An integrative redescription of the nominal taxon for the Mesobiotus harmsworthi group (Tardigrada: Macrobiotidae) leads to descriptions of two new Mesobiotus species from Arctic

Abstract

The Mesobiotus harmsworthi group has a global distribution, with localities in polar, temperate and tropical zones. Since the first species of the harmsworthi group was described in the beginning of the 20th century, tens of new species within the group were found and named. However, the diagnosis of the nominal Mesobiotus harmsworthi is insufficient and enigmatic, thus it can be is a serious obstacle in solving the taxonomy of this group. Here, we integratively redescribe the nominal species for the genus Mesobiotus, i.e., Mesobiotus harmsworthi and clarify taxonomic statuses of the two subspecies: M. harmsworthi harmsworthi and M. harmsworthi obscurus that have been recognised as distinct taxa for more than three decades. Traditionally, egg chorion in M. harmsworthi was considered almost smooth and without any traces of areolation, however here we report many misunderstandings that accumulated across decades and we show that, in fact, the chorion in this species exhibits a partially developed areolation. We present an integrative (morphological, morphometric and molecular) diagnosis of the nominal taxon and we confirm that it differs from other species of the harmsworthi group by morphological characters of both animals and eggs. Additionally, we describe two new species of the genus Mesobiotus: M. skorackii sp. nov. from the Kyrgyz Republic (using classical morphological description) and M. occultatus sp. nov. from Svalbard Archipelago (by means of integrative taxonomy). Finally, we also provide the first genetic phylogeny of the genus Mesobiotus based on COI sequences which, together with molecular species delimitation, independently confirms the validity of the analysed taxa.

Full text

RESEARCH ARTICLE
An integrative redescription of the nominal
taxon for the Mesobiotus harmsworthi group
(Tardigrada: Macrobiotidae) leads to
descriptions of two new Mesobiotus species
from Arctic
Łukasz KaczmarekID
1
*, Krzysztof Zawierucha
1
, Jakub Buda
1
, Daniel Stec
2
,
Magdalena Gawlak
3
, Łukasz MichalczykID
2
, Milena Roszkowska
1,4
1Department of Animal Taxonomy and Ecology, Faculty of Biology, Adam Mickiewicz University, Poznań,
Poznań, Poland, 2Department of Entomology, Institute of Zoology and Biomedical Research, Jagiellonian
University, Krako
´w, Poland, 3The Institute of Plant Protection-National Research Institute, Poznań, Poland,
4Department of Bioenergetics, Faculty of Biology, Adam Mickiewicz University, Poznań, Poznań, Poland
*kaczmar@amu.edu.pl
Abstract
The Mesobiotus harmsworthi group has a global distribution, with localities in polar, temper-
ate and tropical zones. Since the first species of the harmsworthi group was described in the
beginning of the 20
th
century, tens of new species within the group were found and named.
However, the diagnosis of the nominal Mesobiotus harmsworthi is insufficient and enig-
matic, thus it can be is a serious obstacle in solving the taxonomy of this group. Here, we
integratively redescribe the nominal species for the genus Mesobiotus,i.e., Mesobiotus
harmsworthi and clarify taxonomic statuses of the two subspecies: M.harmsworthi harms-
worthi and M.harmsworthi obscurus that have been recognised as distinct taxa for more
than three decades. Traditionally, egg chorion in M.harmsworthi was considered almost
smooth and without any traces of areolation, however here we report many misunderstand-
ings that accumulated across decades and we show that, in fact, the chorion in this species
exhibits a partially developed areolation. We present an integrative (morphological, morpho-
metric and molecular) diagnosis of the nominal taxon and we confirm that it differs from
other species of the harmsworthi group by morphological characters of both animals and
eggs. Additionally, we describe two new species of the genus Mesobiotus:M.skorackii sp.
nov. from the Kyrgyz Republic (using classical morphological description) and M.occultatus
sp. nov. from Svalbard Archipelago (by means of integrative taxonomy). Finally, we also
provide the first genetic phylogeny of the genus Mesobiotus based on COI sequences
which, together with molecular species delimitation, independently confirms the validity of
the analysed taxa.
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 1 / 43
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Kaczmarek Ł, Zawierucha K, Buda J, Stec
D, Gawlak M, Michalczyk Ł, et al. (2018) An
integrative redescription of the nominal taxon for
the Mesobiotus harmsworthi group (Tardigrada:
Macrobiotidae) leads to descriptions of two new
Mesobiotus species from Arctic. PLoS ONE 13(10):
e0204756. https://doi.org/10.1371/journal.
pone.0204756
Editor: Marcos Rubal, Ciimar, PORTUGAL
Received: April 25, 2018
Accepted: September 12, 2018
Published: October 17, 2018
Copyright: ©2018 Kaczmarek et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information
files.
Funding: Sampling in Svalbard in 2013 was
supported by the Polish Ministry of Science and
Higher Education via the Diamond Grant
programme (grant no. DIA 2011035241 to KZ).
The study was supported by the Polish Ministry of
Science and Higher Education via the Iuventus Plus

Introduction
The phylum Tardigrada comprises over 1,200 species [1,2,3] that inhabit both aquatic (fresh-
water, brackish, marine) and terrestrial environments throughout the world, from the deepest
seas to the highest mountain peaks [4,5,6,7]. Tardigrades have been investigated for over two
hundred years, but because of old descriptions and insufficient morphometric data, many spe-
cies currently need revision and redescription, especially those representing nominal taxa for
cosmopolitan groups or genera. One of such taxa is Mesobiotus Vecchi, Cesari, Bertolani, Jo¨ns-
son, Rebecchi & Guidetti, 2016 [8], a cosmopolitan genus comprising ca. 40 known species
that inhabit plants, lichens and soil and are considered carnivorous and/or omnivorous [8].
The genus Mesobiotus is divided into two species groups: the harmsworthi and the furciger
group, classified within the genus Macrobiotus C.A.S. Schultze, 1834 [9] prior to the erection
of Mesobiotus. Species of the harmsworthi group are characterised by three clearly separated
macroplacoids in the shape of short, rounded rods and a distinct microplacoid situated very
close to them, as well as by conical or hemispherical egg processes [10]. Mesobiotus harms-
worthi (Murray, 1907) [11], the nominal species for the harmsworthi group, was described by
Murray [11] as Macrobiotus harmsworthi. Since the original description, the problem with the
exact characteristics of the species was addressed several times by different authors (e.g. [4,12,
13]). Moreover, descriptions of two M.harmsworthi subspecies, M.harmsworthi coronatus (de
Barros, 1942) [14] and M.harmsworthi obscurus (Dastych, 1985) [15], did complicate the tax-
onomy of this group even further. The first subspecies was later elevated to the species level by
Pilato et al. [13], whereas the second is considered valid as a subspecies. Although problems
with the taxonomy of the nominal species were broadly discussed in literature, a formal rede-
scription of M.h.harmsworthi, based on type material or material from the type locality, has
not been published. The only attempt to characterise M.h.harmsworthi in more detail was
made by Pilato et al. [13]. However, the work was based solely on light microscope observa-
tions, thus some fine morphological details, that are below light microscope resolution, could
remain unknown. Also, molecular markers, that are necessary for the accurate characterisation
of the species and for the detection of potential cryptic species, are not available. Furthermore,
in addition to specimens from loci typici (Spitsbergen and Shetlands), Pilato et al. [13] pooled
and analysed together individuals and eggs from Italy and France. Thus, without DNA
sequences, it is not possible to verify whether all specimens constituted a single or multiple
cryptic or pseudocryptic species.
Therefore, in order to clarify the taxonomy of the harmsworthi group, we integratively rede-
scribe M.h.harmsworthi based on typical material of M.h.obscurus (which is now, in fact, a
synonym of M.h.harmsworthi s.s.; for more details see Results and Discussion sections below)
and we additionally describe two new species of the harmsworthi group: M.occultatus sp. nov.
from Spitsbergen and M.skorackii sp. nov. from the Kyrgyz Republic. Our study involved an
integrative taxonomy approach by combing morphological and morphometric data from
phase contrast light microscopy (PCM) and molecular data in form of DNA sequences of four
molecular markers (nuclear: 18S rRNA, 28S rRNA, ITS-2 and mitochondrial: COI). Finally,
we provide the first COI phylogeny of the genus Mesobiotus.
Material and methods
Sample processing
Moss and lichen samples with M.h.harmsworthi,M.occultatus sp. nov. and M.skorackii sp.
nov. were collected by ŁK and KZ during scientific expeditions to the Kyrgyz Republic in July
2002, to Spitsbergen in June–July 2010, August 2011 and to Spitsbergen and Sjuøyane
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 2 / 43
programme (grant no. IP2014 017973 to ŁK and
ŁM).
Competing interests: The authors have declared
that no competing interests exist.

