No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Biological Control of Pierce’s Disease of Grape by an Endophytic Bacterium
Abstract
Effective preventive measures and therapies are lacking for control of Pierce's disease of grape caused by the xylem-colonizing bacterium Xylella fastidiosa responsible for serious losses in grape production. In this study we explored the potential for endophytic bacteria to alter the disease process. While most endophytic bacteria found within grape did not grow or multiply when inoculated into mature grape vines, Paraburkholderia phytofirmans strain PsJN achieved population sizes as large as 106 cells/g and moved 1 m or more within 4 weeks after inoculation into vines. While X. fastidiosa achieved large population sizes and moved extensively in grape when inoculated alone, few viable cells were recovered from plants in which it was co-inoculated with strain PsJN and the incidence of leaves exhibiting scorching symptoms typical of Pierce's disease was consistently greatly reduced from that in control plants. Suppression of disease symptoms occurred not only when strain PsJN was co-inoculated with the pathogen by puncturing stems in the same site in plants, but also when inoculated at the same time but at different sites in the plant. Large population sizes of strain PsJN could be established in both leaf lamina and petioles by topical application of cell suspensions in 0.2% of an organo-silicon surfactant conferring low surface tension, and such treatments were as effective as direct puncture inoculations of this biocontrol strain in reducing disease severity. While inoculation of strain PsJN into plants by either method at the same time as or even 4 weeks after that of the pathogen resulted in large reductions in disease severity, much less disease control was conferred by inoculation of PsJN 4 weeks prior to that of the pathogen. The expression of grapevine PR1 and ETR1 within 3 weeks of inoculation was substantially higher in plants inoculated with both X. fastidiosa and strain PsJN compared with that in plants inoculated only with the pathogen or strain PsJN, suggesting that this biological control agent reduces disease by priming expression of innate disease resistance pathways in plants that otherwise would have exhibited minimal responses to the pathogen. Strain PsJN thus appears highly efficacious for the control of Pierce's disease when used as an eradicant treatment that can be easily made even by spray application.
... Co-inoculation with X. fastidiosa results in a significant reduction of the phytopathogen population and disease symptoms as previously reported for other pathogens [32]. This effect involves priming innate disease resistance pathways in grapevines leading to reduced symptoms when infected with X. fastidiosa [33]. Recently, in a subsequent study, P. phytofirmans PsJN, when topically applied with a surfactant, effectively controlled Pierce's Disease (PD) in grapevines, demonstrating systemic protection against Xylella fastidiosa infection, although the extent of protection was spatially limited, with potential implications for this endophyte use as a biological control agent [34]. ...
... In a prior study, Baccari and colleagues [33] demonstrated that direct contact between X. fastidiosa and P. phytofirmans was not necessary for reducing X. fastidiosa titer loads in xylem vessels. Here we explore the indirect interaction between X. fastidiosa and P. phytofirmans, including the QS-insensitive mutant ΔrpfF. ...
... In prior studies, it was demonstrated that the co-inoculation of P. phytofirmans along with X. fastidiosa leads to a reduction in the symptoms of leaf scorching induced by X. fastidiosa in grapevines. This ameliorative effect was attributed to the activation of plant defense genes, specifically involving pathways related to salicylic acid and ethylene [33]. It was further reported that the topical application of P. phytofirmans with a surfactant, was efficient and sufficient for PD control in grapevines, even though the protection was spatially limited [34]. ...
Microbial competition within plant tissues affects invading pathogens' fitness. Metabolomics is a great tool for studying their biochemical interactions by identifying accumulated metabolites. Xylella fastidiosa, a Gram-negative bacterium causing Pierce's disease (PD) in grapevines, secretes various virulence factors including cell wall degrading enzymes, adhesion proteins, and quorum sensing molecules. These factors, along with outer membrane vesicles, contribute to its pathogenicity. Previous studies demonstrated that co-inoculating X. fastidiosa with Paraburkholderia phytofirmans strain PsJN suppressed PD symptoms. Here, we further investigated the interaction between the phytopathogen and the endophyte by analyzing the exometabolome of wild-type X. fastidiosa and a diffusible signaling factor (DSF) mutant lacking quorum sensing, cultivated with 20% P. phytofirmans spent media. LC-MS and MAGI were used to detect and map metabolites to genomes revealing a total of 121 metabolites, of which 25 were further investigated. These metabolites potentially relate to host adaptation, virulence, and pathogenicity. Notably, this study presents the first comprehensive profile of X. fastidiosa in the presence of P. phytofirmans spent media. The results highlight that P. phytofirmans and the absence of a functional quorum sensing affect the ratios of glutamine to glutamate (Gln:Glu) in X. fastidiosa. Additionally, two compounds with plant metabolism and growth properties, 2-Aminoisobutyric acid and Gibberellic Acid, were downregulated when X. fastidiosa interacted with P. phytofirmans. These findings suggest that P. phytofirmans-mediated disease suppression involves modulation of the exometabolome of X. fastidiosa, impacting plant immunity.
... Co-inoculation with X. fastidiosa results in a significant reduction in the phytopathogenic population and disease symptoms as previously reported for other pathogens [32]. This effect involves priming innate disease resistance pathways in grapevines, leading to reduced symptoms when infected with X. fastidiosa [33]. Recently, in a subsequent study, P. phytofirmans PsJN, when topically applied with a surfactant, effectively controlled Pierce's disease (PD) in grapevines, demonstrating systemic protection against Xylella fastidiosa infection, although the extent of the protection was spatially limited, with potential implications for this endophyte's use as a biological control agent [34]. ...
... In a prior study, Baccari and colleagues [33] demonstrated that direct contact between X. fastidiosa and P. phytofirmans was not necessary for reducing X. fastidiosa titer loads in xylem vessels. Here, we explore the indirect interaction between X. fastidiosa and P. phytofirmans, including the QS-insensitive mutant ∆rpfF. ...
... In a prior study, Baccari and colleagues [33] demonstrated that direct contact between X. fastidiosa and P. phytofirmans was not necessary for reducing X. fastidiosa titer loads in xylem vessels. Here, we explore the indirect interaction between X. fastidiosa and P. phytofirmans, including the QS-insensitive mutant ΔrpfF. ...
Microbial competition within plant tissues affects invading pathogens’ fitness. Metabolomics is a great tool for studying their biochemical interactions by identifying accumulated metabolites. Xylella fastidiosa, a Gram-negative bacterium causing Pierce’s disease (PD) in grapevines, secretes various virulence factors including cell wall-degrading enzymes, adhesion proteins, and quorum-sensing molecules. These factors, along with outer membrane vesicles, contribute to its pathogenicity. Previous studies demonstrated that co-inoculating X. fastidiosa with the Paraburkholderia phytofirmans strain PsJN suppressed PD symptoms. Here, we further investigated the interaction between the phytopathogen and the endophyte by analyzing the exometabolome of wild-type X. fastidiosa and a diffusible signaling factor (DSF) mutant lacking quorum sensing, cultivated with 20% P. phytofirmans spent media. Liquid chromatography–mass spectrometry (LC-MS) and the Method for Metabolite Annotation and Gene Integration (MAGI) were used to detect and map metabolites to genomes, revealing a total of 121 metabolites, of which 25 were further investigated. These metabolites potentially relate to host adaptation, virulence, and pathogenicity. Notably, this study presents the first comprehensive profile of X. fastidiosa in the presence of a P. phytofirmans spent media. The results highlight that P. phytofirmans and the absence of functional quorum sensing affect the ratios of glutamine to glutamate (Gln:Glu) in X. fastidiosa. Additionally, two compounds with plant metabolism and growth properties, 2-aminoisobutyric acid and gibberellic acid, were downregulated when X. fastidiosa interacted with P. phytofirmans. These findings suggest that P. phytofirmans-mediated disease suppression involves modulation of the exometabolome of X. fastidiosa, impacting plant immunity.
... Co-inoculation with X. fastidiosa results in a significant reduction of the phytopathogen population and disease symptoms as previously reported for other pathogens [32]. This effect involves priming innate disease resistance pathways in grapevines leading to reduced symptoms when infected with X. fastidiosa [33]. Recently, in a subsequent study, P. phytofirmans PsJN, when topically applied with a surfactant, effectively controlled Pierce's Disease (PD) in grapevines, demonstrating systemic protection against Xylella fastidiosa infection, although the extent of protection was spatially limited, with potential implications for this endophyte use as a biological control agent [34]. ...
... In a prior study, Baccari and colleagues [33] demonstrated that direct contact between X. fastidiosa and P. phytofirmans was not necessary for reducing X. fastidiosa titer loads in xylem vessels. ...
... In prior studies, it was demonstrated that the co-inoculation of P. phytofirmans along with X. fastidiosa leads to a reduction in the symptoms of leaf scorching induced by X. fastidiosa in grapevines. This ameliorative effect was attributed to the activation of plant defense genes, specifically involving pathways related to salicylic acid and ethylene [33]. It was further reported that the topical application of P. phytofirmans with a surfactant, was efficient and sufficient for PD control in grapevines, even though the protection was spatially limited [34]. ...
Microbial competition within plant tissues affects invading pathogens' fitness. Metabolomics is a great tool for studying their biochemical interactions by identifying accumulated metabolites. Xylella fastidiosa, a Gram-negative bacterium causing Pierce's disease (PD) in grapevines, secretes various virulence factors including cell wall degrading enzymes, adhesion proteins, and quorum sensing molecules. These factors, along with outer membrane vesicles, contribute to its pathogenicity. Previous studies demonstrated that co-inoculating X. fastidiosa with Paraburkholderia phytofirmans strain PsJN suppressed PD symptoms. Here, we further investigated the interaction between the phytopathogen and the endophyte by analyzing the exometabolome of wild-type X. fastidiosa and a diffusible signaling factor (DSF) mutant lacking quorum sensing, cultivated with 20% P. phytofirmans spent media. LC-MS and MAGI were used to detect and map metabolites to genomes revealing a total of 121 metabolites, of which 25 were further investigated. These metabolites potentially relate to host adaptation, virulence, and pathogenicity. Notably, this study presents the first comprehensive profile of X. fastidiosa in the presence of P. phytofirmans spent media. The results highlight that P. phytofirmans and the absence of a functional quorum sensing affect the ratios of glutamine to glutamate (Gln:Glu) in X. fastidiosa. Additionally, two compounds with plant metabolism and growth properties, 2-Aminoisobutyric acid and Gibberellic Acid, were downregulated when X. fastidiosa interacted with P. phytofirmans. These findings suggest that P. phytofirmans-mediated disease suppression involves modulation of the exometabolome of X. fastidiosa, impacting plant immunity.
... For example, in the flowering plant Catharanthus roseus, the endophyte Curtobacterium flaccumfaciens inhibited the growth of X. fastidiosa in vitro and reduced the symptoms caused by this bacterium to the plant host [14]. It can be challenging to identify beneficial plant-associated microbes with antagonistic activity against X. fastidiosa [15], but it is crucial to develop novel control methods against diseases caused by these bacteria [16]. In their work, Vergine et al. [11] identified some taxa found predominantly in the 'Leccino' cultivar which were proposed to be potentially involved in the resistance of cultivar to X. fastidiosa. ...
... Interestingly, BYDV virulence was reduced in endophyte-colonized plants, suggesting that host response modulation by endophytes could reduce pathogen virulence [23]. Similarly, the inoculation of the endophytic bacterium P. phytofirmans strain PsJN triggered the expression of the grapevine PR-1 gene and reduced plant colonization by X. fastidiosa, and also decreased the PD symptoms caused by the pathogen in grapevine [16]. PR-1 activation is indicative of the induction of salicylic acid (SA)-mediated host defenses [8,16]. ...
... Similarly, the inoculation of the endophytic bacterium P. phytofirmans strain PsJN triggered the expression of the grapevine PR-1 gene and reduced plant colonization by X. fastidiosa, and also decreased the PD symptoms caused by the pathogen in grapevine [16]. PR-1 activation is indicative of the induction of salicylic acid (SA)-mediated host defenses [8,16]. Interestingly, X. fastidiosa infection does not trigger SA-mediated defense pathways during early phases of infection, which is associated with higher virulence in plants [8]. ...
Xylella fastidiosa is a vector-borne plant vascular bacterial pathogen that causes several economically important diseases, including Pierce’s disease (PD) in grapevine and olive quick decline syndrome (OQDS) in olive trees, among others [...]
... Furthermore, antibiotics are banned in the EU as a treatment against bacterial plant diseases [13]. Several minerals and compounds in addition to microbial endophytes as biocontrol agents have been tested in America and Italy, showing some protection against Xf infections in grapevines [14], citrus [15], and olive trees [16]; however, their large-scale application is still economically expensive [13]. For this reason, efforts are also being made to find alternative control systems to those directed solely at the bacterium as an economically sustainable strategy over time. ...
... Three main subspecies with allopatric origins, pauca, fastidiosa and multiplex, are known from South, Central, and North America, respectively [8]. Within each subspecies, diverse genetic lineages with different host ranges have evolved [14]. Genetic recombination among subspecies seems to provide the main source of genetic variation, which may lead to host jumps [17,18]. ...
... In addition, germplasm banks of crop varieties have been intensively monitored and sampled during the past years. This information has been used to legislate the planting authorization of certain varieties through the Resolution of 14 In addition, the launch of New Generation funds is promoting a restructuring plan for rainfed fruit plantations in the Balearic Islands for the period 2021-2027. The objectives of the plan are the recovery of part of the lost area, the improvement of the efficiency in the production and transformation, and the increase in the commercialization of derived or elaborated products raising the agricultural income associated with the agriculture sector. ...
