Content uploaded by Md. Mizanur Rahman
Author content
All content in this area was uploaded by Md. Mizanur Rahman on Nov 09, 2018
Content may be subject to copyright.
Accepted by R. Pethiyagoda: 22 Aug. 2018; published: 23 Oct. 2018
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN
1175-5334
(online edition)
Copyright © 2018 Magnolia Press
Zootaxa 4504 (1): 105
–
118
http://www.mapress.com/j/zt/
Article
105
https://doi.org/10.11646/zootaxa.4504.1.5
http://zoobank.org/urn:lsid:zoobank.org:pub:30BB031C-70F9-4875-8F23-460BB8E17680
The identity of Osteobrama cotio, and the status of “Osteobrama serrata”
(Teleostei: Cyprinidae: Cyprininae)
MD. MIZANUR RAHMAN
1
, MICHAEL NORÉN
2
, ABDUR ROB MOLLAH
1
& SVEN KULLANDER
2,3
1
Department of Zoology, University of Dhaka, Dhaka-1000, Bangladesh.
E-mail: mizan.rahmanzool@du.ac.bd; armollah.zool@du.ac.bd
2
Department of Zoology, Swedish Museum of Natural History, PO Box 50007, SE-104 05 Stockholm, Sweden.
E-mail: michael.noren@nrm.se
3
Corresponding author. E-mail: sven.kullander@nrm.se
Abstract
Osteobrama cotio is considered to be a widespread species in India and Bangladesh. Mitochondrial DNA (COI, 16S rR-
NA) shows that populations from the Meghna River, Karnafuli and Sangu Rivers, Narmada River, and Godavari River are
genetically distinct from each other. No morphological differences were found to separate Meghna and Karnafuli+Sangu
populations, however. A putative new species, “Osteobrama serrata” has been described from the Barak River basin, stated
to be distinguished from O. cotio by the presence of a serrated third dorsal-fin ray. The description of “O. serrata” does
not fulfil requirements of the International Code of Zoological Nomenclature, (International Commission on Zoological
Nomenclature 1999) and the name is thus unavailable. Published DNA sequences of “Osteobrama serrata” are identical
to sequences of O. cotio from Bangladesh. As mentioned already in the original description, O. cotio has a serrated third
dorsal-fin ray.
Key words: Asia, DNA barcode, freshwater, morphometrics, phylogeny, taxonomy
Introduction
Species of Osteobrama Heckel, 1843 (type species Cyprinus cotio Hamilton, 1822), are laterally compressed,
silvery fishes with an elevated dorsum, keeled abdomen, and long anal fin (Figs 1–2). They are common and often
abundant throughout their range, which encompasses primarily lentic habitats in Bangladesh, India, Myanmar, and
Pakistan (Hora & Misra 1940; Talwar & Jhingran 1991; Vishwanath & Shantakumar 2007). Recorded maximum
total length ranges from 11cm in O. bakeri (Day, 1873) to 38 cm in O. belangeri (Valenciennes, 1844) (Talwar &
Jhingran 1991).
In the most recent revision of the genus, Hora & Misra (1940), using Rohtee Sykes, 1839 as the generic name,
distinguished seven species, one with two subspecies, and provided descriptions and a key. Talwar & Jhingran
(1991) provided an updated list of species with established synonyms, short diagnoses, and a key that differs
slightly from that of Hora & Misra (1940). Vishwanath & Shantakumar (2007) revised northeastern Indian species,
and Jadhav et al. (2011) analysed nominal species from peninsular India.
Three species have been recorded from Myanmar and the Irrawaddy drainage in India and China, viz.,
Osteobrama feae (Vinciguerra, 1890); O. cunma (Day, 1888), with synonym Rohtee roeboides Myers, 1924; and
O. belangeri (Valenciennes, 1844), with synonyms Rohtee blythi Bleeker, 1860, O. brevipectoralis Tilak & Husain,
1989, and Systomus microlepis Blyth, 1858.
Osteobrama cotio, with the objective junior synonym Leuciscus gangeticus Swainson, 1839, is reported to
have a wide distribution from Pakistan eastwards to Assam and Bangladesh (Talwar & Jhingran, 1991). Hora &
Misra (1940), Talwar & Jhingran (1991), and Menon (1999) considered O. cunma to be a subspecies of O. cotio,
but it was ranked as a separate species by Vishwanath (2000, 2002) and later authors. Osteobrama cotio
peninsularis Silas, 1952, has rarely been reported, but was treated as a valid subspecies of O. cotio by Talwar &
Jhingran (1991), and Jadhav et al. (2011).
RAHMAN ET AL.
106
·
Zootaxa 4504 (1) © 2018 Magnolia Press
Osteobrama vigorsii (Sykes, 1841), with synonyms Leuciscus alfredianus Valenciennes, 1844, Leuciscus
duvaucelli Valenciennes, 1844, O. rapax Günther, 1868, O. bhimensis Singh & Yazdani, 1992, and Rohtee dayi
Hora & Misra, 1940, occurs in the Godavari and Krishna River drainages (Jadhav et al. 2011) .
Osteobrama neilli (Day, 1873) and O. bakeri are present in the extreme south of peninsular India (Talwar &
Jhingran, 1991; Jadhav et al. 2011).
FIGURE 1. Adult specimens of Osteobrama cotio sensu lato. A) NRM 68948, 58.6 mm SL. Bangladesh: Meghna River
drainage, Kushiyara River at Fenchuganj. B) NRM 40578, 63.9 mm SL. India: Brahmaputra River drainage, Dibrugarh Market.
C) NRM 67707, 74.4 mm SL, Bangladesh: Karnafuli river drainage, Kaptai Lake.
The phylogenetic position and monophyly of Osteobrama is uncertain. In a molecular phylogenetic analysis,
Tang et al. (2013) consistently recovered O. cotio and O. cunma as sister species, but not forming a monophyletic
group with O. belangeri. Osteobrama belangeri and other Smiliogastrini, Rohtee ogilbii Sykes, 1839, Pethia ticto
Zootaxa 4504 (1) © 2018 Magnolia Press
·
107
IDENTITY OF OSTEOBRAMA COTIO
(Hamilton, 1822), and Enteromius trimaculatus (Peters, 1852) varied among themselves in relative position in
different analyses. The results of Tang et al. (2013) suggest that Osteobrama is not monophyletic. Osteobrama was
never the subject of a morphological phylogenetic analysis, and no synapomorphies have been recorded as such.