(Phippsøya) in 2013 (Table 1). All samples were air-dried in paper envelopes and delivered to
the laboratory at the Faculty of Biology, Adam Mickiewicz University in Poznań. Tardigrades
were extracted, mounted on microscope slides in Hoyer’s medium and studied following the
protocol by Dastych [16] with modifications by Stec et al. [17]. Additionally, two unidentified
Mesobiotus species, one of the furciger group collected from continental Norway (Lyngen Alps,
moraine of Steindalen glacier; 69˚23’44.04"N, 19˚55’0.84"E) and the other of the harmsworthi
group collected from Russia (Irkuck; 52˚16’42.3’’N, 104˚17’22.1’’E), were extracted from moss
samples and then used in phylogenetic analysis.
Microscopy and imaging
All measurements and photomicrographs were taken using an Olympus BX41 phase contrast
microscope (PCM) associated with an ARTCAM-300Mi digital camera (Olympus Corpora-
tion, Shinjuku-ku, Japan). In order to obtain clean and fully extended material for SEM, ani-
mals and eggs were processed according to Roszkowska et al. [18]. In brief, specimens were
first heated to ca. 70˚C in distilled water in order to obtain stretched animals, then rinsed sev-
eral times with ddH
2
O, then subjected to a water/ethanol series (from 0% to 100% ethanol,
with 10% increments), then to one ethanol/acetone series (100% ethanol and 100% acetone in
1:1 proportion), and at the end three times rinsed with 100% acetone. The material was trans-
ferred between solutions in small cages made of a short plastic tube closed at the ends with fine
plastic mesh (Ø40 μm). The dehydrated specimens and eggs were then dried at the CO
2
criti-
cal point, transferred with an eyebrow hair mounted on a wooden stick onto a SEM stub cov-
ered with double-sided conductive tape, and sputter coated with a thin layer of gold.
Specimens were examined under high vacuum in a Hitachi S3000N Scanning Electron Micro-
scope at the Institute of Plant Protection in Poznań.
All figures were assembled in Corel Photo-Paint 9. For deep structures that could not be
fully focused in a single photograph, a series of 2–10 images were taken and then assembled
into a single deep-focus image manually in Corel Photo-Paint 9.
Morphometrics and morphological nomenclature
All measurements, made with the QuickPhoto Camera 2.3 software, are given in micrometres
[μm]. Structures were measured only if their orientation was suitable. Body length was mea-
sured from the anterior extremity to the end of the body, excluding the hind legs. The types of
bucco-pharyngeal apparatuses and claws were classified according to Pilato & Binda [19] and
Vecchi et al. [8]. The terminology used to describe oral cavity armature, and used in differen-
tial diagnoses, follows Michalczyk & Kaczmarek [20]. Buccal tube length and the level of the
stylet support insertion point were measured according to Pilato [21]. Other buccal apparatus
traits and claws were measured according to Kaczmarek & Michalczyk [22]. Macroplacoid
length sequence is given according to Kaczmarek et al. [23]. The pt ratio is the ratio of the
length of a given structure to the length of the buccal tube expressed as a percentage [21]. Dis-
tance between egg processes was measured as the shortest line connecting base edges of the
Table 1. The list of Mesobiotus specimens from Svalbard archipelago genotyped for the phylogenetic analysis with their collection details (numbers in brackets indi-
cate number of sequences and number of studied specimens).
Species (No of specimens) Coordinates Locality Sample details DNA marker (No of sequences)
M.harmsworthi s.s.(4) 77˚00’47’’N; 15˚31’12’’E Spitsbergen moss on rock, 300 m asl ITS-2 (2), COI (3), 28S rRNA(1), 18S rRNA (2)
M.harmsworthi s.s.(2) 80˚41’13’’N; 20˚50’40’’E Phippsøya moss on rock, 47 m asl COI (2)
M.occultatus sp. nov. (4) 77˚00’48’’N; 15˚33’ 05’’E Spitsbergen moss on rock, 11 m asl ITS-2 (3), COI (2), 18S rRNA (2)
https://doi.org/10.1371/journal.pone.0204756.t001
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 3 / 43

two closest processes [22]. Morphometric data were handled using the “Parachela” ver. 1.3
template available from the Tardigrada Register [24]. Tardigrade taxonomy follows Bertolani
et al. [25] and Vecchi et al. [8].
Comparative material
Paratypes of M.h.obscurus (for details see redescription of M.harmsworthi, below) were bor-
rowed from Zoological Museum of Hamburg University (ZMHU). A single specimen of M.
harmsworthi (labelled as: “Z.1921.144.169, Macro.harmsworthi, Ronas Top, Shetland”) from
the Murray collection was borrowed from the National Museum of Scotland in Edinburgh
(Fig 1). The species were identified based on the key in Kaczmarek et al. [10] and original
descriptions [13,14,15,26,27,28,29,30,31,32,33]. Additionally, holotypes and paratypes of
M.barbarae (Kaczmarek, Michalczyk & Degma, 2007 [32]), M.binieki (Kaczmarek, Gołdyn,
Prokop & Michalczyk, 2011 [10]), M.ethiopicus Stec & Kristensen, 2017 [34], M.insanis
Mapalo, Stec, Mirano-Bascos & Michalczyk, 2017 [35], M.philippinicus Mapalo, Stec, Mirano-
Bascos & Michalczyk, 2016 [36], M.pseudoblocki Roszkowska, Stec, Ciobanu & Kaczmarek,
2016 [37], M.pseudopatiens Kaczmarek & Roszkowska, 2016 [38], M.reinhardti (Michalczyk
& Kaczmarek, [20]), and M.szeptyckii (Kaczmarek & Michalczyk, [39]) were examined under
PCM.
Genotyping
For DNA isolation and sequencing, three individuals of M.harmsworthi and five individuals
of M.occultatus sp. nov. were used (Table 1). The list of individuals with their collection details
are provided in Table 2. The genomic DNA was extracted from single individuals according to
the protocol described in Dabert et al. [40], using Tissue Kit (Qiagen GmbH, Hilden, Ger-
many). In order to obtain tardigrade exoskeletons, a technique adopted by Zawierucha et al.
[41] was used. Specifically, individuals were digested for 48 hours (56˚C) in mixture of ATL
buffer, proteinase K in Eppendorf vials and then centrifuged at 6000 rpm. From each vial
90 μm of DNA extract was taken for further analyses by carefully removing this volume using
a half-automatic pipette. The remaining 10 μm of the DNA extract with the tardigrade exoskel-
eton was preserved in 96% ethanol. Then, exoskeletons were mounted in Hoyer’s medium for
PCM analyses.
Further molecular analyses involved the amplification and sequencing of four DNA mark-
ers, three nuclear (18S rRNA, 28S rRNA, ITS-2) and one mitochondrial (COI). The markers
differ in effective mutation rates: the first two are considered conservative whereas the last two
are more variable. The 18S rRNA together with 28S rRNA are often used for resolving relation-
ships at higher taxonomic levels such as families and genera (e.g. [25]) whereas COI and ITS-2
are appropriate for examining intraspecific and intrageneric genetic variation (e.g. [42,43,44,
45,46,47]).
Amplification of DNA fragments (PCR) for 18S rRNA and 28S rRNA was conducted in the
total volume of 5.5 μl including: 3 μl Type-it Microsatellite PCR Kit (Qiagen), 0.5 μl of each
primer, 0.5 μl Q-Solution (Qiagen) and 1 μl of the DNA template. For ITS-2 and COI a total
volume of PCR mix was 5 μl including: 3 μl Type-it Microsatellite PCR Kit (Qiagen), 0.5 μl of
each primer and 1 μl of the DNA template. Each PCR reactions proceeded in the following
steps: One cycle of 5 min. at 95˚C, followed by 40 steps of 30 s at 95˚C, 90 s at 50˚C, 1 min at
72˚C, and with a final elongation step of 5 min at 72˚C. After PCRs each products were diluted
by 5 μl MQ water. Separation of PCR products were carried out by 1% agarose gel electropho-
resis. Samples containing visible bands were purified with exonuclease I and Fast alkaline
phosphatase (Fermentas). The fragments were sequenced using the BigDye Terminator v3.1
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 4 / 43

Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 5 / 43

kit and the ABI Prism 3130xl Genetic Analyzer (Applied Biosystems), following manufacturer
instructions.
All four mentioned above molecular markers were sequenced for two additional Mesobiotus
species from Norway and Russia following the protocol by Stec et al. [17]. Only for 18S rRNA
and COI other primers were used: 18S_Tar_Ff1 with 18S_Tar_Rr1 and LCO1490 with
HCO2189, respectively (see Table 2 for details).
Comparative molecular analysis
For molecular comparisons, all published sequences of the four abovementioned markers for the
genus Mesobiotus were downloaded from GenBank (listed in Table 3). The sequences were
aligned using the default settings (for COI) and the Q-INS-I method (for ribosomal markers: 18S
rRNA, 28S rRNA and ITS-2) of MAFFT version 7 [48,49] and manually checked against non-
conservative alignments in BioEdit. Then, the aligned sequences were trimmed to: 721 (18S
rRNA), 751 (28S rRNA), 497 (ITS-2), 565 (COI) bp. All COI sequences were translated into pro-
tein sequences in MEGA7 version 7.0 [50] to check against pseudogenes. Genetic distances were
calculated using MEGA7 as suggested by Srivathsan & Meier [51], i.e., as uncorrected pairwise
distances instead of K2P distances. The matrices with calculated uncorrected p-genetic distances
for each of the analysed DNA fragment are provided as supplementary materials (S1 Table).
Phylogenetic and species delimitation analysis
To establish phyletic relationships of M.harmsworthi and M.occultatus sp. nov. and to molec-
ularly delineate the species, we constructed a phylogenetic tree based on all COI sequences for
the genus Mesobiotus available from GenBank (Table 3) together with sequences obtained in
the present study. The COI sequences were aligned using the default settings of MAFFT ver-
sion 7 [48,49]. The obtained alignment was edited and checked manually in BioEdit and then
trimmed to 565 bp. The COI sequence of Macrobiotus scoticus Stec, Morek, Gąsiorek, Blagden
& Michalczyk, 2017 [52] (GenBank accession number KY797267) and Macrobiotus shonaicus
Stec, Arakawa & Michalczyk, 2018 [53] (MG757136–7) were used as outgroups. Given that
Fig 1. Examined microscope slides: With “M.harmsworthi” from the Murray collection deposited at the National
Museum of Scotland in Edinburgh, and with paratypes of M.h.obscurusdeposited at the Zoological Museum of the
Hamburg University (ZMHU).
https://doi.org/10.1371/journal.pone.0204756.g001
Table 2. Primers and references for PCR programmes used for sequencing of DNA fragments.
DNA fragment Primer name Primer direction Primer sequence (5’-3’) Source Program
18S rRNA 18sFw Forward CTTGTCTCAAAGATTAAGCCATGCA [87] [88]
18srev930 Reverse GACGGTCCAAGAATTTCAC
18S_Tar_Ff1 Forward AGGCGAAACCGCGAATGGCTC [34]
18S_Tar_Rr1 Reverse GCCGCAGGCTCCACTCCTGG
28S rRNA 28sF0001 Forward ACCCVCYNAATTTAAGCATAT [89] [89]
28sR0990 Reverse CCTTGGTCCGTGTTTCAAGAC
ITS-2 ITS2_Eutar_Ff Forward CGTAACGTGAATTGCAGGAC [90] [90]
ITS2_Eutar_Rr Reverse TGATATGCTTAAGTTCAGCGG
COI bcdF01 Forward CATTTTCHACTAAYCATAARGATATTGG [87] [87]
bcdR04 Reverse TATAAACYTCDGGATGNCCAAAAAA
LCO1490 Forward GGTCAACAAATCATAAAGATATTGG [91] [85]
HCO2198 Reverse TAAACTTCAGGGTGACCAAAAAATCA
https://doi.org/10.1371/journal.pone.0204756.t002
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 6 / 43

COI is a protein coding gene, before partitioning, we divided our alignment into three data
blocks constituting separated three codon positions. Using PartitionFinder version 2.1.1 [54]
under the Bayesian Information Criterion (BIC), the best scheme of partitioning and substitu-
tion models were chosen for posterior phylogenetic analysis. We ran the analysis to test all pos-
sible models implemented in the program. As best-fit partitioning scheme, PartitionFinder
suggested to retain three predefined partitions separately. The best fit-models for these parti-
tions were: SYM+I+G for the first codon position, GTR+I for the second codon position and
TVM+I+G for the third codon position. Bayesian phylogenetic tree obtained from this data set
was highly polytomous, thus we used only for molecular species delimitation analysis with the
Table 3. Sequences used for molecular comparisons between the Mesobiotus species redescribed/described in this study and all other species of the genus Mesobio-
tus, for which homologous DNA sequences are currently available. The 18S rRNA sequence of M.insanis has not been used because of its shortness. The sequences with
underline GenBank accession numbers were included in the concatenated data matrix to construct the phylogenetic tree (Fig 18) whereas bolded numbers indicate new
sequences obtained in this study.
DNA marker Species Accession number Source
18S rRNA M.ethiopicus MF678793 [34]
M.philippinicus KX129793 [35]
M.hilariae Vecchi et al., 2016 [8] KT226068-71 [8]
M.polaris (Murray, 1910) KT226075-78 [8]
M.cf.mottai KT226072 [8]
M.harmsworthi group species KT226073-74 [8]
M.radiatus MH197153 [92]
M.romani Roszkowska et al., 2018 MH197158 [18]
M.furciger group species MH197148 this study
M.harmsworthi group species MH197149 this study
M.harmsworthi group species HQ604967-70 [25]
M.furciger (Murray, 1907) EU266927-28 [93]
28S rRNA M.ethiopicus Stec and Kristensen, 2017 MF678792 [34]
M.philippinicus Mapalo et al., 2016 KX129794 [36]
M.insanis Mapalo et al., 2017 MF441489 [35]
M.radiatus (Pilato et al., 1991) MH197152 [92]
M.romani Roszkowska et al., 2018 MH197151 [18]
M.furciger group species MH197265 this study
M.harmsworthi group species MH197266 this study
ITS-2 M.philippinicus Mapalo et al., 2016 KX129795 [36]
M.insanis Mapalo et al., 2017 MF441490 [35]
M.radiatus (Pilato et al., 1991) MH197267 [92]
M.romani Roszkowska et al., 2018 MH197150 [18]
M.furciger group species MH197156 this study
M.harmsworthi group species MH197157 this study
COI M.ethiopicus Stec and Kristensen, 2017 MF678794 [34]
M.philippinicus Mapalo et al., 2016 KX129796 [36]
M.insanis Mapalo et al., 2017 MF441491 [35]
M.hilariae Vecchi et al., 2016 KT226108 [8]
M.radiatus (Pilato et al., 1991) MH195147 [92]
M.romani Roszkowska et al., 2018 MH195149 [18]
M.furciger group species MH195153 this study
“M.harmsworthi” GU113140 unpublished
M.harmsworthi group species MH195154 this study
M.furciger (Murray, 1907) JX865306, JX865308, JX865314 [94]
https://doi.org/10.1371/journal.pone.0204756.t003
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 7 / 43