The emergence of Xylella fastidiosa (Xf) in the Balearic Islands in October 2016 was a major phytosanitary challenge with international implications. Immediately after its detection, eradication and containment measures included in Decision 2015/789 were implemented. Surveys intensified during 2017, which soon revealed that the pathogen was widely distributed on the islands and eradication measures were no longer feasible. In this review, we analyzed the control measures carried out by the Balearic Government in compliance with European legislation, as well as the implementation of its control action plan. At the same time, we contrasted them with the results of scientific research accumulated since 2017 on the epidemiological situation. The case of Xf in the Balearic Islands is paradigmatic since it concentrates on a small territory with one of the widest genetic diversities of Xf affecting crops and forest ecosystems. We also outline the difficulties of anticipating unexpected epidemiological situations in the legislation on harmful exotic organisms on which little biological information is available. Because Xf has become naturalized in the islands, coexistence alternatives based on scientific knowledge are proposed to reorient control strategies towards the main goal of minimizing damage to crops and the landscape.
... In grapevine, this strain has been proven to stimulate the growth of root and aerial parts after inoculation (Barka et al. 2000). In addition, this bacterium showed a protection efficacy against gray mold disease caused by Botrytis cinerea (Barka et al. 2000;Miotto-Vilanova et al. 2016 and Pierce's disease caused by Xylella fastidiosa (Baccari et al. 2019). In grapevine plantlets grown in vitro, PsJN can migrate from the root tips up to aerial parts within 7 days after being inoculated through roots (Compant et al. 2005;Miotto-Vilanova et al. 2019). ...
... PsJN was previously described as an antagonist of the fungal pathogen B. cinerea on grapevine by inhibiting spore germination (Barka et al. 2002;Miotto-Vilanova et al. 2016) and having an impact on the physiology of Drechslera teres on barley (Backes et al. 2020), probably thanks to its cell wall degrading enzymes. However, PsJN was reported to have no antibacterial action against Pseudomonas syringae (Su et al. 2017) and X. fastidiosa (Baccari et al. 2019). To the best of our knowledge, this is the first study to describe any antimicrobial effect of PsJN against a phytopathogenic bacterium, although its precise mechanism remains unknown. ...
... Previously, PsJN was reported as triggering induced resistance in Arabidopsis thaliana against P. syringae (Su et al. 2017;Timmermann et al. 2019), in grapevine against B. cinerea (Miotto-Vilanova et al. 2016) and X. fastidiosa (Baccari et al. 2019), and in tomato against Fusarium oxysporum (Frommel et al. 1991b). Therefore, we hypothesized that the impact of PsJN against AvS4 could be explained via the plant host. ...
Controlling crown gall in grapevine (Vitis viniferaL.) caused by the pathogenicbacteriumAllorhizobium vitisis a major challenge for global viticulture, as thispathogen is highly persistent in vineyards once infected. The bacteria can en-ter the plant through open wounds during pruning and then systemically colo-nize the plant. This study aimed at evaluating the potential ofParaburkholderiaphytofirmansPsJN, a beneficial endophytic bacterium able to colonize the xylemof grapevine, the same ecological niche asA. vitis, to control grapevine crown galldisease.P. phytofirmansPsJN was root-inoculated on grapevine plantlets beforeinfection byA. vitisS4 on shoots.A. vitisS4 level in planta, vitopine production, ac-cumulation of lignin in tumors, and symptoms of crown gall were investigated ongrapevine prebacterized or not with PsJN. The expression of 28 grapevine genesinvolved in defense mechanisms was also simultaneously determined by quanti-tative real-time PCR. Despite a direct antibacterial effect againstAvS4, PsJN hasno significant impact on the incidence of crown gall or disease severity. However,PsJN leads to a stronger accumulation of vitopine in tumors and significantlyreduced the population level of the pathogen in planta.
... In grapevine, this strain has been proven to stimulate the growth of root and aerial parts after inoculation (Barka et al. 2000). In addition, this bacterium showed a protection efficacy against gray mold disease caused by Botrytis cinerea (Barka et al. 2000;Miotto-Vilanova et al. 2016 and Pierce's disease caused by Xylella fastidiosa (Baccari et al. 2019). In grapevine plantlets grown in vitro, PsJN can migrate from the root tips up to aerial parts within 7 days after being inoculated through roots (Compant et al. 2005;Miotto-Vilanova et al. 2019). ...
... PsJN was previously described as an antagonist of the fungal pathogen B. cinerea on grapevine by inhibiting spore germination (Barka et al. 2002;Miotto-Vilanova et al. 2016) and having an impact on the physiology of Drechslera teres on barley (Backes et al. 2020), probably thanks to its cell wall degrading enzymes. However, PsJN was reported to have no antibacterial action against Pseudomonas syringae (Su et al. 2017) and X. fastidiosa (Baccari et al. 2019). To the best of our knowledge, this is the first study to describe any antimicrobial effect of PsJN against a phytopathogenic bacterium, although its precise mechanism remains unknown. ...
... Previously, PsJN was reported as triggering induced resistance in Arabidopsis thaliana against P. syringae (Su et al. 2017;Timmermann et al. 2019), in grapevine against B. cinerea (Miotto-Vilanova et al. 2016) and X. fastidiosa (Baccari et al. 2019), and in tomato against Fusarium oxysporum (Frommel et al. 1991b). Therefore, we hypothesized that the impact of PsJN against AvS4 could be explained via the plant host. ...
Controlling crown gall in grapevine ( Vitis vinifera L.) caused by the pathogenic bacterium Allorhizobium vitis is a major challenge for global viticulture, as this pathogen is highly persistent in vineyards once infected. The bacteria can enter the plant through open wounds during pruning and then systemically colonize the plant. This study aimed at evaluating the potential of Paraburkholderia phytofirmans PsJN, a beneficial endophytic bacterium able to colonize the xylem of grapevine, the same ecological niche as A. vitis, to control grapevine crown gall disease. P. phytofirmans PsJN was root-inoculated on grapevine plantlets before infection by A. vitis S4 on shoots. A. vitis S4 level in planta, vitopine production, accumulation of lignin in tumors, and symptoms of crown gall were investigated on grapevine prebacterized or not with PsJN. The expression of 28 grapevine genes involved in defense mechanisms was also simultaneously determined by quantitative real-time PCR. Despite a direct antibacterial effect against AvS4, PsJN has no significant impact on the incidence of crown gall or disease severity. However, PsJN leads to a stronger accumulation of vitopine in tumors and significantly reduced the population level of the pathogen in planta.
[Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .
... Other methods that are Communicated by Haitao Shi. under study rely on the reduction of the pathogen population in infected plants using the endophyte Paraburkholderia phytofirmans (Baccari et al. 2019;Lindow et al. 2023), avirulent X. fastidiosa strains (Hao et al. 2017), lytic phages, and chemical compounds such as copper (II) and citric acid fertilizers (Amanifar et al. 2016;Scortichini et al. 2018;Ge et al. 2020). Although considerable research has been performed, there is still no strategy to protect and completely cure infected plants (Burbank 2022). ...
... This protective effect of plant defense elicitors to fight diseases caused by X. fastidiosa has also been observed in grapevine, in which the application of lipopolysaccharides (LPS) of X. fastidiosa resulted in reduced Pierce's disease symptoms (Rapicavoli et al. 2018b). Our results also align with a study that demonstrated that the application of the endophytic bacteria Paraburkholderia phytofirmans PsJN caused a reduction of disease severity by priming expression of innate disease-resistant pathways in grapevine (Baccari et al. 2019). ...
Key message
New defense elicitor peptides have been identified which control Xylella fastidiosa infections in almond.
Abstract
Xylella fastidiosa is a plant pathogenic bacterium that has been introduced in the European Union (EU), threatening the agricultural economy of relevant Mediterranean crops such as almond (Prunus dulcis). Plant defense elicitor peptides would be promising to manage diseases such as almond leaf scorch, but their effect on the host has not been fully studied. In this work, the response of almond plants to the defense elicitor peptide flg22-NH2 was studied in depth using RNA-seq, confirming the activation of the salicylic acid and abscisic acid pathways. Marker genes related to the response triggered by flg22-NH2 were used to study the effect of the application strategy of the peptide on almond plants and to depict its time course. The application of flg22-NH2 by endotherapy triggered the highest number of upregulated genes, especially at 6 h after the treatment. A library of peptides that includes BP100-flg15, HpaG23, FV7, RIJK2, PIP-1, Pep13, BP16-Pep13, flg15-BP100 and BP16 triggered a stronger defense response in almond plants than flg22-NH2. The best candidate, FV7, when applied by endotherapy on almond plants inoculated with X. fastidiosa, significantly reduced levels of the pathogen and decreased disease symptoms. Therefore, these novel plant defense elicitors are suitable candidates to manage diseases caused by X. fastidiosa, in particular almond leaf scorch.
... Almost complete elimination of viable cells of X. fastidiosa was seen in many plants 56 inoculated with both P. phytofirmans and X. fastidiosa, suggesting that competition or pathogen 57 confusion associated with quorum sensing molecules was not the mechanism by which disease 58 control was achieved. The absence of any detectable cells of X. fastidiosa in many plants that 59 had been inoculated with P. phytofirmans was particularly striking given that large numbers of 60 cells of the pathogen had been inoculated (Baccari et al. 2019). This suggested that X. fastidiosa 61 was killed in plants that were also colonized by P. phytofirmans and that the reduction in disease 62 symptoms was associated with lower pathogen populations. ...
... This suggested that X. fastidiosa 61 was killed in plants that were also colonized by P. phytofirmans and that the reduction in disease 62 symptoms was associated with lower pathogen populations. Initial greenhouse studies revealed 63 that plant disease resistance genes were induced when both X. fastidiosa and P. phytofirmans 64 were present in the plant (Baccari et al. 2019). Only modest induction of plant disease resistance 65 genes such as PR1 were seen in plants inoculated only with P. phytofirmans or only with X. 66 fastidiosa, as has been seen in other studies (Rapicavoli et al. 2018). ...
Replicated field studies were conducted to evaluate the factors that could influence the efficacy of Paraburkholderia phytofirmans PsJN for the control of Pierce’s Disease of grape as well as to determine the extent to which disease control was systemic within plants. Topical applications of PsJN with an organosilicon surfactant was an effective way to introduce this bacterium under field conditions and provided similar levels of disease control as its mechanical inoculation. Disease incidence in inoculated shoots was often reduced 2- to 3-fold when PsJN was inoculated a single time as much as 3 weeks before Xylella fastidiosa and up to 5 weeks after the pathogen. Inoculation of a shoot with PsJN greatly decreased the probability of any symptoms rather than reducing the severity of disease, suggesting a systemic protective response of individual shoots. While the likelihood of disease symptoms on shoots inoculated with the pathogen on PsJN-treated plants was lower than control plants inoculated only with the pathogen, the protection conferred by PsJN was not experienced by all shoots on a given plant. This suggested that any systemic resistance was spatially limited. While the population size of PsJN increased to more than 106 cells/g and spread more than 1 m within 12 weeks after its inoculation alone into grape, its population size subsequently decreased greatly after about 5 weeks and its distal dispersal in stems was restricted when co-inoculated with X. fastidiosa. PsJN may experience collateral damage from apparent host responses induced when both species are present.
... No cure has been found to be effective for the control of X. fastidiosa, neither for ALS nor for the other diseases caused by this pathogenic bacterium (Kyrkou et al. 2018). Different strategies, such as chemical control using oxytetracycline or a Zn, Cu, and citric acid fertilizer (Amanifar et al. 2016;Bruno et al. 2021;Dongiovanni et al. 2017;Scortichini et al. 2018), biological control using endophytes (Baccari et al. 2019;Lacava et al. 2006Lacava et al. , 2007, and agricultural practices such as high-grafting on peach rootstock limbs (Cao et al. 2013), have been studied in different host plants under greenhouse and field conditions. Nevertheless, the general conclusion is that some treatments revitalize trees and reduce the symptoms, but X. fastidiosa is still detectable, resulting in the reappearance of the disease when the treatment ceases (Bragard et al. 2019). ...
... The activation of the SA pathway, which is the one that seems to be mainly triggered by BP178 in almond, could result in the activation of SAR which would cause a priming effect on the plants before X. fastidiosa inoculation. Priming grapevines with the endophytic bacteria Paraburkholderia phytofirmans PsJN, or with mutant cells of X. fastidiosa that lacked the O-antigen fragment of the lipopolysaccharide, activated the SA-mediated defense pathway and caused a reduction in X. fastidiosa population and Pierce's disease severity (Baccari et al. 2019;Rapicavoli et al. 2018). Moreover, the resistant olive cultivar Leccino also presents higher levels of SA when infected with X. fastidiosa (Novelli et al. 2019), in addition to an increase in reactive oxygen species (ROS), secondary metabolites (flavonoids and tannins) and lignin synthesis (Giampetruzzi et al. 2016). ...
Xylella fastidiosa is a plant pathogenic bacterium that has been introduced in the European Union (EU), causing significant yield losses in economically important Mediterranean crops. Almond leaf scorch (ALS) is currently one of the most relevant diseases observed in Spain, and no cure has been found to be effective for this disease. In previous reports, the peptide BP178 has shown a strong bactericidal activity in vitro against X. fastidiosa and to other plant pathogens, and to trigger defense responses in tomato plants. In the present work, BP178 was applied by endotherapy to almond plants of cultivar Avijor using preventive and curative strategies. The capacity of BP178 to reduce the population levels of X. fastidiosa and to decrease disease symptoms and its persistence over time were demonstrated under greenhouse conditions. The most effective treatment consisted of a combination of preventive and curative applications, and the peptide was detected in the stem up to 60 days posttreatment. Priming plants with BP178 induced defense responses mainly through the salicylic acid pathway, but also overexpressed some genes of the jasmonic acid and ethylene pathways. It is concluded that the bifunctional peptide is a promising candidate to be further developed to manage ALS caused by X. fastidiosa.
[Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .
... Generally, whether a strain can colonise leaves or other tissues internally will depend on the genetic repertoire of the microorganism, the plant species and cultivar and the environmental conditions. The P. phytofirmans strain PsJN is known to reduce grapevine Pierce disease infection by the pathogen Xylella fastidiosa (Baccari et al., 2019). This deleterious pathogen colonises xylem vessels, blocks water supply, induces leaf scorches and can kill the plant. ...
