identify if cli-
matic factors inuence infection spread to intermediate hosts using
parasite reproduction as an indicator. A total of 244 individual bob-
white were assessed for average eyeworm counts, 268 for average
caecal worm counts, and 141 cloacal swabs and feces from individual
bobwhite were used for analysis by qPCR. This dataset was not robust
enough to support demographic comparisons and thus, was not ana-
lyzed in this study. Summary data for averaged climatic variables,
average worm counts, and qPCR results are visualized in Table 2.
For average worm count analyses, multiple linear regression ana-
lyses were run to study relationships between the average counts per
bobwhite with average seasonal temperature, precipitation, and the
interaction between average seasonal temperature and precipitation.
Because of small sample sizes, these analyses were weighted by the
number of samples for both eyeworm and caecal worm. For seasonally
totaled qPCR positive results, a binary logistic regression analysis was
run to examine relationships between parasite reproduction with sea-
sonally averaged temperature, precipitation, and the interaction be-
tween temperature and precipitation.
In addition, temperature data was also used to predict eyeworm and
caecal worm infection spread using positive and negative qPCR results.
To do this, temperature data from NOAA was grouped into 15, 30, and
60 days prior to individual bobwhite collection date and then compared
to their corresponding qPCR results, positive or negative. Because of the
lack of variability in precipitation data (with 83% of analyzed data
having < 1 cm of precipitation) and thus, subsequently large con-
dence intervals, precipitation was not used in predicting parasite re-
production in this study. For these analyses, binary logistic regressions
with quadratic terms were used to assess signicance between qPCR
results and the temperature data while also identifying an optimal
temperature range which may facilitate future parasite reproduction
and infection spread. Statistical signicance was based on p < 0.05.
All statistical analyses were run in Minitab (v8) and all data was tested
for normality during regression analyses.
3. Results
3.1. Eyeworm intensity and reproduction
The multiple linear regression analysis for average eyeworm count
with temperature and precipitation had no statistical signicance. For
the binary logistic regression analysis of positive qPCR results, each
variable was run individually because of the heavy collinearity between
temperature and precipitation. In these individual tests, both pre-
cipitation and temperature were statistically signicant. The trend ex-
emplied in Fig. 1d indicates that detection of eyeworm reproduction
in bobwhite increases with increasing temperature and precipitation.
3.2. Caecal worm intensity and reproduction
The multiple linear regression analysis for average caecal worm
count for individual bobwhite with seasonally averaged temperature
and precipitation had a marginal signicance (p = 0.07). The general
trend seen in this analysis reveals higher caecal worm intensities in
lower temperatures and lower precipitation (Fig. 1a).
Because of a heavy collinearity between temperature and pre-
cipitation in the binary regression analysis with positive qPCR results,
each variable was run individually against positive qPCR results using
separate binary logistic regressions. In these analyses, seasonally
averaged temperature was not signicant whereas seasonally averaged
precipitation was signicant. The predicted output of positive qPCR
results indicates that as precipitation increases, the probability of re-
production of caecal worm in birds increases as well (Fig. 1b).
3.3. Climatic inuence on parasite reproduction
Because of the lack of variability in precipitation data, caecal worm
reproduction was not analyzed because of the lack of signicance be-
tween caecal worm reproduction and temperature. Eyeworm re-
production, however, was signicant with temperature. When qPCR
results were compared to temperatures of collection dates, the tem-
perature 60 days prior to collection date was marginally signicant
(p = 0.07), and temperature 15 and 30 days prior to the collection date
Table 2
Data on all sample sizes used in statistical analyses of average worm counts and qPCR positives.
Season and Year Climatic Variables Total Positive qPCR Results Average Worm Counts
Temperature (°C) Precipitation (cm) Eyeworm Caecal worm Eyeworm Caecal worm
2014
Spring 20.00 7.53 0 (N = 0) 0 (N = 0) 23.5 (N = 14) 139.0 (N = 14)
Summer 26.94 1.49 1 (N = 11) 2 (N = 11) 33.0 (N = 16) 149.3 (N = 16)
Fall 22.08 4.36 2 (N = 19) 1 (N = 19) 16.0 (N = 21) 91.5 (N = 21)
2015
Spring 19.31 7.01 1 (N = 2) 1 (N = 2) 26.0 (N = 18) 181.0 (N = 18)
Summer 26.66 3.49 6 (N = 7) 6 (N = 7) 22.0 (N = 39) 101.0 (N = 39)
Fall 22.36 10.22 14 (N = 22) 20 (N = 22) 23.5 (N = 27) 74.5 (N = 51)
2016
Spring 17.59 6.68 0 (N = 20) 3 (N = 20) 13.0 (N = 27) 162.3 (N = 27)
Summer 27.22 4.90 1 (N = 4) 0 (N = 4) 18.5 (N = 10) 238.5 (N = 10)
Fall 22.50 6.70 0 (N = 8) 1 (N = 8) 19.5 (N = 16) 180.0 (N = 16)
2017
Spring 18.70 1.85 0 (N = 21) 8 (N = 21) 18.0 (N = 26) 277.6 (N = 26)
Summer 26.48 9.76 1 (N = 10) 3 (N = 10) 10.6 (N = 14) 153.3 (N = 14)
Fall 20.83 3.49 0 (N = 17) 4 (N = 17) 16.0 (N = 16) 154.5 (N = 16)
K.R. Blanchard et al. IJP: Parasites and Wildlife 8 (2019) 50–55
52
were not signicant. This test also determined that temperatures be-
tween approximately 15 °C and 26 °C 60 days prior to collection of
bobwhite may facilitate increased probability of future eyeworm re-
production and therefore, infection spread to intermediate hosts. These
results are illustrated in Fig. 2.
