Genetic relationship between neuropteran families (Insecta, Neuropterida, Neuroptera) based on Cytochrome oxidase-i sequences

Abstract

The studied specimens belonged to five species of three families of
Chrysopidae, Myrmeleontidae and Ascalaphidae (order Neuroptera). They were
collected from Shush and Dezful, south of Iran. These insects are useful
insects in biological control as the important predators of aphids,
psyllids, caterpillars, ants and other insects. The Sequence alignment of
parts of Cytochrome Oxidase-I (COI) gene of those species was studied. The
insect bodies were entirely ground in a microtube. The PCR products of COI
were sequenced. Pairwise alignment of nucleotides sequences belonging to
five species of Neuroptera was carried out using MegAlign and EditSeq
softwares. The sequencing results in Palpares solidus and Creoleon remanei
showed the mutation potentials in locations of 699, 702, 726, 735 and 750 of
COI gene of mtDNA. According to COI gene sequences, Chrysopa pallens and
Palpares solidus species showed the maximum genetic similarity (98.2%).
There was the minimum genetic similarity (75.9%) between Chrysopa viridana
and Creoleon remanei species.

Full text

___________________________
Corresponding author: Alinaghi Mirmoayedi, Department of Plant Protection, Razi
University, Kermanshah, alimrmoayedi@gmail.com, Tel: 09181317087
UDC 575
https://doi.org/10.2298/GENSR1802717M
Original scientific paper
GENETIC RELATIONSHIP BETWEEN NEUROPTERAN FAMILIES (INSECTA,
NEUROPTERIDA, NEUROPTERA) BASED ON CYTOCHROME OXIDASE-I
SEQUENCES
Alinaghi MIRMOAYEDI1*, Fatemeh RASHIDIKHAH1, Danial KAHRIZI2,4
Kheirullah YARI3,4
Department of Plant Protection, Razi University, Kermanshah, Iran
Department of Agronomy and Plant Breeding, Razi University, Kermanshah, Iran
Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah,
Iran.
Zagros Bioidea Company, Razi University Incubator, Kermanshah, Iran
Mirmoayedi A., F. Rashidikhah, D. Kahrizi, K. Yari (2018): Genetic relationship between
neuropteran families (insecta, neuropterida, neuroptera) based on cytochrome oxidase-i
sequences.- Genetika, Vol 50, No.2, 717-730.
The studied specimens belonged to five species of three families of Chrysopidae,
Myrmeleontidae and Ascalaphidae (order Neuroptera). They were collected from Shush
and Dezful, south of Iran. These insects are useful insects in biological control as the
important predators of aphids, psyllids, caterpillars, ants and other insects. The Sequence
alignment of parts of Cytochrome Oxidase-I (COI) gene of those species was studied. The
insect bodies were entirely ground in a microtube. The PCR products of COI were
sequenced. Pairwise alignment of nucleotides sequences belonging to five species of
Neuroptera was carried out using MegAlign and EditSeq softwares. The sequencing
results in Palpares solidus and Creoleon remanei showed the mutation potentials in
locations of 699, 702, 726, 735 and 750 of COI gene of mtDNA. According to COI gene
sequences, Chrysopa pallens and Palpares solidus species showed the maximum genetic
similarity (98.2%). There was the minimum genetic similarity (75.9%) between Chrysopa
viridana and Creoleon remanei species.
Key words: Cytochrome Oxidase-I (COI), Genetic Relationship, Neuroptera