PTP method, which uses a non-ultrametric phylogenetic tree as the input data, based on which,
the switch from speciation to coalescent processes is modelled and then used to delineate spe-
cies [55]. For the purpose of the PTP analysis, we discarded the outgroup to protect against
eventual biases caused by the distant relationship between the outgroup and the ingroup taxa.
The calculations were conducted on the bPTP webserver (http://species.h-its.org/ptp), with
100,000 MCMC generations, thinning the set to 100, burning at 10% and performing search for
Maximum Likelihood and Bayesian solutions. Then, in order to reduce polytomy and search
for more resolved relationships, we concatenated the COI data set with three nuclear markers,
18S rRNA, 28S rRNA and ITS-2, using SequenceMatrix [56]. Since the molecular data on the
genus Mesobiotus are limited not all taxa have been represented in all added data sets (see
Table 3 for details). Before concatenation, we aligned sequences of each nuclear marker using
the Q-INS-I method of MAFFT version 7, which considers the secondary structure of ribosomal
genes [48,49]. Next, we manually checked against non-conservative alignments in BioEdit. The
aligned sequences were trimmed to: 721 (18S rRNA), 751 (28S rRNA) and 497 (ITS-2). Before
partitioning, we divided our alignment into 6 data blocks constituting three separate blocks of
ribosomal markers and three separate blocks of three codon positions in COI data set. Using
PartitionFinder under the Bayesian Information Criterion (BIC), the best scheme of partition-
ing and substitution models were chosen for posterior phylogenetic analysis. We ran the analy-
sis to test all possible models implemented in the program. As best-fit partitioning scheme,
PartitionFinder suggested to retain six predefined partitions separately. The best fit-models for
these partitions were: K80+G for 18S rRNA, SYM+G for 28S rRNA, K80+G for ITS-2, GTR+I
+G for the first and the third codon position, and HKY+G for the second codon position.
Bayesian inference (BI) marginal posterior probabilities were calculated for both the COI
and the concatenated (COI+18S rRNA+28S rRNA+ITS-2) data set using MrBayes v3.2 [57].
Random starting trees were used and the analysis was run for ten million generations, sam-
pling the Markov chain every 1000 generations. An average standard deviation of split fre-
quencies of <0.01 was used as a guide to ensure the two independent analyses had converged.
The program Tracer v1.6 [58] was then used to ensure Markov chains had reached stationarity,
and to determine the correct ‘burn-in’ for the analysis which was the first 10% of generations.
The ESS values were greater than 200 and the consensus tree was obtained after summarising
the resulting topologies and discarding the ‘burn-in’. The consensus tree was viewed and visu-
alised by FigTree v.1.4.3 available from http://tree.bio.ed.ac.uk/software/figtree.
Nomenclatural acts
The electronic edition of this article conforms to the requirements of the amended Interna-
tional Code of Zoological Nomenclature, and hence the new names contained herein are avail-
able under that Code from the electronic edition of this article. This published work and the
nomenclatural acts it contains have been registered in ZooBank, the online registration system
for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be resolved and the associated
information viewed through any standard web browser by appending the LSID to the prefix
"http://zoobank.org/". The LSID for this publication is: urn:lsid:zoobank.org:pub:86D87D80-
5398-4D89-9767-C8E2A160ADFE. The electronic edition of this work was published in a
journal with an ISSN, and has been archived and is available from the following digital reposi-
tories: PubMed Central, LOCKSS.
Results
Taxonomic account
Phylum: Tardigrada Doyère, 1840 [59]
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 8 / 43

Class: Eutardigrada Richters, 1926 [60]
Order: Parachela Schuster, Nelson, Grigarick & Christenberry, 1980 [61]
Superfamily: Macrobiotoidea Thulin, 1928 [62] (in Marley et al. 2011) [63]
Family: Macrobiotidae Thulin, 1928 [62]
Genus: Mesobiotus Vecchi, Cesari, Bertolani, Jo¨nsson, Rebecchi & Guidetti, 2016 [8]
Mesobiotus harmsworthi (Murray, 1907) [11]
M.harmsworthi, sp. n. [11]
Macrobiotus harmsworthi obscurus ssp. nov. [15]
Macrobiotus harmsworthi obscurus Dastych, 1985 [64]
(Figs 2–7and 18; Tables 4and 5)
Material examined
Type material (original slide labelling): 50 paratypes (41 animals and 9 eggs) of Macrobiotus
harmsworthi obscurus ssp. nov. [15]): (1) Spitsb. 150, Vest Spitsbergen, Sto¨rmerfjellet Mt,
1295m, Sept. 1977, lg. H. Dastych, Eing.Nr.A71/93 (16 animals); (2) Spitsb. 152, Vest Spitsber-
gen, Sto¨rmerfjellet Mt, 1295m, Sept. 1977, lg. H. Dastych, Eing.Nr.A71/93 (23a and 7e); (3)
Spits. 153, Vest Spitsbergen, Sto¨rmerfjellet Mt, 1295m, Sept. 1977, lg. H. Dastych, Eing.Nr.
A71/93 (1a and 1e); (4) Spits. 154, Vest Spitsbergen, Sto¨rmerfjellet Mt, 1295m, Sept. 1977, lg.
H. Dastych, Eing.Nr.A71/93 (1a and 1e). At present these specimens should be considered as
the neotype series.
Additional material: I) Spitsbergen, Hornsund, Revdalen:1) 77˚01’39’’N, 15˚22’47’’E, 76
m asl, moss on rock, northern part of the Revdalen, near the Revvatnet and the Revelva (4 ani-
mals and 2 eggs); 2) 77˚01’34’’N, 15˚23’12’’E, 76 m asl, moss on rock, northern part of the
Revdalen, near the Revvatnet and the Revelva (4a and 9e); 3) 77˚01’09’’N, 15˚24’34’’E, 50 m
asl, moss on rock, northern part of the Revdalen, near the Revvatnet (southern edge) and the
Revelva (9a and 1e) [65]; II) Spitsbergen, Hornsund, Ariekammen: 1) 77˚01’10’’N, 15˚
31’16’’E, 524 m asl, moss on rock (16a and 6e); 2) 77˚01’04’’N, 15˚31’11’’E, 450 m asl, moss on
rock (5a and 1e); 3) 77˚00’58’’N, 15˚31’10’’E, 400 m asl, moss on rock (1a); 4) 77˚00’48’’N, 15˚
30’58’’E, 350 m asl, moss on rock, (2a), 5) 77˚00’47’’N, 15˚31’12’’E, 300 m asl, lichen on rock,
moss on rock (30a and 12e), 6) 77˚00’43’’N, 15˚31’16’’E, 250 m asl, moss on rock (4a and 5e);
7) 77˚00’36’’N, 15˚31’10’’E, 150 m asl, moss on rock, (9a and 1e), 8) 77˚00’31’’N, 15˚31’43’’E,
50 m asl, moss on rock, (6a and 8e) [66]; 9) ca. 77˚0’26.4"N, 15˚32’43.02"E, 9 m asl, moss on
soil (4a and 2e); 10) ca. 77˚0’35.1"N, 15˚32’0.3"E, 28 m asl, moss on soil (1a) [67]. III) Phipp-
søya: 1) 80˚41.211’N; 20˚50.606’E, 47 m asl, moss on rock (9a and 10e).
Redescription of Mesobiotus harmsworthi
Animals (morphometrics in Table 4). Body white in living specimens and transparent
after fixation (Fig 2A and 2B). Eyes present. Cuticle smooth, i.e., without gibbosities, papillae,
spines, sculpture or pores. Granulation present only on the external surface of all legs (Fig 2C–
2F).
Bucco-pharyngeal apparatus of the Macrobiotus type (Fig 3A and 3B), with the ventral lam-
ina and ten peribuccal lamellae. Mouth antero-ventral. The oral cavity armature well devel-
oped and composed of three bands of teeth (Fig 3C–3F). The first band of teeth is composed of
numerous small granules arranged in a several rows situated anteriorly in the oral cavity, just
behind the bases of the peribuccal lamellae (Fig 3C and 3F; arrowhead). The band is hardly
detectible under PCM in small specimens and clearly visible in large individuals. The second
band of teeth is situated between the ring fold and the third band of teeth and comprises ridges
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 9 / 43

Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 10 / 43

parallel to the main axis of the buccal tube and additional teeth between and below them,
larger than those in the first band (Fig 3C,3E and 3F; arrow). The teeth of the third band are
located within the posterior portion of the oral cavity, between the second band of teeth and
the buccal tube opening (Fig 3C–3F; indented arrowhead). The third band of teeth is divided
into the dorsal and the ventral portion. Under PCM, both dorsal and ventral teeth are visible
as two lateral and one median transverse ridges (Fig 3C–3F; indented arrowhead). Pharyngeal
bulb spherical, with triangular apophyses, three rod-shaped macroplacoids and a triangular
microplacoid. Macroplacoid length sequence 2<31. The first macroplacoid narrower
Fig 2. Mesobiotus harmsworthi–habitus and granulation on legs. A–B–dorso-ventral projection of the entire animal;
C–D–granulation on leg III and II, respectively, arrowheads; E–F–granulation on leg IV, arrowheads. Scale bars in
micrometres [μm]. All PCM. B, D, F–Macrobiotus harmsworthi obscurus ssp. nov. (Dastych 1985) (= Mesobiotus
harmsworthi s.s. (Murray, 1907)–photos of paratypes from ZMHU.
https://doi.org/10.1371/journal.pone.0204756.g002
Fig 3. Mesobiotus harmsworthi—buccal apparatus and the oral cavity armature. A–B–general view; C–F–oral cavity armature; flat arrowheads indicate teeth of the
first band, arrows indicate teeth of the second band, indented arrowheads indicate teeth of the third band; G–H–ventral placoids; empty arrowheads indicate a
subterminal constriction. Scale bars in micrometres [μm]. All PCM. B, E, F, H–Macrobiotus harmsworthi obscurus ssp. nov. (Dastych 1985) (= Mesobiotus harmsworthi s.
s. (Murray, 1907)–photos of paratypes from ZMHU.
https://doi.org/10.1371/journal.pone.0204756.g003
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 11 / 43

anteriorly, the second without constrictions and the third with a small, subterminal constric-
tion (Fig 3G and 3H; empty arrowhead).
Claws of the Mesobiotus type, robust (Fig 4A–4D). Primary branches with distinct accessory
points. Accessory point on claws IV are larger and more protruding than in most macrobiotids
(Fig 4B and 4D; arrowheads). Lunules under claws I–III smooth and slightly dentated under
claws IV (Fig 4B and 4D; empty arrowhead). Thin cuticular bars under claws I–III present (Fig
4A, arrow). Other cuticular structures on legs absent.
Eggs (morphometrics in Table 5). Laid freely, white, spherical and ornamented, with
processes and delicate areolation (Figs 5–7). Egg processes in the shape of wide cones (Fig 6A–
6H). The cones can be slightly concave (Figs 5B,5C,6B and 6C) or sigmoidal, i.e., with a
Fig 4. Mesobiotus harmsworthi–claws. A, C–claws III and II respectively with smooth lunules; arrow indicates cuticular bar under claws; B, D–claws IV with indented
lunules (empty arrowheads) (insert–well visible indented lunules); the filled arrowheads indicate large accessory points on claws IV. Scale bars in micrometres [μm]. All
PCM. C–D–Macrobiotus harmsworthi obscurus ssp. nov. (Dastych 1985) (= Mesobiotus harmsworthi s.s. (Murray, 1907)–photos of paratypes from ZMHU.
https://doi.org/10.1371/journal.pone.0204756.g004
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 12 / 43

Fig 5. Mesobiotus harmsworthi–eggs. A–egg chorion visible in PCM; B–egg midsection visible in PCM; C–egg
chorion visible in SEM. Scale bars in micrometres [μm].
https://doi.org/10.1371/journal.pone.0204756.g005
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 13 / 43

slightly swollen base and a narrowed apex (Fig 6D). The processes with a single sharp (Fig 6A
and 6E) or slightly blunt (Fig 6B and 6F) apex, only occasionally bifurcated (Fig 6D,6G and
6H). In PCM, processes reticulated with mesh size 0.5–2.0 μm in diameter, evidently larger
near the process base and apex (Fig 6A–6D). Sometimes, instead of several large meshes, a sin-
gle very large bubble is present in the apex (Fig 6A–6D, arrows). In SEM, processes smooth,
but with well visible small pores at the bases and inside the areoles close to the processes (Figs
6E–6H,7C and 7D, arrows). Each process surrounded by five or six areolae delimited by thin
brims (Fig 7A–7D). The brims are very often discontinuous, thus areolae are not always fully
formed (Fig 7A and 7C, arrowheads). Surface inside the areolae with clearly visible wrinkles,
both in PCM (Fig 7A and 7B) and in SEM (Fig 7C and 7D). Occasionally, the wrinkles may
form a small whirl in the areola centre (Fig 7C, empty arrowhead).
DNA sequences. We obtained sequences for all four analysed genetic markers from the
three sequenced syngenophores collected from Spitsbergen and an additional COI sequence
from a syngenophore collected from Phippsøya (see Table 1 for details). All nuclear markers
were represented by a single haplotypes whereas COI exhibited two distinct haplotypes (sepa-
rated by the p-distance of 0.7%):
The 18S rRNA sequence (GenBank: MH197146), 829 bp long:
The 28S rRNA sequence (GenBank: MH197264), 751 bp long:
The ITS-2 sequence (GenBank: MH197154), 415 bp long:
The COI haplotype 1 sequence (GenBank: MH195150), 621 bp long:
The COI haplotype 2 sequence (GenBank: MH195151), 621 bp long:
Etymology. Although Murray [11] did not explain the choice of the species name, it
seems reasonable to assume that M.harmsworthi was named after Cape Mary Harmsworth in
Fig 6. Mesobiotus harmsworthi–egg processes morphology. A–D–egg process morphology seen in PCM; arrows indicate a single, large bubble in the apex; E–H–egg
process morphology seen in SEM; arrows indicate small pores at process bases. Scale bars in micrometres [μm].
https://doi.org/10.1371/journal.pone.0204756.g006
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 14 / 43