4. Discussion
While there are numerous recent studies on eyeworm and caecal
worm prevalence in the Rolling Plains (Dunham et al., 2016b;Henry
et al., 2017;Brym et al., 2018;Bruno et al., 2018), this is the rst study
to analyze and predict eyeworm and caecal worm intensity and re-
production in bobwhites based on climatic factors. By analyzing pre-
dictive statistics on available temperature and precipitation data, this
study reveals the potential of climate to inuence both eyeworms and
caecal worms. Understanding how seasonal dynamics and changing
climatic patterns inuence these parasites is an essential step in ana-
lyzing how these infections alter with global warming (Altizer et al.,
2006). This is essential in the Rolling Plains ecoregion because the
average temperature in the Rolling Plains is predicted to increase from
35.5 °C to 38.4 °C in July, 1.1 °C2.1 °C in January, and annual
rainfall may decrease from 50 cm/year to as low as 37.3 cm/year
(Modala et al., 2017;Texas A&M AgriLife Extension, 2018).
With the predicted climate changes in the Rolling Plains, this study
is useful for understanding how climate can potentially inuence eye-
worm and caecal worm infection dynamics. For example, results from
this study indicate temperature 60 days prior to collection date of
bobwhite may inuence eyeworm reproduction which coincides with
Kistler et al.s (2016b) experimental infection indicating eyeworm re-
production in bobwhite 5256 days post infection. Similarly, caecal
worm intensities increase in low precipitation which supports
Lehmanns (1984) theory that caecal worm infection is exacerbated in
drought conditions. However, this study analyzes what is likely to be a
few factors in the multitude of inuences that dictate eyeworm and
caecal worm infection dynamics. Despite this, the current data set re-
veals preliminary insight as to the potential roles of temperature and
precipitation, especially when compared to other parasite species.
Climate eects on parasites have been well documented, particu-
larly regarding their eects on parasite development, reproduction, and
intensity (Schad, 1977;Lima, 1998;Sommerville and Davey, 2002;
Sissay et al., 2007). Such infection dynamics are apparent in other
Fig. 1. Contour and scatterplot of relationships between temperature and precipitation on parasite worm burdens and egg shedding. a) Predicted caecal worm
intensity against temperature and precipitation contour plot. b) Scatterplot of predicted caecal worm reproduction against precipitation. d) Predicted eyeworm
reproduction against temperature and precipitation contour plot.
Fig. 2. Scatterplot of predicted eyeworm reproduction with temperature 60
days prior to collection date with upper and lower 95% condence intervals.
K.R. Blanchard et al. IJP: Parasites and Wildlife 8 (2019) 50–55
53
nematodes like Ostertagia ostertagi, a gastrointestinal parasite of cattle,
which has been shown to enter stages of arrested development during
the winter seasons (Michel et al., 1974,1975;1976). Temperature can
also induce arrested development for the larvae of Obeliscoides cuniculi,
a parasite of rabbits, in which larvae stored at 4 °C were dormant while
those kept at 15 °C remained active (Fernando et al., 1971). A similar
instance has been identied for both eyeworms and caecal worms in the
Rolling Plains where there was less detection of parasite eggs in feces
collected during September and October (Kalyanasundaram et al.,
2018b), which may have been because of an arrested development state
caused by lower temperatures. Furthermore, a study by Lima (1998)
examining gastrointestinal nematode infection of Cooperia spp. in Nel-
lore cattle of Brazil found that cattle had the lowest worm counts during
July in the dry season when compared to the rainy season. Contrast-
ingly, Dunham et al. (2016b) observed a decrease in eyeworm and
caecal worm prevalence with decreased precipitation.
In addition to the direct eects of temperature and precipitation,
caecal worm and eyeworm infection dynamics may be inuenced by
the abundance of insect intermediate hosts. For instance, Henry et al.
(2017) speculated that the parasite-induced die-oof bobwhite in
Mitchell County, TX during 2017 may have been because of increased
rainfall and a resulting surge in intermediate host populations. This
trend has been demonstrated before in some insect species having
greater density of adult species in moist habitats (Janzen and Schoener,
1968). Because reproduction in both the eyeworm and caecal worm
increases with increasing precipitation, this may indicate a relationship
between insect intermediate host and parasite reproduction to maintain
the parasite life cycle. Additionally, parasite egg viability is higher in
moist conditions (Rogers and Sommerville, 1963;Gaasenbeek and
Borgsteede, 1998), which may also increase the advantages of parasite
reproduction at that time and therefore, increase the likelihood of
successful transmission to intermediate hosts.
Moreover, climate change may facilitate expansion of arthropod
intermediate host ranges (Guo et al., 2009) and can extend native
ranges of various parasites as formerly uninhabitable areas become
suitable (Laerty, 2009). This was also suspected by Henry et al. (2018)
who postulated that caecal worm infections might spread geo-
graphically in response to rising temperatures. Climate-induced ex-
pansions in either arthropod or parasite ranges could also lead to the
possibility of host switching, as potentially new host species become
exposed (Brooks and Hoberg, 2007). The increase in extreme climatic
events associated with global climate change (Coumou and Rahmstorf,
2012) have also been linked to the simultaneous emergence of parasites
from arrested development, resulting in epizootic events (Hudson et al.,
2006).
