No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Biological Control of Pierce’s Disease of Grape by an Endophytic Bacterium
Abstract
Effective preventive measures and therapies are lacking for control of Pierce's disease of grape caused by the xylem-colonizing bacterium Xylella fastidiosa responsible for serious losses in grape production. In this study we explored the potential for endophytic bacteria to alter the disease process. While most endophytic bacteria found within grape did not grow or multiply when inoculated into mature grape vines, Paraburkholderia phytofirmans strain PsJN achieved population sizes as large as 106 cells/g and moved 1 m or more within 4 weeks after inoculation into vines. While X. fastidiosa achieved large population sizes and moved extensively in grape when inoculated alone, few viable cells were recovered from plants in which it was co-inoculated with strain PsJN and the incidence of leaves exhibiting scorching symptoms typical of Pierce's disease was consistently greatly reduced from that in control plants. Suppression of disease symptoms occurred not only when strain PsJN was co-inoculated with the pathogen by puncturing stems in the same site in plants, but also when inoculated at the same time but at different sites in the plant. Large population sizes of strain PsJN could be established in both leaf lamina and petioles by topical application of cell suspensions in 0.2% of an organo-silicon surfactant conferring low surface tension, and such treatments were as effective as direct puncture inoculations of this biocontrol strain in reducing disease severity. While inoculation of strain PsJN into plants by either method at the same time as or even 4 weeks after that of the pathogen resulted in large reductions in disease severity, much less disease control was conferred by inoculation of PsJN 4 weeks prior to that of the pathogen. The expression of grapevine PR1 and ETR1 within 3 weeks of inoculation was substantially higher in plants inoculated with both X. fastidiosa and strain PsJN compared with that in plants inoculated only with the pathogen or strain PsJN, suggesting that this biological control agent reduces disease by priming expression of innate disease resistance pathways in plants that otherwise would have exhibited minimal responses to the pathogen. Strain PsJN thus appears highly efficacious for the control of Pierce's disease when used as an eradicant treatment that can be easily made even by spray application.
... For example, in the flowering plant Catharanthus roseus, the endophyte Curtobacterium flaccumfaciens inhibited the growth of X. fastidiosa in vitro and reduced the symptoms caused by this bacterium to the plant host [14]. It can be challenging to identify beneficial plant-associated microbes with antagonistic activity against X. fastidiosa [15], but it is crucial to develop novel control methods against diseases caused by these bacteria [16]. In their work, Vergine et al. [11] identified some taxa found predominantly in the 'Leccino' cultivar which were proposed to be potentially involved in the resistance of cultivar to X. fastidiosa. ...
... Interestingly, BYDV virulence was reduced in endophyte-colonized plants, suggesting that host response modulation by endophytes could reduce pathogen virulence [23]. Similarly, the inoculation of the endophytic bacterium P. phytofirmans strain PsJN triggered the expression of the grapevine PR-1 gene and reduced plant colonization by X. fastidiosa, and also decreased the PD symptoms caused by the pathogen in grapevine [16]. PR-1 activation is indicative of the induction of salicylic acid (SA)-mediated host defenses [8,16]. ...
... Similarly, the inoculation of the endophytic bacterium P. phytofirmans strain PsJN triggered the expression of the grapevine PR-1 gene and reduced plant colonization by X. fastidiosa, and also decreased the PD symptoms caused by the pathogen in grapevine [16]. PR-1 activation is indicative of the induction of salicylic acid (SA)-mediated host defenses [8,16]. Interestingly, X. fastidiosa infection does not trigger SA-mediated defense pathways during early phases of infection, which is associated with higher virulence in plants [8]. ...
Xylella fastidiosa is a vector-borne plant vascular bacterial pathogen that causes several economically important diseases, including Pierce’s disease (PD) in grapevine and olive quick decline syndrome (OQDS) in olive trees, among others [...]
... Furthermore, antibiotics are banned in the EU as a treatment against bacterial plant diseases [13]. Several minerals and compounds in addition to microbial endophytes as biocontrol agents have been tested in America and Italy, showing some protection against Xf infections in grapevines [14], citrus [15], and olive trees [16]; however, their large-scale application is still economically expensive [13]. For this reason, efforts are also being made to find alternative control systems to those directed solely at the bacterium as an economically sustainable strategy over time. ...
... Three main subspecies with allopatric origins, pauca, fastidiosa and multiplex, are known from South, Central, and North America, respectively [8]. Within each subspecies, diverse genetic lineages with different host ranges have evolved [14]. Genetic recombination among subspecies seems to provide the main source of genetic variation, which may lead to host jumps [17,18]. ...
... In addition, germplasm banks of crop varieties have been intensively monitored and sampled during the past years. This information has been used to legislate the planting authorization of certain varieties through the Resolution of 14 In addition, the launch of New Generation funds is promoting a restructuring plan for rainfed fruit plantations in the Balearic Islands for the period 2021-2027. The objectives of the plan are the recovery of part of the lost area, the improvement of the efficiency in the production and transformation, and the increase in the commercialization of derived or elaborated products raising the agricultural income associated with the agriculture sector. ...
The emergence of Xylella fastidiosa (Xf) in the Balearic Islands in October 2016 was a major phytosanitary challenge with international implications. Immediately after its detection, eradication and containment measures included in Decision 2015/789 were implemented. Surveys intensified during 2017, which soon revealed that the pathogen was widely distributed on the islands and eradication measures were no longer feasible. In this review, we analyzed the control measures carried out by the Balearic Government in compliance with European legislation, as well as the implementation of its control action plan. At the same time, we contrasted them with the results of scientific research accumulated since 2017 on the epidemiological situation. The case of Xf in the Balearic Islands is paradigmatic since it concentrates on a small territory with one of the widest genetic diversities of Xf affecting crops and forest ecosystems. We also outline the difficulties of anticipating unexpected epidemiological situations in the legislation on harmful exotic organisms on which little biological information is available. Because Xf has become naturalized in the islands, coexistence alternatives based on scientific knowledge are proposed to reorient control strategies towards the main goal of minimizing damage to crops and the landscape.
... In grapevine, this strain has been proven to stimulate the growth of root and aerial parts after inoculation (Barka et al. 2000). In addition, this bacterium showed a protection efficacy against gray mold disease caused by Botrytis cinerea (Barka et al. 2000;Miotto-Vilanova et al. 2016 and Pierce's disease caused by Xylella fastidiosa (Baccari et al. 2019). In grapevine plantlets grown in vitro, PsJN can migrate from the root tips up to aerial parts within 7 days after being inoculated through roots (Compant et al. 2005;Miotto-Vilanova et al. 2019). ...
... PsJN was previously described as an antagonist of the fungal pathogen B. cinerea on grapevine by inhibiting spore germination (Barka et al. 2002;Miotto-Vilanova et al. 2016) and having an impact on the physiology of Drechslera teres on barley (Backes et al. 2020), probably thanks to its cell wall degrading enzymes. However, PsJN was reported to have no antibacterial action against Pseudomonas syringae (Su et al. 2017) and X. fastidiosa (Baccari et al. 2019). To the best of our knowledge, this is the first study to describe any antimicrobial effect of PsJN against a phytopathogenic bacterium, although its precise mechanism remains unknown. ...
... Previously, PsJN was reported as triggering induced resistance in Arabidopsis thaliana against P. syringae (Su et al. 2017;Timmermann et al. 2019), in grapevine against B. cinerea (Miotto-Vilanova et al. 2016) and X. fastidiosa (Baccari et al. 2019), and in tomato against Fusarium oxysporum (Frommel et al. 1991b). Therefore, we hypothesized that the impact of PsJN against AvS4 could be explained via the plant host. ...
Controlling crown gall in grapevine (Vitis viniferaL.) caused by the pathogenicbacteriumAllorhizobium vitisis a major challenge for global viticulture, as thispathogen is highly persistent in vineyards once infected. The bacteria can en-ter the plant through open wounds during pruning and then systemically colo-nize the plant. This study aimed at evaluating the potential ofParaburkholderiaphytofirmansPsJN, a beneficial endophytic bacterium able to colonize the xylemof grapevine, the same ecological niche asA. vitis, to control grapevine crown galldisease.P. phytofirmansPsJN was root-inoculated on grapevine plantlets beforeinfection byA. vitisS4 on shoots.A. vitisS4 level in planta, vitopine production, ac-cumulation of lignin in tumors, and symptoms of crown gall were investigated ongrapevine prebacterized or not with PsJN. The expression of 28 grapevine genesinvolved in defense mechanisms was also simultaneously determined by quanti-tative real-time PCR. Despite a direct antibacterial effect againstAvS4, PsJN hasno significant impact on the incidence of crown gall or disease severity. However,PsJN leads to a stronger accumulation of vitopine in tumors and significantlyreduced the population level of the pathogen in planta.
... In grapevine, this strain has been proven to stimulate the growth of root and aerial parts after inoculation (Barka et al. 2000). In addition, this bacterium showed a protection efficacy against gray mold disease caused by Botrytis cinerea (Barka et al. 2000;Miotto-Vilanova et al. 2016 and Pierce's disease caused by Xylella fastidiosa (Baccari et al. 2019). In grapevine plantlets grown in vitro, PsJN can migrate from the root tips up to aerial parts within 7 days after being inoculated through roots (Compant et al. 2005;Miotto-Vilanova et al. 2019). ...
... PsJN was previously described as an antagonist of the fungal pathogen B. cinerea on grapevine by inhibiting spore germination (Barka et al. 2002;Miotto-Vilanova et al. 2016) and having an impact on the physiology of Drechslera teres on barley (Backes et al. 2020), probably thanks to its cell wall degrading enzymes. However, PsJN was reported to have no antibacterial action against Pseudomonas syringae (Su et al. 2017) and X. fastidiosa (Baccari et al. 2019). To the best of our knowledge, this is the first study to describe any antimicrobial effect of PsJN against a phytopathogenic bacterium, although its precise mechanism remains unknown. ...
... Previously, PsJN was reported as triggering induced resistance in Arabidopsis thaliana against P. syringae (Su et al. 2017;Timmermann et al. 2019), in grapevine against B. cinerea (Miotto-Vilanova et al. 2016) and X. fastidiosa (Baccari et al. 2019), and in tomato against Fusarium oxysporum (Frommel et al. 1991b). Therefore, we hypothesized that the impact of PsJN against AvS4 could be explained via the plant host. ...
Controlling crown gall in grapevine ( Vitis vinifera L.) caused by the pathogenic bacterium Allorhizobium vitis is a major challenge for global viticulture, as this pathogen is highly persistent in vineyards once infected. The bacteria can enter the plant through open wounds during pruning and then systemically colonize the plant. This study aimed at evaluating the potential of Paraburkholderia phytofirmans PsJN, a beneficial endophytic bacterium able to colonize the xylem of grapevine, the same ecological niche as A. vitis, to control grapevine crown gall disease. P. phytofirmans PsJN was root-inoculated on grapevine plantlets before infection by A. vitis S4 on shoots. A. vitis S4 level in planta, vitopine production, accumulation of lignin in tumors, and symptoms of crown gall were investigated on grapevine prebacterized or not with PsJN. The expression of 28 grapevine genes involved in defense mechanisms was also simultaneously determined by quantitative real-time PCR. Despite a direct antibacterial effect against AvS4, PsJN has no significant impact on the incidence of crown gall or disease severity. However, PsJN leads to a stronger accumulation of vitopine in tumors and significantly reduced the population level of the pathogen in planta.
[Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .
... The aim was to make peptides that could bind to transport proteins in the GWSS midgut microvillar membrane or to GWSS salivary enzymes. The best candidate target so far is V-ATPase c, a protein that affects H+/K+ transport, which in turn maintains insect gut pH Ahern et al., 2014;Das et al., 2015 Antagonistic bacteria Inoculating with P. phytofirmans strain PsJN Tested in the greenhouse Lindow et al., 2015Lindow et al., , 2017a Natural, antibacterial substances Radicinin Tested in vitro Rolshausen et al., 2015Rolshausen et al., , 2017 Antibiotics tetracycline, gentamicin, ampicillin, kanamycin, novobiocin, chloramphenicol and rifampin Tested in vitro Kuzina et al., 2006 Inoculating with antibiotic streptomycin Tested in the greenhouse Kirkpatrick et al., 2004 Antimicrobial peptides PGQ, indolicidin, magainin 2, and dermaseptin (Federici, 2005). Tests are still ongoing to ensure the efficiency of the constructed antibody peptides. ...
... Although the titer and spread of PsJN within the vines 6 weeks after inoculation resembled that of XYLEFA, population sizes measured 12 weeks after inoculation were quite low (Lindow et al., 2015). In planta experiments demonstrated that the endophyte can inhibit growth of XYLEFA in various vine cultivars when co-inoculated or even when inoculated 30 days after the pathogen (Lindow et al., 2017a). Another attractive characteristic is that PsJN can control PD not only when inoculated but also when applied foliarly, provided it is combined with a penetrative surfactant (Lindow et al., 2015). ...
... Another attractive characteristic is that PsJN can control PD not only when inoculated but also when applied foliarly, provided it is combined with a penetrative surfactant (Lindow et al., 2015). Field experiments and further attempts to decipher how PsJN mediates control of PD are in progress (Lindow et al., 2017a). Results indicate that PD mitigation does not derive from a putative rpfF gene of PsJN. ...
Xylella fastidiosa is a notorious plant pathogenic bacterium that represents a threat to crops worldwide. Its subspecies, Xylella fastidiosa subsp. fastidiosa is the causal agent of Pierce's disease of grapevines. Pierce's disease has presented a serious challenge for the grapevine industry in the United States and turned into an epidemic in Southern California due to the invasion of the insect vector Homalodisca vitripennis. In an attempt to minimize the effects of Xylella fastidiosa subsp. fastidiosa in vineyards, various studies have been developing and testing strategies to prevent the occurrence of Pierce's disease, i.e., prophylactic strategies. Research has also been undertaken to investigate therapeutic strategies to cure vines infected by Xylella fastidiosa subsp. fastidiosa. This report explicitly reviews all the strategies published to date and specifies their current status. Furthermore, an epidemiological model of Xylella fastidiosa subsp. fastidiosa is proposed and key parameters for the spread of Pierce's disease deciphered in a sensitivity analysis of all model parameters. Based on these results, it is concluded that future studies should prioritize therapeutic strategies, while investments should only be made in prophylactic strategies that have demonstrated promising results in vineyards.