... This deleterious pathogen colonises xylem vessels, blocks water supply, induces leaf scorches and can kill the plant. As the PsJN strain is known to systemically colonise plants by spreading through the xylem vessels, Baccari et al. (2019) inoculated strain PsJN into a branch using a syringe and thereby reduced Xylella pathogen loads. Knowing the niches of colonisation and the routes used by beneficial bacteria can provide information regarding new strategies for crop protection. ...
Plants contain diverse microorganisms that interact with their hosts and with each other. Beneficial bacteria can be utilised on crops to protect plants against biotic and abiotic stresses and to stimulate plant growth. However, the behaviour of specific microorganisms on and within plants is still underexplored. Knowledge of bacterial colonisation behaviour and the precise ecological niches in a natural environment of a target strain can lead to better application and utilisation of these microorganisms for crop enhancement, in different plant soil environments, and for both biocontrol and biofertilisation approaches in organic and integrated protection systems. Understanding colonisation characteristics will also provide information on putative new strategies for maximising inoculation efficiency and thus crop enhancement. In this chapter, we set out how beneficial bacteria can colonise their host plants under various conditions and demonstrate how an understanding of plant colonisation can be used to improve bacterial application approaches.
... Recently, there has been increasing interests in research related on bacteriomes/microbiomes of plant diseases that could provide useful information for disease management. For example, grape Pierce's disease (PD), caused by Xylella fastidiosa in California, was found to be effectively controlled by the inoculation of a bacterial endophyte, Paraburkholderia phytofirmans (Baccari et al., 2019). Strains of Burkholderia in citrus roots could trigger expression of disease-resistant genes (Zhang et al., 2017). ...
... It is interesting that Paraburkholderia strain A-SBCA19 was highly similar to Pa. phytofirmans strain PsJN (ANI = 95.34, Figure 4). Strain PsJN showed its biocontrol capacity grape PD (Baccari et al., 2019). ...
Citrus Huanglongbing (HLB; yellow shoot disease) is associated with an unculturable α-proteobacterium “Candidatus Liberibacter asiaticus” (CLas). HLB was found in southern California in 2012, and the current management strategy is based on suppression of the Asian citrus psyllid (Diaphorina citri) that transmits CLas and removal of confirmed CLas-positive trees. Little is known about Asian citrus psyllid-associated bacteria and citrus-associated bacteria in the HLB system. Such information is important in HLB management, particularly for accurate detection of CLas. Recent advancements in next-generation sequencing technology provide new opportunities to study HLB through genomic DNA sequence analyses (metagenomics). In this study, HLB-related bacteria in Asian citrus psyllid and citrus (represented by leaf midrib tissues) samples from southern California were analyzed. A metagenomic pipeline was developed to serve as a prototype for future bacteriomic research. This pipeline included steps of next-generation sequencing in Illumina platform, de novo assembly of Illumina reads, sequence classification using the Kaiju tool, acquisition of bacterial draft genome sequences, and taxonomic validation and diversity evaluation using average nucleotide identity. The identified bacteria in Asian citrus psyllids and citrus together included Bradyrhizobium, Buchnera, Burkholderia, “Candidatus Profftella armature,” “Candidatus Carsonella ruddii,” CLas, Mesorhizobium, Paraburkholderia, Pseudomonas, and Wolbachia. The whole genome of a CLas strain recently found in San Bernardino County was sequenced and classified into prophage typing group 1 (PTG-1), one of the five known CLas groups in California. Based on sequence similarity, Bradyrhizobium and Mesorhizobium were identified as possible source that could interfere with CLas detection using the 16S rRNA gene-based PCR commonly used for HLB diagnosis, particularly at low or zero CLas titer situation.
... The onion root endophyte Paraburkholderia phytofirmans PsJNn reduces Pierce's disease symptom severity and X. fastidiosa subsp. fastidiosa Temecula1 in grapevines [47,53], but was not effective in the olive pathosystem in Italy [47,54]. The olive ionome, i.e., the relative content of mineral elements present in a specific tissue, interfered with OQDS symptoms expression in olive trees [55]. ...
Olive Quick Decline Syndrome (OQDS) associated with Xylella fastidiosa subsp. pauca is one of the most destructive diseases of olive trees in the Salento Peninsula (Southern Italy), particularly on the cultivars Cellina di Nardò and Ogliarola Salentina. This study proposes the NuovOlivo protocol as a management strategy to permit coexistence between X. fastidiosa subsp. pauca and olive drupes and extra-virgin oil production. Thirty-two private olive orchards affected by OQDS and cultivated following the standard agronomic techniques in use in the area were surveyed during the 2019–2023 olive-growing seasons. Tested cultivars included Cellina di Nardò, Ogliarola Salentina, Coratina, Ascolana Tenera, Nociara, Leccino, and Bella di Cerignola. At the beginning of the protocol application, the susceptible plants showed OQDS symptom severity of 40–80% and did not produce olives or oil, while the resistant(?)/tolerant cultivars exhibited a 2–8% leaf scorch and a drupe production less than 1–2 kg/plant. After the removal of dry branches in January–February, plants were sprayed two times per year (preferably in March and October) with NuovOlivo®, a mixture of aqueous botanical extracts esterified in the presence of sodium hydroxide with vegetable oils and activated at the time of use with sodium bicarbonate. In all the orchards, a slow-release fertilizer was distributed, and weeds were controlled by mowing or chopping. Upon eventual appearance, the dry twigs were removed. Treated olive trees produced new vegetation, rebuilt their foliage, reduced OQDS symptoms, and turned out cluster inflorescence and drupes. The drupes yield was 6.67–51.36 kg per plant, with an average of 13.19% in extra-virgin olive oil (free acidity 0.01–0.2%). Plants used as controls showed OQDS symptoms and were unproductive, and newly formed shoots were desiccated. The proposed protocol promotes, supports, and restores new vegetation, flowers, fruits, and oil production of the treated olive plants affected by OQDS without losing susceptible olive plants. The Apulian landscape and economy, based on olive presence and production, could be also safeguarded.
... pauca [45], never found in Portugal, while for Vitis vinifera, it belongs to Xf subsp. fastidiosa [46]. ...
The detection of Xylella fastidiosa in Portugal occurred through prospection in 2019 in Vila Nova de Gaia, Porto, in plants of Lavandula dentata L. Currently, in Portugal, there are 18 Xylella fastidiosa Demarcated Zones (DZs). The main objective of this study is to gain a comprehensive understanding of this problem within the defined Demarcated Zones in the North Region of Portugal from 2019 to June 2023. This work comprised two phases: the prospection phase (inspecting plants, sampling, and submission of samples to the laboratory) and the research phase (collecting and organizing data and statistical treatment). Our findings provide essential insights, suggesting that the Northern Region of Portugal is highly conducive to Xylella fastidiosa. Portugal has Xf-preferred hosts such as the olive tree, orange tree, Laurus nobilis, Rosa spp., Nerium oleander L., Pelargonium sp., Hedera helix L., and Lavandula dentata L. Portugal’s favorable environmental factors such as temperature and humidity can have an important role in influencing the interaction between bacteria and hosts. Nevertheless, it is crucial to consider variations in the behavior of insect vectors, as these variations can limit the prevalence of the disease. Activities like the transport of infected planting materials from the first Demarcated Zone of the Area Metropolitana do Porto could be associated with the introduction and spread of Xylella fastidiosa, potentially triggering new disease outbreaks in the country. Our findings confirm the alarming spread of Xylella fastidiosa across Portugal. Factors such as the presence of insect vectors, abundance of host plants, and climate suitability play pivotal roles in Xylella fastidiosa dispersal. We recommend that countries identified with relatively high risk, like Portugal, undertake thorough individual risk analyses. The implementation of preventive measures and, if necessary, the enhancement of surveillance systems for early detection of Xylella fastidiosa in plants and insect vectors are crucial steps.
... Several innovative approaches have emerged as alternatives to conventional agrochemicals for treating plant diseases, including the identification of resistant or tolerant olive germplasm (Giampetruzzi et al. 2016;Pavan et al. 2021;Vergine et al. 2020), management of the insect vectors (Dáder et al. 2019;Liccardo et al. 2020;Morente et al. 2022;Sanna et al. 2021), biological control strategies (Araújo et al. 2002;Baccari et al. 2019;Zicca et al. 2020), and the use of plant and microbial derived compounds (e.g., olive mill wastewaters, Trichoderma spp. crude culture extracts, phenolic compounds) (Bleve et al. 2018;Maddox et al. 2010), as well as physical techniques such as microwave irradiation or cold treatment (Hilton et al. 2021;Lieth et al. 2011). ...
Xylella fastidiosa (Xf) is a quarantine plant pathogen capable of colonizing the xylem of a wide range of hosts. Currently, there is no cure able to eliminate the pathogen from a diseased plant, whereas several integrated strategies have been implemented for containing the spread of Xf. Nanotechnology represents an innovative strategy based on the possibility of maximizing the potential antibacterial activity by increasing the surface-to-volume ratio of nanoscale formulations. Nanoparticles based on Chitosan and/or Fosetyl-Al have shown different in vitro antibacterial efficacy against Xf subspecies fastidiosa (Xff) and pauca (Xfp). This work demonstrated the uptake of Chitosan-Coated Fosetyl-Al nanocrystals (CH-nanoFos) by roots and their localization in the stems and leaves of olea europaea plants. Additionally, the antibacterial activity of Fosetyl-Al, nano-Fosetyl, nano-chitosan, and Chitosan-Coated Fosetyl-Al nanocrystals (CH-nanoFos) was tested on Nicotiana tabacum cv. SR1 (Petite Havana) inoculated with Xff, Xfp, or Xf subsp. multiplex (Xfm). The bacterial load was evaluated with qPCR, and the results showed that CH-nanoFos was the only treatment able of reducing the colonization of Xff, Xfm, and Xfp in tobacco plants. Additionally, the Area Under Disease Progress Curve (AUDPC), used to assess symptoms development in tobacco plants inoculated with Xff, Xfm, and Xfp and treated with CH-nanoFos, showed a reduction in symptom development. Furthermore, the twitching assay and bacterial growth under microfluidic conditions confirmed the antibacterial activity of CH-nanoFos.
... In addition, they provide a basis for unraveling the impact of Xfp infection on the xylem microbial communities, and for the identification of microorganisms associated with tolerant or resistant genotypes. As previously shown for the Paraburkholderia phytofirmans strain PsJN, which appears highly efficient for the control or eradication of the Pierce's disease [61], the genera Burkholderia, Quambalaria, Phaffia and Rhotodorula might be of interest to the development of defence strategies against Xfp. Nevertheless, although the identification of most of these species was also reported in our previous work [25], further analyses are ongoing to evaluate the effect of these putatively beneficial species in contrasting the Xfp infection. ...
Background
Endophytes mediate the interactions between plants and other microorganisms, and the functional aspects of interactions between endophytes and their host that support plant-growth promotion and tolerance to stresses signify the ecological relevance of the endosphere microbiome. In this work, we studied the bacterial and fungal endophytic communities of olive tree (Olea europaea L.) asymptomatic or low symptomatic genotypes sampled in groves heavily compromised by Xylella fastidiosa subsp. pauca, aiming to characterize microbiota in genotypes displaying differential response to the pathogen.
Results
The relationships between bacterial and fungal genera were analyzed both separately and together, in order to investigate the intricate correlations between the identified Operational Taxonomic Units (OTUs). Results suggested a dominant role of the fungal endophytic community compared to the bacterial one, and highlighted specific microbial taxa only associated with asymptomatic or low symptomatic genotypes. In addition, they indicated the occurrence of well-adapted genetic resources surviving after years of pathogen pressure in association with microorganisms such as Burkholderia, Quambalaria, Phaffia and Rhodotorula.
Conclusions
This is the first study to overview endophytic communities associated with several putatively resistant olive genotypes in areas under high X. fastidiosa inoculum pressure. Identifying these negatively correlated genera can offer valuable insights into the potential antagonistic microbial resources and their possible development as biocontrol agents.
... Translating this to the field will be another challenge because, probably, a big portion of the antimicrobial compounds will be lost by leakage or immobilized in the soil particles and lead to contamination of soils. In the case of using a living microorganism as a biocontrol to inhibit X. fastidiosa growth, research has shown that foliar application of a bacterial endophyte can reach the xylem if added with adjuvants (Baccari et al. 2019;Lindow et al. 2024). ...
An unprecedented plant health emergency in olives has been registered over the last decade in Italy, arguably more severe than what occurred repeatedly in grapes in the US in the last 140 years. These emergencies are epidemics caused by a stealthy pathogen, the xylem-limited, insect-transmitted bacterium Xylella fastidiosa. Although these epidemics spurred research that answered many questions about the biology and management of this pathogen, many gaps in knowledge remain. For this review, we set to represent both the US and European perspectives on the most pressing challenges that need to be addressed. These are presented in ten sections, that we hope will stimulate discussion and interdisciplinary research. We reviewed intrinsic problems that arise from the fastidious growth of X. fastidiosa, the lack of specificity for insect transmission, and the economic and social importance of perennial mature woody plant hosts. Epidemiological models and predictions of pathogen establishment and disease expansion, vital for preparedness, are based on very limited data. Most of the current knowledge has been gathered from a few pathosystems, while several hundred remain to be studied, probably including those that will become the center of the next epidemic. Unfortunately, aspects of a particular pathosystem are not always transferable to others. We recommend diversification of research topics of both fundamental and applied nature addressing multiple pathosystems. To increase preparedness through knowledge acquisition is the best strategy to anticipate and manage diseases caused by this pathogen described as ‘the most dangerous plant bacteria known worldwide’.
... This method led to significant reductions in disease severity, indicating that these biological agents can reduce disease by inducing the expression of disease resistance. The strain used showed high efficacy in controlling Pierce's disease and can be easily applied through spray treatment as an eradication measure [107]. ...