FIGURE 2. Subadult specimens of Osteobrama cotio sensu lato. A) NRM 68828, 49.1 mm SL. Bangladesh: Meghna River
drainage, Surma River at Kheaghat Point. B) NRM 40331, 42.9 mm SL. India: Brahmaputra River drainage, Sessa River, 30
km from Dibrugarh. C) NRM 67707, 50.5 mm SL, Bangladesh: Karnafuli River drainage, Kaptai Lake.
RAHMAN ET AL.
108
·
Zootaxa 4504 (1) © 2018 Magnolia Press
Singh et al. (2018) and Maisnam et al. (2018) analysed phylogenetic relationships of species of Osteobrama,
based on the cytochrome c oxidase subunit 1 (COI), and 16S ribosomal RNA (16S rRNA) mitochondrial genes. The
latter paper also included a morphometric comparison. Singh et al. (2018) considered their sample from the Barak
River, a tributary of the Meghna River in Manipur, India, to represent a new species, for which they proposed the
specific name “Osteobrama serrata”. Comparing the information in Singh et al. (2018) with our data on
Osteobrama from Bangladesh, we noticed, besides the name “serrata” not being available under the International
Code of Zoological Nomenclature (International Commission on Zoological Nomenclature 1999), that “O. serrata”
does not represent a new species, and that there is unrecorded variability in what has been called Osteobrama cotio.
Here we present a complementary phylogenetic analysis of Osteobrama and review the taxonomic status of O.
cotio and “O. serrata” based on collections from Bangladesh, supplemented by DNA sequences available from
GenBank.
Materials and methods
Specimens were already available in museum collections, purchased from fishermen or markets; or collected in the
wild using a beach seine or hand net and euthanized through immersion in buffered tricaine-methanesulphonate
(MS 222) until cessation of opercular movements plus an additional 30 minutes, following the protocol in permits
from the Swedish Environmental Protection Agency (dnr 412-7233-08 Nv) and the Stockholm Ethical Committee
of the Swedish Board of Agriculture (dnr N 85/15). Collecting in Bangladesh was conducted under a permit to the
University of Dhaka. Voucher specimens are deposited in the collections of the University of Dhaka, Dhaka (DU),
and the Swedish Museum of Natural History, Stockholm (NRM).
Measurements and counts were taken as described by Fang (1997). Vertebral counts are given as
precaudal+caudal, where the first vertebra bearing a long haemal spine articulating with anal-fin pterygiophores
was recorded as the first caudal vertebra (Kullander et al. 2018). X-radiographs were made with a Kevex 130kVP
microfocus X-ray source and a Samsung/Rayence 17x17 inch DR panel. Statistics were calculated using SYSTAT
v. 13 (Systat 2013). Two specimens were digested in trypsin solution, counterstained with Alcian Blue 8GS for
cartilage and Alizarin Red S for bone, and cleared and stored in full strength glycerol, following the procedure of
Taylor & Van Dyke (1985).
For the genetic analysis, a 655 basepair (bp) fragment of the 5’ end of the mitochondrial COI gene and a 596
bp fragment of the mitochondral 16S rRNA gene were sequenced from morphologically identified specimens of
Osteobrama. Additional sequences of Osteobrama were downloaded from GenBank. DNA was extracted, and COI
sequences obtained as as described by Kullander et al. (2018) 16S rRNA was amplified using the primers
16S_arLm2 (CCTCGCCTGTTTACCAAAAACA) and 16S_brHm (CTCCGGTCTGAACTCAGATCACGT),
with a PCR cycle of 94°C 4 min; 35 * (94°C 30s; 55°C 30s; 72°C 30s); 72°C 8 min). The PCR products were
processed as described by Kullander et al. (2018). Geneious (Kearse et al. 2008) was used to calculate genetic
distances (uncorrected pairwise p-distance, as recommended by Srivatsan & Meier (2012), and the Geneious plug-
in Species Delimitation (Masters et al. 2011) was used to calculate the probability of reciprocal monophyly under a
model of random coalescence. Automatic barcode gap detection was performed with ABGD (http://
wwwabi.snv.jussieu.fr/public/abgd/abgdweb.html) (Puillandre et al. 2011). A phylogenetic hypothesis was
constructed using MrBayes version 3.2 (Huelsenbeck & Ronquist 2001; Ronquist & Huelsenbeck 2003) (5 million
generations, GTR + Γ + I model), COI data partitioned by codon position; samples were taken every 1000
generations, and the first 25% of samples were discarded as ‘burn-in’. Convergence was checked with Tracer,
version 1.6 (Rambaut et al. 2014).
New sequences in this study are listed in Table 1. Sequences downloaded from GenBank are referred to in text
and figures by their GenBank accession numbers.
The distribution map was constructed in QGis (https://qgis.org/) with layers from Natural Earth (http://
www.naturalearthdata.com).
Material examined. Osteobrama cotio sensu stricto: India. Brahmaputra River drainage: NRM 40331,
12, 26.7–43.3 mm SL; Assam, about 30 km SW of Dibrugarh, Sessa River close to Patiola village, 27°18ʹ47ʺN
94°49ʹ46ʺE; 21 Jan 1998. F. Fang & A. Roos (FANG-98-006).—NRM 40578, 3, 60.8–63.9 mm SL; Assam,
Dibrugarh Market, 27°29ʹ0ʺN 94°54ʹ0ʺE; 20 Jan 1998. F. Fang & A. Roos (FANG-98-005).—Ganga River
Zootaxa 4504 (1) © 2018 Magnolia Press
·
109
IDENTITY OF OSTEOBRAMA COTIO
drainage: NRM 40479, 8, 32.8–37.5 mm SL; Bihar, roadside ditch about 8 km on road Lukeesarai–Munger,
25°13ʹ52ʺN 86°3ʹ27ʺE; 28 Jan 1998, F. Fang & A. Roos (FANG-98-018).—Bangladesh. Meghna River drainage:
NRM 68828,1, 49.1 mm SL; NRM 68885, 8, 37.4–66.9 mm SL; Sylhet Division: Sylhet District: Golapganj:
Surma River left bank, at Kheaghat point, 1.5 km upstream from Golapganj, 24°51ʹ40ʺN 91°59ʹ37ʺE; 23 Mar 2016,
M.M. Rahman, et al. (SRL-2016-013).—NRM 66129, 1, not measured; DU 9031/NRM 69352, 1, not measured;
NRM 68929,1, 64.6 mm SL; Dhaka Division: Khishoreganj District: Ashuganj, Meghna River at Ashuganj Point,
24°2ʹ47ʺN 91°0ʹ20ʺE; 20 Mar 2016. M.M. Rahman, et al. (SRL-2016-005).—NRM 68904, 2, 53.9–47.4 mm SL;
NRM 69284, 1, 45.7 mm SL; NRM 69291, 1, not measured; NRM 68948, 2, 55.9–58.6 mm SL; Sylhet Division:
Sylhet District: Fenchuganj, Kushiyara River left bank in Fenchuganj at junction with Juri River, 24°42ʹ19ʺN
91°57ʹ16ʺE; 22 Mar 2016. M.M. Rahman, et al. (SRL-2016-008).—NRM 68918, 3, 43.7–46.2 mm SL; NRM
68995, 1, not measured; Sylhet Division, Sylhet District, Goyanghat, Piyain Goyan River near Goyanghat,
25°5ʹ18ʺN 91°58ʹ53ʺE; 25 Mar 2016, M.M. Rahman, et al. (SRL-2016-020).—Padma River drainage: DU 6149, 1,
41.6 mm SL Dhaka Division: Munshigonj district: Arial Beel, 23°34ʹ47ʺN, 090°16ʹ20ʺE; 10 Oct 2014, M.M.
