Prepatent RT-LAMP Detection of Fasciola gigantica in Snails (Lymnaea spp.) and Goats (Capra hircus) Targeting Cathepsin B3 gene

Full text

A SciTechnol Journal
Research Article
Domingo et al., J Vet Sci Med Diagn 2018, 7:3
DOI: 10.4172/2325-9590.1000262
All articles published in Journal of Veterinary Science & Medical Diagnosis are the property of SciTechnol, and is protected by
copyright laws. Copyright © 2018, SciTechnol, All Rights Reserved.
Journal of
Veterinary Science &
Medical Diagnosis
International Publisher of Science,
Technology and Medicine
Introduction
Fasciola species are helminth parasites that cause uke pestilence
in cattle, bualoes, goats and sheep worldwide and became a critical
pathogen of humans. Fasciolosis is a zoonotic disease with various
reports on the incidence of human infections [1-3]. It is brought about
by two trematode species, Fasciola hepatica and Fasciola gigantica. F.
hepatica is a concern in Europe and America but the distribution of
these species overlaps in Africa and Asia [4] while F. gigantica is the
most common species infesting ruminants in the tropical parts of Asia
and Africa [5] which includes the Philippines. Many of uke species
contribute to a great loss in economic and medical aspects, with losses
of economic productivity and lives of livestock animals particularly
in ruminants and illnesses in humans [6]. ey are one of the serious
reasons contributing to the negative impact on animal health, welfare
Prepatent RT-LAMP Detection
of Fasciola gigantica in Snails
(Lymnaea spp.) and Goats (Capra
hircus) Targeting Cathepsin B3
gene
Clarissa Yvonne J Domingo, Rubigilda Paraguison Alili*, Irish
Marie Alvaran and Rayniel Joshua Aquino
Abstract
Cathepsins are cysteine proteases secreted in different stages of
Fasciola species of ukes. Cathepsin B is predominantly found
in eggs, metacercariae and the newly excysted juvenile (NEJ)
stages of the uke but not in adults. Cathepsin B3 was identied
in F. gigantica NEJs that facilitates the migration of the excysted
parasite to the liver. Here, RT-LAMP was utilized in the detection
of F. gigantica during the prepatent period or the period between
infection and the demonstration of the parasite i.e. from the egg
to the NEJ stages. We investigated the feasibility of identifying
the cathepsin B3 gene in various samples including snails, as
the intermediate host, the plasma, sera and feces of goats as the
denitive host animal targeting the Cathepsin B3 gene. Out of 90
snails, 61% were detected positive using RT-LAMP, 26% (32/122)
in fecal samples, 4% (5/122) in sera and 70% (86/122) in plasma
of the suspected infected goats. These ndings provide further
indication for early diagnosis of fasciolosis and a novel approach for
the improved disease management and control.
Keywords
Prepatent; Fasciola gigantica; Cathepsin B3; RT-LAMP
*Corresponding author: Rubigilda Paraguison Alili, College of Veterinary
Science and Medicine, Central Luzon State University, Science City of Muñoz,
Nueva Ecija, Philippines, Tel: +63-998-5683345; E-mail: cyjd1793@gmail.com
Received: July 19, 2018 Accepted: August 11, 2018 Published: August 17,
2018
and global food security [7-9]. e complication of this disease
worsens by occurrence of resistance to the available anti-uke drugs
in both animals and human [10,11]. Adult uke is the reproductively
active stage and aects the physical, nutritional and immunological
aspects of the animal host. However, the tissue-penetrating invasive
newly-excysted juvenile (NEJ)/juvenile stage causes major damage to
the host tissues during their migration from the gut lumen, through
the hepatic parenchyma to the bile ducts. Besides, diagnosis is usually
done during the chronic stage of the infection since it can only be
done through examining of the fecal samples when ukes are already
full-grown and eggs are already laid. is implicates delayed diagnosis
which impedes administration of the necessary control measures.