Understanding climatic factors of importance that trigger these
epizootic events may also prove to be important for the timing of an-
thelmintic treatment. This is because anthelmintics are not as likely to
be as eective during periods of arrested development because of the
lower energy requirements of nematodes (Sommerville and Davey,
2002). For instance, timing of anthelmintic treatment is suggested to
contribute to the lack of response in O. oestertagi (Pritchard et al., 1978)
and most anthelmintics are ineective against arrested larvae of para-
sites that infect horses (Proudman and Matthews, 2000). Since growth
and development are halted during arrested development, is it also
likely that reproduction in parasites is also not occurring (Blitz and
Gibbs, 1972;Gibbs, 1986). Thus, understanding that temperatures be-
tween 15 °C and 26 °C may inuence eyeworm reproduction 60 days
later could allow implementation of anthelmintics when they would be
most eective.
While this study provides preliminary results for eyeworm and
caecal worm dynamics in the Rolling Plains, further investigation is
needed to better understand the inuence of climatic variables on these
parasites. Studies have revealed that eyeworm and caecal worm pre-
valence can vary seasonally and spatially in the Rolling Plains. For
example, Dunham et al. (2016b) reports that bobwhite trapped between
August and October of 20112013 had an eyeworm prevalence of 41%
while Bruno (2014) found a 66% prevalence in bobwhite collected
during the 2012 to 2013 hunting season (NovemberFebruary). Yet,
Henry et al. (2017) reported 100% prevalence of eyeworms in bobwhite
captured in March 2017 from Mitchell County, Texas. In contrast,
caecal worm prevalence has remained at 90%100% in the Rolling
Plains over the past several years, though intensity can vary by in-
dividual bobwhite (Dunham et al., 2017b;Brym et al., 2018;Bruno
et al., 2018). These dierences in prevalence could be explained by
variances in temperature and precipitation as environmental conditions
may vary from county to county in the Rolling Plains (Modala et al.,
2017), potentially impacting intensities of both parasites.
Further studies are also necessary as the current results cannot
conclude whether temperature or precipitation have an inuence on
eyeworm intensity. Additionally, the low predicted probability in
caecal worm reproduction with climate (Fig. 1b) and eyeworm re-
production 60 days prior to bobwhite collection dates (Fig. 2) introduce
uncertainty in these predictions. Furthermore, marginal signicance
was observed in a few analyses. However, a larger data set with samples
collected from multiple locations in the Rolling Plains would help ac-
count for these variable factors and increase the accuracy of these
predictions, thus decreasing uncertainty while also reducing time and
resources required for laboratory and eld testing of infection. For
example, month-by-month variations of parasite egg presence have
been presented for other parasites (Wood et al., 2013), indicating that a
more robust dataset may further the understanding of climatic variables
on eyeworm and caecal worm reproduction. Similarly, while there have
been a few studies expanding on mean parasite abundance and bob-
white demographics (Dunham et al., 2014;Dunham et al., 2017b), a
larger dataset may allow future analyses to include parasite reproduc-
tion in relation to demographic trends. Nevertheless, because of lim-
itations in the current data, it is suggested that consistent testing should
continue to better analyze eyeworm and caecal worm dynamics in
bobwhite hosts.
In conclusion, this was the rst predictive study on the eyeworm
and caecal worm infecting bobwhite of the Rolling Plains Ecoregion.
Results suggest climate inuences caecal worm intensity, caecal worm
reproduction, and eyeworm reproduction which provides preliminary
insight to possible infection dynamics based on temperature and pre-
cipitation. Furthermore, an estimated time range and temperature
range were generated based on eyeworm reproduction to suggest
timing in which anthelmintic treatment will be most eective to miti-
gate the eyeworm. However, the current dataset could not provide
conclusive evidence on all aspects of infection dynamics that were
targeted in this study. For optimization of future predictive analyses,
larger sample sizes and continuous, thorough monitoring should be
used in the future to determine more conclusive eects climate has on
these parasites.
Acknowledgements
We thank Rolling Plains Quail Research Foundation (23A470), Park
Cities Quail (23A540), and Texas Tech University for their nancial
support of our research. We also thank you our study ranch for pro-
viding resources for our data collection and members of the Wildlife
Toxicology Laboratory for their eld and laboratory assistance.
References
Addison, E.M., Anderson, R.C., 1969. A review of eyeworms of the genus Oxyspirura
(Nematoda: Spirurodidea). J. Wildl. Dis. 55, 158.
Almas, S., Gibson, A.G., Presley, S.M., 2018. Molecular detection of Oxyspirura larva in
arthropod intermediate hosts. Parasitol. Res. 117, 819823.
Altizer, S., Dobson, A., Hosseini, P., Hudson, P., Pascual, M., Rohani, P., 2006. Seasonality
and the dynamics of infectious diseases. Ecol. Lett. 9, 467484.
Armour, J., Bruce, R.G., 1974. Inhibited development in Ostertagia ostertagi infections a
diapause phenomenon in a nematode. Parasitology 69, 161174.
