PreprintPDF Available
Preprints and early-stage research may not have been peer reviewed yet.

Abstract and Figures

The Neotropical tribe Dorynotini is characterized by a conspicuous tubercle or spine adorning the elytra, which, along with a few other characters, has been used to differentiate its recognized five genera and two subgenera. However, relationships among these taxa and the evolutionary origin of the pronounced tubercle remain speculative. Here we present the first total-evidence phylogenetic reconstruction of Dorynotini to investigate the homology and evolution of the elytral tubercle. Our analyses are based on 89 discrete morphological characters and DNA sequence data from three gene regions. Phylogenetic relationships were inferred using Bayesian inference, maximum likelihood and maximum parsimony. Our analyses support the respective monophyly of Dorynotini and its genera and subgenera, except the paraphyletic Dorynota s.s. Species endemic to the Greater Antilles form a clade with three distinct morphotypes. Omoteina aculeata (Boheman, 1854) nov. comb. is transferred from the genus Dorynota, and Paratrikona Spaeth, 1923 nov. syn. is found to be congeneric with Omoteina Chevrolat, 1836. The spiniform projection is found to be plesiomorphic within Dorynotini and convergently reduced/lost in different lineages of the tribe. Some morphological characters defining dorynotine taxa are homoplastic, requiring re-evaluation guided by molecular analyses for more accurate classification and an improved understanding of taxon evolution.
Content may be subject to copyright.
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14 1
Zoological Journal of the Linnean Society, 2018, XX, 1–14. With 5 figures.
Solving a thorny situation: DNA and morphology
illuminate the evolution of the leaf beetle tribe
Dorynotini (Coleoptera: Chrysomelidae: Cassidinae)
MARIANNA V. P. SIMÕES1,*,, STEPHEN M. BACA2, EMMANUEL F. A. TOUSSAINT3,
DONALD M. WINDSOR4 and ANDREW E. Z. SHORT2
1Department of Marine Zoology-Crustaceans, Senckenberg Research Institute and Natural History
Museum, Senckenberganlage 25, 60325 Frankfurt am Main, Germany
2Department of Ecology and Evolutionary Biology; and Division of Entomology, Biodiversity Institute,
University of Kansas, Lawrence, KS 66045, USA
3Florida Museum of Natural History, University of Florida, Powell Hall, 3215 Hull Road, Gainesville,
FL 32611–2710, USA
4Smithsonian Tropical Research Institute, Apartado 0843-03092, Balboa, Ancon, Republica de Panamá
Received 7 March 2018; revised 28 June 2018; accepted for publication 10 September 2018
The Neotropical tribe Dorynotini is characterized by a conspicuous tubercle or spine adorning the elytra, which,
along with a few other characters, has been used to differentiate its recognized five genera and two subgenera.
However, relationships among these taxa and the evolutionary origin of the pronounced tubercle remain speculative.
Here we present the first total-evidence phylogenetic reconstruction of Dorynotini to investigate the homology and
evolution of the elytral tubercle. Our analyses are based on 89 discrete morphological characters and DNA sequence
data from three gene regions. Phylogenetic relationships were inferred using Bayesian inference, maximum likeli-
hood and maximum parsimony. Our analyses support the respective monophyly of Dorynotini and its genera and
subgenera, except the paraphyletic Dorynota s.s. Species endemic to the Greater Antilles form a clade with three
distinct morphotypes. Omoteina aculeata (Boheman, 1854) nov. comb. is transferred from the genus Dorynota,
and Paratrikona Spaeth, 1923 nov. syn. is found to be congeneric with Omoteina Chevrolat, 1836. The spiniform
projection is found to be plesiomorphic within Dorynotini and convergently reduced/lost in different lineages of the
tribe. Some morphological characters defining dorynotine taxa are homoplastic, requiring re-evaluation guided by
molecular analyses for more accurate classification and an improved understanding of taxon evolution.
ADDITIONAL KEYWORDS: ancestral character reconstructionn – Caribbean – Insecta – insect phylogeny –
molecular systematics – Neotropical – phylogenetic systematics – phylogenetics, Bayesian analysis – phylogenetics,
maximum likelihood – taxa, new classification – taxonomy – total-evidence phylogenetic reconstruction.
INTRODUCTION
Cassidinae s.l., commonly known as tortoise beetles, is
the second largest subfamily of leaf beetles, with ~6300
described species worldwide (Borowiec & Świętojańska,
2018). The tribe Dorynotini Monrós & Viana, 1949 is
an exclusively Neotropical clade of cassidines (Chaboo,
2007) distributed from central Mexico to northern
Argentina, including the Greater Antilles (Borowiec &
Świętojańska, 2018). The tribe currently contains 56 spe-
cies distributed in five genera: Dorynota Chevrolat, 1836,
Heteronychocassis Spaeth, 1915 (one species), Omoteina
Chevrolat, 1836 (one species), Paranota Monrós & Viana,
1949 (five species) and Paratrikona Spaeth, 1923 (seven
species). The most diverse genus, Dorynota, is further
split into two subgenera: Dorynota s.s. (18 species) and
Akantaka Maulik, 1916 (24 species) (Bouchard et al.,
2011; Simões, 2014; Simões & Sekerka, 2014; Simões &
Sekerka, 2015; Borowiec & Świętojańska, 2018).
Chevrolat (in Dejean, 1836) first proposed the
genus Dorynota for Neotropical cassidines with a
*Corresponding author. E-mail: mariannavpsimoes@gmail.com
12October2018
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
2 M. V. P. SIMÕES ET AL.
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
post-scutellar spiniform projection. Later, Maulik
(1916) erected two additional genera, Akantaka and
Trikona, based on the presence and shape of the post-
scutellar projection on the elytra and provided an iden-
tification key, where the shape of the scutellum was
also proposed to distinguish the three genera. Monrós
& Viana (1949) considered the classification proposed
by Chapuis (1835) as better supported by morpho-
logical characters, and revalidated the tribe (= group;
Chapuis, 1835) ‘Batonotites’, changing its name to
Dorynotini, characterized by: (1) the presence of in-
sertion pockets (for the posterior margin of the pro-
notum) on the anterior margin of the elytra; (2) the
presence and shape of a vertical post-scutellar spine/
tubercle on the elytral suture; and (3) the symmetry
and angle between pretarsal claws. The genera in this
tribe were grouped mostly based on the presence or ab-
sence and shape of the elytral spine/tubercle, forming
five conspicuous, recognizable morphotypes (Figs 1, 2).
Moreover, Monrós & Viana (1949) described the genus
Paranota and recognized six other genera in the tribe:
Akantaka, Dorynota, Heteronychocassis, Omoteina,
Paratrikona and Eremionycha Spaeth, 1911.
Hincks (1952) downgraded Akantaka to a subgenus
of Dorynota and synonymized the genus Trikona with
Omoteina for sharing the type species (Cassida humer-
alis Olivier, 1808), a classification that was accepted in
later works (Borowiec, 1999; Borowiec & Świętojańska,
2018). In 1999, Borowiec transferred Eremionycha to
the tribe Cassidini Gyllenhal, resulting in the current
composition of Dorynotini.
Multiple cladistic analyses based on adult morph-
ology (Borowiec, 1995; Chaboo, 2007; López-Pérez
et al., 2017) and molecular data (12S mitochondrial
DNA; Hsiao & Windsor, 1999) have supported the
monophyly of the Dorynotini. However, phylogenetic
relationships among genera remain unresolved, and
insights about the homology and function of the elytral
spine/tubercle are still lacking.
Spaeth (1923) observed that members of the tribe
lacking the post-scutellar projection or with a tuber-
cle-shaped projection are restricted to the Greater
Antilles (Omoteina and Paratrikona) and the Amazon
Basin region (Akantaka), whereas species with a spin-
iform post-scutellar projection occur throughout the
Neotropics, with their diversity concentrated in the
southern part of the tribal range. Based on this dis-
tribution pattern, he suggested that the presence and
prominence of the post-scutellar projection would be
correlated with environmental gradients across the
distribution of the clade, allowing the species with the
spine to invade cooler areas of the Neotropics. Simões
et al. (2017) rejected the hypothesis posed by Spaeth
Figure 1. A–E, dorsal and lateral habitus of the five mor-
photypes found within the tribe Dorynotini.