... No cure has been found to be effective for the control of X. fastidiosa, neither for ALS nor for the other diseases caused by this pathogenic bacterium (Kyrkou et al. 2018). Different strategies, such as chemical control using oxytetracycline or a Zn, Cu, and citric acid fertilizer (Amanifar et al. 2016;Bruno et al. 2021;Dongiovanni et al. 2017;Scortichini et al. 2018), biological control using endophytes (Baccari et al. 2019;Lacava et al. 2006Lacava et al. , 2007, and agricultural practices such as high-grafting on peach rootstock limbs (Cao et al. 2013), have been studied in different host plants under greenhouse and field conditions. Nevertheless, the general conclusion is that some treatments revitalize trees and reduce the symptoms, but X. fastidiosa is still detectable, resulting in the reappearance of the disease when the treatment ceases (Bragard et al. 2019). ...
... The activation of the SA pathway, which is the one that seems to be mainly triggered by BP178 in almond, could result in the activation of SAR which would cause a priming effect on the plants before X. fastidiosa inoculation. Priming grapevines with the endophytic bacteria Paraburkholderia phytofirmans PsJN, or with mutant cells of X. fastidiosa that lacked the O-antigen fragment of the lipopolysaccharide, activated the SA-mediated defense pathway and caused a reduction in X. fastidiosa population and Pierce's disease severity (Baccari et al. 2019;Rapicavoli et al. 2018). Moreover, the resistant olive cultivar Leccino also presents higher levels of SA when infected with X. fastidiosa (Novelli et al. 2019), in addition to an increase in reactive oxygen species (ROS), secondary metabolites (flavonoids and tannins) and lignin synthesis (Giampetruzzi et al. 2016). ...
Xylella fastidiosa is a plant pathogenic bacterium that has been introduced in the European Union (EU), causing significant yield losses in economically important Mediterranean crops. Almond leaf scorch (ALS) is currently one of the most relevant diseases observed in Spain, and no cure has been found to be effective for this disease. In previous reports, the peptide BP178 has shown a strong bactericidal activity in vitro against X. fastidiosa and to other plant pathogens, and to trigger defense responses in tomato plants. In the present work, BP178 was applied by endotherapy to almond plants of cultivar Avijor using preventive and curative strategies. The capacity of BP178 to reduce the population levels of X. fastidiosa and to decrease disease symptoms and its persistence over time were demonstrated under greenhouse conditions. The most effective treatment consisted of a combination of preventive and curative applications, and the peptide was detected in the stem up to 60 days posttreatment. Priming plants with BP178 induced defense responses mainly through the salicylic acid pathway, but also overexpressed some genes of the jasmonic acid and ethylene pathways. It is concluded that the bifunctional peptide is a promising candidate to be further developed to manage ALS caused by X. fastidiosa.
[Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .
... Generally, whether a strain can colonise leaves or other tissues internally will depend on the genetic repertoire of the microorganism, the plant species and cultivar and the environmental conditions. The P. phytofirmans strain PsJN is known to reduce grapevine Pierce disease infection by the pathogen Xylella fastidiosa (Baccari et al., 2019). This deleterious pathogen colonises xylem vessels, blocks water supply, induces leaf scorches and can kill the plant. ...
... This deleterious pathogen colonises xylem vessels, blocks water supply, induces leaf scorches and can kill the plant. As the PsJN strain is known to systemically colonise plants by spreading through the xylem vessels, Baccari et al. (2019) inoculated strain PsJN into a branch using a syringe and thereby reduced Xylella pathogen loads. Knowing the niches of colonisation and the routes used by beneficial bacteria can provide information regarding new strategies for crop protection. ...
Plants contain diverse microorganisms that interact with their hosts and with each other. Beneficial bacteria can be utilised on crops to protect plants against biotic and abiotic stresses and to stimulate plant growth. However, the behaviour of specific microorganisms on and within plants is still underexplored. Knowledge of bacterial colonisation behaviour and the precise ecological niches in a natural environment of a target strain can lead to better application and utilisation of these microorganisms for crop enhancement, in different plant soil environments, and for both biocontrol and biofertilisation approaches in organic and integrated protection systems. Understanding colonisation characteristics will also provide information on putative new strategies for maximising inoculation efficiency and thus crop enhancement. In this chapter, we set out how beneficial bacteria can colonise their host plants under various conditions and demonstrate how an understanding of plant colonisation can be used to improve bacterial application approaches.
... Recently, there has been increasing interests in research related on bacteriomes/microbiomes of plant diseases that could provide useful information for disease management. For example, grape Pierce's disease (PD), caused by Xylella fastidiosa in California, was found to be effectively controlled by the inoculation of a bacterial endophyte, Paraburkholderia phytofirmans (Baccari et al., 2019). Strains of Burkholderia in citrus roots could trigger expression of disease-resistant genes (Zhang et al., 2017). ...
... It is interesting that Paraburkholderia strain A-SBCA19 was highly similar to Pa. phytofirmans strain PsJN (ANI = 95.34, Figure 4). Strain PsJN showed its biocontrol capacity grape PD (Baccari et al., 2019). ...
Citrus Huanglongbing (HLB; yellow shoot disease) is associated with an unculturable α-proteobacterium “Candidatus Liberibacter asiaticus” (CLas). HLB was found in southern California in 2012, and the current management strategy is based on suppression of the Asian citrus psyllid (Diaphorina citri) that transmits CLas and removal of confirmed CLas-positive trees. Little is known about Asian citrus psyllid-associated bacteria and citrus-associated bacteria in the HLB system. Such information is important in HLB management, particularly for accurate detection of CLas. Recent advancements in next-generation sequencing technology provide new opportunities to study HLB through genomic DNA sequence analyses (metagenomics). In this study, HLB-related bacteria in Asian citrus psyllid and citrus (represented by leaf midrib tissues) samples from southern California were analyzed. A metagenomic pipeline was developed to serve as a prototype for future bacteriomic research. This pipeline included steps of next-generation sequencing in Illumina platform, de novo assembly of Illumina reads, sequence classification using the Kaiju tool, acquisition of bacterial draft genome sequences, and taxonomic validation and diversity evaluation using average nucleotide identity. The identified bacteria in Asian citrus psyllids and citrus together included Bradyrhizobium, Buchnera, Burkholderia, “Candidatus Profftella armature,” “Candidatus Carsonella ruddii,” CLas, Mesorhizobium, Paraburkholderia, Pseudomonas, and Wolbachia. The whole genome of a CLas strain recently found in San Bernardino County was sequenced and classified into prophage typing group 1 (PTG-1), one of the five known CLas groups in California. Based on sequence similarity, Bradyrhizobium and Mesorhizobium were identified as possible source that could interfere with CLas detection using the 16S rRNA gene-based PCR commonly used for HLB diagnosis, particularly at low or zero CLas titer situation.
... Lindow et al. (2005) confirmed the ability of endophytic species within the genera Paenibacillus, Pseudomonas, Staphylococcus, and Bacillus in reducing disease symptoms by altering X. fastidiosa DSF-mediated signaling. A promising result was obtained using the Burkholderia phytofirmans strain PsJN against X. fastidiosa in different grapevine cultivars co-inoculated or even inoculated 30 days after the pathogen (Lindow et al., 2017). In planta experiments suggested that the pathogen limitation could be due to not only molecular interference with X. fastidiosa quorum-sensing regulation and biofilm formation but also induction of the grapevine immune defense responses (Lindow et al., 2017). ...
... A promising result was obtained using the Burkholderia phytofirmans strain PsJN against X. fastidiosa in different grapevine cultivars co-inoculated or even inoculated 30 days after the pathogen (Lindow et al., 2017). In planta experiments suggested that the pathogen limitation could be due to not only molecular interference with X. fastidiosa quorum-sensing regulation and biofilm formation but also induction of the grapevine immune defense responses (Lindow et al., 2017). Deyett et al. (2017) found that endophytic P. fluorescens and Achromobacter xylosoxidans showed significant negative correlations with the X. fastidiosa titer; in particular, P. fluorescens emerged as a promising BCA of PD. ...
Endophytism within Vitis represents a topic of critical relevance due to the multiple standpoints from which it can be approached and considered. From the biological and botanical perspectives, the interaction between microorganisms and perennial woody plants falls within the category of stable relationships from which the plants can benefit in multiple ways. The life cycle of the host ensures persistence in all seasons, repeated chances of contact, and consequent microbiota accumulation over time, leading to potentially high diversity compared with that of herbaceous short-lived plants. Furthermore, grapevines are agriculturally exploited, highly selected germplasms where a profound man-driven footprint has indirectly and unconsciously shaped the inner microbiota through centuries of cultivation and breeding. Moreover, since endophyte metabolism can contribute to that of the plant host and its fruits’ biochemical composition, the nature of grapevine endophytic taxa identities, ecological attitudes, potential toxicity, and clinical relevance are aspects worthy of a thorough investigation. Can endophytic taxa efficiently defend grapevines by acting against pests or confer enough fitness to the plants to endure attacks? What are the underlying mechanisms that translate into this or other advantages in the hosting plant? Can endophytes partially redirect plant metabolism, and to what extent do they act by releasing active products? Is the inner microbial colonization necessary priming for a cascade of actions? Are there defined environmental conditions that can trigger the unleashing of key microbial phenotypes? What is the environmental role in providing the ground biodiversity by which the plant can recruit microsymbionts? How much and by what practices and strategies can these symbioses be managed, applied, and directed to achieve the goal of a better sustainable viticulture? By thoroughly reviewing the available literature in the field and critically examining the data and perspectives, the above issues are discussed.
... Therefore, the use of agrochemicals to prevent bacterial growth in the plant are not an effective strategy for dealing with diseases caused by X. fastidiosa (Scortichini et al., 2018). The development of successful methods against the bacterium is currently in progress (Scortichini et al., 2021;Morelli et al., 2021;Baccari et al., 2019;Antelmi et al., 2019).. ...
The most effective way to contain spread of the plant pathogen Xylella fastidiosa in Europe is to manage populations of its main insect vector, Philaenus spumarius L. (Hemiptera: Aphrophoridae). The action of some entomopathogenic endophytic fungi (EEF) on insect pests, directly through contact or indirectly by internal colonization of host plant tissues, may offer an excellent control option within integrated pest management (IPM) programmes. This study evaluated the impact of two EEF strains as control agents of P. spumarius (Metarhizium brunneum strain EAMa 01/58-Su and Beauveria bassiana strain EABb 01/33-Su [Hypocreales: Clavicipitaceae and Cordycipitaceae, respectively]); both strains were known to be excellent control agents of many other serious chewing and sap-sucking agricultural pests. First, the pathogenicity of strains applied directly to P. spumarius adults was evaluated, resulting in 50.0% and 32.0% mortality and a mean survival time of 4.7 and 6.2 days for M. brunneum and B. bassiana, respectively. Furthermore, colonization of Sonchus oleraceus by EEFs was observed after both soil and foliar applications. Greatest colonization (91.0%) was observed in plants treated with foliar applications of M. brunneum. Based on these results, we evaluated the feeding behaviour of P. spumarius on S. oleraceus plants previously colonized by M. brunneum using the ‘Electrical Penetration Graph’ technique. P. spumarius fed in a similar way on EEF-colonized and non-colonized S. oleraceus plants, with the exception that insects feeding on colonized plants reached xylem vessels faster than insects feeding on non-colonized plants. In addition, significantly higher mortality of P. spumarius was observed when feeding on plants treated by M. brunneum compared with the control. The duration of xylem ingestion events indicates that P. spumarius preferred to feed on basal leaves of the plant compared with apical leaves. Our results indicate strong potential for strain EAMa 01/58-Su of M. brunneum to be used as part of an X. fastidiosa IPM programme.
... It was shown that PsJN promoted plant growth under various abiotic stresses such as drought on wheat (Naveed et al., 2014) and maize (Naveed et al., 2015), salinity on quinoa (Yang et al., 2020), high temperature (32°C) on tomato (Issa et al., 2018), low temperatures (4°C) on grapevine (Ait Barka et al., 2006), and freezing temperatures on A. thaliana (Su et al., 2015). Further, PsJN protected plants from biotic stresses caused by pathogenic microorganisms such as the bacterial pathogens Pseudomonas syringae on A. thaliana (Timmermann et al., 2017) and Xylella fastidious on grapevine (Baccari et al., 2019); and fungal pathogens including Verticillium dahliae on tomato (Sharma and Nowak, 1998) and Botrytis cinerea on grapevine (Miotto-Vilanova et al., 2016). Overall, PsJN can colonize and benefit a wide range of plants and has been established as a model to study the molecular mechanisms of plant-endophytic bacteria interactions (Esmaeel et al., 2018). ...
Paraburkholderia phytofirmans PsJN is an endophytic bacterium and has been shown to promote the growth and health of many different plants. Exopolysaccharide (EPS) plays important roles in plant-bacteria interaction and tolerance to environmental stresses. However, the function of EPS in PsJN and its interaction with plants remain largely unknown. In this study, a deletion mutation of bceQ gene, encoding a putative flippase for the EPS biosynthesis, was introduced in the genome of PsJN. The Δ bceQ mutant produced a significantly lower level of EPS than the wild type strain in culture media. Compared to the wild type PsJN, the Δ bceQ mutant was more sensitive to desiccation, UV damage, salt (NaCl) and iron (FeCl 3 ) stresses, and bacteriophage infection. More importantly, the mutation of bceQ decreased the endophytic colonization of PsJN in camelina ( Camelina sativa ) and pea ( Camelina sativa ) under plant drought stress conditions. To the best of our knowledge, this is the first report that EPS production is required for the maximal colonization of an endophytic bacterium in the plant tissues under stress conditions.
... The Burkholderia sensu stricto clade covers phytopathogens such as Burkholderia gladioli, which causes onion soft rot, and clinically relevant species such as members of the Burkholderia cepacia complex (3,4). In contrast, the genus Paraburkholderia contains environmental plant beneficial strains such as nitrogen-fixing and plant growth-promoting symbionts (e.g., Paraburkholderia phymatum, Paraburkholderia sabiae, Paraburkholderia tuberum, Paraburkholderia tropica, Paraburkholderia phytofirmans, and Paraburkholderia kururiensis) (3,(5)(6)(7)(8). Rhizobia must be competitive in order to prevent other strains present in the soil from colonizing plant roots. ...