Cathepsin L and B are the signicantly expressed cysteine
proteases in many stages of Fasciola species which are also the
virulence gene targets and proposed vaccine antigen candidates [12-
15]. Cathepsins obtained from NEJ and immature juvenile ukes
were shown distinctive from the enzymes of adult parasites [12-17].
In a report, mature cathepsin B3 was present only in Fasciola spp.
NEJs but none in adult parasites and its ability to digest bronectin, a
native component of host’s connective tissue, suggest that the possible
function of secreted cathepsin B3 may be in digesting the host’s tissues
to facilitate the migration of the excysted parasite to the [12,14,15,
18]. According to Anuracpreeda et al. [5], cathepsin B3 gene switch
o during maturation of the parasite implicating that these enzymes
may be used by the juvenile stages to digest host tissues during their
penetration and migration to the liver; whereas catB1, which is
present in all stages and performs general digestive function. Since
Cathepsin B is released into the host uid in a fairly large amount,
it may possibly be an excellent candidate for immunodiagnosis of
fasciolosis by F. gigantica, particularly the early phase of infection [4].
Cathepsin B has been detected using RT-PCR and real time
PCR in Fasciola hepatica from sheep [12]. At present, no extensive
study has been done using RT-LAMP for detecting Cathepsin B3 of
Fasciola gigantica. Loop-mediated Isothermal Amplication (LAMP)
assay has been developed to diagnose and detect food borne [19] and
infectious diseases. More recently, LAMP assay is developed and used
to diagnose and detect parasitic infections [20-22]. Hence, this study
conrmed that Cathepsin B3 is detectable in Fasciola gigantica eggs
and validated the RT-LAMP assay on the known vector snail (Lymnea
sp.) and from the sera, plasma and feces of goats raised in Fasciola
endemic areas.
Materials and Methods
Intermediate hosts of 90 snails (Lymnaea spp.) were randomly
collected in the river and ooded rice elds from where the goats
were sampled. Denitive hosts of 122 goats from 7 barangays of
Science City of Muñoz, Nueva Ecija, Philippines were subjected for
extraction of blood including the collection of their feces via rectal
collection. Collected samples were put in storage prior to processing.
Fecal samples were processed in the laboratory using sedimentation
technique to determine the presence of uke eggs. Sampling sites for
both goats and snails were reported to have stable Fasciola endemicity
of 60% to 80% at any given time. e snails and the plasma, sera from
whole blood and the remaining fecal samples were processed for RNA
extraction and RT-LAMP assay.

Citation: Domingo CYJ, Alili RP, Alvaran IM, Aquino RJ (2018) Prepatent RT-LAMP Detection of Fasciola gigantica in Snails (Lymnaea spp.) and Goats
(Capra hircus) Targeting Cathepsin B3 gene. J Vet Sci Med Diagn 7:3.
• Page 2 of 5 •
doi: 10.4172/2325-9590.1000262
Volume 7 • Issue 3 • 1000262
An aliquot of 500 µl or 700-1000 mg of each plasma, serum and
fecal sample was placed in microcentrifuge tubes. Total RNA was
extracted using TRIzol (Invitrogen, USA) following manufacturer’s
instructions, eluted with 30-µl RNase-free water. e snails were
transferred into 1.5 microcentrifuge tubes, frozen with liquid
nitrogen and crushed with sterile mini pestle. About 500-700 mg of
each snail sample was placed in individual microcentrifuge tubes and
macerated by alkaline lysis.
RT-LAMP Optimization
LAMP primers were generated for Fasciola gigantica from
cathepsin B3 (cat-B3) mRNA, complete cds with GenBank Accession
No. AY227675.1 using the soware LAMP Designer 1.10 (Table 1).