K.R. Blanchard et al. IJP: Parasites and Wildlife 8 (2019) 50–55
54
Barua, P., Barua, N., Hazarika, N.K., Das, S., 2005. Loa loa in the anterior chamber of the
eye: a case report. Indian J. Med. Microbiol. 23, 59.
Blitz, N.M., Gibbs, H.C., 1972. Studies on the arrested development of Haemonchus con-
tortus in sheep - II. termination of arrested development and the spring rise phe-
nomenon. Int. J. Parasitol. 2, 1322.
Brooks, D.R., Hoberg, E.P., 2007. How will global climate change aect parasite-host
assemblages? Trends Parasitol. 23, 571574.
Bruno, A., 2014. Survey for Trichomonas gallinae and Assessment of Helminth Parasites in
Northern Bobwhites from the Rolling Plains Ecoregion. Thesis. Texas A&M
University-Kingsville, USA.
Bruno, A., Fedynich, A.M., Smith-Herron, A., Rollins, D., 2015. Pathological response of
northern bobwhites to Oxyspirura petrowi infections. J. Parasitol. 101, 364368.
Bruno, A., Fedynich, A.M., Rollins, D., Wester, D.B., 2018. Helminth communities and
host dynamics in northern bobwhites from the Rolling Plains Ecoregion, USA. J.
Helminthol. 17. https://doi.org/10.1017/S0022149X18000494.
Brym, M.Z., Henry, C., Kendall, R.J., 2018. Potential parasite induced host mortality in
northern bobwhite (Colinus virginianus) from the Rolling Plains ecoregion of West
Texas. Archives of Parasitology 2, 1.
Cattadori, I.M., Haydon, D.T., Hudson, P.J., 2005. Parasites and climate synchronize red
grouse populations. Nature 433, 737741.
Chandler, A.C., 1935. A new genus and species of Subulurinae (Nematodes). Trans. Am.
Microsc. Soc. 54, 3335.
Clench, M.H., Mathias, J.R., 1995. The avian cecum: a review. Wilson Bull. 1, 93121.
Coumou, D., Rahmstorf, S., 2012. A decade of weather extremes. Nat. Clim. Change 2,
491496.
Dobson, A.P., Carper, R.J., 1992. Global warming and potential changes in host-parasite
and disease vector relationships. In: Peters, R., Lovejoy, T. (Eds.), Global Warming
and Biodiversity. Yale University Press, New Haven, Connecticut, pp. 201217.
Dunham, N.R., Kendall, R.J., 2017. Eyeworm infections of Oxyspirura petrowi, Skrjabin,
1929 (Spirurida: Thelaziidae), in species of quail from Texas, New Mexico and
Arizona, USA. J. Helminthol. 91, 491496.
Dunham, N.R., Soliz, L.A., Fedynich, A.M., Rollins, D., Kendall, R.J., 2014. Evidence of an
Oxyspirura petrowi epizootic in Northern bobwhites (Colinus virginianus), Texas, USA.
J. Wildl. Dis. 50, 552558.
Dunham, N.R., Reed, S., Rollins, D., Kendall, R.J., 2016a. Oxyspirura petrowi infection
leads to pathological consequences in Northern bobwhite (Colinus virginianus). Int. J.
Parasitol. Parasites Wildl. 5, 273276.
Dunham, N.R., Bruno, A., Almas, S., Rollins, D., Fedynich, A.M., Presley, S.M., Kendall,
R.J., 2016b. Eyeworms (Oxyspirura petrowi) in northern bobwhites (Colinus virgi-
nianus) from the rolling plains ecoregion of Texas and Oklahoma, 2011-13. J. Wildl.
Dis. 52, 562567.
Dunham, N.R., Henry, C., Brym, M., Rollins, D., Helman, G.R., Kendall, R.J., 2017a.
Caecal worm, Aulonocephalus pennula, infection in the northern bobwhite quail,
Colinus virginianus. Int. J. Parasitol. Parasites Wildl. 6, 3538.
Dunham, N.R., Peper, S.T., Downing, C., Brake, E., Rollins, D., Kendall, R.J., 2017b.
Infection levels of eyeworm Oxyspirura petrowi and caecal worm Aulonocephalus
pennula in the northern bobwhite and scaled quail from the Rolling Plains of Texas. J.
Helminthol. 91, 569577.
Fernando, M.A., Stockdale, P.H.G., Ashton, G.C., 1971. Factors contributing to the re-
tardation of development of Obeliscoides cuniculi in rabbits. Parasitology 63, 2129.
Gaasenbeek, C.P.H., Borgsteede, F.H.M., 1998. Studies on the survival of Ascaris suum
eggs under laboratory and simulated eld conditions. Vet. Parasitol. 75, 227234.
Gibbs, H.C., 1986. Hypobiosis and the periparturient rise in sheep. Vet. Clin. North Am.
Food Anim. Pract. 2, 345353.
Guo, K.U.N., Hao, S.G., Sun, O.J., Kang, L.E., 2009. Dierential responses to warming and
increased precipitation among three contrasting grasshopper species. Global Change
Biol. 15, 25392548.
Henry, C., Brym, M.Z., Kendall, R.J., 2017. Oxyspirura petrowi and Aulonocephalus pennula
infection in wild northern bobwhite quail in the Rolling Plains ecoregion, Texas:
possible evidence of a die-o. Archives of Parasitology 1, 2.