Rahman.—NRM 67729, 4, 38.5–39.6 mm SL; Dhaka Division: Sreenagar: fish market in Shonbari, Sreenagar,
[23°32ʹ38ʺN 90°17ʹ47ʺE]; 2 Dec 2014. M.M. Rahman, et al. (SRL-2014-018).—Feni River drainage: DU 6112, 4,
33.8–61.4 mm SL; Chittagong Division, Feni District: Feni River and Shitakunda Hillstream: Kohua River,
22°54ʹ42ʺN, 091°30ʹ10ʺE; M.M Rahman, 29 May 2015 (SL-6). Osteobrama cotio sensu lato: Bangladesh.
Karnafuli River drainage: DU 9031/NRM 66545, 1, not measured; NRM 67721, 1, 59.0 mm SL; Chittagong
Division: Rangamati District: Rangamati, town fish market, fish from Kaptai Lake; 22°38ʹ59ʺN 92°11ʹ1ʺE. 27 Nov
2014. M.M. Rahman, et al. (SRL-2014-001).—NRM 67707, 9, 52.0–74.4 mm SL; NRM 70222, 9, 29.6–53.9 mm
SL; NRM 70230, 2, 43.0–50.0 mm SL, cleared and stained; Chittagong Division: Rangamati District: Rangamati,
fish landing pier, fish from Kaptai Lake, 22°39ʹ0ʺN 92°11ʹ9ʺE; 27–28 Nov 2014, M.M. Rahman et al. (SRL-2014-
002).—Sangu River drainage: NRM 67175, 48.2 mm SL; Chittagong Division: Bandarban District: Sangu River at
Dhopachari, 22°12ʹ22ʺN 92°8ʹ2ʺE. 13 May 2015. M.M Rahman et al. (SRL-2015-025).
TABLE 1. New DNA sequences produced for this paper.
Results
Our new COI sequences combined with those available from GenBank in May 2018, identified as Osteobrama
cotio or “O. serrata”, and including those published by Maisnam et al. (2018) and Singh et al. (2018), show two
major clades (Fig. 3), correlating with the geographical distribution of samples (Fig. 4). For clarity, we refer to
Species Catalogue /Voucher
number(s)
Locality GenBank
Accession No.:
COI
GenBank
Accession No.:
16S rRNA
Systomus sarana DU 0101086 Bangladesh, Meghna basin: Jaflong MH708075 —
Systomus sarana DU 1101128 Bangladesh, Ganga basin: Atrai River MH708074 —
Labeo gonius NRM 67602 Bangladesh: fish market in Dhaka MG895641 MG920325
Osteobrama belangeri NRM 58399 Myanmar: Kyaikto market MG895642 MG920320
Osteobrama belangeri NRM 58873 Myanmar, Chindwin basin: Monywa MG895643 MG920321
Osteobrama cotio
sensu lato
DU 9032/NRM
66545
Bangladesh, Karnafuli basin: Rangamati
fish market
MG895647 MG920323
Osteobrama cotio
sensu lato
NRM 67175 Bangladesh, Sangu River at Dopachari MG895646 MG920324
Osteobrama cotio
sensu stricto
NRM 69291 Bangladesh, Meghna basin: Kushiyara
River at Fenchuganj
MG895645 MG920326
Osteobrama cotio
sensu stricto
DU 9031/NRM
69352
Bangladesh: Meghna River at Ashuganj
Point
MG895644 MG920327
Osteobrama cunma NRM 59480 Myanmar, Chindwin basin: Kalaymyo MG895648 MG920322
Osteobrama cunma NRM 58233 Myanmar, Irrawaddy basin: near Yangon MG895649 MG920319
RAHMAN ET AL.
110
·
Zootaxa 4504 (1) © 2018 Magnolia Press
these groups as clade A, comprising all O. cotio from the Karnafuli, Narmada, and Sangu, drainages, and one sub-
clade inferred to represent the Godavari drainage; and clade B, comprising all O. cotio from the Barak,
Brahmaputra, Meghna, Surma, and Yamuna (Ganga) drainages and including all specimens identified in GenBank
as “O. serrata”. Within clade A, there are three sub-clades, suggesting strong population structure or possibly
cryptic species: O. cotio from Karnafuli and Sangu drainages; O. cotio from the Narmada drainage; a group of O.
cotio with origin stated only as “India” (KF550101–KF550103), but 99% identical with BOLD sequences from the
Godavari River drainage (BOLD identifiers GDK340-13.COI-5P and GDK559-13.COI-5P, not yet published in
GenBank as of 16 May 2018); and KX550004, with origin “India”, but according to Raja, M. & Perumal, P. (2017)
(DNA barcoding and phylogenetic relationships of selected freshwater fishes based on mtDNA COI sequences.
Journal of Phylogenetics & Evolutionary Biology, 5: 5 pp.), listing the voucher as PUMNH23/2014, it is from a
study sampling in the Kaveri and Bhavani River systems in southern India.