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
EVOLUTION OF DORYNOTINE TORTOISE BEETLES 3
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
(1923), concluding that morphological divergence
occurs with high levels of environmental overlap, and
suggested that the presence of the post-scutellar pro-
jection could be related to biotic interactions, perhaps
as camouflage to guard against predation.
The tribe Dorynotini was last reviewed by Monrós
& Viana (1949), and no systematic work has been
conducted at the tribal level since. Here, we combine
morphological and molecular data to (1) test the mono-
phyly of the tribe; (2) test the monophyly and relation-
ships among the genera within the tribe; (3) elucidate
biogeographical patterns; and (4) investigate the hom-
ology and evolution of the post-scutellar projection and
other key characters using ancestral character state
reconstruction (ACSR). This is the first systematic
attempt to resolve relationships among dorynotine
lineages, allowing further insight into their intriguing
evolution and morphology.
MATERIAL AND METHODS
Taxon sampling
For morphological and molecular datasets, we sam-
pled 16 species of Dorynotini, including four of the five
genera and both subgenera (Supporting Information,
Table S1). We were unable to include the monotypic
genus Heteronychocassis, from French Guiana. The
species is known only from the heavily damaged holo-
type, deposited at The Manchester Museum (Simões &
Sekerka, 2014). Although sampling of in-group species is
limited, we sought to cover the diversity of genera within
the tribe, in which species are extremely rare in the field
and in collections, usually known only from short series
of specimens (Blake, 1939; Borowiec, 2009; Simões, 2017).
We sampled a broad selection of outgroup taxa be-
cause the relationships among tribes of Cassidinae
remain contentious (Borowiec, 1995; Hsiao & Windsor,
1999; Chaboo, 2007). We sampled 15 species repre-
senting the tribes that had been recovered in past
studies as closely related to Dorynotini, Cassidini
Gyllenhal, 1813, Ischyrosonychini Chapuis, 1875 and
Mesomphaliini Chapuis, 1875 (Borowiec, 1995; Hsiao
& Windsor, 1999; Chaboo, 2007; Lopez et al., 2017)
(Table 1). Specimens for sequencing were obtained
during fieldwork in Bolivia, Brazil, the Dominican
Republic, French Guiana and Panama.
morphological characTers
Eighty-nine phylogenetically informative adult mor-
phological characters were used to assess interspe-
cific morphological differences and build a discrete
data matrix (Supporting Information, Appendix S1
and Table S2). They include 85 external anatomical
characters and four internal anatomical characters
(Supporting Information, Appendix S1).
To prepare for the morphological examinations of
the exo- and endoskeleton including wings, specimens
were placed in a heated aqueous solution of 10% potas-
sium hydroxide (KOH) for 7 min. Structural termin-
ology follows Monrós & Viana (1949), Borowiec (2005)
and Chaboo (2007), with the following exceptions:
hind wing venation, which follows Suzuki (1994); and
the metendosternite, which follows Crowson (1938)
and Hübler & Klass (2013). All character states were
treated as unordered in all analyses. Missing charac-
ters states were scored as ‘?’.
exTracTion of Dna anD gene sequencing
Total genomic DNA was extracted from legs or thoracic
tissue of specimens preserved in 96% ethanol using a
Qiagen DNeasy extraction kit (Qiagen, Valencia, CA,
Figure 2. A–C, adult Dorynotini. A, male and female of Dorynota (s.s.) pugionata (Germar) copulating. B, Omoteina humer-
alis (Olivier). C, Dorynota (Akantaka) funesta (Boheman). [Phototographs: A, Victor Chaves Machado; C, alapi973 (Flickr:
https://www.flickr.com/people/83287919@N00/)].
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
4 M. V. P. SIMÕES ET AL.
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
Table 1. List of specimens used in this study
Tribe Genus Species Code Locality CO1 CAD 28S
Cassidini Coptocycla arcuata MVPS32B Brazil, Rio de
Janeiro
MH717727 MH717755 MH744688
Cassidini Charidotella quadrisignata MVPS22B Dominican
Republic, Santo
Domingo
MH717726 MH717754 MH744687
Cassidini Deloyala fuliginosa MVPS28B Dominican
Republic, Santo
Domingo
MH717729 MH717757 MH744690
Cassidini Eremionycha bahiana MVPS13B Brazil, Rio de
Janeiro
MH717740 MH717767 MH744702
Cassidini Metriona elatior MVPS08B Brazil, Rio de
Janeiro
MH717742 MH717770 MH744705
Cassidini Plagiometriona ambigena MVPS35B Brazil, Rio de
Janeiro
MH717750 MH717779 MH744714
Cassidini Plagiometriona inscripta MVPS23B Brazil, Rio de
Janeiro
MH717749 MH717778 MH744713
Cassidini Syngambria bisinuata MVPS31B Brazil, Minas
Gerais
MH717753 MH717782 MH744717
Dorynotini Dorynota pugionata MVPS09B Brazil, Minas
Gerais
MH717730 MH717758 MH744691
Dorynotini Dorynota aculeata MVPS17B Dominican
Republic,
Barahona
MH717731 MH717759 MH744692
Dorynotini Dorynota bidens MVPS16B Brazil, Rio de
Janeiro
MH717732 MH717760 MH744693
Dorynotini Dorynota boliviana MVPS01B Bolivia, Andres
Ibanez
MH717733 MH717761 MH744694
Dorynotini Dorynota collucens MVPS05B Bolivia, Florida MH717734 MH717762 MH744695
Dorynotini Dorynota distincta MVPS11B Panama MH717735 MH717763 MH744696
Dorynotini Dorynota funesta DW7829 French Guiana,
Patawa
– MH744697
Dorynotini Dorynota insidiosa MVPS04B Panama, Chiriqui MH717736 MH717764 MH744698
Dorynotini Dorynota monoceros DW0515 Brazil, Colombo MH717737 MH744699
Dorynotini Dorynota parallela MVPS20B Brazil, Minas
Gerais
MH717738 MH717765 MH744700
Dorynotini Dorynota truncata MVPS06B French Guiana MH717739 MH717766 MH744701
Dorynotini Omoteina humeralis MVPS18B Dominican
Republic,
Barahona
MH717743 MH717771 MH744706
Dorynotini Paranota minima MVPS07B Bolivia, Andres
Ibanez
MH717744 MH717772 MH744707
Dorynotini Paranota rugosa MVPS14B Brazil, Mato Grosso MH717745 MH717773 MH744708
Dorynotini Paranota spinosa MVPS15B Brazil, Mato Grosso MH717774 MH744709
Dorynotini Paratrikona rubescens MVPS19B Brazil, Mato Grosso MH717746 MH717775 MH744710
Mesomphaliini Cyrtonota sexpustulata MVPS41B Brazil, Rio de
Janeiro
MH717728 MH717756 MH744689
Mesomphaliini Mesomphalia variolaris MVPS46B Brazil, Bahia MH717769 MH744704
Mesomphaliini Stolas conspersa MVPS44B Brazil, Rio de
Janeiro
MH717751 MH717780 MH744715
Mesomphaliini Stolas modica MVPS43B Brazil, Rio de
Janeiro
MH717752 MH717781 MH744716
Physonotini Eurypepla calachoroa MVPS56B USA, Florida MH717741 MH717768 MH744703
Physonotini Physonota attenuata MVPS53B Nicaragua, Granada MH717747 MH717776 MH744711
Physonotini Physonota gigantea MVPS52B Nicaragua, Granada MH717748 MH717777 MH744712
Classification follows Borowiec & Świetojańska (2018). GenBank accession codes for each successfully sequenced or downloaded gene fragment will
be provided once the paper is accepted.