Henry, C., Brym, M.Z., Kalyanasundaram, A., Kendall, R.J., 2018. Molecular identica-
tion of potential intermediate hosts of Aulonocephalus pennula from the Order
Orthoptera. J. Helminthol. 13, 16.
Hernández, F., Kelley, K.M., Arredondo, J.A., Hernández, F., Hewitt, D.G., Bryant, F.C.,
Bingham, R.L., 2007. Population irruption of northern bobwhite: testing an age-
specic reproduction hypothesis. J. Wildl. Manag. 71, 895901.
Hernández, F., Brennan, L.A., DeMaso, S.J., Sands, J.P., Wester, D.B., 2013. On reversing
the northern bobwhite decline: 20 years later. Wildl. Soc. Bull. 37, 177188.
Holly, F.J., Lemp, M.A., 1977. Tear physiology and dry eyes. Surv. Ophthalmol. 22,
6987.
Hudson, P.J., Dobson, A.P., Newborn, D., 1998. Prevention of population cycles by
parasite removal. Science 282, 22562258.
Hudson, P.J., Cattadori, I.M., Boag, B., Dobson, A.P., 2006. Climate disruption and
parasite-host dynamics: patterns and processes associated with warming and the
frequency of extreme climatic events. J. Helminthol. 80, 175182.
Inglis, W.G., 1958. The comparative anatomy of the Subulurid head (Nematoda): with a
consideration of its systematic importance. J. Zool. 130, 577604.
Janzen, D.H., Schoener, T.W., 1968. Dierences in insect abundance and diversity be-
tween wetter and drier sites during a tropical dry season. Ecology 49, 96110.
Kalyanasundaram, A., Blanchard, K.R., Kendall, R.J., 2017. Molecular identication and
characterization of partial COX1 gene from caecal worm (Aulonocephalus pennula) in
Northern bobwhite (Colinus virginianus) from the Rolling Plains ecoregion of Texas.
Int. J. Parasitol. Parasites Wildl. 6, 195201.
Kalyanasundaram, A., Blanchard, K.R., Henry, C., Brym, M.Z., Kendall, R.J., 2018a.
Phylogenetic analysis of eyeworm (Oxyspirura petrowi) in Northern Bobwhite quail
(Colinus virginianus) based on the nuclear 18S rDNA and mitochondrial cytochrome
oxidase 1 gene (COX1). Parasitology Open 4, 17.
Kalyanasundaram, A., Blanchard, K.R., Henry, C., Brym, M.Z., Kendall, R.J., 2018b.
Development of a multiplex quantitative PCR assay for eyeworm (Oxyspirura petrowi)
and caecal worm (Aulonocephalus pennula) detection in Northern Bobwhite quail
(Colinus virginianus) of the Rolling Plains Eco-Region. Texas. Vet. Parasitol. 253,
6570.
Kistler, W.M., Parlos, J.A., Peper, S.T., Dunham, N.R., Kendall, R.J., 2016a. A quantitative
PCR protocol for detection of Oxyspirura petrowi in northern bobwhites (Colinus
virginianus). PLoS One 11 e0166309.
Kistler, W.M., Hock, S., Hernout, B., Brake, E., Williams, N., Downing, C., Dunham, N.R.,
Kumar, N., Turaga, U., Parlos, J., Kendall, R.J., 2016b. Plains lubber grasshopper
(Brachystola magna) as an intermediate host for Oxyspirura petrowi in northern bob-
whites (Colinus virginianus). Parasitology 2, 18.
Laerty, K.D., 2009. The ecology of climate change and infectious diseases. Ecology 90,
888900.
Lehmann, V.W., 1984. The Bobwhite in the Rio Grande Plain of Texas. Texas A&M
University Press, College Station, USA.
Lima, W.S., 1998. Seasonal infection pattern of gastrointestinal nematodes of beef cattle
in Minas Gerais State - Brazil. Vet. Parasitol. 74, 203214.
Lusk, J.J., Guthery, F.S., Peterson, M.J., Demaso, S.J., 2007. Evidence of regionally
synchronized cycles in Texas quail population dynamics. J. Wildl. Manag. 71,
837843.
Michel, J.F., Lancaster, M.B., Hong, C., 1974. Studies on arrested development of
Ostertagia ostertagi and Cooperia oncophora. J. Comp. Pathol. 84, 539554.
Michel, J.F., Lancaster, M.B., Hong, C., 1975. Arrested development of Ostertagia os-
tertagi and Cooperia oncophora:eect of temperature at the free-living third stage. J.
Comp. Pathol. 85, 133138.
Michel, J.F., Lancaster, M.B., Hong, C., 1976. The resumed development of arrested
Ostertagia ostertagi in experimentally infected calves. J. Comp. Pathol. 86, 615619.
Michel, J.F., Lancaster, M.B., Hong, C., 1978. Arrested development of Ostertagia ostertagi
and Cooperia oncophora:eect of the time of year on the conditioning and decondi-
tioning of infective larvae. J. Comp. Pathol. 88, 131136.
Modala, N.R., Ale, S., Goldberg, D.W., Olivares, M., Munster, C.L., Rajan, N., Feagin, R.A.,
2017. Climate change projections for the Texas high plains and rolling plains. Theor.
Appl. Chem. 129, 263280.