Citation: Loureiro, T.; Mesquita, M.M.; Dapkevicius, M.d.L.E.; Serra, L.; Martins, Â.; Cortez, I.; Poeta, P. Xylella fastidiosa: A Glimpse of the Portuguese Situation. Microbiol. Res. Abstract: Xylella fastidiosa (Xf) is classified as a quarantine pest due to its consequences on economically significant crops. Its main form of transmission in Europe is through the insect Philaenus spumarius. Due to climate change, the populations of insect vectors have become more extensive, resulting in the dissemination of the bacteria over longer periods, but the destruction of these insects raises issues due to their role in nature. Upon infection, Xf causes the occlusion of xylem vessels via bacterial aggregates and tylosis production by the plant as a response to infection. Although symptomatic manifestations of Xf are often linked to water stress, a variety of plant species have been found to carry the pathogen without symptoms, making it all too easy to evade detection when relying on visual inspections. Beyond water stress, other conditions (individual plant resistance/tolerance, bacterial concentrations, transpiration rates, and interactions between subspecies) may be implicated in symptom development. A thorough understanding of how this disease develops, especially its capacity to spread from the initial focus and establish a systemic infection, is imperative. This review focuses on the Xf infection process, the development of symptoms, its spread within Portugal, and the actions that have been taken to counter it.
... Therefore, the use of agrochemicals to prevent bacterial growth in the plant are not an effective strategy for dealing with diseases caused by X. fastidiosa (Scortichini et al., 2018). The development of successful methods against the bacterium is currently in progress (Scortichini et al., 2021;Morelli et al., 2021;Baccari et al., 2019;Antelmi et al., 2019).. ...
The most effective way to contain spread of the plant pathogen Xylella fastidiosa in Europe is to manage populations of its main insect vector, Philaenus spumarius L. (Hemiptera: Aphrophoridae). The action of some entomopathogenic endophytic fungi (EEF) on insect pests, directly through contact or indirectly by internal colonization of host plant tissues, may offer an excellent control option within integrated pest management (IPM) programmes. This study evaluated the impact of two EEF strains as control agents of P. spumarius (Metarhizium brunneum strain EAMa 01/58-Su and Beauveria bassiana strain EABb 01/33-Su [Hypocreales: Clavicipitaceae and Cordycipitaceae, respectively]); both strains were known to be excellent control agents of many other serious chewing and sap-sucking agricultural pests. First, the pathogenicity of strains applied directly to P. spumarius adults was evaluated, resulting in 50.0% and 32.0% mortality and a mean survival time of 4.7 and 6.2 days for M. brunneum and B. bassiana, respectively. Furthermore, colonization of Sonchus oleraceus by EEFs was observed after both soil and foliar applications. Greatest colonization (91.0%) was observed in plants treated with foliar applications of M. brunneum. Based on these results, we evaluated the feeding behaviour of P. spumarius on S. oleraceus plants previously colonized by M. brunneum using the ‘Electrical Penetration Graph’ technique. P. spumarius fed in a similar way on EEF-colonized and non-colonized S. oleraceus plants, with the exception that insects feeding on colonized plants reached xylem vessels faster than insects feeding on non-colonized plants. In addition, significantly higher mortality of P. spumarius was observed when feeding on plants treated by M. brunneum compared with the control. The duration of xylem ingestion events indicates that P. spumarius preferred to feed on basal leaves of the plant compared with apical leaves. Our results indicate strong potential for strain EAMa 01/58-Su of M. brunneum to be used as part of an X. fastidiosa IPM programme.
... It was shown that PsJN promoted plant growth under various abiotic stresses such as drought on wheat (Naveed et al., 2014) and maize (Naveed et al., 2015), salinity on quinoa (Yang et al., 2020), high temperature (32°C) on tomato (Issa et al., 2018), low temperatures (4°C) on grapevine (Ait Barka et al., 2006), and freezing temperatures on A. thaliana (Su et al., 2015). Further, PsJN protected plants from biotic stresses caused by pathogenic microorganisms such as the bacterial pathogens Pseudomonas syringae on A. thaliana (Timmermann et al., 2017) and Xylella fastidious on grapevine (Baccari et al., 2019); and fungal pathogens including Verticillium dahliae on tomato (Sharma and Nowak, 1998) and Botrytis cinerea on grapevine (Miotto-Vilanova et al., 2016). Overall, PsJN can colonize and benefit a wide range of plants and has been established as a model to study the molecular mechanisms of plant-endophytic bacteria interactions (Esmaeel et al., 2018). ...
Paraburkholderia phytofirmans PsJN is an endophytic bacterium and has been shown to promote the growth and health of many different plants. Exopolysaccharide (EPS) plays important roles in plant-bacteria interaction and tolerance to environmental stresses. However, the function of EPS in PsJN and its interaction with plants remain largely unknown. In this study, a deletion mutation of bceQ gene, encoding a putative flippase for the EPS biosynthesis, was introduced in the genome of PsJN. The ΔbceQ mutant produced a significantly lower level of EPS than the wild type strain in culture media. Compared to the wild type PsJN, the ΔbceQ mutant was more sensitive to desiccation, UV damage, salt (NaCl) and iron (FeCl3) stresses, and bacteriophage infection. More importantly, the mutation of bceQ decreased the endophytic colonization of PsJN in camelina (Camelina sativa) and pea (Camelina sativa) under plant drought stress conditions. To the best of our knowledge, this is the first report that EPS production is required for the maximal colonization of an endophytic bacterium in the plant tissues under stress conditions.
... The Burkholderia sensu stricto clade covers phytopathogens such as Burkholderia gladioli, which causes onion soft rot, and clinically relevant species such as members of the Burkholderia cepacia complex (3,4). In contrast, the genus Paraburkholderia contains environmental plant beneficial strains such as nitrogen-fixing and plant growth-promoting symbionts (e.g., Paraburkholderia phymatum, Paraburkholderia sabiae, Paraburkholderia tuberum, Paraburkholderia tropica, Paraburkholderia phytofirmans, and Paraburkholderia kururiensis) (3,(5)(6)(7)(8). Rhizobia must be competitive in order to prevent other strains present in the soil from colonizing plant roots. ...
Rhizobia often display additional beneficial traits such as the production of plant hormones and the acquisition of limited essential nutrients that improve plant growth and enhance plant yields. Here, we show that the rhizobial strain P. sabiae antagonizes important phytopathogens such as P. carotovorum, P. syringae , and R. solanacearum and that this effect is due to contact-dependent killing mediated by one of two T6SS systems identified in the complete, de novo assembled genome sequence of P. sabiae .
... multiplex was detected in diseased almond trees in the Valencian Community (Spain), and in 2021, the infected area reached 2292 ha, and more than 100,000 diseased almond trees have been destroyed (Morelli et al., 2021). Several strategies have been assessed to control X. fastidiosa diseases on plant hosts, including chemical control using oxytetracycline or Zn/Cu citric biocomplex foliar treatments (Amanifar et al., 2016;Dongiovanni et al., 2017;Scortichini et al., 2018;Bruno et al., 2021), stimulators of plant defense responses (Zhang et al., 2019;Moll et al., 2022), biological control using antagonistic endophytes (Baccari et al., 2019) or different agricultural practices. Some of these treatments can reduce symptoms, and in some few cases, even decrease the population levels in infected plants or trees. ...
The activity of Eucalyptus essential oil against eleven strains pertaining to six species of plant pathogenic bacteria was studied using growth inhibition and contact assays. All strains were susceptible to the formulation EGL2, and Xylella fastidiosa subspecies and Xanthomonas fragariae were the most sensitive. The bactericidal effect was strong causing 4.5 to 6.0 log reductions in survival in 30 min at concentrations in the range of 0.75 to 15.0 μl/ml depending on the bacteria tested. Transmission electron microscopy of the formulation EGL2 against the three X. fastidiosa subspecies studied allowed the observation of a strong lytic effect on bacterial cells. In addition, the preventive spray application of EGL2 to potted pear plants subsequently inoculated with Erwinia amylovora significantly decreased the severity of infections. Almond plants treated by endotherapy or soil drenching, and then inoculated with X. fastidiosa showed a significant decrease in disease severity as well as in the levels of the pathogen, depending on the strategy used (endotherapy/soil drenching, preventive/curative). The treatment by endotherapy in almond plants induced the expression of several genes involved in plant defense. It was concluded that the reduction of infections by the Eucalyptus oil treatments was due to the combination of its bactericidal and plant defense induction activities.
... To assess the specificity of the cLAMP assay, several non-target bacterial species available in our laboratory were tested. Xanthomonas campestris pv campestris, a Gram-negative bacterium that causes black rot of Brassicaceae, Paraburkholderia phytofirmans strain PsJN, a rhizosphere-colonizing bacterium known to be effective in reducing Pierce's disease symptom severity in grapevines [36], and Pseudomonas marginalis, a Gram-negative bacterium responsible for field and storage soft rots in different plant species, were cultivated on Tryptone Soy Agar (TSA) plate medium at 28 °C for one, two, or three days, respectively. The Gram-negative epiphytic bacterium Rahnella aquatilis [37] was cultivated on Luria Bertani (LB) solid medium for one day at 28 °C and Escherichia coli strain BL21(DE3) was grown at 37 °C overnight. ...
Xylella fastidiosa subsp. pauca (Xfp) infects olive trees and other hosts in Southern Apulia (Italy), devastating agriculture and landscape. A containment strategy of the disease requires quick and sensitive detection tools. Therefore, a colorimetric LAMP protocol was developed using as a template a crude alkaline sap obtained from incubation of 50-60 mg of thin slices of olive twigs in a NaOH-containing buffer. This rapid molecular assay can be performed directly in the field, as it needs only a portable isothermal block. Tissues of the same olive trees analysed by this technique were also compared to qPCR (using purified total plant DNA as template) as well as digital droplet PCR (on the same crude alkaline extracts used in cLAMP). A titration of the cLAMP reaction with healthy olive sap, spiked with dilutions of in vitro cultivated Xfp cells and plasmid DNA containing the target sequence, gave positive detection results as low as 10 2 CFU/mL and up to 169.2 target copies/μL, equivalent to about 0.9 pg of the genomic DNA. A portable, sensitive and target-specific Xfp field test was developed, which has a 40 min sample-to-answer time and does not require any DNA isolation procedure or laboratory equipment. The application of this detection assay could help the monitoring and containment of the disease spread.
... Also, when coinoculating the endophytic strain Paraburkholderia phytofirmans and the pathogen Xilella fastidiosa in grapevine, the incidence of leaves exhibiting scorching symptoms typical of Pierce's disease was consistently greatly reduced from that in control plants. This effect was caused by priming expression of innate disease resistance pathways in plants that otherwise would have exhibited minimal responses to the pathogen (for example grapevine PR1 and ETR1) (Baccari et al., 2019). Soft rot caused by Pectobacterium carotovorum is a major constraint in the production of Chinese cabbage. ...
Contribution of plant-associated bacterial endophytes to plant growth is widely accepted, and there is growing evidence that they may play an important role in plant stress tolerance. This fact is especially important in our present scenario of climate change and changing environments, as well as in our current model of crop production and consumption. This chapter presents the state-of-the-art in the role of endophytes in plant stress tolerance. Endophytes have demonstrated a wide range of activities that promote plant stress alleviation against a range of biotic and abiotic stressors like phytopathogens, soil salinity, pollution, high atmospheric CO2, high and low temperatures or drought. Among these abilities, we can find plant growth promoting activities, like siderophores or phytohormones production, phosphate solubilization, nitrogen fixation or biofilm formation. Endophytes may also modulate antioxidant enzymes and the expression of certain genes. They have the ability to transform phytotoxic products, and to produce bioactive compounds and metabolites. These properties, together with others described in the chapter, make endophytes a natural and environmentally friendly resource to be considered to aid plants to face environmental challenges. However, further research is needed concerning molecular understanding of processes that take place, also more studies at the field level and optimization of endophyte inoculants formulation to make this biotool as much effective and accessible as possible. In this chapter, we provided a concise review on current search on the role of endophytes on stress tolerance.
... A similar approach has been explored using unrelated endophytic bacteria to trigger systemic protection from X. fastidiosa infection. A grapevine endophyte, Paraburkholderia phytofirmans PSjN, can reduce disease caused by X. fastidiosa both when the plants are inoculated with the biocontrol at the same time as infection challenge, and when the biocontrol is used up to 4 weeks after X. fastidiosa inoculation in grapevine [117]. Unlike the biocontrol strains of X. fastidiosa that need to be inoculated by needle puncture, PSjN can also be effectively established in host plants using a foliar spray of the bacterium in combination with an organo-silicon surfactant. ...
The bacterial pathogen Xylella fastidiosa continues to threaten agricultural production of many different crops around the world, with significant economic burden from crop loss, disease management, and surveillance costs. In addition to direct economic consequences, plant diseases caused by X. fastidiosa have had significant societal impacts in the most affected regions. Although X. fastidiosa infects long-term perennial crops and landscape plants, there has never been a truly effective treatment for plants once they become infected. This review discusses the threat of X. fastidiosa to agriculture, landscapes, and global commerce, in addition to the most recent progress in treatment for X. fastidiosa in infected plants. Current disease mitigation options include nutritional, chemical, biocontrol, and plant resistance-based strategies, with the potential to develop combined management approaches. Overall, several strategies are promising for disease suppression but there is still opportunity for innovation, especially in treatment approaches that can be administered systemically by soil or foliar spray routes. Prevention of severe disease outcomes and crop loss, and the ability to suppress pathogen populations and reduce transmission without heavy reliance on insecticides would have significant economic and environmental benefits.
... Strains belonging to Pseudomonadaceae, Bacillaceae, Enterobacteriaceae, Actinobacteria and Burkholderiaceae have been shown to have a positive effect on B. cinerea control (Compant et al. 2013). This strategy is also sought for the biological control of Xylella fastidiosa, the causal agent of Pierce's disease of grapevine (Baccari et al. 2019;Compant et al. 2013). A new promising alternative to fungicides, developed in the last two decades, is the use of yeasts, such as Candida oeleophila Montrocher (Saccharomycetaceae), as biological control agents of post-harvest diseases of a wide variety of fruits in apple orchards Guerrero et al. 2014). ...