Briey, the LAMP primer mix was prepared from 100 µM stock of
each primer preparation: 2.5 µl of F3 and B3 primers; 10 µl of FIP and
BIP primers and nally, 5 µl of F-loop and B-loop primers. A 12.5-
µL RT-LAMP premix was prepared: 7.2 mM MgSO4, 1.2x RT-LAMP
buer, 1.2 M Betaine, 0.8 mM dNTP mix, 0.5 µl of the LAMP primer
mix, 4U of Bst DNA polymerase, 20U of reverse transcriptase and 1
µL of RNA extract from the positive control. Incubation was done at
60°C for 1 hour. Aer completion of the reaction, 1 µL of 10X SYBR
Green I uorescent dye was added into each tube. Positive reactions
displayed a visible green color, whereas the negative reactions
remained orange due to the unbound SYBR Green I. Conrmation
through gel electrophoresis was performed using 1.5% molecular-
grade agarose gel with 1X Tris-Actetate-EDTA buer stained with
Gel Red (Biotium).
Positive control was prepared from eggs which were extracted
through an incision at the upper third of the uke’s body just below
the acetabulum where the uterus is located (Figure 1). e eggs were
subjected to RNA extraction and were used for optimizing the RT-
LAMP protocol.
Data were presented by the prevalence of infected snails from
dierent barangays for eld validation of snails and the plasma, serum
and feces of goats. Diagnostic sensitivity and specicity of RT-LAMP
in plasma, serum and feces against fecalysis using sedimentation
technique was also evaluated.
Results and Discussion
RT-PCR and RT-LAMP were able to amplify the target gene,
Cathepsin B3 mRNA in the Fasciola gigantica eggs and none in the
adult neither in the non-target cDNA of Calicophoron calicophorum,
an amphistome.
e optimal reaction temperature and time for RT-LAMP
assay based on the dye test, dye and uorescence test and by gel
electrophoresis can be achieved aer at 60°C to 64°C for 90 minutes.
Positive in dye test indicates when the reaction changes color from
orange to green aer the addition of SYBR Green. Positive in
uorescence test is indicates bright luminescence under the UV or
blue light while a multiple ladder-like bands appear in agarose gel
electrophoresis.
For eld validation, detection of cathepsin B3 among samples
using RT-LAMP is shown in Tables 2-4. Out of the 90 randomly
collected snails, 59 or 65.55% tested positive, 70.49% or 86 out of
122 plasma samples were positive, 4.1% from the sera and 26.22%
from the fecal samples. Positive RT-LAMP results in plasma, serum
and feces of goats were visualized under blue light and conrmed by
agarose gel electrophoresis (Figures 2 and 3).
In parallel, fecalysis using sedimentation test showed a prevalence
of 45.90% or 56 out of 122 goats infected with fasciolosis. e entire
life cycle of Fasciola sp. takes about 17-18 weeks or almost 4 months
including the stages in the intermediate (snail) and nal (vertebrate)
host. Almost half of the entire life cycle of the uke is spent inside
the snail where the development into miracidia, sporocyst, redia and
cercariae take place. is is substantiated by the result of the RT-
LAMP test in which the prevalence of Cathepsin B3 in the snails is
very high (65.55%). is is already indicative of the snails infected
with Fasciola larvae since they were collected from water bodies in
villages endemic to fasciolosis.
Incision site
OS: Oral Sucker
Ph: Pharynx
G: Main Ceca Of The Gut
Sv: Seminal Vesicle
A: Acetabulum Or Ventral Sucker
U: Uterus Filled With Eggs
Genital pore
pporw
Figure 1: Location where eggs of the adult Fasciola gigantica were extracted
for positive control.
Primer Name Sequence
F3 CCATCCACTCGATTCAACAA
B3 TACGCACAACAACTGACAA
FIP CGAGCATCGAAAGATTCGGGTA-GGAACACTCAACGACAA
BIP TTCCGAGATTCGTGACCAATCC-TTATTGCCGAAGCAGAGC
FLoop CTGATACGGAATACCTCACGG
BLoop TAGTTCGTGTTGGGCTGTC
Table 1: Nucleotide sequences of the LAMP primers targeting the Cathepsin
B3 gene.