National Oceanic and Atmospheric Administration, 2018. Daily summaries, Sterling City,
TX, US. Available from: www.ncdc.noaa.gov (accessed June 2018).
Nayak, B., Sinha, S., Nayak, L., 2016. Loa loa in the vitreous cavity of the eye. BMJ Case
Rep. https://doi.org/10.1136/bcr-2015-213879.
Payne, A.P., 1994. The Harderian gland: a tercentennial review. J. Anat. 185, 149.
Pritchard, R.K., Donald, A.D., Dash, K.M., Hennessey, D.R., 1978. Factors involved in the
relative anthelmintic tolerance of arrested fourth-stage larvae of Ostertagia ostertagi.
Vet. Rec. 102, 382.
Proudman, C., Matthews, J., 2000. Control of intestinal parasites in horses. In Pract. 22,
9097.
Redpath, S.M., Mougeout, F., Leckie, F.M., Elston, D.A., Hudson, P.J., 2006. Testing the
role of parasites in driving the cyclic population dynamics of a gamebird. Ecol. Lett.
9, 410418.
Robel, R.J., Walker Jr., T.L., Hagen, C.A., Ridley, R.K., Kemp, K.E., Applegate, R.D., 2003.
Helminth parasites of lesser prairie-chicken Tympanuchus pallidicinctus in south-
western Kansas: incidence, burdens and eects. Wildl. Biol. 9, 341349.
Rogers, W.P., Sommerville, R.I., 1963. The infective stage of nematode parasites and its
signicance in parasitism. Adv. Parasitol. 1, 109177.
Rollins, D., 2007. Quails on the rolling plains. In: Brennan, L. (Ed.), Texas Quails: Ecology
and Management. Texas A&M University Press, College Station, USA, pp. 117141.
Sauer, J.R., Hines, J.E., Fallon, J.E., Pardieck, K.L., Ziolkowski Jr., D.J., Link, W.A., 2013.
The North American Breeding Bird Survey, Results, and Analysis 19662013. USGS
Patuxent Wildlife Research Center, Laurel, MD, USA.
Saunders, G.B., 1935. Michigan's studies of sharp-tailed grouse. Trans. Am. Game Con. 21,
342344.
Schad, G.A., 1977. The role of arrested development in the regulation of nematode po-
pulations. In: Esch, G.W. (Ed.), Regulation of Parasite Populations. Academic Press,
New York, USA, pp. 111200.
Sissay, M.M., Uggla, A., Walker, P.J., 2007. Prevalence and seasonal incidence of ne-
matode parasites and uke infections of sheep and goats in eastern Ethiopia. Trop.
Anim. Health Prod. 39, 521531.
Sommerville, R.I., Davey, K.G., 2002. Diapause in parasitic nematodes: a review. Can. J.
Zool. 80, 18171840.
Texas A&M AgriLife Extension, 2018. Extension Education in Mitchell, County. Available
from: http://mitchell.agrilife.org/ (accessed August 2018).
Wood, E.L.D., Matthews, J.B., Stephenson, S., Slote, M., Nussey, D.H., 2013. Variation in
fecal egg counts in horses managed for conservation purposes: individual egg shed-
ding consistency, age eects and seasonal variation. Parasitology 140, 115128.
K.R. Blanchard et al. IJP: Parasites and Wildlife 8 (2019) 50–55
55
... Due to the important functions of the avian caecum, such as nutrient and water absorption, antibody production, and cellular digestion (Clench and Mathias, 1995), disruption to its function may indeed exacerbate periods of stress for bobwhite, such as drought and food scarcity. In addition to being coincident with periods of low precipitation, caecal worm infections are also known to peak in winter (Lehmann, 1953;Rollins, 1980;Blanchard et al., 2019), and both of these periods typically result in high mortality for bobwhite (Hernández et al., 2005;Hernández and Peterson, 2007). Furthermore, the effects of A. pennula may not only be limited to survivability, but these worms could also impede the breeding potential of bobwhite by reducing the availability of vitamin A, a key nutrient for reproduction and survival (Nestler, 1946), as well as diverting resources from reproduction. ...
... Molecular techniques may also be useful in understanding the transmission dynamics of parasites, which are often influenced by climate (Harvell et al., 2002;Benton et al., 2015). For example, Blanchard et al. (2019) used qPCR and climatic variables to determine that temperature and precipitation could influence eyeworm and caecal worm egg shedding in bobwhite. ...
Article
Full-text available
The potential of parasites to affect host abundance has been a topic of heated contention within the scientific community for some time, with many maintaining that issues such as habitat loss are more important in regulating wildlife populations than diseases. This is in part due to the difficulty in detecting and quantifying the consequences of disease, such as parasitic infection, within wild systems. An example of this is found in the Northern bobwhite quail (Colinus virginanus), an iconic game bird that is one of the most extensively studied vertebrates on the planet. Yet, despite countless volumes dedicated to the study and management of this bird, bobwhite continue to disappear from fields, forest margins, and grasslands across the United States in what some have referred to as “our greatest wildlife tragedy”. Here, we will discuss the history of disease and wildlife conservation, some of the challenges wildlife disease studies face in the ever-changing world, and how a “weight of evidence” approach has been invaluable to evaluating the impact of parasites on bobwhite in the Rolling Plains of Texas. Through this, we highlight the potential of using “weight of the evidence” to better understand the complex effects of diseases on wildlife and urge a greater consideration of the importance of disease in wildlife conservation.