718 GENETIKA, Vol. 50, No2, 717-730, 2018
INTRODUCTION
In the past twenty years, molecular techniques were used to acquire more informations about
different living organisms from viruses and bacteria to humans. The use of DNA of insects for
taxonomical studies is a better and more precise method to know the relationship between
different orders or families of insects.
The study of biological polymorphism is dependent to the study of biodiversity,
phylogenetics and evolutionary sciences (BROOKS, 1997; MIRMOAYEDI et al., 2012,).
Neuroptera is the name of an order of holometabolous insects belonging to super order
Neuropterida. This superorder consists of three orders; Neuroptera, Megaloptera, Raphidioptera
(BROOKS and BARNARD 1990; FARAHI et al.,2009 ).
Green lacewings (Chrysopidae) and brown lacewings (Hemerobiidae) are important
predators of aphids, psyllids and caterpillars (MIRMOAYEDI 2003; GHAHARI et al., 2010) and
Coniopterygidae are predators of mites. Therefore these insects are useful insects in biological
control. Other Neuropteran families such as Myrmeleontidae (antlions) are predators of ants and
other insects. The larvae of Ascalaphidae (owlflies) are also predators of ants and resemble very
much to antlion larvae. The adults make themselves hidden by pressing their legs and body to the
long axis of plant twigs such as wheat shoots in wheat field in daytime, besides adult antlions are
active when it is dawn or dusk (MIRMOAYEDI, 2003; KRIVOKHATSKY, 2011).
For rapid identification of different insect species, DNA based methods are increasingly used
and the use of mitochondrial Cytochrome Oxidase1(mt CO1) gene, is mostly used in insect
species identifications. For showing the importance of mt CO1, we mention the works of some
of the authors which used this method here. The relative lack of diagnostic morphological
characteristics in Aphidina (Insecta,Hemiptera, Aphididae) caused the identification of species in
this group to be difficult and erroneous, so some authors have used mt CO1gene for
identification of this subtribe of Aphididae with success. Thirty-six species of Aphidina were
identified in a neighbor-joining tree. Mean intraspecific sequence divergence in Aphidina was
0.52%, with a range of 0.00% to 2.95%, and the divergences of most species were less than 1%.
The mean interspecific divergence with Aphidina was 6.80%, with a range of 0.68% to 11.40%,
and most genera were in the range of 3.50% to 8.00% (WANG et al.,2011).
Patterns of amino acid variation suggest convergent or parallel evolution at the
protein level connected to the transition into a parasitic life style. Denser sampling of two diverse
insect taxa revealed that the beetles (Coleoptera) show more amino acid variation than the
butterflies and moths (Lepidoptera), indicating fundamental difference in patterns of molecular
evolution in COI. Several amino acid sites were found to be under notably strong purifying
selection in Lepidoptera as compared to Coleoptera (PENTINSAARI et al.,2016).
In Thailand, a 658 bp fragment of COI was amplified from 145 adult horse flies belonging to 48
morphologically distinct species and sequenced. Sequence analysis revealed an intraspecific
divergence of 0.0%–4.4% (CHANGBUNJONG et al.,2018).
As a goal of our study we wanted to understand the family relationship among three
families of Neuroptera, so we used the mitochondrial Cytochrome Oxidase-I (COI) genes to
compare DNA nucleotides. In the past fifty years, there were some studies on systematics of
different families of Neuroptera (such as Chrysopidae, Coniopterygidae and Mantispidae) in
Iran, however most of the species recorded for Iran were identified only by the use of
morphological characters of the specimens. Although in recent years there were some efforts
between the Iranian entomologists to study the phylogenetic and family relationship between

A.MIRMOAYEDI et al.: GENETIC RELATIONSHIP BETWEEN NEUROPTERAN FAMILIES 719
some orders and families of insects. We have already used RAPD-PCR methods for the study of
Chrysopidae and Myrmeleontidae families (MIRMOAYEDI, 2006; MIRMOAYEDI et.al.,2012;
MIRMOAYEDI et al.,2013) and there were also other authors which used RAPD-PCR for
molecular studies of other insect families (GADELHAK and ENAN, 2005).
Estimation of evolutionary distances between protein and DNA sequences is important to
construct phylogenetic trees, dating species divergencies and understanding the mechanisms of
evolution of genes, proteins and populations (WILLIAMS et al.,1990; TAKEZAKI et al., 1995;
RAHIMI et al.,2014). To estimate the divergence times of species or species groups with
molecular data, a linearized tree under assumption of a molecular clock could be constructed
(TAKEZAKI et al., 1995). Some authors have shown that in phylogenetic inference simple
methods are often as efficient as complex ones when the bootstrap test is used (PHILLIPS and
SIMON, 1995 ).
The present study is a new approach to the systematic study of Neuroptera. As it
compares the relationship between three families of Neuroptera (Chrysopidae, Myrmeleontidae
and Ascalaphidae) by use of COI gene sequences. Deleproctophylla variegata is a species
which belong to Ascalaphidae family and we wanted to determine for the first time the genetic
similarity or distance and phylogenetic relationship of this species versus the other species
belonging to the families of Chrysopidae and Myrmeleontidae.
MATERIALS AND METHODS
Shush(32°11'21.19" N, 48°15'28.03" E) and Dezful(32°22′52″ N , 48°24′20″ E ) are two
cities in Khuzestan province in south Iran, a distance of 34 kilometers separates them from each
other. The Neuropteran specimens of three families Ascalaphidae, Chrysopidae and
Myrmeleontidae were collected from these two locations.
The Palpares solidus and Creoleon remanei of Myrmeleontidae family,
Deleproctophylla variegata of Ascalaphidae family and Chrysopa viridana and Chrysopa
pallens of Chrysopidae family were the species collected and used for molecular assays. The
determination of species was done using the male genitalia. The DNA extraction, electrophoresis
and other molecular experiments performed in the Zagros Bioidea Co., Razi University,
Kermanshah, Iran.
DNA purification
The buffer preparation and DNA extraction was carried out according to previous reports
(21, 22). At first the CTAB (Cetyl Trimethyl Ammonium Bromide) buffer was prepared for 40
specimens.
The wings of specimens were separated and using 50 μl of extract buffer (Tris EDTA,
NaCl, CTAB, β-mercaptoethanol) the insects bodies was entirely ground in 1.5 mL sterilized
microtubes and 550 μl of buffer was added simultaneously. Then samples were incubated in
temperature of 65◦C for 60 min. The samples were centrifuged in 13000 rpm for 7 min to
precipitate proteins and polysaccharides.
The supernatant was pipetted out, then 550 μl of cold chloroform was added and was
vortexed slowly. After re-centrifuging and pipetting out of supernatant it was transferred to a
new 1.5 ml microtube and 750 μl of cold isopropanolol alcohol was added.