Pairwise uncorrected p-distance is the number of different homologous positions between two sequences,
expressed in percent. Empirically, pairwise p-distances for the COI gene greater than 1–2% suggest that the
compared sequences belong to different species (Ward 2009). Closest uncorrected p-distance between clades A and
B was 11.9%. The within-clade longest uncorrected pairwise p-distance was 0.5% for clade B, and 6.6% for clade
A. The uncorrected p-distance between all three sub-clades in clade A was >2%, suggesting they may represent
three distinct species. However, p-distance is sensitive to artefacts such as ambiguities or missing data in the data
set.
Automatic Barcode Gap Detection (ABGD) (Puillandre et al. 2012) groups sequences based on the distribution
of pairwise distances, given a prior intraspecific divergence estimate. Our ABGD analysis of the COI barcode data
finds two distinct groups, corresponding to clades A and B, throughout the prior pairwise distance range 1–3%,
where empirically groups have been found to best correspond to species (Puillandre et al. 2012). ABGD finds four
distinct groups, with clade A dissolving into three groups, at prior pairwise distances lower than 0.5%. This
suggests that clade A and B are separate and distinct species, and that clade A has strong population structure.
Rosenberg’s P
AB
(Rosenberg, 2007) test rejects the hypothesis that the clades A and B are artefacts caused by
random coalescence (p = 3.4*10
-12
). P ID(Liberal) (Masters et al. 2011) is a comparison of the intraspecific
variation in a putative species, the interspecific distance to its closest relative, and the intraspecific variation in that
relative, providing an estimate of the probability that an unknown sequence from the putative species would be
correctly identified as a member of the species. P ID(Liberal) for clade A is 0.96; for clade B = 0.99.
The phylogram based on 16S rRNA sequences (Fig. 4) is similar to the COI tree (Fig. 1), with two major clades
reflecting clades A and B in the COI tree, but the number of sequences and distinct localities is smaller, with 14
sequences from the Barak River, two from the Meghna River, and one each from the Karnafuli and Sangu Rivers.
Separation of Osteobrama cotio and “O. serrata” is not supported.
Morphometric data, summarized in Table 2, did not separate our Karnafuli and Sangu samples from those of
the Meghna basin in Bangladesh. No specimens were available from the Narmada or Barak River drainages for a
morphometric comparison. Ontogenetic shape change was noticeable, with young specimens more elongate than
adults, but this transition was shared among samples (Figs 1–2). Fin-ray counts were taken from 10 specimens
from the Meghna and 11 from the Karnafuli+Sangu drainages. All specimens had the dorsal-fin count iii.8½ and
the pelvic-fin count i.9. Number of branched anal-fin rays varied: Meghna: 29½ (2), 31½(5), 32½ (3);
Karnafuli+Sangu 28½ (1), 30½ (4), 31½ (4), 32½ (2). Pectoral-fin rays: Meghna: i.12 (1), i.13 (7), i.14 (2);
Karnafuli+Sangu: i.13 (4), i.14 (5), i15 (1). Vertebral counts were nearly invariant: 15+19 in three Meghna basin
specimens, 15+18 (1), (15+19 (2), and 15+20 (1) in four specimens from Kaptai Lake.
Discussion
The morphometric and meristic data from Bangladeshi specimens identified as Osteobrama cotio show no obvious
difference between the Karnafuli, Sangu, and Meghna drainages. The sample sizes are small, however, and largely
based on specimens sampled from markets and not in optimal condition. The fin counts are very conservative, with
minor variation in the pectoral and anal fins. Due to abrasion, none of the specimens retains a complete lateral line
scale series. Transverse and circumpeduncular scale counts could not be obtained with accuracy due to loss of
scales. Attempting to count lateral line scales based on scale pockets gave low numbers down to 47, whereas the
Zootaxa 4504 (1) © 2018 Magnolia Press
·
111
IDENTITY OF OSTEOBRAMA COTIO
better preserved specimens had counts up to 58–61. With the exception of scale counts, our meristic data are
compatible with those of Hora & Misra (1940), Maisnam et al. (2018), and Vishwanath & Shantakumar (2007) for
O. cotio, and Singh et al. (2018) for “O. serrata”. Singh et al. (2018) recorded two unbranched and eight or nine
branched pelvic-fin rays in “O. serrata”, but, this may be in error, as no cyprinine cyprinids are known to have two
unbranched anterior pelvic-fin rays, or the last pelvic-fin ray was somehow considered to be unbranched.
The reported count of scales in the lateral line for Osteobrama cotio varies slightly between authors. Hora &
Misra (1940) counted up to 70 lateral-line scales. Maisnam et al. (2018) counted 65 lateral-line scales in their five
specimens. Vishwanath & Shantakumar (2007) reported 66 lateral-line scales. Singh et al. (2018) did not provide
lateral-line scale counts for “O. serrata”.
Kumar & Goswami (2013), using a traditional taxonomic set of measurements, did not find any morphometric
differences between samples of Osteobrama cotio from the Brahmaputra (Gauhati), Tista, and Barak rivers.
Measurement data of Osteobrama cotio from Bangladesh (Meghna, Karnafuli) and corresponding data from
Vishwanath & Shantakumar (2007), Kumar & Goswami (2013), and Maisnam et al. (2018) are given in Table 2,
showing similar variation between different authors and data sets. Vishwanath & Shantakumar (2007) did not state
number of specimens measured, but 75 specimens were listed as material examined. The mean length of the pelvic
fin was reported by them as 17.4% of SL, which is longer than the maximum (16.5%). In Kumar & Goswami's
(2013) data it is not clear whether “caudal peduncle” mentioned in their table summarizing the measurement data
refers to caudal peduncle depth or length. Caudal peduncle measurements were not mentioned in the text. The text,
however mentioned “caudal fin length”, a measurement not present in the measurement table. The proportional
measurement "caudal peduncle" is interpreted here as caudal peduncle length. Dhanze & Dhanze (2018) give
similar values to those in Table 2, but their head depth measurement is too low to be homologous.