This chapter focuses on the different stages of the process of classical biological control (CBC) through selected examples, including cottony cushion scale, oriental chestnut gall wasp, vine mealybug, fruit fly, bagrada stink bug and codling moth. The starting point of this long process is the search for natural enemies of species that are considered harmful because they negatively impact crops or natural ecosystems. These natural enemies, or biological control agents, are considered “beneficial”; they are used for the benefit of human activities, while the fauna and flora of the invaded areas also benefit from this sustainable and environmentally friendly control method. The different CBC stages start with studying the literature on pests and potential biological control agents, before moving on to field exploration, authorization to collect and import, and finally specimen collection. Once a species (pest or natural enemy) has been identified, and before considering introducing it into a new environment, we detail the tests to conduct, often in a quarantine facility, for evaluating the specificity to the target, to understand life history traits and parameters that are useful for conducting laboratory rearing.
... Particularly, the endophyte Curtobacterium flaccumfaciens was found to limit the in vitro growth of X. fastidiosa and reduce the symptoms generated in Catharanthus roseus [14]. Moreover, the endophytic bacterium Paraburkholderia phytofirmans strain PsJN was reported to control X. fastidiosa infections in the grapevine [15]. Recently published studies have stated the absence of native antagonists isolated from Apulian olive trees to inhibit X. fastidiosa ST53 growth in vitro [16]. ...
Olive quick decline syndrome (OQDS), which is caused by Xylella fastidiosa, poses a severe threat to the agriculture of Mediterranean countries and causes severe damage to the olive trees in Italy. Since no effective control measures are currently available, the objective of this study was the screening of antagonistic bacteria that are potentially deployable as biocontrol agents against X. fastidiosa. Therefore, two approaches were used, i.e., the evaluation of the antagonistic activity of (i) endophytic bacteria isolated from two different cultivars of olive trees (Leccino and Ogliarola salentina) and (ii) epiphytic bacteria isolated from the phyllospheres of different host plant species of X. fastidiosa. In vitro dual culture tests showed that 12 out of 200 isolates inhibited X. fastidiosa growth, with appearances of clear zones between 4.0 and 38.6 mm. 16S rRNA gene sequencing revealed different species of the genera Paenibacillus, Bacillus, Pantoea, Microbacterium, Stenotrophomonas, Delftia, and Pseudomonas. Furthermore, an investigation for antimicrobial activity identified 5 out of the 12 antagonistic bacteria, Paenibacillus rigui, Bacillus subtilis, Bacillus pumilus, Microbacterium oxydans, and Stenotrophomonas rhizophila, that were able to produce culture filtrates with inhibitory activities. Our results are promising for further investigation to develop an eco-sustainable strategy to control X. fastidiosa using biocontrol agents or their secreted metabolites.
... Bacterial and fungal biological control agents have been identified. They can help in limiting PD damages in grapevines, such as Paraburkholderia phytofirmans (Baccari et al. 2019), but most of them were not able to provide long-term protection. Bacterial phage therapy looks to be a promising strategy (Das et al. 2015). ...
Grapevines are challenged by a range of diseases and pests, causing economic losses and requiring often costly approaches to mitigate damage. Public interest in reducing the use of chemicals is a related challenge, along with climate change. Yet, the Vitis gene pool provides vast resources for the development of genetic resistance in rootstock and scion cultivars. Traditional breeding approaches have made great strides in the development of adaptive traits, and recent access to ‘omic technologies has further facilitated the identification of useful loci along with rapid trait introgression from wild species. Moreover, marker technologies are now used to stack multiple genes for the same trait into a single genotype, a heretofore barely accessible technology. Genomic technologies are also impacting germplasm characterization, and thereby facilitating “Breeding by Design” approaches. Genetic transformation and gene-editing technologies are also applicable for both cultivar improvement as well as functional studies of genes. The landscape for acceptance of new resistant cultivars is complex and with wine grapes, subject to high degrees of regulation especially in the European Union. With rootstocks, as well as table/raisin grapes, gaining acceptance in the marketplace for new cultivars developed through either traditional or marker-assisted approaches is routine. Yet even in the highly regulated EU environment, the adoption of new wine cultivars of interspecific origins is beginning to take place in both traditional wine growing regions as well as non-traditional regions nearby.KeywordsGenotypingMolecular breedingPathogenPestPhenotypingR-lociResistance
Vitis
... Moreover, the antibiotic oxytetracycline along with three other compounds, like NAC, a bioactive detergent composed of plant oil extracts, and a Zn, Cu, and citric acid fertilizer, showed potential to be used to control X. fastidiosa diseases in almond (Amanifar et al., 2016) and olive orchards (Dongiovanni et al., 2017;Scortichini et al., 2018;Bruno et al., 2021), respectively. Other strategies that have been studied involve the use of the endophyte Paraburkholderia phytofirmans (Baccari et al., 2019), avirulent X. fastidiosa strains (Hao et al., 2017), and lytic phages (Das et al., 2015) as biological control agents. Although the results obtained in most of these trials were positive, no strategy was able to completely cure plants infected by X. fastidiosa. ...
Xylella fastidiosa is a plant pathogen that was recently introduced in Europe and is causing havoc to its agriculture. This Gram-negative bacterium invades the host xylem, multiplies, and forms biofilm occluding the vessels and killing its host. In spite of the great research effort, there is no method that effectively prevents or cures hosts from infections. The main control strategies up to now are eradication, vector control, and pathogen-free plant material. Antimicrobial peptides have arisen as promising candidates to combat this bacterium due to their broad spectrum of activity and low environmental impact. In this work, peptides previously reported in the literature and newly designed analogs were studied for its bactericidal and antibiofilm activity against X. fastidiosa. Also, their hemolytic activity and effect on tobacco leaves when infiltrated were determined. To assess the activity of peptides, the strain IVIA 5387.2 with moderate growth, able to produce biofilm and susceptible to antimicrobial peptides, was selected among six representative strains found in the Mediterranean area (DD1, CFBP 8173, Temecula, IVIA 5387.2, IVIA 5770, and IVIA 5901.2). Two interesting groups of peptides were identified with bactericidal and/or antibiofilm activity and low-moderate toxicity. The peptides 1036 and RIJK2 with dual (bactericidal–antibiofilm) activity against the pathogen and moderate toxicity stand out as the best candidates to control X. fastidiosa diseases. Nevertheless, peptides with only antibiofilm activity and low toxicity are also promising agents as they could prevent the occlusion of xylem vessels caused by the pathogen. The present work contributes to provide novel compounds with antimicrobial and antibiofilm activity that could lead to the development of new treatments against diseases caused by X. fastidiosa.
... Additionally, due to their biological control ability, some species might be ecological friendly alternatives to synthetic pesticides (Radhakrishnan et al., 2017). For example, bacteria from the genera Bacillus (Fira et al., 2018;Radhakrishnan et al., 2017), Burkholderia (Sandani et al., 2019), Paraburkholderia (Baccari et al., 2019) and Pseudomonas (Sandani et al., 2019) have been found on strawberry tree and according to several reports might have potential as biological control agents. Furthermore, several species identified on strawberry tree, such as Bacillus thuringiensis, Kocuria palustris, K. rhizophila, Pseudomonas alcaligenes, P. mendocina, Sphingomonas azotifigens, S. multivorum and Streptomyces mirabilis, might provide great benefits to their host plants as mentioned before (Anum et al., 2019;Hakim et al., 2021;Kohler et al., 2006;Matsuda et al., 2001;Schütze et al., 2014;Videira et al., 2009;Widnyana et al., 2013;Zacaria Vital et al., 2019). ...
Arbutus unedo L. (strawberry tree) is a multipurpose Ericaceae tree with a circum-Mediterranean distribution and tolerant to abiotic and biotic stresses. The bioactive compounds and edible berries make this species attractive from an economical perspective, which causes a high demand for true to type plants. As micropropagation techniques are quite popular for the production of strawberry tree clonal plants, the characterization of its microbiome is essential, due to the possible impact in micropropagation success, including acclimatization. Thus, this study aims to identify the endophytic communities on strawberry tree plant tissues in vitro, as well as their prevalence and/or alteration upon plant acclimatization. For this purpose, the microbiome of two genotypes under micropropagation and ex vitro was identified using a culture-independent method. Bacterial OTUs were assigned to 7 phyla and 79 genera whereas only one Archaea genus was identified. The most abundant and diverse bacterial phylum was Actinobacteriota (48%) followed by Proteobacteria (43%), Firmicutes (6%) and Bacteroidota (3%). Noticeable differences in terms of composition and diversity were found when the micro-biome of genotypes in vitro was compared, whereas the composition of ex vitro samples was similar. A significant higher diversity was found on both genotypes ex vitro when compared to the respective in vitro plants. This study presents the very approach into the identification and characterization of strawberry tree microbiome, including in vitro plants, using a culture-independent method. The genotype proved to be a determinant factor shaping microbiota structure. The relevance of this results for micropropagation and breeding are discussed.
... Among other microbial strains, the beneficial endophyte Paraburkholderia phytofirmans PsJN, isolated from onion roots [74,75], is known to colonize several host plants [75,76], stimulating their growth and protecting them against biotic and abiotic stresses [76]. It has been shown to be effective in reducing Pierce's disease symptom severity and X. fastidiosa Temecula1 populations in grapevines [77]. Preliminary trials aimed at testing its effectiveness as a biocontrol agent in the "De Donno" olive pathosystem in Italy, although limited to a single season, have not revealed significant differences in the reduction of OQDS symptoms in therapeutic treatments, nor reduction of the new infections upon preventive applications [78]. ...
Since 2013, Xylella fastidiosa Wells et al. has been reported to infect several hosts and to be present in different areas of Europe. The main damage has been inflicted on the olive orchards of southern Apulia (Italy), where a severe disease associated with X. fastidiosa subspecies pauca strain De Donno has led to the death of millions of trees. This dramatic and continuously evolving situation has led to European and national (Italian and Spanish) measures being implemented to reduce the spread of the pathogen and the associated olive quick decline syndrome (OQDS). Research has been also carried out to find solutions to better and directly fight the bacterium and its main insect vector, Philaenus spumarius L. In the course of this frantic effort, several treatments based on chemical or biological substances have been tested, in addition to plant breeding techniques and integrated pest management approaches. This review aims to summarize the attempts made so far and describe the prospects for better management of this serious threat, which poses alarming questions for the future of olive cultivation in the Mediterranean basin and beyond.
... Microorganisms play pivotal roles in plant growth and fitness. Some bacteria form close relationships with plants and establish mutualistic symbioses that protect the plants from potential pathogens or provide essential elements for plant growth (Baccari et al. 2019;Compant et al. 2005). Some bacteria are free-living but show a preference to live in the rhizosphere of plants; therefore, plants can benefit from their biological activities such as nitrogen fixation, phytohormone modulation, and phosphate solubilization (Berendsen et al. 2012;Smercina et al. 2019). ...
Basal stem rot (BSR) is the most common disease of oil palm (Elaeis guineensis Jacq.) in Southeast Asia. BSR is caused by a white-rot fungus Ganoderma boninense. The disease is difficult to manage. Therefore, development of novel and environmentally safe approaches to control the disease is important. Species of Burkholderia are known to have diverse lifestyles, some of which can be beneficial to plants either by suppressing diseases or enhancing plant growth. In the present study, antifungal peptides (AFPs) produced by a bacterial strain isolated from the rhizosphere of an oil palm tree, namely Burkholderia sp. strain CP01, exhibited strong growth inhibition on G. boninense. A loss-of-function mutant of CP01 was generated, and it has enabled the identification of a 1.2 kDa peptide and its variants as the active antifungal compounds. High-resolution mass spectrometry revealed six analogous compounds with monoisotopic masses similar to the previously reported cyclic lipopeptides occidiofungin and burkholdine. The antifungal compounds of CP01 were secreted into media and we sought to use CP01 culture extract without living cells to control BSR disease. Glasshouse experiments showed that CP01 culture extract suppressed BSR disease in oil palm seedlings. The ability of CP01 to produce an antifungal substance and suppress plant disease suggests its potential application as a biofungicide in agriculture.
... The results of our analysis demonstrate that affected producers and consumers jointly carry the economic risk associated with Xfp. To mitigate the risk, research currently targets the identification of resistant traits in olive varieties (De Pascali et al., 2019;Sabella et al., 2018;Baù et al., 2017;Luvisi et al., 2017aLuvisi et al., , 2017bCaserta et al., 2017;Giampetruzzi et al., 2016), biological control of the vectors (Baccari et al., 2019), early detection of the disease (Zarco-Tejada et al., 2018), and the establishment of a cordon sanitaire by removing host plants near the infected zone. Evidently, all these measures aim at growers taking action to prevent further impacts. ...
The introduction of Xylella fastidiosa in Apulia has resulted in the desiccation of millions of olive trees. Here, we employ a multi-country partial equilibrium model to analyze the possible distribution of economic impacts among olive oil processors and consumers. The results suggest that the majority of the impacts would fall on consumers as a consequence of higher prices. If the disease disperses beyond the current extent in Italy the decline in consumer welfare ranges from 4.1 billion to 10.3 billion Euro over the course of 50 years depending on the rate of disease spread. In other words, each of the 195 million households in Europe would incur additional costs ranging 63 cents to 1.6 Euro every year over the course of 50 years. Introductions of the pathogen into Greece or Spain could cost European consumers between 0.4 billion to 3.3 billion Euro and 1.8 billion to 53 billion Euro, respectively. This would correspond to additional annual household costs ranging 6 to 51 cents and 27 cents to 8.2 Euro, respectively. As significant economic consequences from further dispersal of the disease are borne by consumers, the economic threat is not limited to producers but should be contextualized as a societal problem.
... In addition, maintaining healthy microbiota and the presence of cultivar-specific microbes may support the resilience of the resistant olive cultivar Leccino to Xf infection [38]. This evidence was also confirmed in other pathosystems where experimental evidence suggests that plant colonization by specific bacterial endophytes is marked by a change in the expression of key genes in central metabolic and by priming expression of innate disease resistance pathways in plants that result in the reduction of disease [39,40]. At the same time, endophytic fungi can influence the plant's metabolism by increasing the content of antioxidant compounds in the host [41]. ...