720 GENETIKA, Vol. 50, No2, 717-730, 2018
Then samples were kept in a freezer for 30 min. Supernatant was centrifuged and pipetted
out once again. Then 70% cold ethanol was added to rinse pelleted DNA and the tubes were
centrifuged at 7000 rpm.
The supernatant pipetted out and was poured into opened cap microtubes to let the
pelleted DNA to be air dried. Then the dried pelleted DNA was dissolved in 50 μl. deionized
water and was preserved for further investigations in (-20 C) in a deep freeze freezer (23).
Polymerase chain reaction (PCR) and electrophoresis
The two following primers were used for PCR:
Forward primer (5'-CAACATTTATTTTGATTTTTTGG-3') and
Reverse primer (5'-TCCATTGCACTAATCTGCCATATTA -3').
For each DNA sample, a 25 L of PCR mixture (MgCl2, PCR-buffer, dNTPmix (Bio
Flux), primers, DNA, Taq DNA polymerase was added and PCR was done as follows; initial
denaturation, one cycle, 5 min at 94C, 38 cycles of (denaturation- 35 s at 94C, annealing- 45 s
at 36C, primers extension- 2 min at 72C), and final primers extension one cycle at 72C, for 5
min. 1.5 % Agarose gel was used for electrophoresis, staining of the bands were done using a 0.5
l g/mL ethidium bromide, and finally UV Rays by (Bio-Rad Gel Doc 2000) was used to make
the bands visible, and ready for final photography.
DNA Sequencing
The PCR products of COI sequences were sent to Tekapozist Co., Tehran for sequencing.
The sequencing was done both in forward and reverse directions to compare segments of DNA
of every two species. Then we have compared the sequences obtained for our species of
neuropterans with those which was accessible in Gene bank of NCBI.
Analysis of Molecular Data
MegAlign software (6th edition May 2001, DNASTAR® Inc. USA) was used to evaluate
genetic distances as well as the replacements of nucleotides between nucleotide sequences of
different species.
The EditSeq (6th edition May 2001, DNASTAR® Inc. USA) was used to edit sequences,
comments and annotations and SPSS version 16 was used for calculating coefficient of
cophenetic.
RESULTS AND DISCUSSION
Although all neuropteran families are predators but they have different strategies to prey
on their hosts, for example larvae of Chrysopidae are predators of aphids so they are named as
aphidlions and Cannibalism is very intense between larvae of Chrysoperla carnea in absence of
prey, sometimes reach to 100%. (MOCHIZUKI et al., 2006). But the adults lacewings are pollen
feeders and not predators and larvae of Myrmeleontidae are predators of ants so they are called
antlions.The body size of neuropteran are different from a few millimeters in Coniopterygidae to
more than 7 centimeters in some of antlion species. Their habitat also are very diverse, while
Chrysopidae prey on aphids so are generally found in aphid assemblages in plants, shrubs and
trees, Coniopterygidae larvae should be found in colonies of plant mites. The antlions (family