In their phylogenetic analysis of Osteobrama, Singh et al. (2018) presented altogether 15 new sequences of
COI , and 14 new sequences of 16S rRNA from three species, namely Osteobrama belangeri, O. cunma, and their
proposed new species “O. serrata”. In addition, they used selected sequences from GenBank representing other
species of Osteobrama. The sequences were used to build separate phylogenetic trees with the COI and 16S rRNA
sequences using a Maximum Likelihood approach. In their COI tree (fig. 2), sequences from the Narmada River
River basin (JQ667557, JX983423, 983425, 983427, 983429) and one without locality (EU417780) were labelled
as O. cotio, whereas their own four sequences from Jiribam, Jiri River, Meghna River basin (KU867238–
KU867241), and one GenBank sequence from Tanguar Haor, Sunamganj, Bangladesh, in the Meghna River basin
(KT762359) were assigned to “O. serrata”. The 16S rRNA tree (fig. 3) only contains sequences assigned to “O.
serrata”. Singh et al. (2018) distinguished “ O. serrata” from Osteobrama cotio by K2P distance, but also
morphology, based on a comparison with data in Hamilton (1822): presence vs. no mention of serrations along the
third dorsal-fin ray, 11–12 vs. 10 dorsal-fin rays, three vs. two unbranched dorsal-fin rays, 29–33 vs. 36 anal-fin
rays, 10–11 vs. 12 pelvic-fin rays, 14–15 vs. 16 anal-fin rays, 4 vs. 3 branchiostegal rays, absence vs. presence of
black spots on anterior part of lateral line. In the morphological comparison Singh et al. (2018) note that there is no
mention of serrated dorsal-fin rays in Hamilton’s description of O. cotio, but in the text, p. 362, they mention that
“As the individuals of new species has serrated dorsal spine (an adjective), so it was named as Osteobrama serrata
sp. nov.”. Whereas Singh et al. (2018) apparently derived some descriptive data from specimens identified as“O.
serrata” in their molecular analysis, the identification of O. cotio was based exclusively on specimens that were not
examined.
In the original description of Osteobrama cotio, Hamilton (1822: 340) states clearly that the second dorsal-fin
ray [apparently, the very short anteriormost ray was overlooked] is “indented behind”, and in his field notes this is
expressed in Latin as “simplex, posterius denticulatus” [undivided, with small teeth posteriorly] (R. Britz, personal
communication). Hamilton (1822) repeatedly used the term indented to describe serially repeated sharp projections
along the rear margin of the third dorsal-fin ray in cyprinids, a condition commonly described as serrated in current
literature. In Osteobrama, the first dorsal-fin ray is extremely short, and tightly attached to the second ray, and may
easily be overlooked. Consequently, a serrated dorsal-fin ray does not distinguish “O. serrata” from O. cotio. Also
Singh et al.’s (2018) more explicit comparison of “O. serrata” with O. cotio, summarized above, is of doubtful
value. Data in Hamilton (1822) must be viewed as observed without advanced magnification tools, X-radiographs,
or even an advanced understanding of fish morphology. There is nothing in the comparison provided by Singh et
al. (2018) that cannot be explained by methodological differences. The colour character may need particular
consideration, however. Hamilton described a row of 5–6 black spots “below the fore part of the lateral line, around
RAHMAN ET AL.
112
·
Zootaxa 4504 (1) © 2018 Magnolia Press
FIGURE 3. Phylogram of relationships of species of Osteobrama, based on mitochondrial COI sequences, with emphasis of
samples identified as O. cotio or “O. serrata”. Other branches were collapsed. Sequences of “O. serrata” are duplicated, as
obviously these sequences were first submitted as O. cotio (KT896700, KT896701, KT896702, KT896703), and again as “O.
serrata” (KU867239, KU867238, KU867240, KU867241). Branches are annotated with GenBank Accession number, clade
designation (A, B), and river drainage. Collapsed branches include Osteobrama belangeri (KT921838–921849, KU867233–
867237, KX245099, MG895642–43, MG895247, NC_036232); O. cunma (KF029669; KT921850–921860, KU867242–
KU867247, KX245100, MG895648–895649, NC_031559); O. feae (KT921871–921873, NC_031560); O vigorsii
(KF550094–550100). Numbers at branches show Bayesian posterior probabilities. The scale bar shows number of expected
substitutions per site.
Zootaxa 4504 (1) © 2018 Magnolia Press
·
113
IDENTITY OF OSTEOBRAMA COTIO
TABLE 2. Osteobrama cotio. Comparison of morphometric data. Ten specimens from two localities in Bangladesh (Meghna River basin, NRM 68904, 68918, 68929, 68948,
68858: Karnafuli River basin: NRM 67707, 67721), corresponding data of O. cotio from Maisnam et al. (2018), from Barak River; Vishwanath & Shantakumar (2007), from
Barak and Brahmaputra rivers; and Kumar & Goswami (2013), from Brahmaputra, Barak, and Tista Rivers.
O. cotio Meghna
O. cotio Karnafuli Maisnam et al. Vishwanath & Shantakumar
Kumar & Goswami 2012
N
min max mean
SD
N
min
max
mean
SD N
min max mean
SD min max SD N min
max
mean SD
SL (mm) 10
43.7
66.9
54.7 7.8
10
41.0
74.4
55.8 10.3
5
67.2 75.4 71.8 3.8 52.3 74.9 220
31 65 44.1 5.8
Body depth 10
36.9
44.7
40.4 2.8
10
36.1
43.1
40.1 2.0 5
31.6 38.7 37.1 3.1 39.3 44.9 2.0 220
33 48.6
39.6 2.7
Head length 10
22.4
24.7
23.7 0.7
10
23.2
26.2
24.4 0.9 5
18.7 23.7 22.1 2 23.8 26.3 0.7 220
21 29.3
24.3 1.3
Snout length 10
5.8 6.5 6.2 0.2
10
5.9 7.1 6.5 0.5 5
4.8 6.4 5.9 0.7 220
3.8 8.8 5 0.6
Head depth 10
18.1
20.6
19.2 0.9
10
17.6
18.7
18.1 0.3 5
17.2 18.6 17.9 0.5
Head width 10
13.0
14.5
13.6 0.5
10
12.8
14.4
13.4 0.6 5
8.7 12.6 11.6 1.6 13.4 15.3 0.5
Upper jaw length 10
6.4 7.0 6.7 0.2
10
6.9 8.2 7.4 0.4
Lower jaw length 10
8.6 10.6
9.7 0.5
10
9.5 11.7
10.6 0.6
Orbital diameter 10
9.3 11.2
10.1 0.6
10
9.5 11.0
10.3 0.4 5
6.4 8.7 8.0 0.9 220
6.8 12.9
9.8 0.7
Interorbital width 10
9.1 9.8 9.4 0.2
10
8.7 10.5
9.3 0.5 5
7.6 8.7 8.2 0.4
Caudal peduncle length 10
8.5 12.6
11.4 1.2
10
10.1
12.4
11.3 0.7 5
9.2 11.8 10.9 1 9.0 10.6 0.5 220
9.4 15.8
11.6 0.9
Caudal peduncle depth 10
9.9 11.3
10.6 0.5
10
9.1 10.9
10.1 0.5 5
9.5 11.0 10.4 0.6 10.3 11.5 0.5
Dorsal-fin base length 10
10.1
13.0
11.6 1.0
10
11.0
12.5
11.8 0.6 11.3 12.6 0.4
Anal-fin base length 10
38.4
41.3
39.9 0.9
10
35.6
42.2
39.0 1.8
Predorsal length 10
49.8
54.7
52.1 1.6
10
50.7
55.4
52.3 1.5 5
42.3 51.6 48.9 3.8 47.2 50.7 1.2 220
41.0
58.5
49.6 2.2
Preanal length 10
51.8
58.6
55.5 1.9
10
51.3
59.8
55.7 2.8 5
45.2 53.7 51.4 3.5 52.3 58.2 2.1
Prepelvic length 10
38.3
43.4
40.8 1.8
10
38.5
44.0
41.7 1.8 5
34.4 41.5 39.4 2.8 37.4 42.2 1.5
Pectoral-fin length 10
16.8
20.8
19.2 1.2
10
19.0
21.2
20.1 0.8 18.3 20.4 0.7
Pelvic-fin length 10
16.2
19.7
18.1 1.0
10
16.0
19.3
17.9 1.0
14.0 16.5 0.7
RAHMAN ET AL.