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
EVOLUTION OF DORYNOTINE TORTOISE BEETLES 5
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
USA). We used the primers listed in Table 2 to amp-
lify and sequence one mitochondrial gene fragment,
cytochrome oxidase subunit 1 (CO1, 588 bp), and
two nuclear gene fragments, 28S (995 bp) and carba-
moylphosphate synthetase (CAD, 723 bp).
Polymerase chain reactions (PCRs) consisted of the
following cycling steps: initial denaturation for 4 min
at 95–98 °C; 30–40 cycles of denaturation for 30 s at
95–98 °C, annealing for 30 s at different temperatures
depending on the primer pair (see below), and exten-
sion for 1–1.5 min at 72 °C; with a final extension for
5–10 min at 72 °C. The annealing temperatures for each
gene fragment were as follows: 50–51 °C for CO1 (Baca
et al., 2017) and 50 °C for 28S. Fragment 1 of CAD was
generated using a ‘touchdown’ PCR with the following
conditions: initial denaturation at 95 °C (3.5 min); six
cycles of 95 °C (30 s), 50 °C (30 s) and 72 °C (1 min); ten
cycles of 95 °C (30 s), 51 °C (30 s) and 72 °C (1 min); ten
cycles of 95 °C (30 s), 52 °C (30 s) and 72 °C (1 min); six
cycles of 95 °C (30 s), 53 °C (30 s) and 72 °C (1 min); four
cycles of 95 °C (30 s), 54 °C (30 s) and 72 °C (1 min); four
cycles of 95 °C (30 s), 55 °C (30 s) and 72 °C (1 min); four
cycles of 95 °C (30 s), 56 °C (30 s) and 72 °C (1 min); and
six cycles of 95 °C (30 s), 57 °C (30 s) and 72 °C (1 min).
GenBank accession numbers, specimen voucher num-
bers and collection data are provided in the Table 1.
sequence alignmenT anD phylogeneTic analysis
Sequence alignment
Sequence data were aligned and concatenated using
Geneious R v.9.0.5 (Biomatters, http://www.geneious.
com/). Protein-coding gene fragments (CO1 and CAD)
were aligned using MUSCLE (Edgar, 2004), and the
ribosomal gene fragment (28S) was aligned using
MAFFT v.7.017 (Katoh & Standley, 2013) with de-
fault settings (algorithm: Auto; scoring matrix: 200
PAM/k = 2; gap open penalty: 1.53; and offset value:
0.123). The reading frames of protein-coding gene
fragments CO1 and CAD were checked in Geneious R
v.9.0.5 to ensure the absence of stop codons or other
alignment problems.
Phylogenetic analyses
We performed analyses using three combinations of
data: morphology only, molecular only and a third
with both molecular and morphological datasets com-
bined (total-evidence dataset). For the morphology-
only dataset, we conducted an equal-weight maximum
parsimony (MP) analysis in TNT v.1.5 (Goloboff &
Catalano, 2016) using a New Technology Search with
10 000 trees held in memory, and 1000 parsimony
ratchet iterations performed (Nixon, 1999), followed
by 100 cycles of tree drifting and 100 rounds of tree
fusing (Goloboff, 1999). Branch support was calculated
with the bootstrap (BS, nona: 1000 replications, option
‘mult*100; hold/100’). A BS 70 is considered as indi-
cating strong support for a given node (Felsenstein,
1985).
For the molecular-only and total-evidence data-
sets, phylogenetic relationships were investigated
using maximum likelihood (ML) and Bayesian in-
ference (BI). Individual gene trees of each fragment
were inferred with both ML and BI analyses (via
analysis methods described below). The concatenated
molecular dataset was partitioned a priori by codon
position for protein-coding gene fragments (CO1
and CAD), with the ribosomal gene fragment (28S)
treated as a single whole partition, resulting in a total
of seven partitions. Optimal partitioning schemes
(Supporting Information, Table S2) and models for
BI analyses were estimated with PartitionFinder v.2
(Lanfear et al., 2016) using the ‘greedy’ search algo-
rithm, the ‘MrBayes’ set of models, and the Bayesian
information criteria (BIC) metric for model selection
and scheme comparison; for ML analyses, we speci-
fied the partitions a priori and used the ‘Auto’ func-
tion to find the best partitioning scheme (ModelFinder;
Kalyaanamoorthy et al., 2017) and using the in W-IQ-
TREE v.1.5.4 (Nguyen et al., 2015). For the total-
evidence dataset, the morphological partition was
Table 2. List of primers used to amplify the gene fragments used in this study
Gene Location Primer Direction Sequence Reference
CO1 Mitochondrial Jerry Forward CAACAYTTATTTTGATTTTTTGG Simon et al. (1994)
CO1 Mitochondrial Pat Reverse ATCCATTACATATAATCTGCCATA Simon et al. (1994)
28S Nuclear NLF184-21 Forward ACCCGCTGAAYTTAAGCATAT Van der Auwera
et al. (1994)
28S Nuclear LS1041R Reverse TACGGACRTCCATCAGGGTTTCCCCTGACTTC Wild & Maddison
(2008)
CAD Nuclear CD439F Forward TTCAGTGTACARTTYCAYCCHGARCAYAC Wild & Maddison
(2008)
CAD Nuclear CD688R Reverse TGTATACCTAGAGGATCDACRTTYTCCATRTTRCA Wild & Maddison
(2008)
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
6 M. V. P. SIMÕES ET AL.
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
analysed using the MK model (Lewis, 2001) and run
using MrBayes v.3.2.6 (Ronquist et al., 2012).
The BI analyses were conducted in MrBayes v.3.2.6
(Ronquist et al., 2012) using the BEAGLE library
(Ayres et al., 2012) on the CIPRES Science Gateway
server (Miller et al., 2010). We used two independent
runs of eight Markov chain Monte Carlo (MCMC)
chains (one cold and seven incrementally heated),
each running for 20 million generations, with sam-
pling every 1000 generations. After checking for con-
vergence of the runs in Tracer v.1.5 (http://BEAST.bio.
ed.ac.uk/Tracer) and applying a conservative burn-in
of 25%, we used the command sump in MrBayes to
calculate the posterior probabilities (PP) and sumt to
produce a 50% majority rule consensus tree.
The ML analyses were carried out in IQ-TREE
v.1.5.4 as implemented in W-IQ-TREE (http://iqtree.
cibiv.univie.ac.at/; Trifinopoulos et al., 2016). We per-
formed 1000 ultrafast bootstrap replicates (UFBoot;
Minh et al., 2013) to investigate nodal support across
topologies, using the SH-aLRT test (Guindon et al.,
2010). A posterior probability (PP) 0.95 and an
UFBoot 95 were recognized as indicating strong sup-
port for a given node (Erixon et al., 2003; Minh et al.,
2013).
ancesTral characTer sTaTe reconsTrucTion
The analysis of morphological character evolution
was conducted through ACSR with Mesquite v.3.10
(Maddison & Maddison, 2015) using the ML tree, be-
cause it offered a sounder hypothesis of the relation-
ship between taxa (see ‘Monophyly and systematic
placement of Dorynotini within Cassidinae’).
The MP approach was used to account for the in-
completeness of sampling within the representatives
of the tribe (Joy et al., 2016). We reconstructed all 85
external anatomical characters and four internal ana-
tomical characters, with a focus on the few characters
that were used by previous authors to characterize
different genera. The reconstructed characters states
were as follows: antennal calli (absent; present, poorly
developed; and present, well developed; character 28);
shape of scutellum (triangular or diamond shaped;
character 46); anterior margin of elytra with inser-
tion pocket (character 49); shape of lateral margins
(concave or convex/straight; character 53); presence of
post-scutellar projection (character 56), and its shape
(conical-shaped tubercle; triangular-shaped tubercle;
and spiniform; character 57); angle formed at the base
of pretarsal claws (obtuse; straight; acute; and sub-
parallel with no angle near the base; character 82);
and their symmetry (symmetrical; inconspicuously
asymmetrical; and conspicuously asymmetrical;
character 83).