Sample Prevalence
Plasma 70.49 (86/122)
Serum 4.1 (5/122)
Feces 26.22 (32/122)
Snails 65.55 (59/90)
Table 2: Prevalence of Cathepsin B3 among samples using RT-LAMP.
Sensitivity (%) 95% Condence interval
LAMP Feces 30.35 18.78 44.10
LAMP Plasma 71.42 57.79 82.70
LAMP Serum 3.57 0.44 12.31
Table 3: Sensitivity of RT-LAMP relative to Fecalysis.
Specicity 95% Condence interval
LAMP Feces 77.27% 69.17 84.11
LAMP Plasma 30.30% 22.61 38.90
LAMP Serum 95.45% 90.37 98.31
Table 4: Specicity of RT-LAMP relative to Fecalysis.

Citation: Domingo CYJ, Alili RP, Alvaran IM, Aquino RJ (2018) Prepatent RT-LAMP Detection of Fasciola gigantica in Snails (Lymnaea spp.) and Goats
(Capra hircus) Targeting Cathepsin B3 gene. J Vet Sci Med Diagn 7:3.
• Page 3 of 5 •
doi: 10.4172/2325-9590.1000262
Volume 7 • Issue 3 • 1000262
Figure 2: Agarose gel image (A) RT-PCR product (1,150bp) between adult and eggs of Fasciola gigantica and adult Calicophoron calicophorum as nontarget.
Figure 3: RT-LAMP positive results in plasma, serum and feces of goats.
Comparing the referential fecalysis method, the sensitivity and specicity of RT-LAMP were presented in Tables 3 and 4 indicating that RT LAMP can be in good
agreement with fecalysis and it can even demonstrate higher sensitivity and specicity. To test if the animal is free from fasciolosis, RT-LAMP using a serum
sample can be utilized considering its 95% specicity. For purposes of detection, RT-LAMP using plasma can be used due to its 71% sensitivity.
e presence of Cathepsin B3 gene in the plasma can be explained
by the presence of NEJs released aer ingestion of metacercariae
from plants or contaminated water. e NEJs are released in the
duodenum and migrate for 1.5 mos in the circulation until they
reach the liver. During migration and development, NEJs encounter
dierent host tissues and macromolecules, dynamic physicochemical
microenvironments, and host responses such as blood coagulation,
complement activation, in addition to other innate and acquired
immune responses [23]. is could also be the reason why Cathepsin
B3 was rarely detected in the sera speculating that it might have been
trapped in the clot.
e presence of Cathepsin B3 in the blood can be described as the
newly excysted juveniles (NEJ) naturally emerge in the duodenum
and migrate to the liver. Following a period of blood feeding and
growth in the liver, they move to the bile ducts, where they obtain
blood by puncturing the duct wall, undergo maturation, and produce
eggs [24]. Although adult ukes are reproductively active and are
responsible for the pathology in mammalian hosts, NEJ are the cause
of signicant damage to host tissues when migrating from the gut
lumen to the bile ducts [25-30]. During migration and development,
NEJs encounter dierent host tissues and macromolecules, dynamic
physicochemical microenvironments, and host responses such as
blood coagulation, complement activation, in addition to other innate
and acquired immune responses (Andrews) [1,31-36]. Although the
presence of Fasciola eggs in fecalysis indicates adults in the goats.
Amplifying Cathepsin B3 cDNAs in the feces could have come from
the Fasciola eggs [37-42].
Conclusion
e presence of Fasciola eggs in fecalysis only indicates the
presence of adults where, newly excysted juvenile (NEJ) ukes taken in
by goats from freshly ingested metacercariae are not detected. Hence,
the dewormer of choice oen would be for adults where hepatic
destruction is already in the advance state. Strategic deworming
calls for identifying infected animals to prevent uke resistance from

Citation: Domingo CYJ, Alili RP, Alvaran IM, Aquino RJ (2018) Prepatent RT-LAMP Detection of Fasciola gigantica in Snails (Lymnaea spp.) and Goats
(Capra hircus) Targeting Cathepsin B3 gene. J Vet Sci Med Diagn 7:3.