A.MIRMOAYEDI et al.: GENETIC RELATIONSHIP BETWEEN NEUROPTERAN FAMILIES 721
Myrmeleontidae) have the unique behavior to be sedentary predators among insects, mostly pit
building in the soil, they make an inverted cone shaped pit in the soil at the bottom of which the
larvae wait for the prey(ants) to fall into the pitfall and the antlion suck the blood of ants by
inserting a pair of pointed mandibles to the body of their victims. DEVETAK et al. (2005)
emphasized that antlions Euroleon nostras make their pits with sand particles 0.23-0.54 mm of
diameter and these antlions prefer fine sands to coarser sands, they found that larval antlions
perceive their preys visually together with their odors and vibrations made by the movements of
the walking ants on the sands near their pit.Concerning the ladybirds, they are intense predators
of aphids both as larvae or adults, however the adults of many species such as Coccinella
septempunctata like many other ladybug species are more effective predators of aphids than
their larvae, the exception is wingless ladybird Harmonia axyridis (RIDDICK, 2017). Silverflies
(Diptera, Chamaemyiidae) are another group of aphidiphagous and coccidophagous predator
insects, which the maximum peak of their population reach in fall and winter, although one
species is found in midsummer. Chamaemyiidae larvae was seen preying on aphids infesting
herbaceous crops, fruit orchards and also neighborhood plants belonging to spontaneous flora,
poor synchronization of predator-prey seasonal habits and lack of searching ability of some
Chamaemyiidae species against a targeted prey are two major weakness of these predators in
nature (SATAR et al., 2015).The Cecidomyiidae midges=larvae (Diptera) are another predators
specially of Tetranychid mites. Feltiella acarisuga one of the species of Cecidomyidae is now
commercially available in the USA and other countries as a biological control agent of
Tetranychid mites (ZHANG, 2003).
Pairwise alignments of nucleotide sequences belonging to five species of Neuroptera
(Fig-1).Some segments of nucleotides of COI gene of Palpares solidus (M1) was compared with
Creoleon remanei (M2). This comparison showed that differences in COI gene nucleotides
sequences were observed in residues of 699, 702, 726, 735 and 750 of Palpares solidus. The
adenine was changed to thymine in Creoleon remanei. Other mutations were the cause of
changing guanine to adenine in position 705, cytosine to thymine in position 720, adenine to
cytosine in position 724, adenine to guanine in position 729 and guanine to adenine in position
738 of the nucleotide sequences in sequences of COI gene of Palpares solidus (Fig.1).
Fig 1.Pairwise comparison of a part of nucleotides of COI in five species of Neuroptera.

722 GENETIKA, Vol. 50, No2, 717-730, 2018
The Chrysopa pallens and Palpares solidus have 98.2% (maximum of similarity), in
other words there are the least divergence (1.6%) between them (Table 1). The Chrysopa
viridana and Creoleon remanei have the maximum of distance (20.7%) and the minimum
similarity (75.9%).
Table 1. Coefficient of cophenetic for cluster analysis of aminoacids of mitochondrial COI in
five species of Neuroptera (Palpares solidus(M1), Chrysopa pallens (C2), Chrysopa viridana (C1),
Creoleon remanei (M2), Deleproctophylla variegata (A1) in this figure, is equal to 0.702 which is
significantly different at 5% probability(0.01≤ p˂0.05)
Percentage of identity
1
2
3
4
5
Divergency
1
79.1
82.7
82.9
81.3
1
Deleproctophylla
Variegata
2
18.8
96.1
95.5
75.9
2
Chrysopa
Viridana
3
18.3
4.00
98.2
78.8
3
Chrysopa
pallens
4
17.9
4.2
1.6
79.8
4
Palpares solidus
5
17.8
20.7
19.9
18.9
5
Creoleon
remanei
1
2
3
4
5
We also have compared pairwise alignment of sequences 22-81 of 60 amino acids
sequences corresponding to triplets of nucleotides in parts of COI gene of Palpares solidus,
Deleproctophylla variegata, Chrysopa pallens with positions of 31-90 amino acids sequences in
Creoleon remanei and compared them with sequences 5-64 of amino acids corresponding to
triplets of nucleotides in COI of Chrysopa viridana. Maximum similarities (i.e. 56 AA of 60
AA) have been found in the above indicated sequences; however four of them are different. Then
93% of AA in the interval of 60 above mentioned AA had the same sequences in five species of
Neuroptera. As concerning the amino acids which participate in composition of proteins, coded
by COI gene (Fig. 2) we have seen that histidine (H) was the amino acid in position of 26 in AA
sequences in Palpares solidus, Deleproctophylla variegate, Chrysopa pallens and in position 35
of AA sequences in Creoleon remanei.
However it was replaced by Arginine (R) in position of 9 of AA sequences in Chrysopa
viridana. There is two codons for histidine (CAU and CAC), while the two codons of Arginine
are AGA and AGG. So there was a chance of occurrence of a point mutation which changed
histidine and replaced it with arginine. In position of sequence 30 in COI of Palpares solidus,
Chrysopa pallens, in position 39 in Creoleon remanei and position 13 in Chrysopa viridana we
saw histidine (H) replaced by glutamine (Q) in Deleproctophylla variegata and as the two first
letters of two codons for Histidine and glutamine are similar and are CA, but the third letter are
different, so there was a possibility that U or C as the third letters of the codons for histidine
have had a mutation which changed them to A or G. Glutamic acid in position 36 of sequences
of amino acids in Deleproctophylla variegata and in position 45 of sequence of amino acids in
Creoleon remanei and in position 19 of sequences of amino acids in Chrysopa viridana was
replaced by Glycine (G) in position 36 of sequences of amino acids in Palpares solidus and
Chrysopa pallens. As in this case the two codons for glutamic acid (GAA and GAG) and the
four codons for glycine (GGU, GGC, GGA and GGG) and as the first letter of the codons for