RESULTS
phylogeneTic analyses
The concatenated molecular matrix comprised 2291
aligned base pairs. Analyses of the morphological data-
set (MP) and the individual-gene and total-evidence
datasets (under both ML and BI) produced topologies
with low nodal support at nearly all nodes. All gene
trees and total-evidence analyses recovered broadly
similar phylogenetic patterns, with heterogeneous
values of nodal support depending on the optimality
criterion and dataset (see Supporting Information,
Appendix S2, Figs S89–S96).
Both analyses (ML and BI) of the concatenated mo-
lecular dataset recovered Cassidini as the sister group
to Dorynotini with strong support (UFBoot = 100,
PP = 1.0). Cassidini is decisively paraphyletic, as pre-
vious phylogenetic reconstructions have demonstrated
(Chaboo, 2007; López-Pérez et al., 2017). A repre-
sentative of Cassidini was recovered as sister taxon
to Dorynotini in all analyses (Fig. 3), Syngambria
bisinuata (Boheman, 1855) in the ML analysis and
Eremionycha bahiana (Boheman, 1855) in the BI ana-
lysis (Fig. 4).
Dorynotini was strongly supported as monophyletic
in all concatenated molecular analyses (UFBoot = 100,
PP = 1.0). The genus Paranota was also recovered as
monophyletic with strong support (UFBoot = 100,
PP = 1.0), and the ML and BI topologies were congruent
with respect to intrageneric phylogenetic relation-
ships. The genus Dorynota was recovered as polyphyl-
etic in all analyses (Fig. 4; Supporting Information,
Appendix S2, Figs S89–S96), although there was
some consistent structuring within the genus. The
subgenus Akantaka was recovered as monophyletic
with strong support (UFBoot = 99, PP = 0.98), al-
beit the intrasubgeneric phylogenetic relationships
received low support and exhibited areas of conflict
across analyses (Fig. 4). The subgenus Dorynota s.s.
was recovered as paraphyletic with respect to other
genera, with its members emerging in three differ-
ent clades within the tree: (1) a strongly supported
clade of South American Dorynota s.s. species (‘clade
1’; UFBoot = 99, PP = 1.0) was recovered as sister to
the rest of Dorynotini (UFBoot = 88, PP = 1.0); (2)
Dorynota (s.s.) aculeata, was recovered as sister to
Paratrikona (UFBoot = 97, PP = 0.87), together with
Omoteina forming a clade endemic to the Greater
Antilles, with high support (‘clade 2’; UFBoot = 100,
PP = 1.0); and (3) Dorynota (s.s.) bidens was recovered
as sister to the subgenus Akantaka, with high support
(‘clade 3’ UFBoot = 99, PP = 0.99) (Fig. 3).
The MP analysis of morphological data (Supporting
Information, Appendix S2, Fig. S95) recovered a well-
resolved strict consensus tree, collapsed from the
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
EVOLUTION OF DORYNOTINE TORTOISE BEETLES 7
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
16 shortest trees [length = 319, consistency index
(CI) = 0.418, retention index (RI) = 0.752]. The top-
ology recovered is congruent, in part, with results of
the molecular dataset analyses. The tribe Dorynotini,
the genus Paranota and subgenus Akantaka were
recovered as monophyletic, with high nodal support
(BS = 98, BS = 80 and BS = 49, respectively); and clades
2 and 3 were strongly supported (BS = 82 and BS = 80,
respectively). Dorynota s.s. was recovered as paraphy-
letic, with representatives emerging independently in
two clades along the tree: (1) within clade 2, with high
nodal support (BS = 82); and (2) in a poorly supported
clade (BS = 13), including the subgenera Dorynota s.s.
and Akantaka, where D. (s. s.) pugionata and D. (s.s.)
Figure 3. Phylogeny of the tribe Dorynotini based on maximum likelihood analysis of the concatenated molecular dataset
comprising two nuclear (28S, CAD) and one mitochondrial (CO1) gene fragment. Nodal support values represent bootstraps
of the maximum likelihood analysis and posterior probabilities of the Bayesian inference. Nodes that were not consistently
recovered in all phylogenetic analyses are indicated by ‘*’. Adult Cassidinae photographs (top to bottom): Physonota attenu-
ata Boheman; Stolas modica (Boheman); Eremionycha bahiana (Boheman); Dorynota (s.s.) pugionata (Germar); Omoteina
humeralis (Olivier); and Dorynota (Akantaka) truncata (Fabricius).
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
8 M. V. P. SIMÕES ET AL.
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
parallela are recovered as a clade, sister to D. (s.s.)
monoceros and clade 3.
ancesTral characTer sTaTe reconsTrucTion
For Dorynotini, the diamond-shaped scutellum
(Supporting Information, Appendix S1, Figs S53,
S54) and the spiniform post-scutellar projection
(Supporting Information, Appendix S1, Figs S2, S52)
were recovered as synapomorphies. The diamond-
shaped scutellum exhibits a single reversal to tri-
angular shaped (Supporting Information, Appendix
S1, Figs S3, S51) in the Greater Antillean clade
(Supporting Information, Appendix S1, Figs S3, S51),
and the spiniform post-scutellar projection was lost
in Omoteina humeralis and underwent transitions
in Paratrikona rubescens and Akantaka to conical or
triangular-shaped tubercles (Fig. 5A, B). The straight
angle between the pretarsal claws was recovered as
the plesiomorphic state within Dorynotini, which
evolved to subparallel once in Dorynota (s.s.) pugio-
nata + Dorynota (s.s.) parallela, and to an acute angle
in the clades Dorynota (s.s. ) aculeata + Paratrikona
rubescens and Paranota (Supporting Information,
Appendix S1, Figs S81–S83). Based on our results, the
symmetry and angle at the base of the pretarsal claws
are correlated characters within Dorynotini: subpar-
allel claws are inconspicuously asymmetric, acute-
angled base of claws are distinctly asymmetric, and
obtuse-angled base of claws are symmetric (Fig. 5C).
The presence of well-developed antennal calli was
recovered as a synapomorphic character for the
Figure 4. Mirrored topologies recovered using maximum likelihood (left) and Bayesian inference (right) analyses.
Conflicting nodes between both analyses and respective nodal support values are depicted.
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
EVOLUTION OF DORYNOTINE TORTOISE BEETLES 9
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
tribe, with one reversal to being poorly developed in
Paranota + clade 3.
The ancestral character state reconstruction ana-
lysis also revealed other characters that appear to
have a phylogenetic significance as potential synapo-
morphies for the tribe, which are as follows: w-shaped
posterior angle of pronotum (character 25); the proti-
bial apex depressed on the internal margin (char-
acter 40); presence of insertion pocket in the anterior
margin of the elytra (character 49); presence of hu-
meral ridge on the elytra (character 50); presence of
locking system at the elytral suture (character 64);
Figure 5. A–C, ancestral character state reconstruction (ACSR) of selective characters traditionally used to classify differ-
ent genera of Dorynotini. The tribe stem node is indicated by an arrow. Branch colours highlight the results of the ACSR
parsimony reconstruction. A, elytra dorsum with post-scutellar projection (character 56). B, shape of post-scutellar projec-
tion (character 57). C, symmetry of pretarsal claws (character 83). Adult Cassidinae species represented (left to right): Stolas
modica (Boheman); Dorynota (s.s.) pugionata (Germar); Omoteina humeralis (Olivier); Dorynota (s.s.) aculeata (Boheman);
Paratrikona rubescens Blake; Paranota minima (Wagener); Dorynota (s.s.) bidens (Fabricius); and Dorynota (Akantaka)
truncata (Fabricius).