Rhizobia often display additional beneficial traits such as the production of plant hormones and the acquisition of limited essential nutrients that improve plant growth and enhance plant yields. Here, we show that the rhizobial strain P. sabiae antagonizes important phytopathogens such as P. carotovorum, P. syringae , and R. solanacearum and that this effect is due to contact-dependent killing mediated by one of two T6SS systems identified in the complete, de novo assembled genome sequence of P. sabiae .
... multiplex was detected in diseased almond trees in the Valencian Community (Spain), and in 2021, the infected area reached 2292 ha, and more than 100,000 diseased almond trees have been destroyed (Morelli et al., 2021). Several strategies have been assessed to control X. fastidiosa diseases on plant hosts, including chemical control using oxytetracycline or Zn/Cu citric biocomplex foliar treatments (Amanifar et al., 2016;Dongiovanni et al., 2017;Scortichini et al., 2018;Bruno et al., 2021), stimulators of plant defense responses (Zhang et al., 2019;Moll et al., 2022), biological control using antagonistic endophytes (Baccari et al., 2019) or different agricultural practices. Some of these treatments can reduce symptoms, and in some few cases, even decrease the population levels in infected plants or trees. ...
The activity of Eucalyptus essential oil against eleven strains pertaining to six species of plant pathogenic bacteria was studied using growth inhibition and contact assays. All strains were susceptible to the formulation EGL2, and Xylella fastidiosa subspecies and Xanthomonas fragariae were the most sensitive. The bactericidal effect was strong causing 4.5 to 6.0 log reductions in survival in 30 min at concentrations in the range of 0.75 to 15.0 ml/ml depending on the bacteria tested. Transmission electron microscopy of the formulation EGL2 against the three X. fastidiosa subspecies studied allowed the observation of a strong lytic effect on bacterial cells. In addition, the preventive spray application of EGL2 to potted pear plants subsequently inoculated with Erwinia amylovora significantly decreased the severity of infections. Almond plants treated by endotherapy or soil drenching, and then inoculated with X. fastidiosa showed a significant decrease in disease severity as well as in the levels of the pathogen, depending on the strategy used (endotherapy/soil drenching, preventive/ curative). The treatment by endotherapy in almond plants induced the expression of several genes involved in plant defense. It was concluded that the reduction of infections by the Eucalyptus oil treatments was due to the combination of its bactericidal and plant defense induction activities.
... To assess the specificity of the cLAMP assay, several non-target bacterial species available in our laboratory were tested. Xanthomonas campestris pv campestris, a Gram-negative bacterium that causes black rot of Brassicaceae, Paraburkholderia phytofirmans strain PsJN, a rhizosphere-colonizing bacterium known to be effective in reducing Pierce's disease symptom severity in grapevines [36], and Pseudomonas marginalis, a Gram-negative bacterium responsible for field and storage soft rots in different plant species, were cultivated on Tryptone Soy Agar (TSA) plate medium at 28 °C for one, two, or three days, respectively. The Gram-negative epiphytic bacterium Rahnella aquatilis [37] was cultivated on Luria Bertani (LB) solid medium for one day at 28 °C and Escherichia coli strain BL21(DE3) was grown at 37 °C overnight. ...
Xylella fastidiosa subsp. pauca (Xfp) infects olive trees and other hosts in Southern Apulia (Italy), devastating agriculture and landscape. A containment strategy of the disease requires quick and sensitive detection tools. Therefore, a colorimetric LAMP protocol was developed using as a template a crude alkaline sap obtained from incubation of 50-60 mg of thin slices of olive twigs in a NaOH-containing buffer. This rapid molecular assay can be performed directly in the field, as it needs only a portable isothermal block. Tissues of the same olive trees analysed by this technique were also compared to qPCR (using purified total plant DNA as template) as well as digital droplet PCR (on the same crude alkaline extracts used in cLAMP). A titration of the cLAMP reaction with healthy olive sap, spiked with dilutions of in vitro cultivated Xfp cells and plasmid DNA containing the target sequence, gave positive detection results as low as 10 2 CFU/mL and up to 169.2 target copies/μL, equivalent to about 0.9 pg of the genomic DNA. A portable, sensitive and target-specific Xfp field test was developed, which has a 40 min sample-to-answer time and does not require any DNA isolation procedure or laboratory equipment. The application of this detection assay could help the monitoring and containment of the disease spread.
... Also, when coinoculating the endophytic strain Paraburkholderia phytofirmans and the pathogen Xilella fastidiosa in grapevine, the incidence of leaves exhibiting scorching symptoms typical of Pierce's disease was consistently greatly reduced from that in control plants. This effect was caused by priming expression of innate disease resistance pathways in plants that otherwise would have exhibited minimal responses to the pathogen (for example grapevine PR1 and ETR1) (Baccari et al., 2019). Soft rot caused by Pectobacterium carotovorum is a major constraint in the production of Chinese cabbage. ...
Contribution of plant-associated bacterial endophytes to plant growth is widely accepted, and there is growing evidence that they may play an important role in plant stress tolerance. This fact is especially important in our present scenario of climate change and changing environments, as well as in our current model of crop production and consumption. This chapter presents the state-of-the-art in the role of endophytes in plant stress tolerance. Endophytes have demonstrated a wide range of activities that promote plant stress alleviation against a range of biotic and abiotic stressors like phytopathogens, soil salinity, pollution, high atmospheric CO2, high and low temperatures or drought. Among these abilities, we can find plant growth promoting activities, like siderophores or phytohormones production, phosphate solubilization, nitrogen fixation or biofilm formation. Endophytes may also modulate antioxidant enzymes and the expression of certain genes. They have the ability to transform phytotoxic products, and to produce bioactive compounds and metabolites. These properties, together with others described in the chapter, make endophytes a natural and environmentally friendly resource to be considered to aid plants to face environmental challenges. However, further research is needed concerning molecular understanding of processes that take place, also more studies at the field level and optimization of endophyte inoculants formulation to make this biotool as much effective and accessible as possible. In this chapter, we provided a concise review on current search on the role of endophytes on stress tolerance.
... A similar approach has been explored using unrelated endophytic bacteria to trigger systemic protection from X. fastidiosa infection. A grapevine endophyte, Paraburkholderia phytofirmans PSjN, can reduce disease caused by X. fastidiosa both when the plants are inoculated with the biocontrol at the same time as infection challenge, and when the biocontrol is used up to 4 weeks after X. fastidiosa inoculation in grapevine [117]. Unlike the biocontrol strains of X. fastidiosa that need to be inoculated by needle puncture, PSjN can also be effectively established in host plants using a foliar spray of the bacterium in combination with an organo-silicon surfactant. ...
The bacterial pathogen Xylella fastidiosa continues to threaten agricultural production of many different crops around the world, with significant economic burden from crop loss, disease management, and surveillance costs. In addition to direct economic consequences, plant diseases caused by X. fastidiosa have had significant societal impacts in the most affected regions. Although X. fastidiosa infects long-term perennial crops and landscape plants, there has never been a truly effective treatment for plants once they become infected. This review discusses the threat of X. fastidiosa to agriculture, landscapes, and global commerce, in addition to the most recent progress in treatment for X. fastidiosa in infected plants. Current disease mitigation options include nutritional, chemical, biocontrol, and plant resistance-based strategies, with the potential to develop combined management approaches. Overall, several strategies are promising for disease suppression but there is still opportunity for innovation, especially in treatment approaches that can be administered systemically by soil or foliar spray routes. Prevention of severe disease outcomes and crop loss, and the ability to suppress pathogen populations and reduce transmission without heavy reliance on insecticides would have significant economic and environmental benefits.
... Strains belonging to Pseudomonadaceae, Bacillaceae, Enterobacteriaceae, Actinobacteria and Burkholderiaceae have been shown to have a positive effect on B. cinerea control (Compant et al. 2013). This strategy is also sought for the biological control of Xylella fastidiosa, the causal agent of Pierce's disease of grapevine (Baccari et al. 2019;Compant et al. 2013). A new promising alternative to fungicides, developed in the last two decades, is the use of yeasts, such as Candida oeleophila Montrocher (Saccharomycetaceae), as biological control agents of post-harvest diseases of a wide variety of fruits in apple orchards Guerrero et al. 2014). ...
This chapter focuses on the different stages of the process of classical biological control (CBC) through selected examples, including cottony cushion scale, oriental chestnut gall wasp, vine mealybug, fruit fly, bagrada stink bug and codling moth. The starting point of this long process is the search for natural enemies of species that are considered harmful because they negatively impact crops or natural ecosystems. These natural enemies, or biological control agents, are considered “beneficial”; they are used for the benefit of human activities, while the fauna and flora of the invaded areas also benefit from this sustainable and environmentally friendly control method. The different CBC stages start with studying the literature on pests and potential biological control agents, before moving on to field exploration, authorization to collect and import, and finally specimen collection. Once a species (pest or natural enemy) has been identified, and before considering introducing it into a new environment, we detail the tests to conduct, often in a quarantine facility, for evaluating the specificity to the target, to understand life history traits and parameters that are useful for conducting laboratory rearing.
... Particularly, the endophyte Curtobacterium flaccumfaciens was found to limit the in vitro growth of X. fastidiosa and reduce the symptoms generated in Catharanthus roseus [14]. Moreover, the endophytic bacterium Paraburkholderia phytofirmans strain PsJN was reported to control X. fastidiosa infections in the grapevine [15]. Recently published studies have stated the absence of native antagonists isolated from Apulian olive trees to inhibit X. fastidiosa ST53 growth in vitro [16]. ...
Olive quick decline syndrome (OQDS), which is caused by Xylella fastidiosa, poses a severe threat to the agriculture of Mediterranean countries and causes severe damage to the olive trees in Italy. Since no effective control measures are currently available, the objective of this study was the screening of antagonistic bacteria that are potentially deployable as biocontrol agents against X. fastidiosa. Therefore, two approaches were used, i.e., the evaluation of the antagonistic activity of (i) endophytic bacteria isolated from two different cultivars of olive trees (Leccino and Ogliarola salentina) and (ii) epiphytic bacteria isolated from the phyllospheres of different host plant species of X. fastidiosa. In vitro dual culture tests showed that 12 out of 200 isolates inhibited X. fastidiosa growth, with appearances of clear zones between 4.0 and 38.6 mm. 16S rRNA gene sequencing revealed different species of the genera Paenibacillus, Bacillus, Pantoea, Microbacterium, Stenotrophomonas, Delftia, and Pseudomonas. Furthermore, an investigation for antimicrobial activity identified 5 out of the 12 antagonistic bacteria, Paenibacillus rigui, Bacillus subtilis, Bacillus pumilus, Microbacterium oxydans, and Stenotrophomonas rhizophila, that were able to produce culture filtrates with inhibitory activities. Our results are promising for further investigation to develop an eco-sustainable strategy to control X. fastidiosa using biocontrol agents or their secreted metabolites.
... Bacterial and fungal biological control agents have been identified. They can help in limiting PD damages in grapevines, such as Paraburkholderia phytofirmans (Baccari et al. 2019), but most of them were not able to provide long-term protection. Bacterial phage therapy looks to be a promising strategy (Das et al. 2015). ...
Grapevines are challenged by a range of diseases and pests, causing economic losses and requiring often costly approaches to mitigate damage. Public interest in reducing the use of chemicals is a related challenge, along with climate change. Yet, the Vitis gene pool provides vast resources for the development of genetic resistance in rootstock and scion cultivars. Traditional breeding approaches have made great strides in the development of adaptive traits, and recent access to ‘omic technologies has further facilitated the identification of useful loci along with rapid trait introgression from wild species. Moreover, marker technologies are now used to stack multiple genes for the same trait into a single genotype, a heretofore barely accessible technology. Genomic technologies are also impacting germplasm characterization, and thereby facilitating “Breeding by Design” approaches. Genetic transformation and gene-editing technologies are also applicable for both cultivar improvement as well as functional studies of genes. The landscape for acceptance of new resistant cultivars is complex and with wine grapes, subject to high degrees of regulation especially in the European Union. With rootstocks, as well as table/raisin grapes, gaining acceptance in the marketplace for new cultivars developed through either traditional or marker-assisted approaches is routine. Yet even in the highly regulated EU environment, the adoption of new wine cultivars of interspecific origins is beginning to take place in both traditional wine growing regions as well as non-traditional regions nearby.KeywordsGenotypingMolecular breedingPathogenPestPhenotypingR-lociResistance
Vitis
... Moreover, the antibiotic oxytetracycline along with three other compounds, like NAC, a bioactive detergent composed of plant oil extracts, and a Zn, Cu, and citric acid fertilizer, showed potential to be used to control X. fastidiosa diseases in almond (Amanifar et al., 2016) and olive orchards (Dongiovanni et al., 2017;Scortichini et al., 2018;Bruno et al., 2021), respectively. Other strategies that have been studied involve the use of the endophyte Paraburkholderia phytofirmans (Baccari et al., 2019), avirulent X. fastidiosa strains (Hao et al., 2017), and lytic phages (Das et al., 2015) as biological control agents. Although the results obtained in most of these trials were positive, no strategy was able to completely cure plants infected by X. fastidiosa. ...
Xylella fastidiosa is a plant pathogen that was recently introduced in Europe and is causing havoc to its agriculture. This Gram-negative bacterium invades the host xylem, multiplies, and forms biofilm occluding the vessels and killing its host. In spite of the great research effort, there is no method that effectively prevents or cures hosts from infections. The main control strategies up to now are eradication, vector control, and pathogen-free plant material. Antimicrobial peptides have arisen as promising candidates to combat this bacterium due to their broad spectrum of activity and low environmental impact. In this work, peptides previously reported in the literature and newly designed analogs were studied for its bactericidal and antibiofilm activity against X. fastidiosa. Also, their hemolytic activity and effect on tobacco leaves when infiltrated were determined. To assess the activity of peptides, the strain IVIA 5387.2 with moderate growth, able to produce biofilm and susceptible to antimicrobial peptides, was selected among six representative strains found in the Mediterranean area (DD1, CFBP 8173, Temecula, IVIA 5387.2, IVIA 5770, and IVIA 5901.2). Two interesting groups of peptides were identified with bactericidal and/or antibiofilm activity and low-moderate toxicity. The peptides 1036 and RIJK2 with dual (bactericidal–antibiofilm) activity against the pathogen and moderate toxicity stand out as the best candidates to control X. fastidiosa diseases. Nevertheless, peptides with only antibiofilm activity and low toxicity are also promising agents as they could prevent the occlusion of xylem vessels caused by the pathogen. The present work contributes to provide novel compounds with antimicrobial and antibiofilm activity that could lead to the development of new treatments against diseases caused by X. fastidiosa.