During their evolutionary history, plants have evolved the ability to synthesize and accumulate small molecules known as secondary metabolites. These compounds are not essential in the primary cell functions but play a significant role in the plants' adaptation to environmental changes and in overcoming stress. Their high concentrations may contribute to the resistance of the plants to the bacterium Xylella fastidiosa, which has recently re-emerged as a plant pathogen of global importance. Although it is established in several areas globally and is considered one of the most dangerous plant pathogens, no cure has been developed due to the lack of effective bactericides and the difficulties in accessing the xylem vessels where the pathogen grows and produces cell aggregates and biofilm. This review highlights the role of secondary metabolites in the defense of the main economic hosts of X. fastidiosa and identifies how knowledge about biosynthetic pathways could improve our understanding of disease resistance. In addition, current developments in non-invasive techniques and strategies of combining molecular and physiological techniques are examined, in an attempt to identify new metabolic engineering options for plant defense.
... Statistical differences were determined using Student's t-test performed with statistical package XLSTAT (Microsoft Excel). The gene-specific primers VvPR1_F1: GGAGTCCATTAGCACTCCTTTG and VvPR1_R1: CATAATTCTGGGCGTAGGCAG [68] or VvEF1a_F1: AACCAAAATATCCGGAGTAAAAGA and VvEF1a_R1: GAACTGGGTGCTTGATAGGC [69] were used for the amplification of the VvPR1and VvEF1a genes, respectively. The gene sequence from this article can be found in the GenBank/EMBL databases under the following NCBI accession numbers: XM_002273752.3(VvPR1) ...
Upon pathogen attack, plants very quickly undergo rather complex physico-chemical changes, such as the production of new chemicals or alterations in membrane and cell wall properties, to reduce disease damages. An underestimated threat is represented by root parasitic nematodes. In Vitis vinifera L., the nematode Xiphinema index is the unique vector of Grapevine fanleaf virus, responsible for fanleaf degeneration, one of the most widespread and economically damaging diseases worldwide. The aim of this study was to investigate changes in the emission of biogenic volatile organic compounds (BVOCs) in grapevines attacked by X. index. BVOCs play a role in plant defensive mechanisms and are synthetized in response to biotic damages. In our study, the BVOC profile was altered by the nematode feeding process. We found a decrease in β-ocimene and limonene monoterpene emissions, as well as an increase in α-farnesene and α-bergamotene sesquiterpene emissions in nematode-treated plants. Moreover, we evaluated the PR1 gene expression. The transcript level of PR1 gene was higher in the nematode-wounded roots, while in the leaf tissues it showed a lower expression compared to control grapevines.
... Employing plant growth-promoting rhizobacteria or pretreatment with a weakly virulent strain of a plant pathogen to control the growth of a virulent strain of the same, are two key possible ways by which induced systemic defence can be triggered in plants (Wei et al., 1991;Ramamoorthy et al., 2001). The concept of induced systemic defence can be applied to control plant pathogens as exemplified by the fact that citrus seedlings inoculated with a weakly virulent isolate of P. tracheiphila can successfully inhibit further infection by a virulent strain of the same pathogen (Migheli et al., 2009 (Istifadah et al., 2006;Ginting et al., 2013;Mousa et al., 2015;Gouda et al., 2016;Yuan et al., 2017;Baccari et al., 2018). ...
Phoma is the most widely distributed and omnipresent genus of the order Pleosporales and the largest genus with some 3000 taxa described so far. Of which, approximately 110 species are pathogenic that occupy varied ecological niches. The genus Phoma is polyphyletic and isn’t really delimited with unclear species boundaries that make it a taxonomically controversial genus. Fungi belonging to Phoma commonly occur on crop plants that are economically important where they cause devastating plant diseases. Pathogenic members of Phoma sensu lato species attacks crop plants with symptoms ranging from leaf blight, root rot to even wilting of the plant. In infected crop residues and field stubbles, the pathogen produces abundant pycnidia and pseudothecia which serve as the source of primary inoculum whereas repeated crops of conidia produced inside pycnidium are the main source of secondary infection during the same growing season. After successful infection, the pathogen produces various phytotoxin that alters photosynthetic efficiency, actin cytoskeleton‐based functions and causes electrolyte leakage from cells. Controlling the diseases caused by members of Phoma sensu lato is challenging and efforts have been made to identify resistant varieties that can be used in various plant breeding programs. Studies have also been conducted to devise cultural and biological control measures as well as to evaluate the efficacy of fungicides against members of Phoma sensu lato. In this review we aim to discuss the disease epidemiology and control measures that can be practiced to protect crops from Phoma diseases.
Endophytic bacteria live in the internal tissues of plants, forming symbiotic, mutualistic, commensalistic and trophobiotic relationships. Some are spread via seeds after sprouting from the rhizosphere or phyllosphere. These bacteria capable of promoting plant growth and impart biotic stress by synthesing plant growth hormones, ACC deaminase, organic acids and siderophore. Endophytes aid in phytoremediation by removing soil contaminants and boosting soil fertility via phosphate solubilization and nitrogen fixation. The endophytic microbes are becoming increasingly popular in biotechnological applications which supports sustainable growth of non-food crops for biomass and biofuel. They offer valuable natural materials which is used in medicine, agriculture and industry. Bacterial endophytes are endowed with the enormous potential in the biological treatment of plant pathogens and considered as the superior alternative to synthetic fungicides. The review emphasizes benefits of bacterial endophytes in promoting plant growth and prospects of agricultural applications viz., increasing crop yield under biotic stress condition and their mode of action towards plant diseases. It also summarises the diverse and vital role of endophytes in agroecosystems as well as insights for sustainable agriculture and crop resilience.
Graphical Abstract
Biological control of plant diseases is an important component of disease management, particularly in the today's' world of environmental consciousness and awareness. It is particularly preferred method of disease management under organic production system. Biological control is successful in almost all the crops against a number of diseases but soil borne diseases are most responsive to bio-control methods. The agents of biological control, known as bio-control agents (BCAs) belong to a vast group of micro-organisms, particularly fungi (Trichoderma, Ampelomyces, etc), bacteria (Pseudomonas, Bacillus, etc) and actinomycetes. Bottle gourd is an important vegetable crop belonging to the family Cucurbitaceae. It suffers from a number of diseases like anthracnose, powdery mildew, downy mildew, wilt, etc. The present review shall be an attempt to review the biological control of the major diseases of bottle gourd.
Does Xylella fastidiosa, a bacterial plant pathogen with noncirculative foregut-borne transmission, manipulate behavior of its sharpshooter vector to facilitate its own inoculation? To answer this question, blue-green sharpshooters, Graphocephala atropunctata (Signoret), were reared on basil to clean their foreguts, then removed from the colony and given one of four pre-electropenetrography (EPG) treatments: i) old colony adults on basil, ii) young colony adults on basil, iii) young colony adults held on healthy grapevine for 4 days, and iv) young colony adults held on Xf-infected (symptomatic) grapevine for 4 days. After treatments, stylet probing behaviors were recorded on healthy grapevine via AC-DC electropenetrography. Waveforms representing putative Xf inoculation (XB1 [salivation and rinsing egestion] and XC1 [discharging egestion]) and other behaviors were statistically compared among treatments. Mean number of events per insect and 'total' duration per insect of XB1 and XC1 were highest for insects from healthy grape, lowest for basil (regardless of insect age), and intermediate for Xf-infected grape. The surprising results showed that prior exposure to healthy grapevines had a stronger effect on subsequent performance of inoculation behaviors on healthy grapevine than did prior exposure to Xf-infected grapevine. It is hypothesized that non-Xf microbes were acquired from healthy grapevine, causing greater clogging of the precibarium, leading to more performance of inoculation behaviors. This study shows for the first time that presence of noncirculative, foregut-borne microbes can directly manipulate a vector's behavior to increase inoculation. Also, EPG can uniquely visualize the dynamic interactions between vectors and the microbes they carry.
(Read full pdf: https://rdcu.be/c474v)
The exploration of knowledge for crop improvement has been a continuous practice to address the food insecurity of the growing human population, and the necessity of the new knowledge is crucial due to decreasing arable land and climate change. The proper use of technology and knowledgebase has the potential to narrow down poverty in the world, more specifically in developing countries. This review aimed to assess the role of the endophytic and rhizospheric bacteria as a potential crop improvement tool in climate-smart agriculture. Endophytic and rhizospheric were found to be efficient alternatives to the chemical-based solution to develop crops. Endophytic and rhizospheric bacteria have improved many agronomic traits such as yield, quality, disease resistance, and stress tolerance. Besides, we discussed the recent development of the field-level application of endophytic and rhizospheric bacteria. These bacteria have potential since they are efficient in developing crops significantly without affecting the environment in a deleterious way. In terms of biodiversity, natural resources such as endophytic and rhizospheric bacterial application to crops are unlikely to affect the non-target species. Hence, endophytic and rhizospheric bacteria application in crop improvement is applicable for agricultural development, thereby ensuring food sustainability without affecting the environment, eventually leading us to climate-smart agriculture. This review aims to recapitulate the current knowledge and prospects of endophytic and rhizospheric bacteria to achieve the goal of climate-smart agriculture.
Five isolates of Xylella fastidiosa subs. fastidiosa were evaluated for virulence differences using the grape cultivar Cabernet Sauvignon. Significant variation in virulence was observed among isolates. Two isolates representing high and moderate virulence in grape were used for evaluating susceptibility on twenty-one grape lines (cultivars (cv.) and breeding lines). Lines showed significant differences in symptom development and bacterial populations when inoculated with one of two isolates. Table grape cultivars Scarlet Royal, Solbrio, and Red Globe were among the cultivars with the highest disease symptoms and bacterial populations, while ‘Flame Seedless’ showed moderate or low symptoms and had lower bacterial populations in this study than most other commercial table grape cultivars. Sources of Pierce’s disease resistance or tolerance commonly used in breeding programs showed few symptoms when inoculated with either isolate, but levels of bacteria within the plant varied. A new source of Pierce’s disease resistance/tolerance, IAC 572, was identified.
Xylella fastidiosa is the causal agent of important crop diseases and is transmitted by xylem‐sap‐feeding insects. The bacterium colonizes xylem vessels and can persist with a commensal or pathogen lifestyle in more than 500 plant species. In the past decade, reports of X. fastidiosa across the globe have dramatically increased its known occurrence. This raises important questions: How does X. fastidiosa interact with the different host plants? How does the bacterium interact with the plant immune system? How does it influence the host’s microbiome? We discuss recent strain genetic typing and plant transcriptome and microbiome analyses, which have advanced our understanding of factors that are important for X. fastidiosa plant infection.
Bacterial extracellular vesicles (EVs) are cytosol-containing membrane spheres providing a chassis for the removal and delivery of cargoes in a highly dynamic and cue-responsive manner. EVs play important roles in cell-to-cell communication, including the dialogue between recipient microbial and plant cells. Bacterial EVs are well-studied in the medical field, but their relevance for plant infection is only now being recognized. Recent studies have demonstrated the role of EVs from phytobacteria in modulating plant immunity and the outcome of disease or in symbiosis. In this review, we highlight the composition of EVs and discuss their role in the interaction with plants. Knowledge of EV composition and functions will aid their use in biotechnology and agriculture.
Phoma spp. are very important plant pathogens over the world which are recorded as soil-borne and saprophytic species. Many crops are affected by the Phoma spp. diseases, such as potatoes, beets, legumes, ornamentals, and citrus plants. This chapter aims to understand better about identification, epidemiology, and the management of diseases caused by Phoma spp. Most of Phoma species were identified according to the morphological, biological, and molecular basis. Primary infection of hosts by Phoma species may occur through wounds, through stomata, or directly through the epidermis. Phoma spp. cause infection in high humidity. Phoma spp. diseases usually are controlled through a package of integrated disease management including cultivating of resistant varieties, conducting the best agricultural practices, and biological control, in addition to the chemical control through spraying the fungicides which is considered the most effective method in the case of epidemic infection.
Priming plants with natural agents, including microorganisms, is a promising alternative to chemical methods of protection in growing plants and, particularly, in viticulture. However, the molecular mechanisms of the priming phenomenon are still not fully elucidated. The antioxidant system and reactive oxygen species are known to effectively modulate plant responses to various external influences. This study aimed to identify the relationship between the priming of grapes by microorganisms and the functioning of the antioxidant system in a protective response to downy mildew infection. The experiment was carried out on leaf discs of Muscat blanc susceptible to downy mildew infected with Plasmopara viticola and treated with microorganisms incompatible with the pathogen, as well as with the corresponding symbiotic microorganisms. During the compatible interaction between P. viticola and grapes, oxidative processes were suppressed with viniferin formation. Leaf treatments with Saccharomyces cerevisiae and Bacillus subtilis effectively curbed the development of downy mildew on grape leaves. Priming with these microorganisms did not lead to a significant change in the biochemical parameters of grapes. Nevertheless, subsequent downy mildew infection initiated the formation of viniferin and maintained H2O2 content at a high level. Thus, priming with microorganisms eliminates the physiological effects of compatible interactions between downy mildew and grapes associated with blocking oxidative processes. To suppress pathogen development, host defenses and antagonistic effects of microbial priming agents are required
Xylella fastidiosa subsp. pauca is the causal agent of “olive quick decline syndrome” in Salento (Apulia, Italy). On April 2015, we started interdisciplinary studies to provide a sustainable control strategy for this pathogen that threatens the multi-millennial olive agroecosystem of Salento. Confocal laser scanning microscopy and fluorescence quantification showed that a zinc-copper-citric acid biocomplex—Dentamet®—reached the olive xylem tissue either after the spraying of the canopy or injection into the trunk, demonstrating its effective systemicity. The biocomplex showed in vitro bactericidal activity towards all X. fastidiosa subspecies. A mid-term evaluation of the control strategy performed in some olive groves of Salento indicated that this biocomplex significantly reduced both the symptoms and X. f. subsp. pauca cell concentration within the leaves of the local cultivars Ogliarola salentina and Cellina di Nardò. The treated trees started again to yield. A 1H-NMR metabolomic approach revealed, upon the treatments, a consistent increase in malic acid and γ-aminobutyrate for Ogliarola salentina and Cellina di Nardò trees, respectively. A novel endotherapy technique allowed injection of Dentamet® at low pressure directly into the vascular system of the tree and is currently under study for the promotion of resprouting in severely attacked trees. There are currently more than 700 ha of olive groves in Salento where this strategy is being applied to control X. f. subsp. pauca. These results collectively demonstrate an efficient, simple, low-cost, and environmentally sustainable strategy to control this pathogen in Salento.