... Two helminths, eyeworm Oxyspirura petrowi and caecal worm Aulonocephalus pennula, have been demonstrated to have high prevalence of 66% and 91%, respectively, in wild bobwhite in the Rolling Plains ecoregion of Texas [12]. A number of studies have been published in relation to prevalence and diagnostic techniques of these parasitic infections in wild bobwhite [13][14][15][16][17]. However, the available knowledge on host parasite interaction in this species is limited due to very few studies having utilized histological or proteomic approaches to assess the host response to these parasites [12,18]. ...
Article
Full-text available
Many recent studies have been focused on prevalence and impact of two helminth parasites, eyeworm Oxyspirura petrowi and caecal worm Aulonocephalus pennula, in the northern bobwhite quail (Colinus virginianus). However, few studies have attempted to examine the effect of these parasites on the bobwhite immune system. This is likely due to the lack of proper reference genes for relative gene expression studies. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme that is often utilized as a reference gene, and in this preliminary study, we evaluated the similarity of bobwhite GAPDH to GAPDH in other avian species to evaluate its potential as a reference gene in bobwhite. GAPDH was identified in the bobwhite full genome sequence and multiple sets of PCR primers were designed to generate overlapping PCR products. These products were then sequenced and then aligned to generate the sequence for the full-length open reading frame (ORF) of bobwhite GAPDH. Utilizing this sequence, phylogenetic analyses and comparative analysis of the exon–intron pattern were conducted that revealed high similarity of GAPDH encoding sequences among bobwhite and other Galliformes. Additionally, This ORF sequence was also used to predict the encoded protein and its three-dimensional structure which like the phylogenetic analyses reveal that bobwhite GAPDH is similar to GAPDH in other Galliformes. Finally, GAPDH qPCR primers were designed, standardized, and tested with bobwhite both uninfected and infected with O. petrowi, and this preliminary test showed no statistical difference in expression of GAPDH between the two groups. These analyses are the first to investigate GAPDH in bobwhite. These efforts in phylogeny, sequence analysis, and protein structure suggest that there is > 97% conservation of GADPH among Galliformes. Furthermore, the results of these in silico tests and the preliminary qPCR indicate that GAPDH is a prospective candidate for use in gene expression analyses in bobwhite.
Article
Full-text available
Aulonocephalus pennula is a heteroxenous nematode that commonly infects a declining game bird, the northern bobwhite quail ( Colinus virginianus ). There is a lack of information on the life cycle of A. pennula and the potential effects of infection on bobwhites. In order to better understand the life cycle of this parasite, various species from the order Orthoptera were collected from a field site in Mitchell County, Texas. Using polymerase chain reaction (PCR), nine potential intermediate hosts were identified from the 35 orthopteran species collected. Later, ten live specimens were collected to identify larvae within the potential intermediate hosts. Larvae were present in three of these and were sent for sequencing. Similarly, the presence of larvae was confirmed from extra tissues of samples identified as positive with PCR. This was the first study to document potential intermediate hosts, but future studies are needed to confirm that these species are capable of transmitting infection to bobwhite. However, this study demonstrates that PCR has increased sensitivity and may be a valuable tool when determining intermediate hosts.
Article
Full-text available
Oxyspirura petrowi is a heteroxenous nematode found in northern bobwhite ( Colinus virginianus ) of the Rolling Plains ecoregion of Texas. Despite its impact on this popular gamebird, genetic level studies on O. petrowi remain relatively unexplored. To accomplish this, we chose the previously studied nuclear rDNA 18S region as well as the mitochondrial COX1 gene region of O. petrowi to investigate phylogenetic relations between O. petrowi and other nematode species. In this study, we generate primers using multiple alignment and universal nematode primers to obtain a near-complete 18S and partial COX1 sequence of O. petrowi , respectively. Phylogenetic trees for O. petrowi ’s 18S and COX1 gene regions were constructed using the Maximum Likelihood and Maximum Parsimony method. A comparative analysis was done based on the nuclear and mitochondrial region similarities between O. petrowi and other nematode species that infect both humans and animals. Results revealed a close relation to the zoonotic eyeworm Thelazia callipaeda as well as a close relation with filarial super family (Filarioidea) such as the human eyeworm Loa loa and Dirofilaria repens eyeworm of dog and carnivores.
Article
Full-text available
To determine potential intermediate hosts of Oxyspirura petrowi, a common nematode eyeworm of wild gallinaceous birds, various arthropod species including red harvester ants, beetles, wood cockroaches, crickets, grasshoppers, katydids, and desert termites were screened for the presence of O. petrowi using specific polymerase chain reaction (PCR) primers targeting the internal transcribed spacer 2 region (ITS2) of the eyeworm ribosomal deoxyribonucleic acid (rDNA). This is the first study to investigate the intermediate hosts of O. petrowi utilizing molecular techniques. We determined 38% (13/34) of the cockroaches, 27% (3/11) of the crickets, and 23% (68/289) of the grasshoppers which were positive for O. petrowi. Identifying potential intermediate hosts of O. petrowi is essential to better understanding the epizoology of the eyeworm's transmission mechanics and to controlling infections in wild gallinaceous birds.