• Page 4 of 5 •
doi: 10.4172/2325-9590.1000262
Volume 7 • Issue 3 • 1000262
developing. Since the study shows that RT-LAMP technique can
amplify the target gene Cathepsin in the snails, plasma, serum and
feces of goats, it can be a new platform for controlling fasciolosis by
detecting animals harboring NEJ ukes and by detecting Fasciola
infected snails in the area [43]. is economical and quick method
holds promise for fasciolosis diagnosis in countries with resource-
limited settings. e procedure, targeting Cathepsin B3 recommends
an excellent diagnosis during the prepatent period for fasciolosis
and can advance the comprehensive eld surveillance-response
approaches in the Philippines and any developing countries.
Acknowledgments
Grateful acknowledgments to our colleagues at the College of Veterinary
Science and Medicine, Central Luzon State University for the support. Above all,
to God for the wisdom and knowledge.
Funding
This study was funded by the Philippine Council for Agriculture, Aquatic, and
Natural Resources Research and Development (PCAARRD)
Conict of interest statement
The authors whose names are listed below certify that they have NO
afliations with or involvement in any organization or entity with any nancial
interest (such as honoraria; educational grants; participation in speakers’ bureaus;
membership, employment, consultancies, stock ownership, or other equity
interest; and expert testimony or patent-licensing arrangements), or non-nancial
interest (such as personal or professional relationships, afliations, knowledge or
beliefs) in the subject matter or materials discussed in this manuscript. We have
no conict of interest.
Statement of human rights
All procedures performed in studies involving human participants were in
accordance with the ethical standards of the institutional and/or national research
committee and with the 1964 Helsinki declaration and its later amendments or
comparable ethical standards.
c) Statement on the welfare of animals
All applicable international, national, and/or institutional guidelines for the
care and use of animals were followed.
References
1. Mas-Coma MS, Esteban JG, Bargues MD (1999) Epidemiology of human
fascioliasis: A review and proposed new classication. Bull World Health
Organ 77: 340-346.
2. Torgerson P, Claxton J (1999) Epidemiology and control.
3. Hillyer GV (2005) Fasciola antigens as vaccines against fascioliasis and
schistosomiasis. J Helminthol 79: 241-247.
4. Mas-Coma S, Bargues MD, Valero MA (2005) Fascioliasis and other plant-
borne trematode zoonoses. Int J Parasitol 35: 1255-1278.
5. Anuracpreeda P, Wanichanon C, Chaithirayanon K, Preyavichyapugdee
N, Sobhon P (2006) Distribution of 28.5 kDa antigen in tegument of adult
Fasciola gigantica. Acta Tropica 100: 31-40.
6. Roberts LS, Janovy J Jr (2000) Foundations of Parasitology.
7. Fairweather I (2011). Reducing the future threat from (liver) uke: Realistic
prospect or quixotic fantasy? Vet Parasitol 180: 133-143.
8. Keiser J, Utzinger J (2005) Emerging foodborne trematodiasis. Emerg Infect
Dis 11: 1507-1514.
9. Hotez PJ, Brindley PJ, Bethony JM, King CH, Pearce EJ (2008) Helminth
infections: The great neglected tropical diseases. J Clin Invest 118: 1311–
1321.
10. Brennan GP, Fairweather I, Trudgett A, Hoey E, McCoy, et al. (2007)
Understanding triclabendazole resistance. Exp Mol Pathol 82: 104-109.
11. Winkelhagen AJ, Mank T, de Vries PJ, Soetekouw R (2012) Apparent
triclabendazole-resistant human Fasciola hepatica infection, the netherlands.
Emerg Infect Dis: 18: 1028–1029.