... Additionally, due to their biological control ability, some species might be ecological friendly alternatives to synthetic pesticides (Radhakrishnan et al., 2017). For example, bacteria from the genera Bacillus (Fira et al., 2018;Radhakrishnan et al., 2017), Burkholderia (Sandani et al., 2019), Paraburkholderia (Baccari et al., 2019) and Pseudomonas (Sandani et al., 2019) have been found on strawberry tree and according to several reports might have potential as biological control agents. Furthermore, several species identified on strawberry tree, such as Bacillus thuringiensis, Kocuria palustris, K. rhizophila, Pseudomonas alcaligenes, P. mendocina, Sphingomonas azotifigens, S. multivorum and Streptomyces mirabilis, might provide great benefits to their host plants as mentioned before (Anum et al., 2019;Hakim et al., 2021;Kohler et al., 2006;Matsuda et al., 2001;Schütze et al., 2014;Videira et al., 2009;Widnyana et al., 2013;Zacaria Vital et al., 2019). ...
Arbutus unedo L. (strawberry tree) is a multipurpose Ericaceae tree with a circum-Mediterranean distribution and tolerant to abiotic and biotic stresses. The bioactive compounds and edible berries make this species attractive from an economical perspective, which causes a high demand for true to type plants. As micropropagation techniques are quite popular for the production of strawberry tree clonal plants, the characterization of its microbiome is essential, due to the possible impact in micropropagation success, including acclimatization. Thus, this study aims to identify the endophytic communities on strawberry tree plant tissues in vitro, as well as their prevalence and/or alteration upon plant acclimatization. For this purpose, the microbiome of two genotypes under micropropagation and ex vitro was identified using a culture-independent method. Bacterial OTUs were assigned to 7 phyla and 79 genera whereas only one Archaea genus was identified. The most abundant and diverse bacterial phylum was Actinobacteriota (48%) followed by Proteobacteria (43%), Firmicutes (6%) and Bacteroidota (3%). Noticeable differences in terms of composition and diversity were found when the micro-biome of genotypes in vitro was compared, whereas the composition of ex vitro samples was similar. A significant higher diversity was found on both genotypes ex vitro when compared to the respective in vitro plants. This study presents the very approach into the identification and characterization of strawberry tree microbiome, including in vitro plants, using a culture-independent method. The genotype proved to be a determinant factor shaping microbiota structure. The relevance of this results for micropropagation and breeding are discussed.
... Among other microbial strains, the beneficial endophyte Paraburkholderia phytofirmans PsJN, isolated from onion roots [74,75], is known to colonize several host plants [75,76], stimulating their growth and protecting them against biotic and abiotic stresses [76]. It has been shown to be effective in reducing Pierce's disease symptom severity and X. fastidiosa Temecula1 populations in grapevines [77]. Preliminary trials aimed at testing its effectiveness as a biocontrol agent in the "De Donno" olive pathosystem in Italy, although limited to a single season, have not revealed significant differences in the reduction of OQDS symptoms in therapeutic treatments, nor reduction of the new infections upon preventive applications [78]. ...
Since 2013, Xylella fastidiosa Wells et al. has been reported to infect several hosts and to be present in different areas of Europe. The main damage has been inflicted on the olive orchards of southern Apulia (Italy), where a severe disease associated with X. fastidiosa subspecies pauca strain De Donno has led to the death of millions of trees. This dramatic and continuously evolving situation has led to European and national (Italian and Spanish) measures being implemented to reduce the spread of the pathogen and the associated olive quick decline syndrome (OQDS). Research has been also carried out to find solutions to better and directly fight the bacterium and its main insect vector, Philaenus spumarius L. In the course of this frantic effort, several treatments based on chemical or biological substances have been tested, in addition to plant breeding techniques and integrated pest management approaches. This review aims to summarize the attempts made so far and describe the prospects for better management of this serious threat, which poses alarming questions for the future of olive cultivation in the Mediterranean basin and beyond.
... Microorganisms play pivotal roles in plant growth and fitness. Some bacteria form close relationships with plants and establish mutualistic symbioses that protect the plants from potential pathogens or provide essential elements for plant growth (Baccari et al. 2019;Compant et al. 2005). Some bacteria are free-living but show a preference to live in the rhizosphere of plants; therefore, plants can benefit from their biological activities such as nitrogen fixation, phytohormone modulation, and phosphate solubilization (Berendsen et al. 2012;Smercina et al. 2019). ...
Basal stem rot (BSR) is the most common disease of oil palm (Elaeis guineensis Jacq.) in Southeast Asia. BSR is caused by a white-rot fungus Ganoderma boninense. The disease is difficult to manage. Therefore, development of novel and environmentally safe approaches to control the disease is important. Species of Burkholderia are known to have diverse lifestyles, some of which can be beneficial to plants either by suppressing diseases or enhancing plant growth. In the present study, antifungal peptides (AFPs) produced by a bacterial strain isolated from the rhizosphere of an oil palm tree, namely Burkholderia sp. strain CP01, exhibited strong growth inhibition on G. boninense. A loss-of-function mutant of CP01 was generated, and it has enabled the identification of a 1.2 kDa peptide and its variants as the active antifungal compounds. High-resolution mass spectrometry revealed six analogous compounds with monoisotopic masses similar to the previously reported cyclic lipopeptides occidiofungin and burkholdine. The antifungal compounds of CP01 were secreted into media and we sought to use CP01 culture extract without living cells to control BSR disease. Glasshouse experiments showed that CP01 culture extract suppressed BSR disease in oil palm seedlings. The ability of CP01 to produce an antifungal substance and suppress plant disease suggests its potential application as a biofungicide in agriculture.
... The results of our analysis demonstrate that affected producers and consumers jointly carry the economic risk associated with Xfp. To mitigate the risk, research currently targets the identification of resistant traits in olive varieties (De Pascali et al., 2019;Sabella et al., 2018;Baù et al., 2017;Luvisi et al., 2017aLuvisi et al., , 2017bCaserta et al., 2017;Giampetruzzi et al., 2016), biological control of the vectors (Baccari et al., 2019), early detection of the disease (Zarco-Tejada et al., 2018), and the establishment of a cordon sanitaire by removing host plants near the infected zone. Evidently, all these measures aim at growers taking action to prevent further impacts. ...
The introduction of Xylella fastidiosa in Apulia has resulted in the desiccation of millions of olive trees. Here, we employ a multi-country partial equilibrium model to analyze the possible distribution of economic impacts among olive oil processors and consumers. The results suggest that the majority of the impacts would fall on consumers as a consequence of higher prices. If the disease disperses beyond the current extent in Italy the decline in consumer welfare ranges from 4.1 billion to 10.3 billion Euro over the course of 50 years depending on the rate of disease spread. In other words, each of the 195 million households in Europe would incur additional costs ranging 63 cents to 1.6 Euro every year over the course of 50 years. Introductions of the pathogen into Greece or Spain could cost European consumers between 0.4 billion to 3.3 billion Euro and 1.8 billion to 53 billion Euro, respectively. This would correspond to additional annual household costs ranging 6 to 51 cents and 27 cents to 8.2 Euro, respectively. As significant economic consequences from further dispersal of the disease are borne by consumers, the economic threat is not limited to producers but should be contextualized as a societal problem.
... In addition, maintaining healthy microbiota and the presence of cultivar-specific microbes may support the resilience of the resistant olive cultivar Leccino to Xf infection [38]. This evidence was also confirmed in other pathosystems where experimental evidence suggests that plant colonization by specific bacterial endophytes is marked by a change in the expression of key genes in central metabolic and by priming expression of innate disease resistance pathways in plants that result in the reduction of disease [39,40]. At the same time, endophytic fungi can influence the plant's metabolism by increasing the content of antioxidant compounds in the host [41]. ...
During their evolutionary history, plants have evolved the ability to synthesize and accumulate small molecules known as secondary metabolites. These compounds are not essential in the primary cell functions but play a significant role in the plants' adaptation to environmental changes and in overcoming stress. Their high concentrations may contribute to the resistance of the plants to the bacterium Xylella fastidiosa, which has recently re-emerged as a plant pathogen of global importance. Although it is established in several areas globally and is considered one of the most dangerous plant pathogens, no cure has been developed due to the lack of effective bactericides and the difficulties in accessing the xylem vessels where the pathogen grows and produces cell aggregates and biofilm. This review highlights the role of secondary metabolites in the defense of the main economic hosts of X. fastidiosa and identifies how knowledge about biosynthetic pathways could improve our understanding of disease resistance. In addition, current developments in non-invasive techniques and strategies of combining molecular and physiological techniques are examined, in an attempt to identify new metabolic engineering options for plant defense.
... Statistical differences were determined using Student's t-test performed with statistical package XLSTAT (Microsoft Excel). The gene-specific primers VvPR1_F1: GGAGTCCATTAGCACTCCTTTG and VvPR1_R1: CATAATTCTGGGCGTAGGCAG [68] or VvEF1a_F1: AACCAAAATATCCGGAGTAAAAGA and VvEF1a_R1: GAACTGGGTGCTTGATAGGC [69] were used for the amplification of the VvPR1and VvEF1a genes, respectively. The gene sequence from this article can be found in the GenBank/EMBL databases under the following NCBI accession numbers: XM_002273752.3(VvPR1) ...
Upon pathogen attack, plants very quickly undergo rather complex physico-chemical changes, such as the production of new chemicals or alterations in membrane and cell wall properties, to reduce disease damages. An underestimated threat is represented by root parasitic nematodes. In Vitis vinifera L., the nematode Xiphinema index is the unique vector of Grapevine fanleaf virus, responsible for fanleaf degeneration, one of the most widespread and economically damaging diseases worldwide. The aim of this study was to investigate changes in the emission of biogenic volatile organic compounds (BVOCs) in grapevines attacked by X. index. BVOCs play a role in plant defensive mechanisms and are synthetized in response to biotic damages. In our study, the BVOC profile was altered by the nematode feeding process. We found a decrease in β-ocimene and limonene monoterpene emissions, as well as an increase in α-farnesene and α-bergamotene sesquiterpene emissions in nematode-treated plants. Moreover, we evaluated the PR1 gene expression. The transcript level of PR1 gene was higher in the nematode-wounded roots, while in the leaf tissues it showed a lower expression compared to control grapevines.
... Employing plant growth-promoting rhizobacteria or pretreatment with a weakly virulent strain of a plant pathogen to control the growth of a virulent strain of the same, are two key possible ways by which induced systemic defence can be triggered in plants (Wei et al., 1991;Ramamoorthy et al., 2001). The concept of induced systemic defence can be applied to control plant pathogens as exemplified by the fact that citrus seedlings inoculated with a weakly virulent isolate of P. tracheiphila can successfully inhibit further infection by a virulent strain of the same pathogen (Migheli et al., 2009 (Istifadah et al., 2006;Ginting et al., 2013;Mousa et al., 2015;Gouda et al., 2016;Yuan et al., 2017;Baccari et al., 2018). ...
Phoma is the most widely distributed and omnipresent genus of the order Pleosporales and the largest genus with some 3000 taxa described so far. Of which, approximately 110 species are pathogenic that occupy varied ecological niches. The genus Phoma is polyphyletic and isn’t really delimited with unclear species boundaries that make it a taxonomically controversial genus. Fungi belonging to Phoma commonly occur on crop plants that are economically important where they cause devastating plant diseases. Pathogenic members of Phoma sensu lato species attacks crop plants with symptoms ranging from leaf blight, root rot to even wilting of the plant. In infected crop residues and field stubbles, the pathogen produces abundant pycnidia and pseudothecia which serve as the source of primary inoculum whereas repeated crops of conidia produced inside pycnidium are the main source of secondary infection during the same growing season. After successful infection, the pathogen produces various phytotoxin that alters photosynthetic efficiency, actin cytoskeleton‐based functions and causes electrolyte leakage from cells. Controlling the diseases caused by members of Phoma sensu lato is challenging and efforts have been made to identify resistant varieties that can be used in various plant breeding programs. Studies have also been conducted to devise cultural and biological control measures as well as to evaluate the efficacy of fungicides against members of Phoma sensu lato. In this review we aim to discuss the disease epidemiology and control measures that can be practiced to protect crops from Phoma diseases.
... Recent researches on vector-pathogen relationship disruption (Killiny et al. 2012;Labroussaa et al. 2016), bacterium biological control (Baccari et al. 2018), and sources of resistance (Giampetruzzi et al. 2016) offer promising perspectives for a sustainable and effective X. fastidiosa disease control. However, with regard to the European outbreaks of the bacterium, these perspectives are limited by our lack of knowledge about several pivotal aspects of the epidemics, especially concerning the spittlebug-bacterium interaction and the spittlebug-mediated transmission mechanism. ...
Here, we provide the first insights into the transmission dynamics of the bacterium Xylella fastidiosa by the meadow spittlebug Philaenus spumarius, gathered through DC EPG (electrical penetration graph)-assisted transmission tests and comparative observations of the probing and feeding behavior of infective versus non-infective vectors on healthy olive plants. Bacterial cells binding to P. spumarius’ foregut occurred at a very low rate and in a time as short as 15 min spent by the insect in xylem ingestion or activities interspersed with xylem ingestion (interruption during xylem ingestion and resting). P. spumarius inoculation of bacterial cells into the xylem was exclusively associated with an early (ca. 2 to 7 min after the onset of the first probe) and occasional behavior, provisionally termed waveform Xe, presumably related to egestion regulated by pre-cibarial valve fluttering. Infective spittlebugs compared to non-infective ones exhibited: (i) longer non-probing and shorter xylem ingestion; (ii) longer duration of single non-probing events; (iii) fewer sustained ingestions (ingestion longer than 10 min) and interruptions of xylem activity (N); and (iv) longer time required to perform the first probe. These observations suggest difficulties in feeding of infective P. spumarius probably caused by the presence of X. fastidiosa within the foregut. Overall, our data indicate that likely short time—few minutes—is required for X. fastidiosa transmission by P. spumarius; thus, vector control strategies should aim at preventing spittlebug access to the host plant. Furthermore, our findings represent an important contribution for further research on the disruption of spittlebug–bacterium interactions.