Article
Full-text available
Anecdotal reports of Northern bobwhite quail (Colinus virginianus) exhibiting strange behavior have raised suspicions of parasite induced host mortality (PIHM) in the Rolling Plains of West Texas. In 2017, we received 11 bobwhite carcasses associated with such reports and found parasites in all of these specimens. While further research is needed to evaluate the impact of parasites on bobwhite, these reports provide a valuable supplement to on-going investigations of PIHM in bobwhite from the Rolling Plains of West Texas.
Article
Full-text available
We have been monitoring wild Northern bobwhite quail (Colinus virginianus) on a research transect in Mitchell County, Texas. We captured a total of 51 bobwhites in March-May of 2016 and 2017 and examined them for eyeworm (Oxyspirura petrowi) and caecal worm (Aulonocephalus pennula) infections. In March 2017, bobwhites averaged 15 ± 10 eyeworms and 269 ± 90 caecal worms, and by mid-April averages had increased to 18 ± 13 eyeworms and 372 ± 144 caecal worms. These averages were much higher than those observed in March 2016 (11 ± 13 eyeworms and 160 ± 57 caecal worms) and April 2016 (12 ± 12 and 216 ± 56, respectively). We observed a precipitous decline in quail numbers by late April 2017, and average infection had dropped to 7 ± 2 eyeworms and 252 ± 109 caecal worms. The number of trapping sessions needed to capture one bobwhite also increased from 14.26 in 2016 to 36.46 in 2017. These observations warrant further investigation into the effects these helminth parasites may have on bobwhites and their populations within the Rolling Plains.
Article
Full-text available
Aulonocephalus pennula is a nematode living in the caeca of the wild Northern bobwhite quail (Colinus virginianus) present throughout the Rolling Plains Ecoregion of Texas. The cytochrome oxidase 1 (COX 1) gene of the mitochondrial genome was used to screen A. pennula in wild quail. Through BLAST analysis, similarity of A. pennula to other nematode parasites was compared at the nucleotide level. Phylogenetic analysis of A. pennula COX1 indicated relationships to Subuluridae, Ascarididae, and Anisakidae. This study on molecular characterization of A. pennula provides new insight for the diagnosis of caecal worm infections of quail in the Rolling plains Ecoregion of Texas.
Article
Full-text available
Parasitic nematodes that infect quail have been understudied and long been dismissed as a problem in quail management. Within the Rolling Plains ecoregion of Texas, an area that has experienced quail population “boom and bust” cycles and ultimately a general decline, the need to determine why Northern bobwhite (Colinus virginianus) populations are diminishing has increased in priority. Previously, caecal parasites have been documented to cause inactivity, weight loss, reduced growth, inflammation to the caecal mucosa, and even death. The caecal worm Aulonocephalus pennula is an intestinal nematode parasite that is commonly found within the caecum of quail, as well as many other avian species. In the Rolling Plains ecoregion, A. pennula has been documented to have as high as a 98% prevalence in bobwhite quail samples; however, the effect it has on its host is not well understood. The present study documents A. pennula causes no pathological changes within the caeca of the Northern bobwhite. However, there is concern for disruption of digestion and the possible implications of infection for wild bobwhite quail survival are discussed.
Article
Full-text available
Oxyspirura petrowi is a parasitic nematode that infects wild birds. This parasite has a broad host range, but has recently been reported in high prevalences from native Galliformes species in the United States. In order to better understand the impact O. petrowi has on wild bird populations, we developed a quantitative PCR protocol to detect infections in wild northern bobwhites (Colinus virginianus). We used paired fecal and cloacal swab samples from wild caught and experimentally infected northern bobwhites and matching fecal float data from experimentally infected birds to validate our assay. Overall we detected more positive birds from fecal samples than the paired cloacal swabs and there was strong agreement between the qPCR results from fecal samples and from fecal flotation (84%; κ = 0.69 [0.53–0.84 95% CI]). We also detected O. petrowi DNA in ten replicates of samples spiked with one O. petrowi egg. This qPCR assay is an effective assay to detect O. petrowi infections in wild birds. Our results suggest that fecal samples are the most appropriate sample for detecting infections; although, cloacal swabs can be useful for determining if O. petrowi is circulating in a population.
Article
One hundred and sixty-one northern bobwhites ( Colinus virginianus ; hereafter ‘bobwhite’) were examined from the Rolling Plains ecoregion of Texas and western Oklahoma from 2011 to 2013. Complete necropsies yielded 13 species, of which two are new host ( Gongylonema phasianella ) and region ( Eucoleus contortus ) records and three ( Dispharynx nasuta , Tetrameres pattersoni and Oxyspirura petrowi ) are known to cause morbidity and mortality. Of the species found, Aulonocephalus pennula commonly occurred, Oxyspirura petrowi was intermediate in prevalence, and the remaining species were rare. Species richness was similar compared to studies from the southeastern U.S., but higher than studies from the same region. In addition, 12 of the 13 species were heteroxenous helminths, supporting the theory that heteroxenous helminths in semi-arid regions are more successful than monoxenous helminths. Prevalence and abundance of A. pennula and O. petrowi were higher in adult bobwhites than in juveniles. Abundance of A. pennula and O. petrowi was higher at southern locations compared to northern locations in the study area. Our study is the first to provide a current assessment of the bobwhite helminth community across the Rolling Plains ecoregion of the U.S.