A.MIRMOAYEDI et al.: GENETIC RELATIONSHIP BETWEEN NEUROPTERAN FAMILIES 723
both amino acids are similar, so there was a chance of mutation that the second letter (A) in two
codons of glutamic acid was changed to (G) in four codons of glycine.
Simultaneously the third codon (A) in GAA for glutamic acid probably had a mutation
and was changed to U,C,G in glycine and (G) in the third codon of GAG for glutamic acid was
changed to A, C and U in codons which code glycine.
Fig 2. Percentage of pairwise identical sequences of aminoacids of part of chain of polypeptides in COI in
five species of Neuroptera
We have used pair alignment of DNA nucleotides of a section of COI genes for
comparison between studied Neuroptera species. We observed that in species Palpares solidus
(M1), Chrysopa pallens (C2), Chrysopa viridana (C1), Creoleon remanei (M2), Deleproctophylla
variegata (A1), the sequences of their mitochondrial COI genes have many totally conserved
parts (Fig.1), the sequences of 60 nucleotides (694-753) of Palpares solidus (M1) and Chrysopa
pallens (C2) were compared. There were 100 % (maximum genetic similarity) between them.
The sequences of 60 nucleotides between 643 and 702 of a part of mtDNA genes coding for
COI in Japanese Chrysopa viridana sequenced by Haruyama et.al., (2008) were compared with
the same sequences of our specimens of Chrysopa viridana COI nucleotides collected from
Dezful in Khuzestan, Iran. Those sequences are as follows:

724 GENETIKA, Vol. 50, No2, 717-730, 2018
Dezful:
643:TTTGTACGAGTGCTATTCTTCTTCTTCATCGTATGAGAAAGAATGGTCTCTAAGC
GCATA:672
Japan:
643:GTATTAAGGTATTTAGTTGATTAGCTACTCTTCATGGTACTCAATTTACTTATAG
ACCTGCT 672
There were 15 identical nucleotides between sixty nucleotides compared. In other words 25% of
them were similar, or we can say 75% of genetic diversity existed between two populations of
Iranian and Japanese Chrysopa viridana concerning the compared sequences The COI gene is an
organelles (mitochondria) gene, some of the nuclear (non organelles) genes are located in
nucleus but their product is collected in the organelles. (e. g. the aroA gene in plants and
bacteria) (MOTAMEDI et al., 2011).
Table 2. Certain nucleotide sequences and names of twenty two species of Chrysopidae family accessed
from NCBI compared with five species of Neuroptera used by us in our study.
Accession numbers
Family name
Species name
AB671795
Chrysopidae
Chrysoperla carnea
AB671779
Chrysopidae
Chrysoperla adamsi
AB671786
Chrysopidae
Chrysoperla agilis
AB671811
Chrysopidae
Chrysoperla johnsoni
AB671823
Chrysopidae
Chrysoperla mediterranea
AB671825
Chrysopidae
Chrysoperla Mohave
AB671837
Chrysopidae
Chrysoperla pallida
AB671841
Chrysopidae
Chrysoperla plorabunda
AB671845
Chrysopidae
Chrysoperla pudica
AB671851
Chrysopidae
Chrysoperla rufilabris
AB671853
Chrysopidae
Chrysoperla zastrowi sillemi
AB354054
Chrysopidae
Chrysopa Formosa
AB671815
Chrysopidae
Chrysoperla lucasina
AB671830
Chrysopidae
Chrysoperla nipponensis
AB354056
Chrysopidae
Chrysopa lezeyi
AB354058
Chrysopidae
Chrysopa nigra
AB354059
Chrysopidae
Chrysopa pallens
AB354062
Chrysopidae
Chrysopa viridana
DQ414489
Chrysopidae
Chrysopa excepta
DQ 414495
Chrysopidae
Dictyochrysa petereseni
DQ414485
Chrysopidae
Calochrysa extranea
DQ414503
Chrysopidae
Leucochrysa lancola
Certain nucleotides sequences of mitochondrial COI gene of twenty two species of
Chrysopidae was downloaded from NCBI and compared with the nucleotide sequences of
mtCOI of five species of Neuroptera species used in current study (Table 2), and maximum
similarity or divergence between them in (Table 3).