... Since there is no practical cure for Xf under field conditions (17,18), control strategies applied in the EU focus on eradication or containment of the disease by host removal, vector control, and restrictions on the production and movement of plant materials for planting. Research efforts are currently targeting the identification of resistance traits and biological control (19)(20)(21)(22)(23)(24)(25)(26)(27). The use of nonhost species or resistant cultivars of host species seems the most feasible and promising long-term strategy to adapt to Xf in affected regions (4,9). ...
Xylella fastidiosa is the causal agent of plant diseases that cause massive economic damage. In 2013, a strain of the bacterium was, for the first time, detected in the European territory (Italy), causing the Olive Quick Decline Syndrome. We simulate future spread of the disease based on climatic-suitability modeling and radial expansion of the invaded territory. An economic model is developed to compute impact based on discounted foregone profits and losses in investment. The model projects impact for Italy, Greece, and Spain, as these countries account for around 95% of the European olive oil production. Climatic suitability modeling indicates that, depending on the suitability threshold, 95.5 to 98.9%, 99.2 to 99.8%, and 84.6 to 99.1% of the national areas of production fall into suitable territory in Italy, Greece, and Spain, respectively. For Italy, across the considered rates of radial range expansion the potential economic impact over 50 y ranges from 1.9 billion to 5.2 billion Euros for the economic worst-case scenario, in which production ceases after orchards die off. If replanting with resistant varieties is feasible, the impact ranges from 0.6 billion to 1.6 billion Euros. Depending on whether replanting is feasible, between 0.5 billion and 1.3 billion Euros can be saved over the course of 50 y if disease spread is reduced from 5.18 to 1.1 km per year. The analysis stresses the necessity to strengthen the ongoing research on cultivar resistance traits and application of phytosanitary measures, including vector control and inoculum suppression, by removing host plants.
... In particular, it has been shown that the endophyte Curtobacterium flaccumfaciens inhibited the growth of X. fastidiosa in vitro and reduced the symptoms caused in Catharanthus roseus (Lacava et al., 2007). Moreover, Baccari et al. (2019) recently reported that the endophytic bacterium Paraburkholderia phytofirmans strain PsJN controls X. fastidiosa infections in grapevine. ...
Strains of Xylella fastidiosa subsp. pauca characterized by a specific genotype, the so called sequence type “ST53”, have been associated with a severe disease named Olive Quick Decline Syndrome (OQDS). Despite the relevant research efforts devoted to control the disease caused by X. fastidiosa, so far there are no therapeutic means able to cure the infected host plants. As such, the aim of this study was the identification of antagonistic bacteria potentially deployable as bio-control agents against X. fastidiosa. To this end, two approaches were used, i.e. the evaluation of the antagonistic activity of: i) endophytic bacteria isolated from olive trees located in an infected area but showing mild or no symptoms, and ii) Bacillus strains, as they are already known as bio-control agents. Characterization of endophytic bacterial isolates revealed that the majority belonged to different species of the genera Sphingomonas, Methylobacterium, Micrococcus and Curtobacterium. However, when they were tested in vitro against X. fastidiosa ST53 none of them showed antagonistic activity. On the contrary, when strains belonging to different species of the genus Bacillus were included in these tests, remarkable antagonistic activities were recorded. Some B. velezensis strains also produced culture filtrates with inhibitory activity against X. fastidiosa ST53. Taking also into account that two of these B. velezensis strains (namely strains D747 and QST713) are already registered and commercially available as bio-control agents, our results pave the way for further studies aimed at the development of a sustainable bio-control strategy of the OQDS.
... tion in leaves and stems of A. tumefaciens-inoculated plantlets after root treatments with Sn48 and Sa14 suggests a pathogen-dependent activation of defence responses. In line with this concept,Baccari et al. (2019) reported priming expression of the innate disease resistance pathway mediated by Paraburkholderia phytofirmans PsJN in grapevine inoculated with Xylella fastidiosa. Our findings revealed that Sn48 colonized grapevine roots but not aboveground plant parts, and enhanced trans-resveratrol, trans-piceid, and δ-viniferin accumulation in all plant tissues of plantlets inoculated by A. tumefaciens. ...
Crown gall disease of grapevine, caused by Agrobacterium tumefaciens, often results in severe economic loss to grape production worldwide. This study demonstrated the ability of the endophytic bacteria Pseudomonas sp. Sn48 and Pantoea sp. Sa14 isolated from domesticated and wild grapevines to induce resistance in both above‐ and belowground tissues of grapevines infected with A. tumefaciens. Our results provide evidence that both strains can colonize roots and/or shoots. We showed that the strains Pseudomonas sp. Sn48 and Pantoea sp. Sa14 are capable of inducing stilbenic phytoalexin production in grapevine tissues and to further prime plantlets for enhanced phytoalexin production after A. tumefaciens inoculation. We also showed that in the majority of treatments, polyamine accumulation remained unchanged or slightly increased in plantlets treated with strains Pseudomonas sp. Sn48 and Pantoea sp. Sa14 compared with the control. Our findings indicated that the levels of polyamines remain unchanged or significantly decrease in plantlets treated with endophytic bacteria after A. tumefaciens challenge compared to the control and plantlets treated with individual endophytic bacterial strains. PR1, PR2, and PR4 gene expression levels of plantlets treated with Pseudomonas sp. Sn48 and Pantoea sp. Sa14 significantly increased after A. tumefaciens inoculation. The findings revealed the efficacy of the selected endophytic bacteria in triggering grapevine resistance against A. tumefaciens and the possible use of these strains as an alternative to chemical control methods in grapevine crown gall disease management.
... Deyett et al. (2017) showed that Pseudomonas correlated negatively with Xylella in PD-affected vines, suggesting that it could be used as a biocontrol agent given its known properties for secreting antimicrobial and plant growth promoting compounds (Khmel et al., 1998;Loper et al., 2012;Pieterse et al., 2014;Gruau et al., 2015). Paraburkholderia phytofirmans (formerly known as Burkholderia phytofirmans) has also been recognized as a potential biocontrol agent to grapevine PD because it has been identified as an endophyte of grapevine leaf and showed the ability to colonize the grapevine endosphere upon inoculation (root, vascular system and leaf) and prime host disease resistance pathways (Compant et al., 2005;Compant et al., 2008;Lo Piccolo et al., 2010;Baccari et al., 2019). Our data did not support the presence of this specific bacterium in the sap of grapevine but identified several taxa from the family Burkholderiaceae (~5% abundance), including Massilia and Ralstonia that were a part of the core microbiome and a biomarker for vines showing moderate PD-symptoms, respectively. ...
Grapevine is a pillar of the California state economy and agricultural identity. This study provides a comprehensive culture-independent microbiome analysis from the sap of grapevine overtime and in a context of a vascular disease. The vascular system plays a key role by transporting nutrient, water and signals throughout the plant. The negative pressure in the xylem conduits, and low oxygen and nutrient content of its sap make it a unique and underexplored microbial environment. We hypothesized that grapevine hosts in its sap, microbes that have a beneficial impact on plant health by protecting against pathogen attack and supporting key biological processes. To address this hypothesis, we chose a vineyard under high Pierce’s disease (PD). PD is caused by the xylem-dwelling pathogenic bacterium Xylella fastidiosa. We selected ten grapevines within this vineyard with a range of disease phenotypes, and monitored them over 2 growing seasons. We sampled each vines at key phenological stages (bloom, veraison, and post-harvest) and used an amplicon metagenomics approach to profile the bacterial (16S -V4) and fungal (ITS) communities of the sap. We identified a core microbiome of the sap composed of seven bacterial (Streptococcus, Micrococcus, Pseudomonas, Bacteroides, Massilia, Acinetobacter and Bacillus) and five fungal (Cladosporium, Mycosphaerella, Alternaria, Aureobasidium, and Filobasidium) taxa that were present throughout the growing season. Overall, the sap microbial makeup collected from canes was more similar to the root microbial profile. Alpha diversity metrics indicated a microbial enrichment at bloom and in vines with moderate PD severity suggesting a host-driven microbial response to environmental cues. Beta diversity metrics demonstrated that disease condition and plant phenology impacted microbial community profiles. Our study identified several potential taxonomic targets with antimicrobial and plant growth promoting capabilities that inhabit the grapevine sap and that should be further tested as potential biological control or biofertilizer agents.
... Further characterization of X. fastidiosa biological control strain EB92-1 demonstrated that this strain lacks 10 putative pathogenicity factors and infects grapevine but does not cause disease [32]. The endophytic bacterium Paraburkholderia phytofirmans strain PsJN can colonize grapevine while restricting the growth of X. fastidiosa [115]. Furthermore, paratransgenesis approaches have shown promise for X. fastidiosa control, with one study inducing a genetically manipulated bacterium in the genus Alcaligenes to colonize the GWSS foregut and compete with X. fastidiosa [116]. ...
Huanglongbing is causing economic devastation to the citrus industry in Florida, and threatens the industry everywhere the bacterial pathogens in the Candidatus Liberibacter genus and their insect vectors are found. Bacteria in the genus cannot be cultured and no durable strategy is available for growers to control plant infection or pathogen transmission. However, scientists and grape growers were once in a comparable situation after the emergence of Pierce’s disease, which is caused by Xylella fastidiosa and spread by its hemipteran insect vector. Proactive quarantine and vector control measures coupled with interdisciplinary data-driven science established control of this devastating disease and pushed the frontiers of knowledge in the plant pathology and vector biology fields. Our review highlights the successful strategies used to understand and control X. fastidiosa and their potential applicability to the liberibacters associated with citrus greening, with a focus on the interactions between bacterial pathogen and insect vector. By placing the study of Candidatus Liberibacter spp. within the current and historical context of another fastidious emergent plant pathogen, future basic and applied research to develop control strategies can be prioritized.
... The use of weakly virulent or avirulent strains of X. fastidiosa is covered in this review, although this organism is an EU quarantine plant pest and its introduction in the EU territory is banned. 1 ...
Abstract This opinion updates the information included in the previous EFSA Scientific Opinion concerning the in planta control measures for Xylella fastidiosa, with a systematic review and critical analysis of the potential treatment solutions that have been published against this pest so far. The output of this opinion focuses on the application of chemical or biological treatments on living plants. In vitro studies, hot water treatments, use of resistant varieties and vector control are excluded from the review. The use of antibiotics is not considered due to the risk of antimicrobial resistance development. The use of weakly virulent or avirulent strains of X. fastidiosa is covered in this review, although this organism is an EU quarantine plant pest and its introduction in the EU territory is banned. Experiments were recently conducted to assess the effect of application of zinc, copper, and citric acid biocomplex, of N‐acetylcysteine, and of ‘diffusible signal factor’ (and of its homologs). Their results showed that these control measures were sometimes able to reduce symptoms caused by X. fastidiosa. Recent experiments also showed that several species of endophytic microorganisms, some bacteriophages and inoculation of weakly virulent/avirulent strains of X. fastidiosa could offer some protection against the Pierce's disease. However, based on the reviewed results, the Panel concludes that, although several published experiments show some effects in reducing symptoms development, the tested control measures are not able to completely eliminate X. fastidiosa from diseased plants. The Panel confirms as previously stated that there is currently no control measure available to eliminate the bacteria from a diseased plant in open field conditions.
... PGPR-mediated ISR enhances the formation of physical barriers such as callose and lignin, the synthesis of plant defense chemicals as reactive oxygen species (ROS), phytoalexins and phenolic compounds (Benhamou, 1996;Samain et al., 2017), but certain PGPR do not induce PR proteins (Hoffland et al., 1995). On the other hand, the upregulation of genes, known as SAR pathway markers, such as PR2, chitinases and PR1, have been observed with PGPR including the genera Bacillus, Pseudomonas, Paenibacillus, and Paraburkholderia (Park and Kloepper, 2007;Samain et al., 2017;Baccari et al., 2019). The overexpression of PR1 induced by PGPR might be explained by the abiotic stress as a response to root colonization by bacteria (Timmusk and Wagner, 1999). ...
Plant-growth-promoting rhizobacteria are known as potential biofertilizers and plant-resistance inducers. The current work aims to study the durability of the resistance induced as a response to the inoculation of wheat grains with Paenibacillus sp. strain B2 (PB2) and its influence by plant genotype, growth stage, and Mycosphaerella graminicola strain (the causal agent of Septoria tritici blotch or STB). The results of the plate-counting method showed that PB2 has high potential for wheat-root external colonization [>10 6 colony-forming unit (CFU)/g of root], and the quantitative real-time polymerase chain reaction (qPCR) analysis demonstrated its internal root-colonization capacity on all tested cultivars. However, the colonization seems to be dependent on wheat-growth stage. The durability of PB2-induced resistance (PB2-IR) was tested at the 3-leaf, tillering, and flag-leaf-growth stages. Additionally, the results showed that the PB2-IR is durable and able to protect the flag leaf, the most important leaf layer during grain fill. It conferred a high protection efficiency (55-94%) against four virulent strains of M. graminicola and over 11 wheat cultivars with different resistance levels to STB. Although, PB2-IR is dependent on M. graminicola strains, wheat genotypes and growth stages, its efficiency, under field conditions, at protecting the last wheat-leaf layers was not an influence. However, it showed 71-79% of protection and reached 81-94% in association with half of the recommended dose of Cherokee R fungicide. This may be explained using laboratory results by its direct impact on M. graminicola strains in these leaf layers and by the indirect reduction of the inoculum coming from leaves infected during the earlier growth stages. Gene expression results showed that PB2-IR is correlated to upregulation of genes involved in defense and cell rescue and a priming effect in the basal defense, jasmonic acid signaling, phenylpropanoids and phytoalexins, and reactive oxygen species gene markers. To conclude, PB2 induces a Frontiers in Plant Science | www.frontiersin.org 1 May 2019 | Volume 10 | Article 587 Samain et al. PGPR-Induced Systemic Resistance in Wheat high and durable resistance against M. graminicola under controlled and field conditions. The PB2-IR is a pathogen strain and is plant-growth-stage and genotype dependent. These results highlight the importance of taking into consideration these factors so as to avoid losing the effectiveness of induced resistance under field conditions.
... First, although efforts to evaluate a wide range of chemical molecules to control infections have been conducted previously, here Zhang et al. (2019) pursue additional in planta tests, which are often lacking from such studies and are key to success since a wide range of molecules can affect X. fastidiosa viability in vitro. Baccari et al. (2019) present their ongoing work on biological control of Pierce's disease of grapevine using a Paraburkholderia phytofirmans strain; this is a particularly stimulating advancement, given that the strain appears to be effective in suppressing disease symptoms even when sprayed on plants by inducing host resistance pathways. Lastly, Mauricio et al. (2019) report on a long-term effort to understand plant resistance to X. fastidiosa infections of sweet orange trees in Brazil; resistance is indeed a highly desirable strategy to manage X. fastidiosa diseases. ...