12. Wilson LR, Good RT, Panaccio M, Wijffels GL, Sandeman RM, et al. (1998)
Fasciola hepatica: Characterization and cloning of the major cathepsin B
protease secreted by newly excysted juvenile liver uke. Exp Parasitol 88:
85-94.
13. Dalton JP, Neill SO, Stack C, Collins P, Walshe A, et al. (2003) Fasciola
hepatica cathepsin L-like proteases: biology, function, and potential in the
development of rst generation liver uke vaccines. Int J Parasitol 33: 1173-
1181.
14. Meemon K, Grams R, Grams S, Hofmann A, Korge G, et al. (2004) Molecular
cloning and analysis of stage and tissue-specic expression of cathepsin B
encoding genes from Fasciola gigantica. Mol Biochem Parasitol 136: 1-10
15. Cancela M, Acosta D, Rinaldi G, Silva E, Durán R, et al. (2008) A distinctive
repertoire of cathepsins is expressed by juvenile invasive Fasciola hepatica.
Biochimie 90: 1461-1475.
16. Carmona C, Dowd AJ, Smith AM, Dalton JP (1993) Cathepsin L proteinase
secreted by Fasciola hepatica in vitro prevents antibody-mediated eosinophil
attachment to newly excysted juveniles. Mol Biochem Parasitol 62: 9–17.
17. Tkalcevic J, Ashman K, Meeusen E (1995) Fasciola hepatica: Rapid
identication of newly excysted juvenile proteins. Biochem. Biophys Res
Commun 213: 169-174.
18. Law RH, Smooker PM, Irving JA, Piedrata D, Ponting R, et al. (2003)
Cloning and expression of the major secreted cathepsin B-like protein from
juvenile Fasciola hepatica and analysis of immunogenicity following liver uke
infection. Infect Immun 71: 6921-6932.
19. Lukinmaa S, Nakari U, Eklund M, Siitonen A (2004) Application of molecular
genetic methods in diagnostics and epidemiology of food-borne bacterial
pathogens. APMIS 112: 908-929.
20. Adams ER, Schoone GJ, Ageed AF, Sa SE, Schallig HDFH (2010)
Development of a reverse transcriptase loop-mediated isothermal
amplication (LAMP) assay for the sensitive detection of Leishmania
parasites in clinical samples. Am J Trop Med Hyg 82: 591-596.
21. Martinez-Vallardes M, Rojo-Vazquez FA (2016) Loop-mediated isothermal
amplication (LAMP) assay for the diagnosis of fasciolosis in sheep and its
application under eld conditions. Parasit Vectors 9:73.
22. Ni X, McManus DP, Yan H, Yang J, Lou Z, et al. (2014) Loop-mediated
isothermal amplication (LAMP) assay for the identication of Echinococcus
multilocularis infections in canine denitive hosts. Parasit Vectors 7:254.
23. Andrews SJ (1999) The Life Cycle of Fasciola hepatica.
24. Mas-Coma S, Valero MA, Bargues MD (2014) Fascioliasis. Adv Exp Med
Biol 766: 77-114
25. Bowman D (2009) Georgis Parasitology for Veterinarians. Saunders Elsevier,
New York.
26. Celestino MTF (2016) PCR based detection of ruminant trematode
metacercariae encysted in plants from barangays of the science city of
muñoz.
27. Chapman HA, Riese RJ, Shi GP (1999) Emerging roles for cysteine proteases
in human biology. Annu Rev Physiol 59: 63-88.
28. Chung YB, Kong Y, Joo IJ, Cho SY, Kang SY (1995) Excystment of
Paragonimus westermani metacercariae by endogenous cysteine
protease. Journal of Parasitology 81: 137-142.
29. Dalton JP, Heffernan M (1989) Thiol proteases released in vitro
by Fasciola hepatica. Mol Biochem Parasitol 35: 161-166.