A.MIRMOAYEDI et al.: GENETIC RELATIONSHIP BETWEEN NEUROPTERAN FAMILIES 725
Table 3. Percent of identity and divergence between nucleotides of certain parts of DNA of COI gene of 27
species of Neuroptera. The nucleotides sequences of five species of Neuroptera (A1, C1, C2, M1,
M2) are those studied by us, the rest were accessed from NCBI. Red circles denote percent of
maximum similarity of nucleotides of some species of Neuropteran studied by us and discussed in
the main text.
Fig. 3. Nucleotides sequences of COI gene of five species

726 GENETIKA, Vol. 50, No2, 717-730, 2018
For this purpose a leading horizontal line representing similar sequences of majority of
nucleotides was drawn in upper side of the Fig. 3, beginning with sequence 721and ending to
sequence 750.
As sequences of nucleotides 343-372 for mtCOI gene of eleven species of Chrysopidae
family (Chrysoperla carnea, Chrysoperla adamsi, Chrysoperla agilis, Chrysoperla johnsoni,
Chrysoperla mediterranea, Chrysoperla mohave, Chrysoperla pallida, Chrysoperla plorabunda,
Chrysoperla pudica , Chrysoperla rufilabris and Calochrysa extranea ) were proved to be
identical, so they should be used for any design of primers for Chrysopidae family in the future
researches comparing the evolution of nucleotide changes of mtCOI genes of species belonging
to this family.
We have marked as red circles in the Table 3 the maximum percentage of genetic
similarity between nucleotides of Neuropteran species. So, we have shown that there were 96.3%
of genetic similarities between nucleotides of gene of COI in Chrysopa pallens (C2) and
Chrysopa viridana (C1), 98.2% of genetic similarities between nucleotides of gene of COI of
Palpares solidus (M1) and Chrysopa pallens (C2).
While between nucleotides of COI genes of Deleproctophylla variegata (A1) and
Palpares solidus (M1) there was only 84.2% of genetic similarities. Besides there were 81.8% of
genetic similarities between Chrysoperla viridana COI gene nucleotides with accession number
(AB354062) accessed from NCBI and Palpares solidus (M1). However between nucleotides of
COI gene of Creoleon remanei (M2) and Chrysopa nigra (AB354058) there were 82.6% of
genetic similarities. Although there were 98.2% of genetic similarities between COI of Palpares
solidus (M1), Chrysopa pallens (C2), 96.1% of genetic similarities between COI of Chrysopa
pallens (C2), Chrysopa viridana (C1) and 82.9% of genetic similarities between COI of
Deleproctophylla variegata (A1) and Palpares solidus (M1) (Table 1). Cluster analysis made for
our obtained data shows that between the five species of Neuropteran the maximum of genetic
similarities were seen between Palpares solidus (M1) and Chrysopa pallens (C2)( Fig.4),.
Fig. 4. Cluster analysis of pairwise alignment of proteins of certain parts of mitochondrial
COI in five species of Neuroptera.

A.MIRMOAYEDI et al.: GENETIC RELATIONSHIP BETWEEN NEUROPTERAN FAMILIES 727
In (Table 4), percent of relative ratio of four nucleotide bases could be seen in five
Neuropteran species in a part of genome of mtCOI. The ratio of thymine bases to cytosine bases
in nucleotides of five Neuropteran species based on sequences of DNA nucleotides of a part of
genome of COI was the maximum and equal to 112, while the ratio observed between Cytosine
bases to guanine bases was the minimum and equal to 6.
Table 4. Percent of relative ratio between bases of nucleotides in five Neuropteran Species based on
sequences of DNA nucleotides of a part of genome of COI.
A
C
G
T
A
46
43
110
C
46
6
112
G
43
6
11
T
110
112
11
Received, April 24th, 2017
Accepted February 18th, 2018
REFERENCES
ARMINIAN, A., D., KAHRIZI, A., MASOOMIASL (2012): In vitro Plant Breeding. Razi University Press (In Farsi),1-150.
BROOKS, S.J. (1997): An Overview of the Current Status of Chrysopidae (Neuroptera) Systematics. Deut. Entomol. Z.,
44: 267-275.
BROOKS, S.J., P.C., BARNARD (1990):The green lacewings of the world: a generic review (Neuroptera: Chrysopidae),
Bull.Br.Mus.Nat.Hist.Zool., 9: 1-286.
CHANGBUNJONG,T., B., BHUSRI., P., SEDWISAI.,T., WELUWANARAK., E., NITIYAMATAWAT,T., CHAREONVIRIYAPHAP,J.,
RUANGSITTICHAI (2018): Species identification of horse flies (Diptera: Tabanidae) in Thailand using DNA
barcoding, Vet. Parasitol., 259:35-43.
DEVETAK, D., B., MENCINGER-VRAČKO, A., ŠPERNJAK, M., DEVETAK (2005[2007]).Capture success in cap building ant-
lion Euroleon nostras(Geoffroy in Fourcroy,1785) (Neuroptera,Myrmeleontidae) depends on pits, sand particle
size and transmission of vibratory signals: a mini-review.Ann.Mus.Civ.St.Nat.Ferrara.,8:161-165.
FARAHI,S., H., SADEGHI, E.,WHITTINGTON ( 2009): Lacewings (Neuroptera: Chrysopidae & Hemerobiidae) from north
Eastern and East provinces of Iran. . Mun.Entomol. Zool., 4: 501-509.
GADELHAK, G.G., M.R., ENAN (2005): Genetic diversity among populations of red palm weevil, Rhynchophorus
ferrugineus Olivier (Coleoptera: Curculionidae), determined by random amplified polymorphic DNA