Xylella fastidiosa is one of the most important threats to plant health worldwide. This bacterial pathogen has a long history, causing disease in the Americas on a range of agricultural crops and trees, with severe economic repercussions particularly on grapevine and citrus. In Europe, X. fastidiosa was detected for the first time in 2013 in association with a severe disease affecting olive trees in southern Italy. Subsequent mandatory surveys throughout Europe led to discoveries in France and Spain in various host species and environments. Detection of additional introductions of X. fastidiosa continue to be reported from Europe, for example from northern Italy in late 2018. These events are leading to a sea change in research, monitoring and management efforts as exemplified by the articles in this Focus Issue . X. fastidiosa is part of complex pathosystems together with hosts and vectors. Although certain X. fastidiosa subspecies and environments have been well studied, particularly those that pertain to established disease in North and South America, this represents only a fraction of the existing genetic, epidemiological, and ecological diversity. This Focus Issue highlights some of the key challenges that must be overcome to address this new global threat, recent advances in understanding the pathosystem, and steps toward improved disease control. It brings together the broad research themes needed to address the global threat of X. fastidiosa, encompassing topics from host susceptibility and resistance, genome sequencing, detection methods, transmission by vectors, epidemiological drivers, chemical and biological control, to public databases and social sciences. Open communication and collaboration among scientists, stakeholders, and the general public from different parts of the world will pave the path to novel ideas to understand and combat this pathogen.
Biological control of plant diseases is an important component of disease management, particularly in the today's' world of environmental consciousness and awareness. It is particularly preferred method of disease management under organic production system. Biological control is successful in almost all the crops against a number of diseases but soil borne diseases are most responsive to bio-control methods. The agents of biological control, known as bio-control agents (BCAs) belong to a vast group of micro-organisms, particularly fungi (Trichoderma, Ampelomyces, etc), bacteria (Pseudomonas, Bacillus, etc) and actinomycetes. Bottle gourd is an important vegetable crop belonging to the family Cucurbitaceae. It suffers from a number of diseases like anthracnose, powdery mildew, downy mildew, wilt, etc. The present review shall be an attempt to review the biological control of the major diseases of bottle gourd.
Does Xylella fastidiosa, a bacterial plant pathogen with noncirculative foregut-borne transmission, manipulate behavior of its sharpshooter vector to facilitate its own inoculation? To answer this question, blue-green sharpshooters, Graphocephala atropunctata (Signoret), were reared on basil to clean their foreguts, then removed from the colony and given one of four pre-electropenetrography (EPG) treatments: i) old colony adults on basil, ii) young colony adults on basil, iii) young colony adults held on healthy grapevine for 4 days, and iv) young colony adults held on Xf-infected (symptomatic) grapevine for 4 days. After treatments, stylet probing behaviors were recorded on healthy grapevine via AC-DC electropenetrography. Waveforms representing putative Xf inoculation (XB1 [salivation and rinsing egestion] and XC1 [discharging egestion]) and other behaviors were statistically compared among treatments. Mean number of events per insect and 'total' duration per insect of XB1 and XC1 were highest for insects from healthy grape, lowest for basil (regardless of insect age), and intermediate for Xf-infected grape. The surprising results showed that prior exposure to healthy grapevines had a stronger effect on subsequent performance of inoculation behaviors on healthy grapevine than did prior exposure to Xf-infected grapevine. It is hypothesized that non-Xf microbes were acquired from healthy grapevine, causing greater clogging of the precibarium, leading to more performance of inoculation behaviors. This study shows for the first time that presence of noncirculative, foregut-borne microbes can directly manipulate a vector's behavior to increase inoculation. Also, EPG can uniquely visualize the dynamic interactions between vectors and the microbes they carry.
(Read full pdf: https://rdcu.be/c474v)
The exploration of knowledge for crop improvement has been a continuous practice to address the food insecurity of the growing human population, and the necessity of the new knowledge is crucial due to decreasing arable land and climate change. The proper use of technology and knowledgebase has the potential to narrow down poverty in the world, more specifically in developing countries. This review aimed to assess the role of the endophytic and rhizospheric bacteria as a potential crop improvement tool in climate-smart agriculture. Endophytic and rhizospheric were found to be efficient alternatives to the chemical-based solution to develop crops. Endophytic and rhizospheric bacteria have improved many agronomic traits such as yield, quality, disease resistance, and stress tolerance. Besides, we discussed the recent development of the field-level application of endophytic and rhizospheric bacteria. These bacteria have potential since they are efficient in developing crops significantly without affecting the environment in a deleterious way. In terms of biodiversity, natural resources such as endophytic and rhizospheric bacterial application to crops are unlikely to affect the non-target species. Hence, endophytic and rhizospheric bacteria application in crop improvement is applicable for agricultural development, thereby ensuring food sustainability without affecting the environment, eventually leading us to climate-smart agriculture. This review aims to recapitulate the current knowledge and prospects of endophytic and rhizospheric bacteria to achieve the goal of climate-smart agriculture.
Five isolates of Xylella fastidiosa subs. fastidiosa were evaluated for virulence differences using the grape cultivar Cabernet Sauvignon. Significant variation in virulence was observed among isolates. Two isolates representing high and moderate virulence in grape were used for evaluating susceptibility on twenty-one grape lines (cultivars (cv.) and breeding lines). Lines showed significant differences in symptom development and bacterial populations when inoculated with one of two isolates. Table grape cultivars Scarlet Royal, Solbrio, and Red Globe were among the cultivars with the highest disease symptoms and bacterial populations, while ‘Flame Seedless’ showed moderate or low symptoms and had lower bacterial populations in this study than most other commercial table grape cultivars. Sources of Pierce’s disease resistance or tolerance commonly used in breeding programs showed few symptoms when inoculated with either isolate, but levels of bacteria within the plant varied. A new source of Pierce’s disease resistance/tolerance, IAC 572, was identified.
Xylella fastidiosa is the causal agent of important crop diseases and is transmitted by xylem sap‐feeding insects. The bacterium colonizes xylem vessels and can persist with a commensal or pathogen lifestyle in more than 500 plant species. In the past decade, reports of X. fastidiosa across the globe have dramatically increased its known occurrence. This raises important questions: How does X. fastidiosa interact with the different host plants? How does the bacterium interact with the plant immune system? How does it influence the host’s microbiome? We discuss recent strain genetic typing, plant transcriptome and microbiome analyses, which have advanced our understanding of factors that are important for X. fastidiosa plant infection.
Bacterial extracellular vesicles (EVs) are cytosol-containing membrane spheres providing a chassis for the removal and delivery of cargoes in a highly dynamic and cue-responsive manner. EVs play important roles in cell-to-cell communication, including the dialogue between recipient microbial and plant cells. Bacterial EVs are well-studied in the medical field, but their relevance for plant infection is only now being recognized. Recent studies have demonstrated the role of EVs from phytobacteria in modulating plant immunity and the outcome of disease or in symbiosis. In this review, we highlight the composition of EVs and discuss their role in the interaction with plants. Knowledge of EV composition and functions will aid their use in biotechnology and agriculture.
Phoma spp. are very important plant pathogens over the world which are recorded as soil-borne and saprophytic species. Many crops are affected by the Phoma spp. diseases, such as potatoes, beets, legumes, ornamentals, and citrus plants. This chapter aims to understand better about identification, epidemiology, and the management of diseases caused by Phoma spp. Most of Phoma species were identified according to the morphological, biological, and molecular basis. Primary infection of hosts by Phoma species may occur through wounds, through stomata, or directly through the epidermis. Phoma spp. cause infection in high humidity. Phoma spp. diseases usually are controlled through a package of integrated disease management including cultivating of resistant varieties, conducting the best agricultural practices, and biological control, in addition to the chemical control through spraying the fungicides which is considered the most effective method in the case of epidemic infection.
Priming plants with natural agents, including microorganisms, is a promising alternative to chemical methods of protection in growing plants and, particularly, in viticulture. However, the molecular mechanisms of the priming phenomenon are still not fully elucidated. The antioxidant system and reactive oxygen species are known to effectively modulate plant responses to various external influences. This study aimed to identify the relationship between the priming of grapes by microorganisms and the functioning of the antioxidant system in a protective response to downy mildew infection. The experiment was carried out on leaf discs of Muscat blanc susceptible to downy mildew infected with Plasmopara viticola and treated with microorganisms incompatible with the pathogen, as well as with the corresponding symbiotic microorganisms. During the compatible interaction between P. viticola and grapes, oxidative processes were suppressed with viniferin formation. Leaf treatments with Saccharomyces cerevisiae and Bacillus subtilis effectively curbed the development of downy mildew on grape leaves. Priming with these microorganisms did not lead to a significant change in the biochemical parameters of grapes. Nevertheless, subsequent downy mildew infection initiated the formation of viniferin and maintained H2O2 content at a high level. Thus, priming with microorganisms eliminates the physiological effects of compatible interactions between downy mildew and grapes associated with blocking oxidative processes. To suppress pathogen development, host defenses and antagonistic effects of microbial priming agents are required
Xylella fastidiosa subsp. pauca is the causal agent of “olive quick decline syndrome” in Salento (Apulia, Italy). On April 2015, we started interdisciplinary studies to provide a sustainable control strategy for this pathogen that threatens the multi-millennial olive agroecosystem of Salento. Confocal laser scanning microscopy and fluorescence quantification showed that a zinc-copper-citric acid biocomplex—Dentamet®—reached the olive xylem tissue either after the spraying of the canopy or injection into the trunk, demonstrating its effective systemicity. The biocomplex showed in vitro bactericidal activity towards all X. fastidiosa subspecies. A mid-term evaluation of the control strategy performed in some olive groves of Salento indicated that this biocomplex significantly reduced both the symptoms and X. f. subsp. pauca cell concentration within the leaves of the local cultivars Ogliarola salentina and Cellina di Nardò. The treated trees started again to yield. A 1H-NMR metabolomic approach revealed, upon the treatments, a consistent increase in malic acid and γ-aminobutyrate for Ogliarola salentina and Cellina di Nardò trees, respectively. A novel endotherapy technique allowed injection of Dentamet® at low pressure directly into the vascular system of the tree and is currently under study for the promotion of resprouting in severely attacked trees. There are currently more than 700 ha of olive groves in Salento where this strategy is being applied to control X. f. subsp. pauca. These results collectively demonstrate an efficient, simple, low-cost, and environmentally sustainable strategy to control this pathogen in Salento.
Xylella fastidiosa (Xf) is a plant pathogen causing significant losses in agriculture worldwide. Originating from America, this bacterium caused recent epidemics in southern Europe and is thus considered an emerging pathogen. As the European regulations do not authorize antibiotic treatment in plants, alternative treatments are urgently needed to control the spread of the pathogen and eventually to cure infected crops. One such alternative is the use of phage therapy, developed more than 100 years ago to cure human dysentery and nowadays adapted to agriculture. The first step towards phage therapy is the isolation of the appropriate bacteriophages. With this goal, we searched for phages able to infect Xf strains that are endemic in the Mediterranean area. However, as Xf is truly a fastidious organism, we chose the phylogenetically closest and relatively fast-growing organism X. albineans as a surrogate host for the isolation step. Our results showed the isolation from various sources and preliminary characterization of several phages active on different Xf strains, namely, from the fastidiosa (Xff), multiplex (Xfm), and pauca (Xfp) subspecies, as well as on X. albilineans. We sequenced their genomes, described their genomic features, and provided a phylogeny analysis that allowed us to propose new taxonomic elements. Among the 14 genomes sequenced, we could identify two new phage species, belonging to two new genera of the Caudoviricetes order, namely, Usmevirus (Podoviridae family) and Subavirus (Siphoviridae family). Interestingly, no specific phages could be isolated from infected plant samples, whereas one was isolated from vector insects captured in a contaminated area, and several from surface and sewage waters from the Marseille area.
Lipopolysaccharides (LPS) are among the known pathogen-associated molecular patterns (PAMPs). LPSs are potent elicitors of PAMP-triggered immunity (PTI), and bacteria have evolved intricate mechanisms to dampen PTI. Here we demonstrate that Xylella fastidiosa (Xf), a hemibiotrophic plant pathogenic bacterium, possesses a long chain O-antigen that enables it to delay initial plant recognition, thereby allowing it to effectively skirt initial elicitation of innate immunity and establish itself in the host. Lack of the O-antigen modifies plant perception of Xf and enables elicitation of hallmarks of PTI, such as ROS production specifically in the plant xylem tissue compartment, a tissue not traditionally considered a spatial location of PTI. To explore translational applications of our findings, we demonstrate that pre-treatment of plants with Xf LPS primes grapevine defenses to confer tolerance to Xf challenge.
In autumn 2013, the presence of Xylella fastidiosa, a xylem-limited Gram-negative bacterium, was detected in olive stands of an area of the Ionian coast of the Salento peninsula (Apulia, southern Italy), that were severely affected by a disease denoted olive quick decline syndrome (OQDS). Studies were carried out for determining the involvement of this bacterium in the genesis of OQDS and of the leaf scorching shown by a number of naturally infected plants other than olive. Isolation in axenic culture was attempted and assays were carried out for determining its pathogenicity to olive, oleander and myrtle-leaf milkwort. The bacterium was readily detected by quantitative polymerase chain reaction (qPCR) in all diseased olive trees sampled in different and geographically separated infection foci, and culturing of 51 isolates, each from a distinct OQDS focus, was accomplished. Needle-inoculation experiments under different environmental conditions proved that the Salentinian isolate De Donno belonging to the subspecies pauca is able to multiply and systemically invade artificially inoculated hosts, reproducing symptoms observed in the field. Bacterial colonization occurred in prick-inoculated olives of all tested cultivars. However, the severity of and timing of symptoms appearance differed with the cultivar, confirming their differential reaction.