114
·
Zootaxa 4504 (1) © 2018 Magnolia Press
which is a bluish shining depression”. Hamilton’s figure of O. cotio, pl. 39, fig. 95, shows four black spots beneath
the anterior lateral line scales. The bluish shining depression apparently refers to the pseudotympanum, which is
not shown on Hamilton’s figure. We have not observed the black spots in any specimens of O. cotio, and there is no
mention of them in later literature describing O. cotio. Black spots as shown and described by Hamilton, however,
are shown on photos of O cunma and O. cotio in Maisnam et al. (2018: fig. 1, b,c), and O. vigorsii in Jadhav et al.
(2011: image 2b,d).
The sequences identified as O. cotio by Singh et al. (2018), are from a study of the fishes of the Narmada River
in Madhya Pradesh (Khedkar et al. 2014: GenBank Accession numbers JX983423, 983425, 983427, 983429);
from Barna, also in the Narmada basin in Madhya Pradesh (GenBank Accession number JQ667557); or without
locality (GenBank Accession number EU9417780). According to Singh et al. (2018), referring to the publisher,
Lakra et al. (2016), the locality of EU9417780 is Kanpur (Uttar Pradesh, Ganga basin), but no locality information
is given in Lakra et al. (2016). The poorly documented sequences indicated to be from southern India, KF55101–
55103 (sister group of Narmada samples), and KX550004 (nested with O. cotio sensu stricto) add complexity to
the tree (Fig. 4), but for now one can only consider them as questionable.
Consequently, Singh et al.’s concept of O. cotio mainly refers to a population from the Narmada River. The
type locality of O. cotio, however, is “ponds and ditches of Bengal”. The Presidency of Bengal at the time
corresponded roughly to the present state of West Bengal in India and present-day Bangladesh (Meyer et al., 1908:
194).
FIGURE 4. Map of Bangladesh and adjacent India and Myanmar showing localities of Osteobrama cotio in the wide sense,
and restricted to samples used in the present analysis. The reported distribution of O. cotio covers a much wider area in northern
India.
If accepted that the published sequences of both O. cotio and “serrata” are correct, they potentially represent
two distinct species. Singh et al.’s samples of “serrata”, however, are from the Meghna basin in Manipur and
Bangladesh, draining to the Bay of Bengal, whereas the Narmada runs westward to the Arabian Gulf. It is not
possible that Hamilton’s locality “ponds and ditches of Bengal” would have included the Narmada basin or any
Zootaxa 4504 (1) © 2018 Magnolia Press
·
115
IDENTITY OF OSTEOBRAMA COTIO
river in the Deccan or western peninsular India. His concept of Bengal may at most have included the lower Ganga,
Brahmaputra and Meghna basins, and adjacent smaller drainages; and perhaps even the Mahanadi drainage; but see
below for Hamilton localities.
Singh et al.’s (2018) sequences of “O. serrata” are from the Jiri River in the Barak drainage in Manipur. The
Barak River drains to the Meghna River. Singh et al. (2018) also included in “serrata” a sequence, KT762359, from
northern Bangladesh: Tanguar Haor, Sunamganj.
Singh et al. (2018: table 2) listed specimen catalog numbers MUMF 4501–14506 as “O. serrata”, but the
publication does not contain the explicit fixation of a holotype, or syntypes, and consequently the name is not
available under the International Code of Zoological Nomenclature (International Commission on Zoological
Nomenclature 1999: Articles16.4, 16.4.1, 72.3, 73.2, 73.21, 732.1.1). Actually, the number of specimens is
uncertain. The number collected is stated to be four on p. 361, corresponding to the GenBank numbers in table 1,
but table 2 has data for six specimens. Four sequences where submitted to GenBank both as O. cotio and as “O.
serrata”.
FIGURE 5. Phylogram of relationships of species of Osteobrama based on mitochondrial 16S rRNA sequences, with emphasis
on samples identified as O. cotio or “O. serrata”. Other branches were collapsed. Branches are annotated with GenBank
Accession number, and river drainage. Numbers at branches show Bayesian posterior probabilities. The scale bar shows
number of expected substitutions per site.
Dhanze & Dhanze (2018) reported specimens identified as Osteobrama cunma from the Gumti River at
Indiranagar, in the Barak River drainage in Tripura (India), apparently syntopic there with O. cotio. They suggested
that the samples of “O. serrata” described by Singh et al. (2018) “may be the habitat dependent morphological
RAHMAN ET AL.
116
·
Zootaxa 4504 (1) © 2018 Magnolia Press
variant of O. cunma”, basing their argument partly on the presence of serrations on the third dorsal-fin ray present
in all species of the genus. They also referred to a publication by Kumar, S.K. [as Konthoujam] & Goswami, U.C.