Franz Joseph Land, which is one of the type localities mentioned in the original description of
the species.
Neotype locality. Norway; 79˚2025@N, 16˚42012@E, 1,295 m asl, Svalbard, Spitsbergen,
Størmerfjellet Mt.
Distribution. Norway; Svalbard Archipelago: Spitsbergen (Albert I Land, Andre
´e Land,
Atomfjella, Bu¨nsow Land and Hornsund), Phippsøya; Russia; Franz Josef Land, Perm Krai;
United Kingdom: Shetland Islands [11,15,64].
Remarks. In our opinion the presence of this species in Perm Krai needs to be confirmed,
especially in the light of the description of a new species Mesobiotus skorackii sp. nov. from the
Kyrgyz Republic. Specimens designated as paratypes by Dastych [15] were collected in few
localities. According to International Commission on Zoological Nomenclature type speci-
mens should be collected from the same locality. However, since all specimens appear to repre-
sent a single species, we decided not to change original designations of type specimens.
Fig 7. Mesobiotus harmsworthi–egg chorion. A–B–the surface between egg processes visible in PCM; filled arrowheads indicate not fully closed areoles; C–D–the
surface between egg processes visible in SEM; filled arrowhead indicate not fully closed areoles; empty arrowheads indicate whirls inside areolae; arrows indicate small
pores at process bases. Scale bars in micrometres [μm].
https://doi.org/10.1371/journal.pone.0204756.g007
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 15 / 43

Phenotypic differential diagnosis. Mesobiotus harmsworthi, by the presence of smooth
cuticle and egg areolation (although not always fully developed), is most similar to M.bar-
barae,M.ethiopicus,M.hieronimi (Pilato & Claxton, 1988 [27]), M.nuragicus (Pilato & Sper-
linga, 1975 [26]), M.ovostriatus (Pilato & Patanè, 1998 [28]), M.peterseni (Maucci, 1991 [29]),
M.pseudoliviae (Pilato & Binda, 1996 [31]) and M.skorackii sp. nov., but differs from all of
them by large and protruding accessory points on claws IV. Additionally, M.harmsworthi dif-
fers specifically from:
1. M.barbarae (known only from type locality in the Dominican Republic [32]) by: the pres-
ence of additional teeth in the second band of teeth, an undivided ventro-median tooth in
Table 4. Measurements and pt values of selected morphological structures of the specimens of paratypes of Macrobiotus harmsworthi obscurus ssp. nov. (Dastych
1985) (= Mesobiotus harmsworthi s.s. (Murray, 1907) (N—number of specimens/structures measured, RANGE refers to the smallest and the largest structure among
all measured specimens; SD—standard deviation).
CHARACTER N RANGE MEAN SD
μmpt μmpt μmpt
Body length 11 275 – 489 –373 54
Buccal tube
Buccal tube length 23 37.3 – 62.0 – 43.5 –5.9 –
Stylet support insertion point 23 28.9 – 49.2 77.1 – 80.034.0 78.24.8 0.8
Buccal tube external width 23 4.9 – 7.5 12.1 – 16.46.3 14.50.7 1.0
Buccal tube internal width 23 3.4 – 5.8 9.1 – 11.44.5 10.30.6 0.7
Ventral lamina length 23 24.0 – 40.5 62.3 – 66.828.2 64.83.8 1.4
Placoid lengths
Macroplacoid 1 23 4.6 – 7.9 12.3 – 16.76.5 14.81.0 1.2
Macroplacoid 2 23 3.8 – 6.7 10.0 – 13.35.1 11.70.7 1.0
Macroplacoid 3 23 4.5 – 7.6 11.9 – 15.56.0 13.61.0 1.1
Microplacoid 22 2.1 – 3.5 5.6 – 7.93.0 6.80.4 0.6
Macroplacoid row 23 15.5 – 25.4 41.0 – 49.919.8 45.62.7 2.4
Placoid row 23 18.7 – 30.5 49.2 – 59.523.8 54.73.2 2.8
Claw 1 lengths
External primary branch 15 8.5 – 11.8 18.7 – 26.19.8 22.11.1 1.9
External secondary branch 8 6.5 – 9.9 16.0 – 21.58.2 18.31.3 1.8
Internal primary branch 14 7.6 – 10.8 16.5 – 22.69.2 20.60.9 1.6
Internal secondary branch 4 5.8 – 8.7 15.4 – 18.67.6 17.01.3 1.8
Claw 2 lengths
External primary branch 15 8.5 – 12.6 19.9 – 26.110.0 23.41.2 1.8
External secondary branch 11 7.1 – 10.5 17.8 – 23.28.4 19.91.1 1.7
Internal primary branch 11 7.9 – 11.0 19.3 – 22.99.1 21.20.9 1.1
Internal secondary branch 7 6.9 – 9.4 16.4 – 19.17.6 18.10.8 1.1
Claw 3 lengths
External primary branch 15 8.4 – 12.6 19.7 – 27.910.5 23.51.5 2.0
External secondary branch 11 7.1 – 11.0 14.8 – 23.78.6 19.71.1 2.4
Internal primary branch 17 7.9 – 11.6 18.2 – 25.79.4 21.61.1 1.8
Internal secondary branch 6 6.8 – 8.7 13.2 – 19.27.6 17.10.7 2.0
Claw 4 lengths
Anterior primary branch 16 9.4 – 14.0 23.3 – 29.611.4 26.21.3 1.5
Anterior secondary branch 11 7.4 – 10.3 19.2 – 21.68.8 20.10.8 0.7
Posterior primary branch 17 10.5 – 15.4 26.6 – 33.412.5 29.11.6 1.7
Posterior secondary branch 13 8.0 – 11.1 20.3 – 23.99.3 21.71.1 1.0
https://doi.org/10.1371/journal.pone.0204756.t004
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 16 / 43