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
10 M. V. P. SIMÕES ET AL.
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
epipleural ridge tooth (character 65); metasternum
with elevated posterior margin (character 74); and
protibial apex depressed on internal margin (char-
acter 40) (see Supporting Information, Appendix S3,
Figs S98, S101, S104, S105, S109, S110, S113). The
morphological characters traditionally used for diag-
nosing genera of the tribe were not recovered as
synapomorphies but represent plesiomorphies or con-
vergent characters. These characters include the scu-
tellum shape, presence and shape of a post-scutellar
spine/tubercle, and the disposition and asymmetry of
the pretarsal claws.
Taxonomic classificaTion
Clade 2 is consistently recovered as monophyletic
in all analyses, with high nodal support (see Fig. 3;
Supporting Information, Appendix S2, Figs S89–
S96). It is composed of the three species endemic to
the Greater Antilles: O. humeralis, D. (s.s.) aculeata
and P. rubescens. Based on ACSR, this clade presents
a general pattern of reversal of states considered
plesiomorphic within Dorynotini. It is characterized
by sharing the following character states: antenno-
mere V wider at apex (character 8); pronotum with
truncate posterior angle (character 25); absence of
hypomeron depression (character 36); triangular-
shaped scutellum (character 46); epipleural ridge
tooth not conspicuously elevated (character 67);
large, deep elytral punctuation (character 71); and
metasternum strongly elevated (character 74) (see
Supporting Information, Appendix S3, Figs S99,
S100, S103, S111–S113).
To address the incongruence of the current classifi-
cation with our results, we propose a nomenclatural
reorganization of clade 2, by proposing the synonymy
of the genus Omoteina with Paratrikona syn. nov.,
and the transfer of its species and D. (s.s.) aculeata to
the genus Omoteina. As a result, the clade is composed
of Omoteina aculeata (Boheman, 1854) comb.
nov., Omoteina blakae (Simões, 2017) comb.
nov., Omoteina lerouxii (Boheman, 1854) comb.
nov., Omoteina ovata (Blake, 1938) comb. nov.,
Omoteina rubescens (Blake, 1939) comb. nov.,
Omoteina turrifera (Boheman, 1854) comb. nov.,
Omoteina turritella (Blake, 1837) comb. nov. and
Omoteina variegata (Blake, 1939) comb. nov.
For the remaining recovered clades, we do not pro-
pose any taxonomic changes. The Greater Antilles
clade is the only clade that is consistently recov-
ered with high support and presents a distributional
pattern that offers another line of evidence sup-
porting the clade as an independent lineage within
Dorynotini.
DISCUSSION
monophyly anD sysTemaTic placemenT of
DorynoTini in cassiDinae
Borowiec (1995) was the first to provide a cladistic
test of the tribal relationships within the subfamily
Cassidinae, based on 19 adult morphological char-
acters that were previously used by Hincks (1952).
In this seminal work, Borowiec (1995) recovered
Dorynotini as part of a polytomy with the tribes
Cassidini and Ischyrosonychini. However, he did not
provide additional discussion on its placement or pos-
sible relationships with other tribes. Hsiao & Windsor
(1999) used molecular data (12S mitochondrial DNA)
to test the relationships between Hispinae and
Cassidinae, but, only one species of Dorynotini was
included, which was recovered as nested in Cassidini.
Chaboo (2007) conducted a phylogenetic analysis of
Cassidinae s.l., based on morphological data of adults
and immatures, including Dorynota and Paratrikona.
Her analysis recovered Dorynotini + Ischyrosonychini
as sister to Stolaini (= Mesomphaliini Chapuis, 1875).
Lopez et al. (2017), based on 96 adult morphological
characters, recovered the Dorynotini as sister to the
Mesomphaliini + Cassidini s.l., whereas in our results
we recovered Cassidini as paraphyletic. In the present
study, the two species recovered as sister to Dorynotini
in the BI or ML analyses are currently placed within
Cassidini: Eremionycha bahiana (Boheman, 1855) and
Syngambria bisinuata (Boheman, 1855). Both species
present different morphologies regarding the presence
of the post-scutellar tubercle. Given the results of the
parsimony ACSR on the ML tree, the most recent an-
cestor of Dorynotini had a cone-shaped tubercle post-
scutellar projection (Fig. 5A, B), with the spiniform
post-scutellar projection a synapomorphy for the tribe,
secondarily lost in O. humeralis and convergently
reduced to a tubercle in P. rubescens (cone shaped) and
Akantaka (triangular shaped). Syngambria bisinu-
ata, recovered as the sister taxon of Dorynotini in our
ML analysis, has a conical tubercle post-scutellar pro-
jection, allowing for speculation on the transition to
the elongate post-scutellar projection within the stem
Dorynotini. In the BI analysis, E. bahiana is recovered
as sister to Dorynotini and, although previously placed
within the tribe, its morphology does not offer support
for such a placement.
The w-shaped posterior angle of the pronotum varied
from well marked to soft marked in our analysis. The
shape of the posterior angle of the pronotum is gener-
ally associated with the presence of a diamond-shaped
scutellum, a synapomorphy for the tribe, and the de-
velopment of both characters is likely to be associ-
ated. The depressed internal margin of the protibia is
possibly involved in antennal rubbing, as observed in
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
EVOLUTION OF DORYNOTINE TORTOISE BEETLES 11
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
other groups of insects, where the foreleg rubs along
the antenna in mid-air anterior or lateral to the head
(Valentine, 1973). The presence of the insertion pocket
in the anterior margin of the elytra helps to accom-
modate the pronotum, as the anterior margin of the
elytra is expanded anteriorly and laterally, which
also contributes to the formation of the conspicuous
humeral angles. The locking system observed in the
elytral suture could potentially be associated with the
spiniform post-scutellar projection (synapomorphic for
the tribe), because it is found in all dorynotine spe-
cies but not in the outgroups. Monrós & Viana (1949)
described the epipleural ridge tooth in the diagnosis of
the genus Dorynota, ‘dentículo elitral’ (= elytral tooth).
In the present study, all members of Dorynotini pre-
sent this character, varying from conspicuous to poorly
conspicuous, and it could be another character contrib-
uting to the elytral locking mechanism. The elevated
posterior margin of the metasternum is another fea-
ture that could potentially have a defensive function,
facilitating the accommodation of retracted meso- and
metalegs. The characters mentioned above need fur-
ther examination to determine their adaptive function
for members of the tribe.
conflicTs over morphological characTers
useD for Taxonomic classificaTion in The Tribe
DorynoTini
Considering currently available evidence and based
on our total-evidence approach, our results conflict
with the morphological taxonomic system of Monrós &
Viana (1949). This suggests that some morphological
characters currently used for taxonomic classification
are homoplastic and are therefore inapplicable for
characterizing natural clades.
The genus Paranota and the subgenus Akantaka
were recovered as monophyletic in our study. Paranota
was characterized by having antennae with five glab-
rous basal antennomeres, six pubescent apical anten-
nomeres, and asymmetric, parallel or subparallel
pretarsal claws (Monrós & Viana, 1949). Simões (2014)
compared the genus with the subgenus Dorynota s.s.
and concluded that instead, Paranota should be char-
acterized as presenting the following: slightly inserted
pronotum in the internal margin of the anterior ely-
tral angle; diamond-shaped scutellum; tarsomere IV
slightly extending past III; and asymmetrical and sub-
parallel claws. Based on our ACSR, we could not re-
cover any of those characters as synapomorphies for
the genus.
The subgenus Akantaka was described based
on the presence of straight or convex lateral ely-
tral margins and a triangular-shaped post-scutellar
projection. Based on the ACSR, we recovered the
triangular-shaped post-scutellar projection as a syn-
apomorphy for the subgenus.
Omoteina (sensu priori), as a previously monotypic
genus, was characterized by presenting gibbous elytra,
deeply punctuate (Maulik, 1916), triangular scutellum
and divergent symmetric claws (Monrós & Viana,
1949). Based on ACSR, the triangular-shaped scu-
tellum was a reversal from the diamond shape found
within Dorynotini, and symmetric claws are plesio-
morphic in the tribe.