(2011) [Nucleotide sequences variation of Osteobrama (Heckel) freshwater fish species of North-east India on
mitochondrial COI gene. Archives of Applied Science Research 3, 437–442], dealing with COI variation in O.
belangeri, O. cotio, and O. feae, but that paper contains no sample metadata, and the sequences were not published
by GenBank or other publicly accessible nucleotide sequence repository. Osteobrama cunma is a relatively deep-
bodied species, similar to O. cotio. The specimen figured by Dhanze & Dhanze (2018: fig. 18) as O. cunma, is
strikingly slender in comparison with O. cunma of the same length from the Ayeyawaddy basin, suggesting a need
for revision of Dhanze & Dhanze’s (2018) determination.
Understanding which species is the “real” Osteobrama cotio requires either an unambiguously unique
character in the original description, a name-bearing type specimen, a precise type locality, or a decisive
combination of the preceding criteria. No specimens are known to have been preserved of species described by
Hamilton (Day 1873, 1877), and consequently no type specimens are in existence for any of Hamilton’s species.
Hamilton’s (1822) description of O. cotio is not detailed, and in case of the existence of several similar species, it
may not be sufficient to enable recognition of the species among several candidates. The stated type locality,
“Ponds and ditches of Bengal”, is imprecise. Based on Hamilton’s notes published by Day (1877: 30, 52, 63, 78,
100), Hamilton observed O. cotio in Dinájpur District [Dinajpur District, now divided between India and
Bangladesh], where it was called Koti and Sangpuyi; in Góálpárá [Goalpara, Assam, India], where it was called
Ghilá-chándá; Laksmípur [Lakshmipur, southern Bangladesh], where it was called Bokri; Purniah District [Purnea
District, Bihar, India], where it was called Guttá; Monghir [Munger, Bihar, India], where it was called called
Pĭthárí and Gordá, as well as in Gorakhpur District [Gorakhpur, Uttar Pradesh, India], where it was called Patuki.
Hamilton (1822) mentions only Koti as the common name, from which one might deduce that the description was
mainly based on specimens from Dinajpur. Osteobrama cotio, however, was already described under a different
manuscript name in his field notes, made before the Bengal survey 1807–1813, but without precise locality (R.
Britz, personal communication).
Because of the congruence with localities at which Hamilton observed Osteobrama cotio, and compatibility
with the original description, we conclude that “O. serrata” of Singh et al. (2018), and O. cotio of Vishwanath &
Shantakumar (2007) and Maisnam et al. (21017), as well as most other records of O. cotio, represent O. cotio sensu
Hamilton, i.e., in a strict sense. Based on our analysis of mtDNA sequences (Fig. 1), the populations in the
Narmada, Godavari and Sangu+Karnafuli rivers apparently represent undescribed cryptic species or distinct
populations. In the case of the Karnafuli+Sangu population, no morphological characters were found to
differentiate it from O. cotio. We have not examined specimens from the Narmada or Godavari drainages, and
cannot comment on their morphology. Osteobrama cotio in the wide sense has a very wide distribution in India,
Bangladesh and Pakistan (Talwar & Jhingran, 1991), and studies with wider geographic coverage may be more
instructive in evaluating the taxonomic status of populations of O. cotio.
The haplotype group represented by the sequences from the Narmada, Karnafuli, Sangu, and Godavari
drainages may represent a distinct species but not necessarily undescribed. Based on the very brief description
(Silas, 1952) and data on topotypes in Jadhav et al. (2011), the oldest alternative available name may be O.
peninsularis Silas, with type locality Pune (Maharashtra, India) in the upper Krishna River drainage.
In conclusion, Osteobrama cotio of authors includes two genetically distinct species or populations. Samples
from the Barak, Meghna, Ganga and Brahmaputra Rivers represent Osteobrama cotio in the strict sense.
Genetically distinct populations from the Narmada and Sangu+Karnafuli Rivers, as well as unidentified localities,
represent one or more genetically distinct populations or cryptic species. “Osteobrama serrata” is not an available
name.
Acknowledgements
Research on Bangladeshi freshwater fishes was supported by the project “Genetic characterization of freshwater
fishes in Bangladesh using DNA barcodes” funded by the Swedish Research Council, contract D0674001 to Sven
Kullander and Abdur Rob Mollah. We thank Ralf Britz, editor Rohan Pethiyagoda, and an anonymous reviewer for
careful reading and insightful comments on our manuscript, and Ralf Britz also for valuable unpublished
information on Francis Hamilton’s manuscripts.
Zootaxa 4504 (1) © 2018 Magnolia Press
·
117
IDENTITY OF OSTEOBRAMA COTIO
References
Britz, R. (2018) Introduction and commentary. In: Britz, R., Hamilton’s Gangetic Fishes in colour—A new edition of the 1822
monograph, with reproductions of unpublished coloured illustrations. The Ray Society, London, pp. 1–35. [in press]
Day, F. (1873) Extracts from the late Dr. Buchanan’s ‘Fishes of Bengal’ with remarks. Proceedings of the Zoological Society of
London, 1873, 743–747.
Day, F. (1877) The fish and fisheries of Bengal. In: Hunter W.W. (Ed.), A statistical account of Bengal. Vol. XX. Trübner & Co.,
London, pp. 1–120.
Dhanze, R. & Dhanze, J.R. (2018) New record and redescription of Osteobrama cunma (Day, 1888) (Cypriniformes:
Cyprinidae) from the Meghna Barak drainage system, Tripura, India. Fish Taxa, 3, 474–480.
Fang, F. (1997) Redescription of Danio kakhienensis, a poorly known cyprinid fish from the Irrawaddy basin. Ichthyological
Exploration of Freshwaters, 7, 289–298.
Hamilton, F. (1822) An account of the fishes found in the River Ganges & its branches. Archibald Constable and Company,
Edinburgh, viii + 405 pp., 39 pls.
Hora, S.L. & Misra, K.S. (1940) Notes on fishes in the Indian Museum. XL. On fishes of the genus Rohtee Sykes. Records of
the Indian Museum, 42, 155–172.
Huelsenbeck, J.P. & Ronquist, F. (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17, 754–755.
https://doi.org/10.1093/bioinformatics/17.8.754
International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature, Fourth
Edition. International Trust for Zoological Nomenclature, London, XXIX + 306 pp.