30. Dalton JP, Mc Gonigle S, Rolph TP, Andrews SJ (1996) Induction of protective
immunity in cattle against infection with Fasciola hepatica by vaccination with
cathepsin L proteinases and with hemoglobin. Infect Immun 64: 5066–5074.
31. Fairweather I (2005) Triclabendazole: New skills to unravel an old(ish)
enigma. J Helminthol 79: 227-234.
32. Hoyle DV, Dalton JP, Chase-Topping M, Taylor DW (2003) Pre-exposure
of cattle to drug- abbreviated Fasciola hepatica infections: the effect upon
subsequent challenge infection and the early immune response. Vet Parasitol
111: 65-82.
33. Lammas DA, Duffus WP (1983) The shedding of the outer glycocalyx of
juvenile Fasciola hepatica. Vet Parasitol 12:165-178.

Citation: Domingo CYJ, Alili RP, Alvaran IM, Aquino RJ (2018) Prepatent RT-LAMP Detection of Fasciola gigantica in Snails (Lymnaea spp.) and Goats
(Capra hircus) Targeting Cathepsin B3 gene. J Vet Sci Med Diagn 7:3.
• Page 5 of 5 •
doi: 10.4172/2325-9590.1000262
Volume 7 • Issue 3 • 1000262
34. Mc Gonigle L, Mousley A, Marks NJ, Brennab GP, Dalton JP, et al. (2008) The
silencing of cysteine proteases in Fasciola hepatica newly excysted juveniles
using RNA interference reduces gut penetration. Int J Parasitol 38: 149-155.
35. Moll L, Gaasenbeek CPH, Vellema P, Borgsteede FHM (2000) Resistance
of Fasciola hepatica against triclabendazole in cattle and sheep in the
Netherlands. Vet Parasitol 91: 153-158.
36. Piacenza L, Acosta D, Basmadjian I, Dalton JP, Carmona C (1999)
Vaccination with cathepsin L proteinases and with leucine aminopeptidase
induces high levels of protection against fascioliasis in sheep. Infect Immun
67: 1954-1961.
37. Piedrata D, Raadsma HW, Prowse R, Spithill TW (2004) Immunology of
the host parasite relationship in fasciolosis (Fasciola hepatica and Fasciola
gigantica). Can J Zool 82: 233-250.
38. Roberts JA, Estuningsih E, Wiedosari E, Spithill TW (1997) Acquisition of
resistance against Fasciola gigantica by Indonesian Thin Tail sheep. Vet
Parasitol 73: 215-224.
39. Sethadavit M, Meemon K, Jardimb A, Spithill TW, Sobhon P (2009)
Identication, expression and immunolocalization of cathepsin B3. A
stagespecic antigen expressed by juvenile Fasciola gigantica. Acta Tropica
112: 164-173.
40. Smith AM, Dowd AJ, Mc Gonigle S, Keegan PS, Brennan G, et al. (1993.
Purication of a cathepsin L-like proteinase secreted by adult Fasciola
hepatica. Mol Biochem Parasitol 62: 1-8.
41. Soulsby E (1982) Helminths, arthropods and protozoa of domestic animals.
Bailliere Tindall: Lea and Febiger.
42. Turk V, Stoka V, Vasiljeva O, Renko M, Sun T, et al. (2011) Cysteine
cathepsins: From structure, function and regulation to new frontiers. Biochim
Biophys Acta 1824: 68-88.
43. Urquhart G, Amour J, Duncan J, Dunn A, Jennings F (1996) Veterinary
parasitology, Wiley-Blackwell Company, Scotland, UK.
Author Afliation Top
College of Veterinary Science and Medicine, Central Luzon State University
Science City of Muñoz, Nueva Ecija, Philippines 3120
Submit your next manuscript and get advantages of SciTechnol
submissions
80 Journals
21 Day rapid review process
3000 Editorial team
5 Million readers
More than 5000
Quality and quick review processing through Editorial Manager System
Submit your next manuscript at ● www.scitechnol.com/submission