the third band of teeth, the presence of granulation on legs I, a different macroplacoid
length sequence (2<31 in M.harmsworthi vs 2<1<3 in M.barbarae), a different mor-
phology of egg process apex (apices not defined in M.harmsworthi vs processes terminated
by a thin, flexible apex in M.barbarae), and by the presence of evidently larger meshes near
the bases of egg processes (uniform mesh size in M.barbarae) and by the areoles not always
fully formed on the egg surface.
2. M.ethiopicus (known only from type locality in Ethiopia [34]) by: the presence of eyes, the
absence of evidently larger teeth in the second band of teeth, the presence of additional
teeth in the oral cavity situated between second and third band of teeth and by a different
morphology of egg process apex (a single, occasionally bifurcated apex in M.harmsworthi
vs processes terminated by several short, thin, and flexible filaments susceptible to fracture
in M.ethiopicus).
3. M.hieronimi (known only from Australia and probably South Georgia [27]) by: the never
joined teeth in second band of teeth, the presence of dentated lunules under claws IV, stylet
supports in a more posterior position (pt = 77.1–80.0in M.harmsworthi vs pt = 73.3–74.8in
M.hieronimi), by the areoles not always fully formed on the egg surface and by evidently
larger meshes near the bases of the egg processes (uniform mesh size in M.hieronimi).
4. M.nuragicus (known from Europe, Africa, Indonesia, South and Central America [5,68,
69,70]) by: the presence of additional teeth in second band of teeth, a different macropla-
coid length sequence (2<31 in M.harmsworthi vs 2<1<3 in M.nuragicus), a different
morphology of egg process apex (apices only occasionally bifurcated in M.harmsworthi vs
apices always divided into several short filaments in M.nuragicus), the presence of larger
meshes near the bases and apices of egg processes (uniform mesh size in M.nuragicus and
by the areoles not always fully formed on the egg surface.
5. M.ovostriatus(known only from type locality in Argentina [28]) by: the presence of the first
band of teeth (in PCM), a better developed second band of teeth (second band of teeth reduced
and composed of small granular teeth in M.ovostriatus), slightly dentated lunules under claws
IV (smooth in M.ovostriatus), evidently larger meshes near the bases and apices of egg pro-
cesses (uniform mesh size in M.ovostriatus), a different morphology of egg process apex (a sin-
gle, occasionally bifurcated apex in M.harmsworthi vs processes terminated by a thin, flexible
apex in M.ovostriatus) and by the areoles not always fully formed on the egg surface.
6. M.peterseni (known only from type locality in Greenland [29]): a different macroplacoid
length sequence (2<31 in M.harmsworthi vs 2<1<3 in M.peterseni) and a different
shape of egg processes (sharp cones in the M.harmsworthi vs blunt domes in M.peterseni).
Table 5. Measurements [in μm] of selected morphological structures of the eggs of Macrobiotus harmsworthi obscurus ssp. nov. (Dastych 1985) (= Mesobiotus harms-
worthi s.s. (Murray, 1907) (N—number of specimens/structures measured, RANGE refers to the smallest and the largest structure among all measured eggs; SD—
standard deviation).
CHARACTER N RANGE MEAN SD
Egg bare diameter 9 71.2 – 84.6 77.9 3.6
Egg full diameter 9 101.0 – 120.0 108.5 5.9
Process height 27 14.3 – 19.7 16.7 1.2
Process base width 27 15.2 – 21.4 18.5 1.4
Process base/height ratio 27 103% – 125% 110% 5%
Distance between processes 27 3.4 – 7.0 5.5 0.9
Number of processes on the egg circumference 9 11 – 12 11.3 0.5
https://doi.org/10.1371/journal.pone.0204756.t005
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 17 / 43

7. M.pseudoliviae (known only from type locality in New Zealand [31]) by: the presence of
additional teeth in second band of teeth, the teeth in second band never joined, evidently
larger meshes near the bases and apices of egg processes (uniform mesh size in M.pseudoli-
viae), the areoles not always fully formed on the egg surface, fewer areoles around the egg
processes (6 in M.harmsworthi vs ca. 16 in M.pseudoliviae), a smaller egg full diameter
(101.0–120.0 μm in M.harmsworthi vs 156.0–177.0 μm in M.pseudoliviae), shorter egg pro-
cesses (14.3–19.7 μm in M.harmsworthi vs 42.0–56.0 μm in M.pseudoliviae), and by nar-
rower process bases (15.2–21.4 μm in M.harmsworthi vs 28.0–45.0 μm in M.pseudoliviae).
Maximum dimensions (both absolute and relative) of all morphological structures are
smaller in M.harmsworthi, but the morphometric comparison of the two species must be
treated with caution because only one specimen was measured in the original description of
M.pseudoliviae.
8. M.skorackii sp. nov.–please see the description and the differential diagnosis below.
Genotypic differential diagnosis. The ranges of uncorrected genetic p-distances between
the new species and species of the genus Mesobiotus, for which sequences are available from
GenBank, were as follows:
18S rRNA: 0.4–5.8% (3.7% on average), with the most similar being M.occultatus from
Spitsbergen (MH197147) and the least similar being M. cf. mottai and M.furciger from the
Antarctic (KT226072 and EU266928, respectively) and an undetermined M.furciger group
species from Norway (MH197148);
28S rRNA: 3.2–9.2% (7.0% on average), with the most similar being an undetermined M.
harmsworthi group species from Russia (MH197266) and the least similar being M.radiatus
Pilato, Binda & Catanzaro, 1991 [71] from Kenya (MH197152);
ITS-2: 10.3–29.4% (19.4% on average), with the most similar being M.occultatus from
Spitsbergen (MH197155) and the least similar being an undetermined M.furciger group spe-
cies from Norway (MH197156);
COI: 17.5–23.5% (21.4% on average), with the most similar being an undetermined M.fur-
ciger group species from Norway (MH195153) and the least similar “M.harmsworthi” from
China (GU113140).
Mesobiotus occultatus sp. nov
urn:lsid:zoobank.org:act:0C31B770-CA14-4664-B923-160737EF0618
Macrobiotus harmsworthi harmsworthi Murray, 1907 [65]
M.harmsworthi harmsworthi Murray, 1907 [66,67]
Mesobiotus harmsworthi harmsworthi (Murray, 1907) [72]
(Figs 8–12; Tables 6and 7)
Material examined. Type material: Holotype (animal) and 50 paratypes (24 animals and
26 eggs).
Additional material: I) Svalbard, Spitsbergen, Hornsund, Revdalen:1) 77˚01’41’’N; 15˚
22’21’’E, 67 m asl, moss on soil, northern part of the Revdalen, near the Revvatnet and the
Revelva (1 egg); 2) 77˚01’39’’N; 15˚22’47’’E, 76 m asl, moss on rock, northern part of the
Revdalen, near the Revvatnet and the Revelva (5 animals and 2e); 3) 77˚01’09’’N; 15˚24’34’’E,
50 m asl, moss on soil, northern part of the Revdalen, near the Revvatnet (southern edge) and
the Revelva (1a and 4e); 4) (77˚01’09’’N; 15˚24’34’’E), 50 m asl, moss and lichen on soil, north-
ern part of the Revdalen, near the Revvatnet (southern edge) and the Revelva (4a and 5e) [65];
II) Svalbard, Spitsbergen, Hornsund, Rotjesfjellet: 1) 77˚00’16’’N; 15˚24’02’’E, 50 m asl,
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 18 / 43

moss on soil, south-east slope (2e); 2) 77˚00’19’’N; 15˚23’55’’E, 100 m asl, moss on soil, south-
east slope (1a and 5e); 3) 77˚00’31’’N; 15˚23’21’’E, 301 m asl, moss on soil, south-east slope (2a
and 1e) [65]; III) Svalbard, Spitsbergen, Hornsund, Ariekammen: 1) 77˚01’10’’N; 15˚
31’16’’E, 524 m asl, moss on rock (20a and 3e); 2) 77˚00’31’’N; 15˚31’43’’E, 50 m asl, moss on
rock (7a and 12e); 2) 77˚00’18’’N; 15˚32’01’’E, 14 m asl, moss on rock (6a and 1e) [66]; 3) 77˚
00’48’’N; 15˚33’05’’E, 11 m asl, moss on rock (48a and 70e); 4) 77˚00’29’’N; 15˚33’09’’E, 1 m
asl, moss on rock (22a and 3e); 5) 77˚00’40’’N; 15˚32’88’’E, 7 m asl, moss on soil (1e) 6) 77˚
00’58’’N; 15˚32’00’’E, 28 m asl, moss on soil (1a and 1e); 7) 77˚00’50’’N; 15˚33’24’’E, 8 m asl,
lichen on stone (6a and 2e) 8) 77˚00’50’’N; 15˚33’24’’E, 8 m asl, moss and lichen on stone (6a
and 5e), 9) 77˚00’79’’N; 15˚32’66’’E, 72 m asl, moss and lichen on stone (2a and 1e), 10) 77˚
00’79’’N 15˚32’66’’E, 72 m asl, moss on stone (1a and 1e) [67]; IV) Svalbard, Phippsøya: 80˚
41.211’N; 20˚50.606’E, 47 m asl, moss on rock (6a and 15e) [72].
Description of Mesobiotus occultatus sp. nov. Animals (morphometrics in Table 6).
Body white in living specimens and transparent after fixation (Fig 8A). Eyes present. Cuticle
smooth, i.e., without gibbosities, papillae, spines, sculpture or pores. However, under SEM
microgranulation is visible on the entire dorso-lateral cuticle (Fig 8B). Granulation present on
the external surface of all legs (Fig 8C–8E).
Bucco-pharyngeal apparatus of the Macrobiotus type (Fig 9A), with the ventral lamina and
ten peribuccal lamellae. Mouth antero-ventral. The oral cavity armature well developed and
composed of three bands of teeth (Fig 9B and 9C). The first band of teeth is composed of
numerous small granules arranged in a several rows situated anteriorly in the oral cavity, just
Fig 8. Mesobiotus occultatus sp. nov.–habitus and granulation on legs. A–dorso-ventral projection of the entire animal (holotype, PCM); B–body microgranulation
visible in SEM (paratype); C–granulation on leg II, arrowhead (paratype, PCM); D–granulation on leg III (paratype, SEM); E–granulation on leg IV, arrowhead
(paratype, PCM). Scale bars in micrometres [μm].
https://doi.org/10.1371/journal.pone.0204756.g008
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 19 / 43