728 GENETIKA, Vol. 50, No2, 717-730, 2018
polymerase chain reaction (RAPD-PCR). Int. J. Agri. Biol., 7: 395–399.
GHAHARI, H., A., SATAR, F., ANDERLE, M.,TABARI., M., HAVASKARY, H., OSTAVAN (2010): Lacewings (Insecta:Neuroptera)
of Iranian rice fields and surrounding grasslands.Mun. Entomol. Zool., 5: 65-72.
HARUYAMA, N., H., NAKA, A., MOCHIZUKI (2008): Mitochondrial phylogeny of cryptic species of the lacewing
Chrysoperla nipponensis (Neuroptera: Chrysopidae) in Japan. Ann. Entomol. Soc. of Am., 101: 971-977.
HUELSENBECK, J.P., F., RONQUIST, R., NIELSEN,J.P., BOLLBACK (2001): Bayesian inference of phylogeny and its impact on
evolutionary biology. Science ., 294 (5550): 2310-2314.
KRIVOKHATSKY,V.A. (2011): Antlions (Neuroptera: Myrmeleontidae) of Russia (in Russian): St.Petersburg-Moscow:
KMK Scientific Press.
LI, G., C.F., QUIROS (2001): Sequence-related amplified polymorphism (SRAP), a new marker system based on a simple
PCR reaction: its application to mapping and gene tagging in Brassica. TAG, 103: 455-461.
MIRMOAYEDI, A. (2003a): Forty years of studies by Iranian entomologists on the Chrysopidae fauna of Iran (1961-2000)
(Insecta, Neuroptera). Zool. Mid. East ., 26: 157-162.
MIRMOAYEDI, A. (2003b):Description of the third stage larvae of Cueta lineosa (Rambur,
1842)(Neuroptera;Myrmeleontidae) rearing for the first time in Iran. Kharkov. Entomol. Soc. Gazz.,10 (1-2):
122-123.
MIRMOAYEDI, A. (2006):New Records of some of Iranian Antlions (Insecta, Neuropterida, Neuroptera,Myrmeleontidae).
Iran. J Anim. Biosyst., 2: 47-55.
MIRMOAYEDI, A., D.,KAHRIZI, A.A., EBADI, K., YARI, M., MOHAMMADI (2012): Study of individual and sex genetic
diversity among each genus and between two genera of Chrysopa and
Chrysoperla (Neuroptera, Chrysopidae) based on RAPD-PCR polymorphism. Mol. Biol. Rep., 39: 8999-9006.
MIRMOAYEDI, A., D.KAHRIZI, S., PANI, K.,YARI (2013):Molecular genetic diversity within Myrmeleontidae family. Mol.
Biol. Rep., 40:639–643.
MOCHIZUKI, A., H., NAKA, K., HAMASAKI, T., MITSUNAGA(2006): Larval Cannibalism and Intraguild Predation Between
the Introduced green lacewing, Chrysoperla carnea, and the Indigenous Trash-Carrying Green Lacewing,
Mallada desjardinsi (Neuroptera:Chrysopidae), as a Case Study of Potential Nontarget Effect Assessment.
Envir. Entomol. 35(5): 1298 -1303.
MOTAMEDI, J., A., ZEBARJADI, D., KAHRIZI, A.H., SALMANIAN (2011): In vitro propagation and Agrobacterium-mediated
transformation of safflower (Carthamus tinctorius L.) using a bacterial mutated aroA gene. Aust. J. Crop. Sci.,
4(5): 479-486.
MURRAY, M., W.F., THOMPSON (1980): Rapid isolation of high molecular weight plant DNA. Nucleic. Acids. Res., 8:
4321-4326.
NEI, M., S., KUMAR (2000): Molecular Evolution and Phylogenetics:U.K. Oxford University Press.
PENTINSAARI, M., H., SALMELA, M., MUTANEN, T.,ROSLIN (2016):Molecular evolution of a widely-adopted taxonomic
marker (COI) across the animal tree of life. Sci. Rep, 6: 35275.
PHILLIPS, A.J., C., SIMON (1995): Simple, efficient, and nondestructive DNA extraction protocol for arthropods. Ann.
Entomol. Soc. Am., 88: 281-283.
RAHIMI,A., A., MIRMOAYEDI, D., KAHRIZI, R., ABDOLSHAHI, E., KAZEMI, K., YARI (2014) . Microsatellite genetic diversity
of Apis mellifera meda Skorikov. Mol. Biol. Rep., 41: 7755-7761.
RAHIMI, A., A., MIRMOAYEDI, D., KAHRIZI, L., ZREI, S., JAMALI (2016): Genetic diversity of Iranian honey bee (Apis
mellifera meda Skorikow, 1829) populations based on ISSR markers. Cell. Mol. Biol., 62(4):53-58
RIDDICK, E.W.( 2017)Identification of Conditions for Successful Aphid Control by Ladybirds in
Greenhouses.Insects.,8(38):1-17.