Species previously in Paratrikona (now in Omoteina,
syn. nov.; comb. nov.) are rare in the field and in col-
lections, usually known from short series of specimens
(Simões, 2017). The genus is characterized by possess-
ing elytra with coarse and regular punctuation and a
short tubercle-like post-scutellar projection. Here, the
genus is represented by a single species; therefore, its
monophyly could not be tested. Results from the ACSR
indicate that the coarse and regular punctuation are
not diagnostic, but the tubercle post-scutellar projec-
tion is unique among Dorynotini and, based on our
ACSR, it is a modification of the plesiomorphic spini-
form post-scutellar projection found within the tribe.
The subgenus Dorynota s.s. was diagnosed by pos-
sessing a spiniform post-scutellar projection, the pro-
notum partly inserted in the elytral anterior margin,
and subequal pretarsal claws (Monrós & Viana, 1949).
In our analysis, we recover the subgenus Dorynota s.s.
as paraphyletic, with representatives dispersed in
three separate clades (Fig. 3). Clade 1 is recovered as
sister to all other Dorynotini, grouping with a wide
geographical range throughout central and southwest
South America. The ancestral character state recon-
struction did not recover potential synapomorphies
for the clade. However, its internal sister taxa, D. (s.s.)
parallela + D. (s.s.) pugionata, share two synapomor-
phies: mesoscutellum with transverse ridges poorly
developed (character 44) (see Supporting Information,
Appendix S3, Fig. S102), and parallel asymmetric pre-
tarsal claws. Clade 2 is composed of species endemic
to the Greater Antilles, O. humeralis, D. (s.s.) aculeata
and P. rubescens (see ‘Taxonomic classification’ and dis-
cussion above). Clade 3 is composed of D. (s.s.) bidens
recovered as sister to the subgenus Akantaka. Based
on the ACSR, clade 3 shares many convergent charac-
ters with clade 1 (e.g. depressed surface of scutellum),
and D. (s. s.) bidens and the subgenus Akantaka share
characters that are plesiomorphic for the tribe (e.g.
elevated posterior margin of metasternum). The lack
of recovered synapomorphies for clade 3 highlights the
need for further investigation of morphological char-
acters and extended taxon sampling. However, it is
noteworthy that Akantaka still forms a clade that is
robustly delineated by an ambiguous synapomorphy,
the triangular elytral post-scutellar projection.
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
12 M. V. P. SIMÕES ET AL.
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
The creaTer anTillean claDe
Besides the morphological characters previously cited
(above), the Greater Antillean clade is also charac-
terized by three of the four possible states of the
post-scutellar projection among its representatives:
absent, found in O. humearlis; conical-shaped tu-
bercle, found in O. rubescens comb. nov. (transferred
from Paratrikona); and spiniform, found in O. aculeata
comb. nov. (transferred from Dorynota). Results of the
ACSR indicate that the presence of the spine is the
plesiomorphic state for all Dorynotini and was lost or
transformed in two of the three lineages of the Greater
Antilles clade.
Within clade 2, O. aculeata comb. nov. was recovered
as the sister-species to O. rubescens comb. nov. Monrós
& Viana (1949) previously suggested that these two
species could be closely related based on the pres-
ence of the triangular-shaped scutellum, which was
recovered here as a synapomorphic state of the whole
Greater Antillean clade. Despite being incorrect with
respect to this character, Monrós & Viana (1949) were
correct about the cladistic relationship between the
species, and our results based on the ancestral char-
acter state reconstruction recovered the pronotum
with a rugose aspect as the synapomorphy for these
species (character 18).
Another interesting feature observed among the
members of the clade is the asymmetry in diversity
between different morphotypes. Field observations
and literature indicate that common species, found
more easily in the field, present a well-developed
spine (O. aculeata comb. nov.) or present no post-
scutellar projection (O. humeralis), whereas species
adorned with a short tubercle are more species rich
but extremely rare and known only from short series
of specimens (Blake, 1939; Borowiec, 2009; Simões,
2017). This asymmetry of diversification patterns,
and morphological characters that might have shaped
such patterns, should be investigated further with
broader sampling of taxa.
conclusions
This study represents the first attempt to investigate
relationships within Dorynotini in a total-evidence
phylogenetic framework. Here, we reaffirmed the re-
ciprocal monophyly of the tribe Dorynotini, the genus
Paranota and the subgenus Akantaka. However, with
other dorynotine groups found to be para- or poly-
phyletic, our study shows that a revision of the clas-
sification of Dorynotini and a re-evaluation of the
traditional morphological diagnostic characters are
needed. The fact that almost all characters tradition-
ally used for classifying genera in the tribe do not
follow the pattern of natural groupings of the tribe
indicate these necessities, and future investigations
would thus strongly benefit from the guidance of mo-
lecular analyses. In this vein, we show that the pres-
ence of the post-scutellar spine, the most conspicuous
character of Dorynotini, is a synapomorphy of the
tribe and has been reduced and transformed in some
of its lineages.
Our study offers substantial progress in resolving
phylogenetic relationships among Dorynotini (and
Cassidinae). Future work should focus on the add-
ition of new morphological characters and increase
the taxon and gene fragment sampling to improve our
understanding of the systematics and evolution of tor-
toise beetles.
ACKNOWLEDGEMENTS
We thank the many curators and collection manag-
ers listed in the Supporting Information (Table S1) for
allowing access to specimens at the respective institu-
tions. We also thank the team that assisted with field-
work in Brazil and the Dominican Republic: Antonio
Tosto, Carlos De Soto Molinari, Claydson de Assis,
Juan P. Botero, Mario Cupello and Rob van Brussel.
We thank the students of the Entomology Division of
the University of Kansas Natural History Museum for
continued guidance and assistance; and A. Townsend
Peterson, Jennifer Giron, Laura Breitkreuz, the edi-
tor and two anonymous reviewers for comments on
an earlier version of the manuscript. Logistic support
was provided by The Smithsonian Tropical Research
Institute. M.V.P.S. received financial support from the
Conselho Nacional de Desenvolvimento Científico e
Tecnológico (CNPq; fellowship no. 201275/2012-0), from
the following University of Kansas grants: Panorama
Award; Division of Entomology; and Graduate Student
Organization Award; and an Ernst Mayr Travel Grant
provided by the Museum of Comparative Zoology (MCZ),
Harvard University, and a Graduate Student Research
Enhancement Award from the Coleopterists Society.
REFERENCES
Ayres DL, Darling A, Zwickl DJ, Beerli P, Holder MT,
Lewis PO, Huelsenbeck JP, Ronquist F, Swofford
DL, Cummings MP, Rambaut A, Suchard MA. 2012.
BEAGLE: an application programming interface and high-
performance computing library for statistical phylogenetics.
Systematic Biology 61: 170–173.
Baca SM, Toussaint EFA, Miller KB, Short AEZ. 2017.
Molecular phylogeny of the aquatic beetle family Noteridae
(Coleoptera: Adephaga) with an emphasis on data partition-
ing strategies. Molecular Phylogenetics and Evolution 107:
282–292.
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
EVOLUTION OF DORYNOTINE TORTOISE BEETLES 13
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
Blake DH. 1939. Eight new Chrysomelidae (Coleoptera) from
the Dominican Republic. Proceedings of the Entomological
Society 41: 231–239.
Borowiec L. 1995. Tribal classification of the cassidoid
Hispinae (Coleoptera: Chrysomelidae). In: Pakaluk J,
Ślipiński SA, Crowson RA, eds. Biology, phylogeny, and clas-
sification of Coleoptera: papers celebrating the 80th Birthday
of Roy A. Crowson. Warsaw: Muzeum i Instytut Zoologii PAN,
541–558.
Borowiec L. 1999. A world catalogue of the Cassidinae
(Coleoptera: Chrysomelidae). Wrocław: Biologica Silesiae.
Borowiec L. 2005. Three new species of the genus Dorynota
sgen. Akantaka Maulik, 1916 from Bolivia and Brazil
(Coleoptera: Chrysomelidae: Cassidinae: Dorynotini). Genus
16: 29–41.