Xylella fastidiosa (Xf) is a plant pathogen causing significant losses in agriculture worldwide. Originating from America, this bacterium caused recent epidemics in southern Europe and is thus considered an emerging pathogen. As the European regulations do not authorize antibiotic treatment in plants, alternative treatments are urgently needed to control the spread of the pathogen and eventually to cure infected crops. One such alternative is the use of phage therapy, developed more than 100 years ago to cure human dysentery and nowadays adapted to agriculture. The first step towards phage therapy is the isolation of the appropriate bacteriophages. With this goal, we searched for phages able to infect Xf strains that are endemic in the Mediterranean area. However, as Xf is truly a fastidious organism, we chose the phylogenetically closest and relatively fast-growing organism X. albineans as a surrogate host for the isolation step. Our results showed the isolation from various sources and preliminary characterization of several phages active on different Xf strains, namely, from the fastidiosa (Xff), multiplex (Xfm), and pauca (Xfp) subspecies, as well as on X. albilineans. We sequenced their genomes, described their genomic features, and provided a phylogeny analysis that allowed us to propose new taxonomic elements. Among the 14 genomes sequenced, we could identify two new phage species, belonging to two new genera of the Caudoviricetes order, namely, Usmevirus (Podoviridae family) and Subavirus (Siphoviridae family). Interestingly, no specific phages could be isolated from infected plant samples, whereas one was isolated from vector insects captured in a contaminated area, and several from surface and sewage waters from the Marseille area.
Lipopolysaccharides (LPS) are among the known pathogen-associated molecular patterns (PAMPs). LPSs are potent elicitors of PAMP-triggered immunity (PTI), and bacteria have evolved intricate mechanisms to dampen PTI. Here we demonstrate that Xylella fastidiosa (Xf), a hemibiotrophic plant pathogenic bacterium, possesses a long chain O-antigen that enables it to delay initial plant recognition, thereby allowing it to effectively skirt initial elicitation of innate immunity and establish itself in the host. Lack of the O-antigen modifies plant perception of Xf and enables elicitation of hallmarks of PTI, such as ROS production specifically in the plant xylem tissue compartment, a tissue not traditionally considered a spatial location of PTI. To explore translational applications of our findings, we demonstrate that pre-treatment of plants with Xf LPS primes grapevine defenses to confer tolerance to Xf challenge.
In autumn 2013, the presence of Xylella fastidiosa, a xylem-limited Gram-negative bacterium, was detected in olive stands of an area of the Ionian coast of the Salento peninsula (Apulia, southern Italy), that were severely affected by a disease denoted olive quick decline syndrome (OQDS). Studies were carried out for determining the involvement of this bacterium in the genesis of OQDS and of the leaf scorching shown by a number of naturally infected plants other than olive. Isolation in axenic culture was attempted and assays were carried out for determining its pathogenicity to olive, oleander and myrtle-leaf milkwort. The bacterium was readily detected by quantitative polymerase chain reaction (qPCR) in all diseased olive trees sampled in different and geographically separated infection foci, and culturing of 51 isolates, each from a distinct OQDS focus, was accomplished. Needle-inoculation experiments under different environmental conditions proved that the Salentinian isolate De Donno belonging to the subspecies pauca is able to multiply and systemically invade artificially inoculated hosts, reproducing symptoms observed in the field. Bacterial colonization occurred in prick-inoculated olives of all tested cultivars. However, the severity of and timing of symptoms appearance differed with the cultivar, confirming their differential reaction.
Paraburkholderia phytofirmans PsJN is a plant growth-promoting rhizobacterium (PGPR) that stimulates plant growth and improves tolerance to abiotic stresses. This study analyzed whether strain PsJN can reduce plant disease severity and proliferation of the virulent strain Pseudomonas syringae pv tomato (Pst) DC3000 in Arabidopsis plants, through the activation of induced resistance. Arabidopsis plants previously exposed to strain PsJN showed a reduction in disease severity and pathogen proliferation in leaves compared to non-inoculated, infected plants. The plant defense-related genes WRKY54, PR1, ERF1, and PDF1.2 demonstrated increased and more rapid expression in strain PsJN-treated plants compared to non-inoculated, infected plants. Transcriptional analyses and functional analysis using signaling mutant plants, suggested that resistance to infection by Pst DC3000 in plants treated with strain PsJN involves salicylic acid, jasmonate, and ethylene-signaling pathways to activate defense genes. Additionally, activation occurs through a specific PGPR-host recognition, being necessary a metabolically active state of the bacterium to trigger the resistance in Arabidopsis, with a strain PsJN-associated molecular pattern only partially involved in the resistance response. This study provides the first report on the mechanism used by the PGPR P. phytofirmans PsJN to protect A. thaliana against a widespread virulent pathogenic bacterium.
Abiotic stress has a growing impact on plant growth and agricultural activity worldwide. Specific plant growth promoting rhizobacteria have been reported to stimulate growth and tolerance to abiotic stress in plants, and molecular mechanisms like phytohormone synthesis and 1-aminocyclopropane-1-carboxylate deamination are usual candidates proposed to mediate these bacterial effects. Paraburkholderia phytofirmans PsJN is able to promote growth of several plant hosts, and improve their tolerance to chilling, drought and salinity. This work investigated bacterial determinants involved in PsJN stimulation of growth and salinity tolerance in Arabidopsis thaliana, showing bacteria enable plants to survive long-term salinity treatment, accumulating less sodium within leaf tissues relative to non-inoculated controls. Inactivation of specific bacterial genes encoding ACC deaminase, auxin catabolism, N-acyl-homoserine-lactone production, and flagellin synthesis showed these functions have little influence on bacterial induction of salinity tolerance. Volatile organic compound emission from strain PsJN was shown to reproduce the effects of direct bacterial inoculation of roots, increasing plant growth rate and tolerance to salinity evaluated both in vitro and in soil. Furthermore, early exposure to VOCs from P. phytofirmans was sufficient to stimulate long-term effects observed in Arabidopsis growth in the presence and absence of salinity. Organic compounds were analyzed in the headspace of PsJN cultures, showing production of 2-undecanone, 7-hexanol, 3-methylbutanol and dimethyl disulfide. Exposure of A. thaliana to different quantities of these molecules showed that they are able to influence growth in a wide range of added amounts. Exposure to a blend of the first three compounds was found to mimic the effects of PsJN on both general growth promotion and salinity tolerance. To our knowledge, this is the first report on volatile compound-mediated induction of plant abiotic stress tolerance by a Paraburkholderia species.
The bacterium Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC) and has been associated with important losses in commercial orchards of all sweet orange [Citrus sinensis (L.)] cultivars. The development of this disease depends on the environmental conditions, including the endophytic microbial community associated with the host plant. Previous studies have shown that X. fastidiosa interacts with the endophytic community in xylem vessels as well as in the insect vector, resulting in a lower bacterial population and reduced CVC symptoms. The citrus endophytic bacterium Methylobacterium mesophilicum can trigger X. fastidiosa response in vitro, which results in reduced growth and induction of genes associated with energy production, stress, transport, and motility, indicating that X. fastidiosa has an adaptive response to M. mesophilicum. Although this response may result in reduced CVC symptoms, the colonization rate of the endophytic bacteria should be considered in studies that intend to use this endophyte to suppress CVC disease. Symbiotic control is a new strategy that uses symbiotic endophytes as biological control agents to antagonize or displace pathogens. Candidate endophytes for symbiotic control of CVC must occupy the xylem of host plants and attach to the precibarium of sharpshooter insects to access the pathogen. In the present review, we focus on interactions between endophytic bacteria from sweet orange plants and X. fastidiosa, especially those that may be candidates for control of CVC.
Scientific Reports 6 : Article number: 18598 10.1038/srep18598 ; published online: 12 January 2016 ; updated: 25 February 2016 . The Acknowledgements section in this Article is incomplete.
Plant innate immunity serves as a surveillance system by providing the first line of powerful weapons to fight against pathogen attacks. Beneficial microorganisms and Microbial-Associated Molecular Patterns might act as signals to trigger this immunity. Burkholderia phytofirmans PsJN, a highly efficient plant beneficial endophytic bacterium, promotes growth in a wide variety of plants including grapevine. Further, the bacterium induces plant resistance against abiotic and biotic stresses. However, no study has deciphered triggered-mechanisms during the tripartite interaction between grapevine, B. phytofirmans PsJN and Botrytis cinerea. Herein, we showed that in contrast with classical rhizobacteria, which are restricted in the root system and act through ISR, B. phytofirmans PsJN is able to migrate until aerial part and forms at leaves surface a biofilm around B. cinerea mycelium to restrict the pathogen. Nevertheless, considering the endophytic level of PsJN in leaves, the plant protection efficacy of B. phytofirmans PsJN could not be explained solely by its direct antifungal effect. Deeper investigations showed a callose deposition, H2O2 production and primed expression of PR1, PR2, PR5, and JAZ only in bacterized-plantlets after pathogen challenge. The presence of PsJN modulated changes in leaf carbohydrate metabolism including gene expression, sugar levels, and chlorophyll fluorescence imaging after Botrytis challenge. Our findings indicated that protection induced by B. phytofirmans PsJN was multifaceted and relied on a direct antifungal effect, priming of defense mechanisms as well as the mobilization of carbon sources in grapevine leaf tissues.
Unlabelled:
Cell density-dependent regulation of gene expression in Xylella fastidiosa that is crucial to its switching between plant hosts and insect vectors is dependent on RpfF and its production of 2-enoic acids known as diffusible signal factor (DSF). We show that X. fastidiosa produces a particularly large variety of similar, relatively long-chain-length 2-enoic acids that are active in modulating gene expression. Both X. fastidiosa itself and a Pantoea agglomerans surrogate host harboring X. fastidiosa RpfF (XfRpfF) is capable of producing a variety of both saturated and unsaturated free fatty acids. However, only 2-cis unsaturated acids were found to be biologically active in X. fastidiosa X. fastidiosa produces, and is particularly responsive to, a novel DSF species, 2-cis-hexadecanoic acid that we term XfDSF2. It is also responsive to other, even longer 2-enoic acids to which other taxa such as Xanthomonas campestris are unresponsive. The 2-enoic acids that are produced by X. fastidiosa are strongly affected by the cellular growth environment, with XfDSF2 not detected in culture media in which 2-tetradecenoic acid (XfDSF1) had previously been found. X. fastidiosa is responsive to much lower concentrations of XfDSF2 than XfDSF1. Apparently competitive interactions can occur between various saturated and unsaturated fatty acids that block the function of those agonistic 2-enoic fatty acids. By altering the particular 2-enoic acids produced and the relative balance of free enoic and saturated fatty acids, X. fastidiosa might modulate the extent of DSF-mediated quorum sensing.
Importance:
X. fastidiosa, having a complicated lifestyle in which it moves and multiplies within plants but also must be vectored by insects, utilizes DSF-based quorum sensing to partition the expression of traits needed for these two processes within different cells in this population based on local cellular density. The finding that it can produce a variety of DSF species in a strongly environmentally context-dependent manner provides insight into how it coordinates the many genes under the control of DSF signaling to successfully associate with its two hosts. Since the new DSF variant XfDSF2 described here is much more active than the previously recognized DSF species, it should contribute to plant disease control, given that the susceptibility of plants can be greatly reduced by artificially elevating the levels of DSF in plants, creating "pathogen confusion," resulting in lower virulence.
A valuable strategy to improve crop yield consists in the use of plant growth-promoting rhizobacteria (PGPRs). However, the influence of PGPR colonization on plant physiology is largely unknown. PGPR Burkholderia phytofirmans strain PsJN (Bp PsJN) colonized only Arabidopsis thaliana roots after seed or soil inoculation. Foliar bacteria were detected only after leaf infiltration. Since, different bacterial times of presence and/or locations in host plant could lead to different plant physiological responses, photosynthesis, and metabolite profiles in A. thaliana leaves were thus investigated following leaf, root, or seed inoculation with Bp PsJN. Only Bp PsJN leaf colonization transiently decreased cyclic electron transport and effective quantum yield of photosystem I (PSI), and prevented a decrease in net photosynthesis and stomatal opening compared to the corresponding control. Metabolomic analysis revealed that soluble sugars, amino acids or their derivatives accumulated differently in all Bp PsJN-inoculated plants. Octanoic acid accumulated only in case of inoculated plants. Modifications in vitamin, organic acid such as tricarboxylic acid intermediates, and hormone amounts were dependent on bacterial time of presence and location. Additionally, a larger array of amino acids and hormones (auxin, cytokinin, abscisic acid) were modified by seed inoculation with Bp PsJN. Our work thereby provides evidence that relative short-term inoculation with Bp PsJN altered physiological status of A. thaliana leaves, whereas long-term bacterization triggered modifications on a larger set of metabolites. Our data highlighted the changes displayed during this plant–microbe interaction to trigger physiological and metabolic responses that could explain the increase in plant growth or stress tolerance conferred by the presence of Bp PsJN.
Pierce’s disease (PD) of grapevines is caused by Xylella fastidiosa (Xf), a xylem-limited gamma-proteobacterium that is responsible for several economically important crop diseases. The occlusion of xylem elements and interference with water transport by Xf and its associated biofilm have been posited as the main cause of PD symptom development; however, Xf virulence mechanisms have not been described. Analysis of the Xf secretome revealed a putative lipase/esterase (LesA) that was abundantly secreted in bacterial culture supernatant and was characterized as a protein ortholog of the cell wall-degrading enzyme LipA of Xanthomonas strains. LesA was secreted by Xf and associated with a biofilm filamentous network. Additional proteomic analysis revealed its abundant presence in outer membrane vesicles (OMVs). Accumulation of LesA in leaf regions associated positively with PD symptoms and inversely with bacterial titer. The lipase/esterase also elicited a hypersensitive response in grapevine. Xf lesA mutants were significantly deficient for virulence when mechanically inoculated into grapevines. We propose that Xf pathogenesis is caused by LesA secretion mediated by OMV cargos and that its release and accumulation in leaf margins leads to early stages of observed PD symptoms.