Paraburkholderia phytofirmans PsJN is a plant growth-promoting rhizobacterium (PGPR) that stimulates plant growth and improves tolerance to abiotic stresses. This study analyzed whether strain PsJN can reduce plant disease severity and proliferation of the virulent strain Pseudomonas syringae pv tomato (Pst) DC3000 in Arabidopsis plants, through the activation of induced resistance. Arabidopsis plants previously exposed to strain PsJN showed a reduction in disease severity and pathogen proliferation in leaves compared to non-inoculated, infected plants. The plant defense-related genes WRKY54, PR1, ERF1, and PDF1.2 demonstrated increased and more rapid expression in strain PsJN-treated plants compared to non-inoculated, infected plants. Transcriptional analyses and functional analysis using signaling mutant plants, suggested that resistance to infection by Pst DC3000 in plants treated with strain PsJN involves salicylic acid, jasmonate, and ethylene-signaling pathways to activate defense genes. Additionally, activation occurs through a specific PGPR-host recognition, being necessary a metabolically active state of the bacterium to trigger the resistance in Arabidopsis, with a strain PsJN-associated molecular pattern only partially involved in the resistance response. This study provides the first report on the mechanism used by the PGPR P. phytofirmans PsJN to protect A. thaliana against a widespread virulent pathogenic bacterium.
Abiotic stress has a growing impact on plant growth and agricultural activity worldwide. Specific plant growth promoting rhizobacteria have been reported to stimulate growth and tolerance to abiotic stress in plants, and molecular mechanisms like phytohormone synthesis and 1-aminocyclopropane-1-carboxylate deamination are usual candidates proposed to mediate these bacterial effects. Paraburkholderia phytofirmans PsJN is able to promote growth of several plant hosts, and improve their tolerance to chilling, drought and salinity. This work investigated bacterial determinants involved in PsJN stimulation of growth and salinity tolerance in Arabidopsis thaliana, showing bacteria enable plants to survive long-term salinity treatment, accumulating less sodium within leaf tissues relative to non-inoculated controls. Inactivation of specific bacterial genes encoding ACC deaminase, auxin catabolism, N-acyl-homoserine-lactone production, and flagellin synthesis showed these functions have little influence on bacterial induction of salinity tolerance. Volatile organic compound emission from strain PsJN was shown to reproduce the effects of direct bacterial inoculation of roots, increasing plant growth rate and tolerance to salinity evaluated both in vitro and in soil. Furthermore, early exposure to VOCs from P. phytofirmans was sufficient to stimulate long-term effects observed in Arabidopsis growth in the presence and absence of salinity. Organic compounds were analyzed in the headspace of PsJN cultures, showing production of 2-undecanone, 7-hexanol, 3-methylbutanol and dimethyl disulfide. Exposure of A. thaliana to different quantities of these molecules showed that they are able to influence growth in a wide range of added amounts. Exposure to a blend of the first three compounds was found to mimic the effects of PsJN on both general growth promotion and salinity tolerance. To our knowledge, this is the first report on volatile compound-mediated induction of plant abiotic stress tolerance by a Paraburkholderia species.
The bacterium Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC) and has been associated with important losses in commercial orchards of all sweet orange [Citrus sinensis (L.)] cultivars. The development of this disease depends on the environmental conditions, including the endophytic microbial community associated with the host plant. Previous studies have shown that X. fastidiosa interacts with the endophytic community in xylem vessels as well as in the insect vector, resulting in a lower bacterial population and reduced CVC symptoms. The citrus endophytic bacterium Methylobacterium mesophilicum can trigger X. fastidiosa response in vitro, which results in reduced growth and induction of genes associated with energy production, stress, transport, and motility, indicating that X. fastidiosa has an adaptive response to M. mesophilicum. Although this response may result in reduced CVC symptoms, the colonization rate of the endophytic bacteria should be considered in studies that intend to use this endophyte to suppress CVC disease. Symbiotic control is a new strategy that uses symbiotic endophytes as biological control agents to antagonize or displace pathogens. Candidate endophytes for symbiotic control of CVC must occupy the xylem of host plants and attach to the precibarium of sharpshooter insects to access the pathogen. In the present review, we focus on interactions between endophytic bacteria from sweet orange plants and X. fastidiosa, especially those that may be candidates for control of CVC.
Scientific Reports 6 : Article number: 18598 10.1038/srep18598 ; published online: 12 January 2016 ; updated: 25 February 2016 . The Acknowledgements section in this Article is incomplete.
Plant innate immunity serves as a surveillance system by providing the first line of powerful weapons to fight against pathogen attacks. Beneficial microorganisms and Microbial-Associated Molecular Patterns might act as signals to trigger this immunity. Burkholderia phytofirmans PsJN, a highly efficient plant beneficial endophytic bacterium, promotes growth in a wide variety of plants including grapevine. Further, the bacterium induces plant resistance against abiotic and biotic stresses. However, no study has deciphered triggered-mechanisms during the tripartite interaction between grapevine, B. phytofirmans PsJN and Botrytis cinerea. Herein, we showed that in contrast with classical rhizobacteria, which are restricted in the root system and act through ISR, B. phytofirmans PsJN is able to migrate until aerial part and forms at leaves surface a biofilm around B. cinerea mycelium to restrict the pathogen. Nevertheless, considering the endophytic level of PsJN in leaves, the plant protection efficacy of B. phytofirmans PsJN could not be explained solely by its direct antifungal effect. Deeper investigations showed a callose deposition, H 2 O 2 production and primed expression of PR1, PR2, PR5, and JAZ only in bacterized-plantlets after pathogen challenge. The presence of PsJN modulated changes in leaf carbohydrate metabolism including gene expression, sugar levels, and chlorophyll fluorescence imaging after Botrytis challenge. Our findings indicated that protection induced by B. phytofirmans PsJN was multifaceted and relied on a direct antifungal effect, priming of defense mechanisms as well as the mobilization of carbon sources in grapevine leaf tissues.
Unlabelled:
Cell density-dependent regulation of gene expression in Xylella fastidiosa that is crucial to its switching between plant hosts and insect vectors is dependent on RpfF and its production of 2-enoic acids known as diffusible signal factor (DSF). We show that X. fastidiosa produces a particularly large variety of similar, relatively long-chain-length 2-enoic acids that are active in modulating gene expression. Both X. fastidiosa itself and a Pantoea agglomerans surrogate host harboring X. fastidiosa RpfF (XfRpfF) is capable of producing a variety of both saturated and unsaturated free fatty acids. However, only 2-cis unsaturated acids were found to be biologically active in X. fastidiosa X. fastidiosa produces, and is particularly responsive to, a novel DSF species, 2-cis-hexadecanoic acid that we term XfDSF2. It is also responsive to other, even longer 2-enoic acids to which other taxa such as Xanthomonas campestris are unresponsive. The 2-enoic acids that are produced by X. fastidiosa are strongly affected by the cellular growth environment, with XfDSF2 not detected in culture media in which 2-tetradecenoic acid (XfDSF1) had previously been found. X. fastidiosa is responsive to much lower concentrations of XfDSF2 than XfDSF1. Apparently competitive interactions can occur between various saturated and unsaturated fatty acids that block the function of those agonistic 2-enoic fatty acids. By altering the particular 2-enoic acids produced and the relative balance of free enoic and saturated fatty acids, X. fastidiosa might modulate the extent of DSF-mediated quorum sensing.
Importance:
X. fastidiosa, having a complicated lifestyle in which it moves and multiplies within plants but also must be vectored by insects, utilizes DSF-based quorum sensing to partition the expression of traits needed for these two processes within different cells in this population based on local cellular density. The finding that it can produce a variety of DSF species in a strongly environmentally context-dependent manner provides insight into how it coordinates the many genes under the control of DSF signaling to successfully associate with its two hosts. Since the new DSF variant XfDSF2 described here is much more active than the previously recognized DSF species, it should contribute to plant disease control, given that the susceptibility of plants can be greatly reduced by artificially elevating the levels of DSF in plants, creating "pathogen confusion," resulting in lower virulence.
A valuable strategy to improve crop yield consists in the use of plant growth-promoting rhizobacteria (PGPRs). However, the influence of PGPR colonization on plant physiology is largely unknown. PGPR Burkholderia phytofirmans strain PsJN (Bp PsJN) colonized only Arabidopsis thaliana roots after seed or soil inoculation. Foliar bacteria were detected only after leaf infiltration. Since, different bacterial times of presence and/or locations in host plant could lead to different plant physiological responses, photosynthesis, and metabolite profiles in A. thaliana leaves were thus investigated following leaf, root, or seed inoculation with Bp PsJN. Only Bp PsJN leaf colonization transiently decreased cyclic electron transport and effective quantum yield of photosystem I (PSI), and prevented a decrease in net photosynthesis and stomatal opening compared to the corresponding control. Metabolomic analysis revealed that soluble sugars, amino acids or their derivatives accumulated differently in all Bp PsJN-inoculated plants. Octanoic acid accumulated only in case of inoculated plants. Modifications in vitamin, organic acid such as tricarboxylic acid intermediates, and hormone amounts were dependent on bacterial time of presence and location. Additionally, a larger array of amino acids and hormones (auxin, cytokinin, abscisic acid) were modified by seed inoculation with Bp PsJN. Our work thereby provides evidence that relative short-term inoculation with Bp PsJN altered physiological status of A. thaliana leaves, whereas long-term bacterization triggered modifications on a larger set of metabolites. Our data highlighted the changes displayed during this plant–microbe interaction to trigger physiological and metabolic responses that could explain the increase in plant growth or stress tolerance conferred by the presence of Bp PsJN.
Pierce’s disease (PD) of grapevines is caused by Xylella fastidiosa (Xf), a xylem-limited gamma-proteobacterium that is responsible for several economically important crop diseases. The occlusion of xylem elements and interference with water transport by Xf and its associated biofilm have been posited as the main cause of PD symptom development; however, Xf virulence mechanisms have not been described. Analysis of the Xf secretome revealed a putative lipase/esterase (LesA) that was abundantly secreted in bacterial culture supernatant and was characterized as a protein ortholog of the cell wall-degrading enzyme LipA of Xanthomonas strains. LesA was secreted by Xf and associated with a biofilm filamentous network. Additional proteomic analysis revealed its abundant presence in outer membrane vesicles (OMVs). Accumulation of LesA in leaf regions associated positively with PD symptoms and inversely with bacterial titer. The lipase/esterase also elicited a hypersensitive response in grapevine. Xf lesA mutants were significantly deficient for virulence when mechanically inoculated into grapevines. We propose that Xf pathogenesis is caused by LesA secretion mediated by OMV cargos and that its release and accumulation in leaf margins leads to early stages of observed PD symptoms.
The genus Burkholderia contains large number of diverse species which are not reliably distinguished by the available biochemical or molecular characteristics. We report here results of detailed phylogenetic and comparative genomic analyses of 45 sequenced species of the genus Burkholderia. In phylogenetic trees based upon concatenated sequences for 21 conserved proteins as well as 16S rRNA gene sequences, Burkholderia species grouped into two major clades. Within these main clades a number of smaller clades were also clearly distinguished. Our comparative analysis of protein sequences from Burkholderia spp. has identified 42 highly specific molecular markers in the form of conserved sequence indels (CSIs) that are uniquely found in different clades of Burkholderia spp. Six of these CSIs are specific for a group of Burkholderia spp. (referred to as Clade I) which contains all clinically relevant members of the genus as well as the phytopathogenic Burkholderia species. The second main clade (Clade II) composed of the environmental Burkholderia species, is also distinguished by 2 of the identified CSIs. Additionally, our work has also identified 3 CSIs that are specific for the Burkholderia cepacia complex, 4 CSIs that are uniquely found in the Burkholderia pseudomallei group, 5 CSIs that are specific for the phytopathogenic Burkholderia spp. and 22 other CSI that distinguish two groups within Clade II. The described molecular markers provide highly specific means for the demarcation of different groups of Burkholderia spp. and for development of novel diagnostic assays for the clinically important members of the group. Based upon the results from different lines of studies, a division of the genus Burkholderia into two genera is proposed. In this new proposal, the emended genus Burkholderia will contain only the clinically relevant and phytopathogenic Burkholderia species, whereas all other Burkholderia spp. are transferred to a new genus Paraburkholderia gen. nov.
Discovery of Xylella fastidiosa from olive trees with “Olive quick decline syndrome” in October 2013 on the west coast of the Salento Peninsula prompted an immediate search for insect vectors of the bacterium. The dominant xylem-fluid feeding hemipteran collected in olive orchards during a 3-mo survey was the meadow spittlebug, Philaenus spumarius (L.) (Hemiptera: Aphrophoridae). Adult P. spumarius, collected in November 2013 from ground vegetation in X. fastidiosa-infected olive orchards, were 67% (40 out of 60) positive for X. fastidiosa by polymerase chain reaction (PCR) assays. Euscelis lineolatus Brullé were also collected but tested negative for the pathogen. Transmission tests with P. spumarius collected from the Salento area were, therefore, conducted. After a 96-h inoculation access period with 8 to 10 insects per plant and a 30-d incubation period, PCR results showed P. spumarius transmitted X. fastidiosa to two of five periwinkle plants but not to the seven olive plants. Sequences of PCR products from infected periwinkle were identical with those from X. fastidiosa-infected field trees. These data showed P. spumarius as a vector of X. fastidiosa strain infecting olives trees in the Salento Peninsula, Italy.
Beneficial microbes in the microbiome of plant roots improve plant health. Induced systemic resistance (ISR) emerged as an important mechanism by which selected plant growth-promoting bacteria and fungi in the rhizosphere prime the whole plant body for enhanced defense against a broad range of pathogens and insect herbivores. A wide variety of root-associated mutualists, including Pseudomonas, Bacillus, Trichoderma, and mycorrhiza species sensitize the plant immune system for enhanced defense without directly activating costly defenses. This review focuses on molecular processes at the interface between plant roots and ISR-eliciting mutualists, and on the progress in our understanding of ISR signaling and systemic defense priming. The central role of the root-specific transcription factor MYB72 in the onset of ISR and the role of phytohormones and defense regulatory proteins in the expression of ISR in aboveground plant parts are highlighted. Finally, the ecological function of ISR-inducing microbes in the root microbiome is discussed. Expected final online publication date for the Annual Review of Phytopathology Volume 52 is August 04, 2014. Please see http://www.annualreviews.org/catalog/pubdates.aspx for revised estimates.