A.MIRMOAYEDI et al.: GENETIC RELATIONSHIP BETWEEN NEUROPTERAN FAMILIES 729
SATAR, S., A., RASPI, I., ÖZDEMIR, A., TUSUN, M., KARACAOĞLU, G., BENELLI (2015): Seasonal habits of predation and prey
range in aphidophagous silver flies (Diptera Chamaemyiidae), an overlooked family of biological control agents,
Bull.Insectology., 68 (2): 173-180.
TAKEZAKI, N., A., RZHETSKY, M., NEI (1995): Phylogenetic test of the molecular clock and linearized trees. Mol.
Biol.Evol., 12: 823-833.
WANG, J-F., L-Y., JIANG, G-X., QIAO (2011): Use of a mitochondrial COI sequence to Identify species of the subtribe
Aphidina (Hemiptera, Aphididae). ZooKeys., 122: 1–17.
WILLIAMS, J.G.K., A., R., KUBELI, K.J., LIVAK, J., ANTONI RAFALSKI, S.V., TINGEY (1990): DNA polymorphisms amplified
by arbitrary primers are useful as genetic markers. Nucleic. Acids. Res., 18: 6531-6535.
ZHANG, Z.Q. (2003): Mites of greenhouses: identification, biology and control. London, CABI.

730 GENETIKA, Vol. 50, No2, 717-730, 2018
GENETIČKI ODNOS IZMEĐU FAMILIJA NEUROPTERA (INSECTA,
NEUROPTERIDA, NEUROPTERA) NA OSNOVU SEKVENCI CITOCHROM
OKSIDASE-I
Alinaghi MIRMOAYEDI1*, Fatemeh RASHIDIKHAH1, Danial KAHRIZI2,4
Kheirullah YARI3,4
Department za zaštitu bilja, Razi Univerzitet, Kermanshah, Iran
Department za agronomiju i oplemenjivanje, Razi Univerzitet, Kermanshah, Iran
Medicinski biološki istraživački centar, Kermanshah Univerzitet medicine, Kermanshah, Iran.
Zagros Bioidea kompanija, Razi Univezitet,Kermanshah, Iran
Izvod
Proučavani uzorci pripadali su vrstama iz tri familije Chrisopidae, Mirmeleontidae i
Ascalaphidae (reda Neuroptera). Prikupljeni su u Šuši i Dezfulu, u južnom Iranu. Ovi insekti su
korisni u biološkoj kontroli kao važni predatori apsida, psilida, gusenica, mrava i drugih
insekata. Urađeno je upoređivanje sekvenci delova gena citohrom oksidaze-I (COI) ovih vrsta.
Tela insekta su bila u potpunosti usitnjena u mikrotube. PCR proizvodi COI su sekvencirani.
Poravnavanje parova nukleotidnih sekvenci koje pripadaju ispitivanim vrstama Neuroptera
izvršeno je korišenjem softverskih programa MegAlign i EditSek. Rezultat sekvenciranja
Palpares solidus i Creoleon remanei su pokazali potencijalne mutacije na lokacijama 699, 702,
726, 735 i 750 COI gena mtDNA. Prema sekvencama COI gena, Chrisopa palen i Palpares
solidus su pokazali maksimalnu genetičku sličnost (98,2%). Postojala je minimalna genetička
sličnost (75,9%) između vrste Chrisopa viridana i Creoleon remanei. Primljeno 24.IV.2017.
Odobreno 18. II. 2018.