The genus Burkholderia contains large number of diverse species which include many clinically important organisms, phytopathogens, as well as environmental species. However, currently, there is a paucity of biochemical or molecular characteristics which can reliably distinguish different groups of Burkholderia species. We report here the results of detailed phylogenetic and comparative genomic analyses of 45 sequenced species of the genus Burkholderia. In phylogenetic trees based upon concatenated sequences for 21 conserved proteins as well as 16S rRNA gene sequence based trees, members of the genus Burkholderia grouped into two major clades. Within these main clades a number of smaller clades including those corresponding to the clinically important Burkholderia cepacia complex (BCC) and the Burkholderia pseudomallei groups were also clearly distinguished. Our comparative analysis of protein sequences from Burkholderia spp. has identified 42 highly specific molecular markers in the form of conserved sequence indels (CSIs) that are uniquely found in a number of well-defined groups of Burkholderia spp. Six of these CSIs are specific for a group of Burkholderia spp. (referred to as Clade I in this work) which contains all clinically relevant members of the genus (viz. the BCC and the B. pseudomallei group) as well as the phytopathogenic Burkholderia spp. The second main clade (Clade II), which is composed of environmental Burkholderia species, is also distinguished by 2 identified CSIs that are specific for this group. Additionally, our work has also identified multiple CSIs that serve to clearly demarcate a number of smaller groups of Burkholderia spp. including 3 CSIs that are specific for the B. cepacia complex, 4 CSIs that are uniquely found in the B. pseudomallei group, 5 CSIs that are specific for the phytopathogenic Burkholderia spp. and 22 other CSI that distinguish two groups within Clade II. The described molecular markers provide highly specific means for the demarcation of different groups of Burkholderia spp. and they also offer novel and useful targets for the development of diagnostic assays for the clinically important members of the BCC or the pseudomallei groups. Based upon the results of phylogenetic analyses, the identified CSIs and the pathogenicity profile of Burkholderia species, we are proposing a division of the genus Burkholderia into two genera. In this new proposal, the emended genus Burkholderia will correspond to the Clade I and it will contain only the clinically relevant and phytopathogenic Burkholderia species. All other Burkholderia spp., which are primarily environmental, will be transferred to a new genus Paraburkholderia gen. nov.
Discovery of Xylella fastidiosa from olive trees with “Olive quick decline syndrome” in October 2013 on the west coast of the Salento Peninsula prompted an immediate search for insect vectors of the bacterium. The dominant xylem-fluid feeding hemipteran collected in olive orchards during a 3-mo survey was the meadow spittlebug, Philaenus spumarius (L.) (Hemiptera: Aphrophoridae). Adult P. spumarius, collected in November 2013 from ground vegetation in X. fastidiosa-infected olive orchards, were 67% (40 out of 60) positive for X. fastidiosa by polymerase chain reaction (PCR) assays. Euscelis lineolatus Brullé were also collected but tested negative for the pathogen. Transmission tests with P. spumarius collected from the Salento area were, therefore, conducted. After a 96-h inoculation access period with 8 to 10 insects per plant and a 30-d incubation period, PCR results showed P. spumarius transmitted X. fastidiosa to two of five periwinkle plants but not to the seven olive plants. Sequences of PCR products from infected periwinkle were identical with those from X. fastidiosa-infected field trees. These data showed P. spumarius as a vector of X. fastidiosa strain infecting olives trees in the Salento Peninsula, Italy.
Beneficial microbes in the microbiome of plant roots improve plant health. Induced systemic resistance (ISR) emerged as an important mechanism by which selected plant growth-promoting bacteria and fungi in the rhizosphere prime the whole plant body for enhanced defense against a broad range of pathogens and insect herbivores. A wide variety of root-associated mutualists, including Pseudomonas, Bacillus, Trichoderma, and mycorrhiza species sensitize the plant immune system for enhanced defense without directly activating costly defenses. This review focuses on molecular processes at the interface between plant roots and ISR-eliciting mutualists, and on the progress in our understanding of ISR signaling and systemic defense priming. The central role of the root-specific transcription factor MYB72 in the onset of ISR and the role of phytohormones and defense regulatory proteins in the expression of ISR in aboveground plant parts are highlighted. Finally, the ecological function of ISR-inducing microbes in the root microbiome is discussed. Expected final online publication date for the Annual Review of Phytopathology Volume 52 is August 04, 2014. Please see http://www.annualreviews.org/catalog/pubdates.aspx for revised estimates.
The rpfF gene from Xylella fastidiosa, encoding the synthase for diffusible signal factor (DSF), was expressed in 'Freedom' grape to reduce the pathogen's growth and mobility within the plant. Symptoms in such plants were restricted to near the point of inoculation and incidence of disease was two- to fivefold lower than in the parental line. Both the longitudinal and lateral movement of X. fastidiosa in the xylem was also much lower. DSF was detected in both leaves and xylem sap of RpfF-expressing plants using biological sensors, and both 2-Z-tetradecenoic acid, previously identified as a component of X. fastidiosa DSF, and cis-11-methyl-2-dodecenoic acid were detected in xylem sap using electrospray ionization mass spectrometry. A higher proportion of X. fastidiosa cells adhered to xylem vessels of the RpfF-expressing line than parental 'Freedom' plants, reflecting a higher adhesiveness of the pathogen in the presence of DSF. Disease incidence in RpfF-expressing plants in field trials in which plants were either mechanically inoculated with X. fastidiosa or subjected to natural inoculation by sharpshooter vectors was two- to fourfold lower in than that of the parental line. The number of symptomatic leaves on infected shoots was reduced proportionally more than the incidence of infection, reflecting a decreased ability of X. fastidiosa to move within DSF-producing plants.
The role of flagellin perception in the context of plant beneficial bacteria still remains unclear. Here, we characterized the flagellin sensing system flg22– FLAGELLIN SENSING 2 ( FLS 2) in grapevine, and analyzed the flagellin perception in the interaction with the endophytic plant growth‐promoting rhizobacterium ( PGPR ) B urkholderia phytofirmans .
The functionality of the grapevine FLS 2 receptor, Vv FLS 2, was demonstrated by complementation assays in the A rabidopsis thaliana fls2 mutant, which restored flg22‐induced H 2 O 2 production and growth inhibition. Using synthetic flg22 peptides from different bacterial origins, we compared recognition specificities between V v FLS 2 and At FLS 2.
In grapevine, flg22‐triggered immune responses are conserved and led to partial resistance against B otrytis cinerea . Unlike flg22 peptides derived from P seudomonas aeruginosa or X anthomonas campestris , flg22 peptide derived from B . phytofirmans triggered only a small oxidative burst, weak and transient defense gene induction and no growth inhibition in grapevine. Although, in A rabidopsis, all the flg22 epitopes exhibited similar biological activities, the expression of V v FLS 2 into the fls2 background conferred differential flg22 responses characteristic for grapevine.
These results demonstrate that V v FLS 2 differentially recognizes flg22 from different bacteria, and suggest that flagellin from the beneficial PGPR B . phytofirmans has evolved to evade this grapevine immune recognition system.
Xylella fastidiosa, like related Xanthomonas species, employs an Rpf cell-cell communication system consisting of a diffusible signal factor (DSF) synthase, RpfF, and
a DSF sensor, RpfC, to coordinate expression of virulence genes. While phenotypes of a ΔrpfF strain in Xanthomonas campestris could be complemented by its own DSF, the DSF produced by X. fastidiosa (XfDSF) did not restore expression of the XfDSF-dependent genes hxfA and hxfB to a ΔrpfF strain of X. fastidiosa, suggesting that RpfF is involved in XfDSF sensing or XfDSF-dependent signaling. To test this conjecture, rpfC and rpfF of X. campestris were replaced by those of X. fastidiosa, and the contribution of each gene to the induction of a X. campestris DSF-dependent gene was assessed. As in X. fastidiosa, XfDSF-dependent signaling required both X. fastidiosa proteins RpfF and RpfC. RpfF repressed RpfC signaling activity, which in turn was derepressed by XfDSF. A mutated X. fastidiosa RpfF protein with two substitutions of glutamate to alanine in its active site was incapable of XfDSF production yet enabled a response to XfDSF, indicating that XfDSF production and the response to XfDSF are two separate functions in which RpfF is involved. This mutant was also hypervirulent to grape, demonstrating the antivirulence
effects of XfDSF itself in X. fastidiosa. The Rpf system of X. fastidiosa is thus a novel example of a quorum-sensing signal synthase that is also involved in the response to the signal molecule
that it synthesizes.
Endophytic bacteria are ubiquitous in most plant species, residing latently or actively colonizing plant tissues locally as well as systemically. Several definitions have been proposed for endophytic bacteria; in this review endophytes will be defined as those bacteria that can be isolated from surface-disinfested plant tissue or extracted from within the plant, and that do not visibly harm the plant. While this definition does not include nonextractable endophytic bacteria, it is a practical definition based on experimental limitations and is inclusive of bacterial symbionts, as well as internal plant-colonizing nonpathogenic bacteria with no known beneficial or detrimental effects on colonized plants. Historically, endophytic bacteria have been thought to be weakly virulent plant pathogens but have recently been discovered to have several beneficial effects on host plants, such as plant growth promotion and increased resistance against plant pathogens and parasites. In general, endophytic bacteria originate from the epiphytic bacterial communities of the rhizosphere and phylloplane, as well as from endophyte-infested seeds or planting materials. Besides gaining entrance to plants through natural openings or wounds, endophytic bacteria appear to actively penetrate plant tissues using hydrolytic enzymes like cellulase and pectinase. Since these enzymes are also produced by pathogens, more knowledge on their regulation and expression is needed to distinguish endophytic bacteria from plant pathogens. In general, endophytic bacteria occur at lower population densities than pathogens, and at least some of them do not induce a hypersensitive response in the plant, indicating that they are not recognized by the plant as pathogens. Evolutionarily, endophytes appear to be intermediate between saprophytic bacteria and plant pathogens, but it can only be speculated as to whether they are saprophytes evolving toward pathogens, or are more highly evolved than plant pathogens and conserve protective shelter and nutrient supplies by not killing their host. Overall, the endophytic microfloral community is of dynamic structure and is influenced by biotic and abiotic factors, with the plant itself constituting one of the major influencing factors. Since endophytic bacteria rely on the nutritional supply offered by the plant, any parameter affecting the nutritional status of the plant could consequently affect the endophytic community. This review summarizes part of the work being done on endophytic bacteria, including their methodology, colonization, and establishment in the host plant, as well as their role in plant–microbe interactions. In addition, speculative conclusions are raised on some points to stimulate thought and research on endophytic bacteria.Key words: endophytic bacteria, methods, localization, diversity, biological control.
Burkholderia phytofirmans PsJN is a naturally occurring plant-associated bacterial endophyte that effectively colonizes a wide range of plants and stimulates their growth and vitality. Here we analyze whole genomes, of PsJN and of eight other endophytic bacteria. This study illustrates that a wide spectrum of endophytic life styles exists. Although we postulate the existence of typical endophytic traits, no unique gene cluster could be exclusively linked to the endophytic lifestyle. Furthermore, our study revealed a high genetic diversity among bacterial endophytes as reflected in their genotypic and phenotypic features. B. phytofirmans PsJN is in many aspects outstanding among the selected endophytes. It has the biggest genome consisting of two chromosomes and one plasmid, well-equipped with genes for the degradation of complex organic compounds and detoxification, e.g., 24 glutathione-S-transferase (GST) genes. Furthermore, strain PsJN has a high number of cell surface signaling and secretion systems and harbors the 3-OH-PAME quorum-sensing system that coordinates the switch of free-living to the symbiotic lifestyle in the plant-pathogen R. solanacearum. The ability of B. phytofirmans PsJN to successfully colonize such a wide variety of plant species might be based on its large genome harboring a broad range of physiological functions.
Unlabelled:
Cell-cell signaling in Xylella fastidiosa has been implicated in the coordination of traits enabling colonization in plant hosts as well as insect vectors. This cell density-dependent signaling has been attributed to a diffusible signaling factor (DSF) produced by the DSF synthase RpfF. DSF produced by related bacterial species are unsaturated fatty acids, but that of X. fastidiosa was thought to be different from those of other taxa. We describe here the isolation and characterization of an X. fastidiosa DSF (XfDSF) as 2(Z)-tetradecenoic acid. This compound was isolated both from recombinant Erwinia herbicola expressing X. fastidiosa rpfF and from an X. fastidiosa rpfC deletion mutant that overproduces DSF. Since an rpfF mutant is impaired in biofilm formation and underexpresses the hemagglutinin-like protein-encoding genes hxfA and hxfB, we demonstrate that these traits can be restored by ca. 0.5 µM XfDSF but not by myristic acid, the fully saturated tetradecenoic acid. A phoA-based X. fastidiosa biosensor that assesses DSF-dependent expression of hxfA or hxfB revealed a high level of molecular specificity of DSF signaling.
Importance:
X. fastidiosa causes diseases in many important plants, including grape, where it incites Pierce's disease. Virulence of X. fastidiosa for grape is coordinated by cell-cell signaling molecules, designated DSF (Diffusible Signaling Factor). Mutants blocked in DSF production are hypervirulent for grape, suggesting that virulence is suppressed upon DSF accumulation and that disease could be controlled by artificial elevation of the DSF level in plants. In this work, we describe the isolation of the DSF produced by X. fastidiosa and the verification of its biological activity as an antivirulence factor. We also have developed X. fastidiosa DSF biosensors to evaluate the specificity of cell-cell signaling to be investigated.