The rpfF gene from Xylella fastidiosa, encoding the synthase for diffusible signal factor (DSF), was expressed in 'Freedom' grape to reduce the pathogen's growth and mobility within the plant. Symptoms in such plants were restricted to near the point of inoculation and incidence of disease was two- to fivefold lower than in the parental line. Both the longitudinal and lateral movement of X. fastidiosa in the xylem was also much lower. DSF was detected in both leaves and xylem sap of RpfF-expressing plants using biological sensors, and both 2-Z-tetradecenoic acid, previously identified as a component of X. fastidiosa DSF, and cis-11-methyl-2-dodecenoic acid were detected in xylem sap using electrospray ionization mass spectrometry. A higher proportion of X. fastidiosa cells adhered to xylem vessels of the RpfF-expressing line than parental 'Freedom' plants, reflecting a higher adhesiveness of the pathogen in the presence of DSF. Disease incidence in RpfF-expressing plants in field trials in which plants were either mechanically inoculated with X. fastidiosa or subjected to natural inoculation by sharpshooter vectors was two- to fourfold lower in than that of the parental line. The number of symptomatic leaves on infected shoots was reduced proportionally more than the incidence of infection, reflecting a decreased ability of X. fastidiosa to move within DSF-producing plants.
The role of flagellin perception in the context of plant beneficial bacteria still remains unclear. Here, we characterized the flagellin sensing system flg22– FLAGELLIN SENSING 2 ( FLS 2) in grapevine, and analyzed the flagellin perception in the interaction with the endophytic plant growth‐promoting rhizobacterium ( PGPR ) B urkholderia phytofirmans .
The functionality of the grapevine FLS 2 receptor, Vv FLS 2, was demonstrated by complementation assays in the A rabidopsis thaliana fls2 mutant, which restored flg22‐induced H 2 O 2 production and growth inhibition. Using synthetic flg22 peptides from different bacterial origins, we compared recognition specificities between V v FLS 2 and At FLS 2.
In grapevine, flg22‐triggered immune responses are conserved and led to partial resistance against B otrytis cinerea . Unlike flg22 peptides derived from P seudomonas aeruginosa or X anthomonas campestris , flg22 peptide derived from B . phytofirmans triggered only a small oxidative burst, weak and transient defense gene induction and no growth inhibition in grapevine. Although, in A rabidopsis, all the flg22 epitopes exhibited similar biological activities, the expression of V v FLS 2 into the fls2 background conferred differential flg22 responses characteristic for grapevine.
These results demonstrate that V v FLS 2 differentially recognizes flg22 from different bacteria, and suggest that flagellin from the beneficial PGPR B . phytofirmans has evolved to evade this grapevine immune recognition system.
Xylella fastidiosa, like related Xanthomonas species, employs an Rpf cell-cell communication system consisting of a diffusible signal factor (DSF) synthase, RpfF, and
a DSF sensor, RpfC, to coordinate expression of virulence genes. While phenotypes of a ΔrpfF strain in Xanthomonas campestris could be complemented by its own DSF, the DSF produced by X. fastidiosa (XfDSF) did not restore expression of the XfDSF-dependent genes hxfA and hxfB to a ΔrpfF strain of X. fastidiosa, suggesting that RpfF is involved in XfDSF sensing or XfDSF-dependent signaling. To test this conjecture, rpfC and rpfF of X. campestris were replaced by those of X. fastidiosa, and the contribution of each gene to the induction of a X. campestris DSF-dependent gene was assessed. As in X. fastidiosa, XfDSF-dependent signaling required both X. fastidiosa proteins RpfF and RpfC. RpfF repressed RpfC signaling activity, which in turn was derepressed by XfDSF. A mutated X. fastidiosa RpfF protein with two substitutions of glutamate to alanine in its active site was incapable of XfDSF production yet enabled a response to XfDSF, indicating that XfDSF production and the response to XfDSF are two separate functions in which RpfF is involved. This mutant was also hypervirulent to grape, demonstrating the antivirulence
effects of XfDSF itself in X. fastidiosa. The Rpf system of X. fastidiosa is thus a novel example of a quorum-sensing signal synthase that is also involved in the response to the signal molecule
that it synthesizes.
Endophytic bacteria are ubiquitous in most plant species, residing latently or actively colonizing plant tissues locally as well as systemically. Several definitions have been proposed for endophytic bacteria; in this review endophytes will be defined as those bacteria that can be isolated from surface-disinfested plant tissue or extracted from within the plant, and that do not visibly harm the plant. While this definition does not include nonextractable endophytic bacteria, it is a practical definition based on experimental limitations and is inclusive of bacterial symbionts, as well as internal plant-colonizing nonpathogenic bacteria with no known beneficial or detrimental effects on colonized plants. Historically, endophytic bacteria have been thought to be weakly virulent plant pathogens but have recently been discovered to have several beneficial effects on host plants, such as plant growth promotion and increased resistance against plant pathogens and parasites. In general, endophytic bacteria originate from the epiphytic bacterial communities of the rhizosphere and phylloplane, as well as from endophyte-infested seeds or planting materials. Besides gaining entrance to plants through natural openings or wounds, endophytic bacteria appear to actively penetrate plant tissues using hydrolytic enzymes like cellulase and pectinase. Since these enzymes are also produced by pathogens, more knowledge on their regulation and expression is needed to distinguish endophytic bacteria from plant pathogens. In general, endophytic bacteria occur at lower population densities than pathogens, and at least some of them do not induce a hypersensitive response in the plant, indicating that they are not recognized by the plant as pathogens. Evolutionarily, endophytes appear to be intermediate between saprophytic bacteria and plant pathogens, but it can only be speculated as to whether they are saprophytes evolving toward pathogens, or are more highly evolved than plant pathogens and conserve protective shelter and nutrient supplies by not killing their host. Overall, the endophytic microfloral community is of dynamic structure and is influenced by biotic and abiotic factors, with the plant itself constituting one of the major influencing factors. Since endophytic bacteria rely on the nutritional supply offered by the plant, any parameter affecting the nutritional status of the plant could consequently affect the endophytic community. This review summarizes part of the work being done on endophytic bacteria, including their methodology, colonization, and establishment in the host plant, as well as their role in plant–microbe interactions. In addition, speculative conclusions are raised on some points to stimulate thought and research on endophytic bacteria.Key words: endophytic bacteria, methods, localization, diversity, biological control.
Burkholderia phytofirmans PsJN is a naturally occurring plant-associated bacterial endophyte that effectively colonizes a wide range of plants and stimulates their growth and vitality. Here we analyze whole genomes, of PsJN and of eight other endophytic bacteria. This study illustrates that a wide spectrum of endophytic life styles exists. Although we postulate the existence of typical endophytic traits, no unique gene cluster could be exclusively linked to the endophytic lifestyle. Furthermore, our study revealed a high genetic diversity among bacterial endophytes as reflected in their genotypic and phenotypic features. B. phytofirmans PsJN is in many aspects outstanding among the selected endophytes. It has the biggest genome consisting of two chromosomes and one plasmid, well-equipped with genes for the degradation of complex organic compounds and detoxification, e.g., 24 glutathione-S-transferase (GST) genes. Furthermore, strain PsJN has a high number of cell surface signaling and secretion systems and harbors the 3-OH-PAME quorum-sensing system that coordinates the switch of free-living to the symbiotic lifestyle in the plant-pathogen R. solanacearum. The ability of B. phytofirmans PsJN to successfully colonize such a wide variety of plant species might be based on its large genome harboring a broad range of physiological functions.
Unlabelled:
Cell-cell signaling in Xylella fastidiosa has been implicated in the coordination of traits enabling colonization in plant hosts as well as insect vectors. This cell density-dependent signaling has been attributed to a diffusible signaling factor (DSF) produced by the DSF synthase RpfF. DSF produced by related bacterial species are unsaturated fatty acids, but that of X. fastidiosa was thought to be different from those of other taxa. We describe here the isolation and characterization of an X. fastidiosa DSF (XfDSF) as 2(Z)-tetradecenoic acid. This compound was isolated both from recombinant Erwinia herbicola expressing X. fastidiosa rpfF and from an X. fastidiosa rpfC deletion mutant that overproduces DSF. Since an rpfF mutant is impaired in biofilm formation and underexpresses the hemagglutinin-like protein-encoding genes hxfA and hxfB, we demonstrate that these traits can be restored by ca. 0.5 µM XfDSF but not by myristic acid, the fully saturated tetradecenoic acid. A phoA-based X. fastidiosa biosensor that assesses DSF-dependent expression of hxfA or hxfB revealed a high level of molecular specificity of DSF signaling.
Importance:
X. fastidiosa causes diseases in many important plants, including grape, where it incites Pierce's disease. Virulence of X. fastidiosa for grape is coordinated by cell-cell signaling molecules, designated DSF (Diffusible Signaling Factor). Mutants blocked in DSF production are hypervirulent for grape, suggesting that virulence is suppressed upon DSF accumulation and that disease could be controlled by artificial elevation of the DSF level in plants. In this work, we describe the isolation of the DSF produced by X. fastidiosa and the verification of its biological activity as an antivirulence factor. We also have developed X. fastidiosa DSF biosensors to evaluate the specificity of cell-cell signaling to be investigated.
Vascular occlusions are common structural modifications made by many plant species in response to pathogen infection. However, the functional role(s) of occlusions in host plant disease resistance/susceptibility remains controversial. This study focuses on vascular occlusions that form in stem secondary xylem of grapevines infected with Pierce's disease (PD) and the impact of occlusions on the hosts' water transport and the systemic spread of the causal bacterium Xylella fastidiosa in infected vines. Tyloses are the predominant type of occlusion that forms in grapevine genotypes with differing PD resistances. Tyloses form throughout PD-susceptible grapevines with over 60% of the vessels in transverse sections of all examined internodes becoming fully blocked. In sharp contrast, tylose development was mainly limited to a few internodes close to the point of inoculation in PD-resistant grapevines, impacting only 20% or less of the vessels. The extensive vessel blockage in PD-susceptible grapevines was correlated to an over 90% decrease in stem hydraulic conductivity, compared to an approximately 30% reduction in the stems of PD-resistant vines. Despite the systemic spread of X. fastidiosa in PD-susceptible grapevines, the pathogen colonized only 15% or less of the vessels in any internode and occurred in relatively small numbers, amounts much too small to directly block the vessels. Therefore we concluded that the extensive formation of vascular occlusions in PD-susceptible grapevines does not prevent the pathogen's systemic spread in them, but may significantly suppress the vines' water conduction, contributing to PD symptom development and the vines' eventual death.
Low temperatures damage many temperate crops, including grapevine, which, when exposed to chilling, can be affected by symptoms ranging from reduced yield up to complete infertility. We have previously demonstrated that Burkholderia phytofirmans PsJN, a plant growth-promoting rhizobacteria (PGPR) that colonizes grapevine, is able to reduce chilling-induced damage. We hypothesized that the induced tolerance may be explained at least partly by the impact of bacteria on grapevine photosynthesis or carbohydrate metabolism during cold acclimation. To investigate this hypothesis, we monitored herein the fluctuations of photosynthesis parameters (net photosynthesis [P(n)], intercellular CO(2) concentration, stomatal conductances, ΦPSII, and total chlorophyll concentration), starch, soluble sugars (glucose, fructose, saccharose, mannose, raffinose, and maltose), and their precursors during 5 days of chilling exposure (4°C) on grapevine plantlets. Bacterization affects photosynthesis in a non-stomatal dependent pattern and reduced long-term impact of chilling on P(n). Furthermore, all studied carbohydrates known to be involved in cold stress tolerance accumulate in non-chilled bacterized plantlets, although some of them remained more concentrated in the latter after chilling exposure. Overall, our results suggest that modification of carbohydrate metabolism in bacterized grapevine plantlets may be one of the major effects by which this PGPR reduces chilling-induced damage.
Several endophytic bacteria reportedly induce resistance to biotic stress and abiotic stress tolerance in several plant species. Burkholderia phytofirmans PsJN is a plant-growth-promoting rhizobacterium (PGPR) that is able to colonize grapevine tissues and induce resistance to gray mold. Further, PsJN induces physiological changes that increase grapevine tolerance to low nonfreezing temperatures. To better understand how bacteria induced the observed phenomena, stress-related gene expression and metabolite accumulation were monitored in 6-week-old Chardonnay grapevine plantlets after exposure to low nonfreezing temperatures. Under normal conditions (26°C), plantlet bacterization had no significant effect on the monitored parameters. By contrast, at 4°C, both stress-related gene transcripts and metabolite levels increased earlier and faster, and reached higher levels in PsJN-bacterized plantlets than in nonbacterized counterparts, in accordance with priming phenomena. The recorded changes may be correlated with the tolerance to cold stress conferred by the presence of PsJN. This is the first time that PGPR-induced priming has been shown to protect plants against low-temperature stress. Moreover, 1 week after cold exposure, levels of stress-related metabolites had declined more in PsJN-bacterized plants, suggesting that the endophyte is involved in the cold acclimation process via the scavenging system.
Citrus variegated chlorosis (CVC) is caused by Xylella fastidiosa, a phytopathogenic bacterium that can infect all Citrus sinensis cultivars. The endophytic bacterial communities of healthy, resistant, and CVC-affected citrus plants were studied by using
cultivation as well as cultivation-independent techniques. The endophytic communities were assessed in surface-disinfected
citrus branches by plating and denaturing gradient gel electrophoresis (DGGE). Dominant isolates were characterized by fatty-acid
methyl ester analysis as Bacillus pumilus, Curtobacterium flaccumfaciens, Enterobacter cloacae, Methylobacterium spp. (including Methylobacterium extorquens, M. fujisawaense, M. mesophilicum, M. radiotolerans, and M. zatmanii), Nocardia sp., Pantoea agglomerans, and Xanthomonas campestris. We observed a relationship between CVC symptoms and the frequency of isolation of species of Methylobacterium, the genus that we most frequently isolated from symptomatic plants. In contrast, we isolated C. flaccumfaciens significantly more frequently from asymptomatic plants than from those with symptoms of CVC while P. agglomerans was frequently isolated from tangerine (Citrus reticulata) and sweet-orange (C. sinensis) plants, irrespective of whether the plants were symptomatic or asymptomatic or showed symptoms of CVC. DGGE analysis of
16S rRNA gene fragments amplified from total plant DNA resulted in several bands that matched those from the bacterial isolates,
indicating that DGGE profiles can be used to detect some endophytic bacteria of citrus plants. However, some bands had no
match with any isolate, suggesting the occurrence of other, nonculturable or as yet uncultured, endophytic bacteria. A specific
band with a high G+C ratio was observed only in asymptomatic plants. The higher frequency of C. flaccumfaciens in asymptomatic plants suggests a role for this organism in the resistance of plants to CVC.