Jadhav, S., Paingankar, M. & Dahanukar, N. (2011) Osteobrama bhimensis (Cypriniformes: Cyprinidae): a junior synonym of
O. vigorsii. Journal of Treathened Taxa, 3, 2078–2084.
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung M., Sturrock, S., Cooper, A., Markowitz S., Duran C., Thierer, T.,
Ashton B., Meintjes P. & Drummond, A. (2012) Geneious Basic: an integrated and extendable desktop software platform
for the organization and analysis of sequence data. Bioinformatics, 28, 1647–1649.
http://doi.org/10.1093/bioinformatics/bts199
Khedkar, G.D., Jamdade, R., Naik, S., David, L. & Haymer, D. (2014) DNA barcodes for the flshes of the Narmada, one of
India’s longest rivers. PLoS ONE, 9 (7), e101460.
https://doi.org/10.1371/journal.pone.0101460
Kullander, S.O., Rahman, M.M., Norén, M. & Mollah, A.R. (2018) Laubuka tenella, a new species of cyprinid fish from
southeastern Bangladesh and southwestern Myanmar (Teleostei, Cyprinidae, Danioninae). ZooKeys, 742, 105–126.
https://doi.org/10.3897/zookeys.742.22510
Kumar, K.S. & Goswami, U.C. (2013) Morphometric analysis and identification of specific metric characters pertaining growth
of the Osteobrama cotio of the Brahmaputra, Barak and Teesta River of North Eastern Himalayan river systems.
Proceedings of the Zoological Society Journal, 66, 51–55. [first published online 29 August 2012]
http://doi.org/10.1007/s12595-012-0046-z
Lakra, W.S., Singh, M., Goswami, M., Gopalakrishnan, A., Lal, K.K., Mohindra, V., Sarkar, U.K, Punia, P.P., Singh, K.V.,
Bhatt, J.P. & Ayyappan, S. (2016) DNA barcoding Indian freshwater fishes. Mitochondrial DNA Part A, 27, 4510–4517.
https://doi.org/10.3109/19401736.2015.1101540
Maisnam M., Chandra S., Lal, K.K., Singh, R.K. & Mohindra, V. (2018) Characterization of threatened endemic fish
Osteobrama belangeri (Valenciennes, 1844) and related species from North-East India based on morphological and
molecular analysis. Mitochondrial DNA Part A, 29, 919–932. [first published online 2 November 2017]
http://doi.org/10.1080/24701394.2017.1389914
Masters, B.C., Fan, V. & Ross, H.A. (2011) Species delimitation – a Geneious plugin for the exploration of species boundaries.
Molecular Ecology Resources, 11, 154–157.
https://doi.org/10.1111/j.1755-0998.2010.02896.x
Menon, A.G.K. (1999) Check list of fishes of India. Zoological Survey of India Occasional Paper, 175, i–xxix + 11–366.
Meyer, W.S., Burn, R., Cotton, J.S. & Risley, H.H. (1908) The Imperial Gazetteer of India. New Edition. Vol. 7. Clarendon
Press, Oxford, vi + 423 pp.
Puillandre, N., Lambert, A., Brouillet, S. & Achaz, G. (2012) ABGD, Automatic Barcode Gap Discovery for primary species
delimitation. Molecular Ecology, 21 (8), 1864–1877.
https://doi.org/10.1111/j.1365-294X.2011.05239.x
Rambaut, A., Suchard, M. & Drummond, A. (2014) Tracer. Version 1.6. available from http://tree.bio.ed.ac.uk/software/tracer/
(accessed 2 February 2017)
Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics,19,
1572–1574.
https://doi.org/10.1093/bioinformatics/btg180
Rosenberg, N.A. (2007) Statistical tests for taxonomic distinctiveness from observations of monophyly. Evolution, 61, 317–
323.
https://doi.org/10.1111/j.1558-5646.2007.00023.x
Silas, E.G. (1952) Further studies regarding Hora's Satpura Hypothesis. 2. Taxonomic assessment and levels of evolutionary
RAHMAN ET AL.
118
·
Zootaxa 4504 (1) © 2018 Magnolia Press
divergence of fishes with the so-called Malayan affinities in Peninsular India. Proceedings of the National Institute of
Sciences of India, 18, 423–448.
Singh M., Verma, R., Yumnam, R. & Vishwanath, W. (2018) Molecular phylogenetic analysis of genus Osteobrama Heckel,
1843 and discovery of Osteobrama serrata sp. nov. from North East India. Mitochondrial DNA Part A, 29, 361–366.
[published online 2 March 2017]
http://doi.org/10.1080/24701394.2017.1285289
Srivatsan, A. & Meier, R. (2012) On the inappropriate use of Kinura-sParameter (K2P) divergences in the DNA-barcoding
literature. Cladistics, 28, 190–194.
https://doi.org/10.1111/j.1096-0031.2011.00370.x
Systat Software (2009) Systat version 13. Systat Software, Inc., San Jose.
Taylor, W.R. & Van Dyke, G.C. (1985) Revised procedures for staining and clearing small fishes and other vertebrates for bone
and cartilage study. Cybium, 9, 107–120.
Tang, K.L., Agnew, M.K., Hirt, M.V., Lumbantobing, D.N., Sado, T., Teoh, V.H., Yang, L., Bart, H.L., Harris, P.M., He, S.,
Miya, M., Saitoh, K., Simons, A.M., Wood, R.M. & Mayden, R.L. (2013) Limits and phylogenetic relationships of East
Asian fishes in the subfamily Oxygastrinae (Teleostei: Cypriniformes: Cyprinidae). Zootaxa, 3681 (2), 101–135.
https://doi.org/10.11646/zootaxa.3681.2.1
Talwar, P.K. & Jhingran, A.G. (1991) Inland fishes of India and adjacent countries. Vol. 1. Oxford & IHB Publishing Co, Pvt.
Ltd, New Delhi, Bombay & Calcutta, 541 pp.
Vishwanath, W. (2000) Fish fauna of Manipur. Manipur Association for Science & Society, Imphal, 9 + 143 pp.
Vishwanath, W. (2002) Fishes of North East India. Manipur University, Imphal, 8 + 198 + 1 pp.
Vishwanath, W. & Shantakumar, A. (2007) Fishes of the genus Osteobrama Heckel of Northeastern India. Zooʹs Print Journal,
22, 2881–2884.
Ward, R.D. (2009) DNA barcode divergence among species and genera of birds and fishes. Molecular Ecology Resources, 9,
1077–1085.
https://doi.org/10.1111/j.1755-0998.2009.02541.x