Borowiec L. 2009. New records of Neotropical tortoise beetles
(Coleoptera: Chrysomelidae: Cassidinae). Genus 20: 615–722.
Borowiec L, Świętojańska J. 2014. Cassidinae Gyllenhal,
1813. In: Leschen RAB, Beutel RG, eds. Handbook of zoology:
Coleoptera, beetles Volume 3: morphology and systematics
(Phytophaga). Berlin/New York: deGruyter Press, 198–217.
Borowiec, L, Świętojańska J. 2018. World catalog of
Cassidinae. Wrocław. Available at: http://www.cassidae.uni.
wroc.pl/katalog%20internetowy/index.htm
Bouchard P, Bousquet Y, Davies AE, Alonso-Zarazaga
MA, Lawrence JF, Lyal CHC, Newton AF, Reid CAM,
Schmitt M, Ślipiński SA, Smith ABT. 2011. Family-group
names in Coleoptera (Insecta). ZooKeys 88: 1–972.
Chaboo CS. 2007. Biology and phylogeny of the Cassidinae
Gyllenhal sensu lato (tortoise and leaf-mining beetles)
(Coleoptera: Chrysomelidae). Bulletin of the American
Museum of Natural History 1–250.
Crowson RA. 1938. The metendosternite in Coleoptera: a
comparative study. Transactions of the Royal Entomological
Society of London 87: 397–415.
Dejean PFMA. 1836. Catalogue des Coléoptères de la
collection de M. le Comte Dejean. [Livraison 5]. Paris:
Méquignon-Marvis.
Edgar RC. 2004. MUSCLE: multiple sequence alignment with
high accuracy and high throughput. Nucleic Acids Research
32: 1792–1797.
Erixon P, Svennblad B, Britton T, Oxelman B. 2003.
Reliability of Bayesian posterior probabilities and boot-
strap frequencies in phylogenetics. Systematic Biology 52:
665–673.
Felsenstein J. 1985. Confidence limits on phylogenies: an
approach using the bootstrap. Evolution 39: 783–791.
Goloboff P. 1999. Analyzing large data sets in reasonable
times: solutions for composite optima. Cladistics 15: 415–428.
Goloboff PA, Catalano SA. 2016. TNT version 1.5, includ-
ing a full implementation of phylogenetic morphometrics.
Cladistics 32: 221–238.
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk
W, Gascuel O. 2010. New algorithms and methods to es-
timate maximum-likelihood phylogenies: assessing the per-
formance of PhyML 3.0. Systematic Biology 59: 307–321.
Hincks WD. 1952. The genera of the Cassidinae (Coleoptera:
Chrysomelidae). Transactions of the Royal Entomological
Society of London 103: 327–358.
Hsiao TH, Windsor DM. 1999. Historical and biological
relationships among Hispinae inferred from 12S mtDNA
sequence data. In: Cox ML, ed. Advances in Chrysomelidae
biology 1. Leiden: Backhuys, 39–50.
Hübler N, Klass KD. 2013. The morphology of the metendos-
ternite and the anterior abdominal venter in Chrysomelinae
(Insecta: Coleoptera: Chrysomelidae). Arthropod Systematics
and Phylogeny 71: 3–41.
Joy JB, Liang RH, McCloskey RM, Nguyen T, Poon AF.
2016. Ancestral reconstruction. PLoS Computational Biology
12: e1004763.
Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler
A, Jermiin LS. 2017. ModelFinder: fast model selection
for accurate phylogenetic estimates. Nature Methods 14:
587–589.
Katoh K, Standley DM. 2013. MAFFT multiple sequence
alignment software version 7: improvements in perform-
ance and usability. Molecular Biology and Evolution 30:
772–780.
Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott
B. 2016. PartitionFinder 2: new methods for selecting parti-
tioned models of evolution for molecular and morphological
phylogenetic analyses. Molecular Biology and Evolution 34:
772–773.
Lewis PO. 2001. A likelihood approach to estimating phyl-
ogeny from discrete morphological character data. Systematic
Biology 50: 913–925.
López-Pérez S, Zaragoza-Caballero S, Ochoterena H,
Morrone JJ. 2017. A phylogenetic study of the worldwide
tribe Cassidini Gyllenhal, 1813 (Coleoptera: Chrysomelidae:
Cassidinae) based on morphological data. Systematic
Entomology 1813: 1–15.
Maddison WP, Maddison DR. 2015. Mesquite: a modular
system for evolutionary analysis. Version 3.04. Available at:
http://mesquiteproject.org
Maulik S. 1916. On Cryptostome beetles in the Cambridge
University Museum of Zoology. Journal of Zoology 86:
567–589.
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the
CIPRES Science Gateway for inference of large phylogenetic
trees. 2010 Gateway Computing Environments Workshop,
GCE 2010.
Minh BQ, Nguyen MA, von Haeseler A. 2013. Ultrafast ap-
proximation for phylogenetic bootstrap. Molecular Biology
and Evolution 30: 1188–1195.
Monrós F, Viana MJ. 1949. Revision de las especies
Argentines de Dorynotyni (Col. Cassidae). Acta Zoologica
Lilloana 8: 391–426.
Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ. 2015.
IQ-TREE: a fast and effective stochastic algorithm for esti-
mating maximum-likelihood phylogenies. Molecular Biology
and Evolution 32: 268–274.
Nixon K. 1999. The parsimony ratchet, a new method for rapid
parsimony analysis. Cladistics 15: 407–414.
Ronquist F, Teslenko M, van der Mark P, Ayres DL,
Darling A, Höhna S, Larget B, Liu L, Suchard MA,
Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian
phylogenetic inference and model choice across a large model
space. Systematic Biology 61: 539–542.
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
14 M. V. P. SIMÕES ET AL.
© 2018 The Linnean Society of London, Zoological Journal of the Linnean Society, 2018, XX, 1–14
Simões MVP. 2014. Taxonomic revision of the genus Paranota
Monrós and Viana, 1949 (Coleoptera: Chrysomelidae:
Cassidinae: Dorynotini). The Coleopterists Bulletin 68:
631–655.
Simões MVP. 2017. Revision of the Greater Antilles genus
Paratrikona Spaeth, 1923 (Coleoptera: Chrysomelidae:
Cassidinae: Dorynotini). Zootaxa 4238: 417–425.
Simões MVP, Lieberman BS, Soberón J, Peterson AT.
2017. Testing environmental correlates of clines in clades:
an example from cassidine beetles. Insect Conservation and
Diversity 10: 472–482.
Simões MVP, Sekerka L. 2014. Redescription of
Heteronychocassis acuticollis Spaeth, 1915 (Coleoptera:
Chrysomelidae: Cassidinae). The Coleopterists Bulletin 68:
407–410.
Simões MVP, Sekerka L. 2015. Review of the neotropical
leaf beetle subgenus Dorynota s.s. Chevrolat (Coleoptera:
Chrysomelidae: Cassidinae: Dorynotini). The Coleopterists
Bulletin 69: 231–254.
Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook
P. 1994. Evolution, weighting, and phylogenetic utility
of mitochondrial gene sequences and a compilation of
conserved polymerase chain reaction primers. Annals of the
Entomological Society of America 87: 651–701.
Spaeth F. 1923. Ueber Batonota Hope (Col. cassid). Wiener
entomologische Zeitung 40: 65–76.
Suzuki K. 1994. Comparative morphology of the hindwing
venation of the Chrysomelidae (Coleoptera). In: Jolivet PH,
Cox ML, Petitpierre E. eds. Novel aspects of the biology of
Chrysomelidae. Series Entomologica, vol 50. Dordrecht:
Springer, 337–354.
Trifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ.
2016. W-IQ-TREE: a fast online phylogenetic tool for max-
imum likelihood analysis. Nucleic Acids Research 44:
W232–W235.
Valentine BD. 1973. Grooming behavior in Coleoptera. The
Coleopterists Bulletin 27: 63–73.
Van der Auwera G, Chapelle S, De Wachter R. 1994.
Structure of the large ribosomal subunit RNA of Phytophthora
megasperma, and phylogeny of the oomycetes. FEBS Letters
338: 133–136.
Wild AL, Maddison DR. 2008. Evaluating nuclear protein-
coding genes for phylogenetic utility in beetles. Molecular
Phylogenetics and Evolution 48: 877–891.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the online version of this article at the publisher's web-site:
Table S1. Material examined for coding morphological characters.
Table S2. Optimal partitioning schemes and models for Bayesian inference analyses estimated with
PartitionFinder.
Appendix S1. Morphological data.
Appendix S2. Figures of resulting gene trees and total-evidence analysis.
Appendix S3. Figures of ancestral character state reconstruction.
Downloaded from https://academic.oup.com/zoolinnean/advance-article-abstract/doi/10.1093/zoolinnean/zly079/5220517 by guest on 03 December 2018
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
Stolas tachiraensis, new species, is described from Venzuela. Cyclosoma gloriosa (Bal y, 1859) is restored from synonymy of Cyclosoma mirabilis (Boheman, 1856). Two new synonyms are proposed: Botanochara matogrossoensis Borowiec, 2006 is junior synonym of Botanochara ricardoi (Buzzi, 1998) new combination, and Eugenysa jasinskii Borowiec et Dąbrowska, 1997 is junior synonym of Eugenysa subopaca (Spaeth, 1919). New records of 492 Cassidinae species from Neotropical Region are given: Brazil (118), Argentina (96), Peru (78), Bolivia (70), Ecuador (64), Venezuela (56), Costa Rica (51), Mexico (51), Panama (45), French Guyana (34), Colombia (27), Guatemala (20), Belize (18), Paraguay (18), Honduras (17), El Salvador (11), Surinam (11), Nicaragua (9), Trinidad and Tobago (8), Uruguay (7), Dominican Republic (7), Cuba (2), Dominica (2), Guadeloupe (2), Chile (1), Guyana (1), Haiti (1), and Martinique (1); 109 new country records are given.
Chapter
Full-text available
Based on phylogenetic analysis, a new tribal classification of the Cassidinae is proposed. The subfamily is polyphyletic and should be merged with the Hispinae. Within the Cassidinae in the old sense there are six monophyletic groups with unclear relationships. The following tribes are proposed for cassidoid Hispinae: Notosacanthini, Spilophorini, Hemisphaerotini, Delocraniini, Basiprionotini (including Epistictinini), Omocerini (including Goniocheniini), Stolaini (including Eugenysini), Dorynotini, Ischyrosonychini (including Physonotini and Asterizini), and Cassidini (including Basiptini and Aspidimorphini). The synonymization of the Imatidiini with the hispine tribe Cephaloleiini and Charidotini with the Cassidini is confirmed.
Article
Full-text available
Cassidini Gyllenhal is the most diverse tribe in Cassidinae and the only one with worldwide distribution. Aspidimorphini have shown a close relationship with Cassidini in different studies, but phylogenetic studies to date have not clarified the relationship between these tribes. A cladistic analysis based on morphological characters was conducted to test the monophyly of Cassidini. Genera distributed in the New and Old World were sampled. The parsimony analysis includes 56 ingroup species, 37 outgroup species and 97 morphological characters. The results show no support for the monophyly of Cassidini, and Aspidimorphini is synonymized with Cassidini syn.n. Moreover, Ischyrosonychini should be also included in Cassidini. Most of the genera represented in the analysis by more than one species were not recovered as monophyletic. Thus, the current internal classification of Cassidini s.l. needs a profound revision before taxonomy reflects natural groupings. The inclusion of evidence from immature stages, bionomics and molecular data should provide a better resolution of the relationships in Cassidini s.l.
Article
Full-text available
1. Phenotypic change across environmental gradients has been an important topic in evolutionary biology. Members of the tortoise beetle tribe Dorynotini are characterised by an elytral suture adorned with either a tubercle or a large, vertical spine. Overall spine height across species had previously been posited to exhibit a latitudinal gradient of increasing height and decreasing width towards the southern extreme of the tribe’s range, and this pattern had been linked to environmental variation. 2. We explore the evidence behind such a cline by testing associations between climate and morphology across the clade’s geographic distribution using an approach based on ecological niche modelling (ENM) and morphological and environmental hypervolumes. The degree of overlap between the respective hypervolumes was assessed, and the correlation of matrix overlap values was quantified using Mantel tests. Degrees of niche similarity and conservatism at the genus level were also assessed using both Schoener’s index and Hellinger distances. 3. Overall, we observed that characters defining our morphological hypervolumes were informative, and capable of grouping taxa into discrete units in morphospace. In contrast, environmental hypervolumes were largely homogeneous across the tribe, with high overlap among taxa. No significant correlations were found between environmental and morphological hypervolumes. 4. Our results indicate that morphological divergence occurs along with high levels of environmental overlap; perhaps historical biogeographic factors along with sexual selection may have promoted its diversification. Our approach based on ENM and statistical comparisons between environmental and morphological hypervolumes can provide a useful approach to testing the existence of gradients and clines.
Article
The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data. In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.
Article
Model-based molecular phylogenetics plays an important role in comparisons of genomic data, and model selection is a key step in all such analyses. We present ModelFinder, a fast model-selection method that greatly improves the accuracy of phylogenetic estimates by incorporating a model of rate heterogeneity across sites not previously considered in this context and by allowing concurrent searches of model space and tree space.
Article
PartitionFinder 2 is a program for automatically selecting best-fit partitioning schemes and models of evolution for phylogenetic analyses. PartitionFinder 2 is substantially faster and more efficient than version 1, and incorporates many new methods and features. These include the ability to analyze morphological datasets, new methods to analyze genome-scale datasets, new output formats to facilitate interoperability with downstream software, and many new models of molecular evolution. PartitionFinder 2 is freely available under an open source license and works on Windows, OSX, and Linux operating systems. It can be downloaded from www.robertlanfear.com/partitionfinder The source code is available at https://github.com/brettc/partitionfinder.
Article
The first molecular phylogenetic hypothesis for the aquatic beetle family Noteridae is inferred using DNA sequence data from five gene fragments (mitochondrial and nuclear): COI, H3, 16S, 18S, and 28S. Our analysis is the most comprehensive phylogenetic reconstruction of Noteridae to date, and includes 53 species representing all subfamilies, tribes and 16 of the 17 genera within the family. We examine the impact of data partitioning on phylogenetic inference by comparing two different algorithm-based partitioning strategies: one using predefined subsets of the dataset, and another recently introduced method which uses the k-means algorithm to iteratively divide the dataset into clusters of sites evolving at similar rates across sampled loci. We conducted both maximum likelihood and Bayesian inference analyses using these different partitioning schemes. Resulting trees are strongly incongruent with prior classifications of Noteridae. We recover variant tree topologies and support values among the implemented partitioning schemes. Bayes factors calculated with marginal likelihoods of Bayesian analyses support a priori partitioning over k-means and unpartitioned data strategies. Our study substantiates the importance of data partitioning in phylogenetic inference, and underscores the use of comparative analyses to determine optimal analytical strategies. Our analyses recover Noterini Thomson to be paraphyletic with respect to three other tribes. The genera Suphisellus Crotch and Hydrocanthus Say are also recovered as paraphyletic. Following the results of the preferred partitioning scheme, we here propose a revised classification of Noteridae, comprising two subfamilies, three tribes and 18 genera. The following taxonomic changes are made: Notomicrinae sensu n. (= Phreatodytinae syn. n.) is expanded to include the tribe Phreatodytini; Noterini sensu n. (= Neohydrocoptini syn. n., Pronoterini syn. n., Tonerini syn. n.) is expanded to include all genera of the Noterinae; The genus Suphisellus Crotch is expanded to include species of Pronoterus Sharp syn. n.; and the former subgenus Sternocanthus Guignot stat. rev. is resurrected from synonymy and elevated to genus rank.