behind the bases of the peribuccal lamellae (Fig 9B and 9C, arrowhead). The band is hardly
detectible under PCM in small specimens but clearly visible in large individuals. The second
band of teeth is situated between the ring fold and the third band of teeth and comprises of
ridges parallel to the main axis of the buccal tube (Fig 9B, arrow). The teeth of the third band
are located within the posterior portion of the oral cavity, between the second band of teeth
and the buccal tube opening (Fig 9B and 9C, indented arrowhead). The third band of teeth is
divided into the dorsal and the ventral portion. Under PCM, both dorsal and ventral teeth are
Fig 9. Mesobiotus occultatus sp. nov.–buccal apparatus and the oral cavity armature. A–general view (paratype); B–C–oral cavity armature; filled flat arrowheads
indicate teeth of the first band, the arrow indicates teeth of the second band, indented arrowheads indicate teeth of the third band (paratype); D–ventral placoids; the
empty arrowhead indicates the subterminal constriction in the third macroplacoid (paratype). Scale bars in micrometres [μm]. All PCM.
https://doi.org/10.1371/journal.pone.0204756.g009
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 20 / 43

Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 21 / 43

visible as two lateral and one median transverse ridges (Fig 9B, indented arrowhead). Pharyn-
geal bulb spherical, with triangular apophyses, three rod-shaped macroplacoids and a triangu-
lar microplacoid. Macroplacoid length sequence 2<31. The first macroplacoid narrower
anteriorly, the second without constrictions and the third with a small, subterminal constric-
tion (Fig 9D, empty arrowhead).
Claws of the Mesobiotus type (Fig 10A–10C). Primary branches with distinct accessory
points. Lunules under all claws smooth (Fig 10A–10C). Thin cuticular bars under claws I–III
present (Fig 10A, arrow). Other cuticular structures on legs absent.
Fig 10. Mesobiotus occultatus sp. nov.–claws. A–claws I with smooth lunules; arrow indicates the cuticular bar under
claws (holotype, PCM); B–claws III with smooth lunules (paratype, SEM); C–claws IV with smooth lunules (paratype,
PCM). Scale bars in micrometres [μm].
https://doi.org/10.1371/journal.pone.0204756.g010
Fig 11. Mesobiotus occultatus sp. nov.–eggs. A–B–egg chorion visible in PCM and SEM respectively; C–the surface between egg
processes visible in PCM; arrows indicate a crown of small thickenings at the base of processes (PCM); D–the surface between egg
processes visible in SEM. Scale bars in micrometres [μm].
https://doi.org/10.1371/journal.pone.0204756.g011
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 22 / 43

Eggs (morphometrics in Table 7). Laid freely, white, spherical and ornamented (Fig 11A
and 11B). Egg processes in the shape of wide cones. The cones are sometimes bifurcated on
the top and often with one to few short apical filaments (Fig 12A–12H). In PCM, processes
reticulated with mesh size 0.5–1.6 μm in diameter, slightly larger near the process base (Fig
12A–12D). In some processes larger meshes are present in the apical part of the process (up to
3.5 μm in diameter; Fig 12A, arrow). At the base of each process a crown of small but well visi-
ble thickenings visible both in PCM and SEM (Fig 11C, arrows). In SEM, processes smooth,
but with well visible small pores at the processes bases (Fig 12E and 12F and 12H, arrows).
Very fine granulation present at the apical part of each process (Fig 12E–12H, empty arrow-
head). Egg areolation absent (Fig 11A–11D). In PCM, the surface between processes with
irregular and rather poorly visible dots (Fig 11C), in SEM visible as large ridges (Fig 11D).
DNA sequences: We obtained sequences for three of the above mentioned molecular mark-
ers from five of six analysed paragenophores (see Table 1 for details). All markers were repre-
sented by single haplotypes:
The 18S rRNA sequence (GenBank: MH197147), 811 bp long:
The ITS-2 rRNA sequence (GenBank: MH197155), 419 bp long:
The COI sequence (GenBank: MH195152), 575 bp long:
Etymology. The name “occultatus”, from Latin = hidden, is given to the new species,
because the species remained unrecognised until the nominal M.harmsworthi was accurately
characterised.
Type Locality. Norway; 77˚00’48’’N; 15˚33’05’’E, 11 m asl, Svalbard, Spitsbergen, Horn-
sund, vicinity of Polish Polar Station “Hornsund”, Ariekammen, southern slope, moss on
rock.
Type depositories. Holotype (slide SV83.7/5) and 25 paratypes (14 specimens and 11 eggs)
(slides SV83.7/2, SV83.7/5, SV83.7/8, SV83.7/9, SV83.7/10, SV83.7/12, SV83.7/13, SV83.7/14,
SV83.7/15, SV83.7/16) are deposited at the Department of Animal Taxonomy and Ecology,
Fig 12. Mesobiotus occultatus sp. nov.–egg processes morphology. A–D–egg process morphology seen in PCM; E–H–egg process morphology seen in SEM; arrows
indicate small pores at the process bases, empty arrowheads indicate fine granulation present at the apical part of the processes. Scale bars in micrometres [μm].
https://doi.org/10.1371/journal.pone.0204756.g012
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 23 / 43

Table 6. Measurements and pt values of selected morphological structures of Mesobiotus occultatus sp. nov. mounted in Hoyer’s medium (N—number of speci-
mens/structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation).
CHARACTER N RANGE MEAN SD Holotype
μmpt μmpt μmpt μmpt
Body length 14 244 – 535 –345 76 353
Buccal tube
Buccal tube length 14 27.4 – 47.9 – 37.4 –6.3 –37.2 –
Stylet support insertion point 14 20.9 – 37.1 75.5 – 78.728.9 77.35.0 0.828.7 77.2
Buccal tube external width 14 4.0 – 7.5 13.7 – 15.75.5 14.71.0 0.75.6 15.1
Buccal tube internal width 14 2.5 – 5.4 8.8 – 11.33.7 9.90.8 0.83.9 10.5
Ventral lamina length 14 17.0 – 29.8 59.3 – 64.923.4 62.53.9 1.522.8 61.3
Placoid lengths
Macroplacoid 1 14 3.2 – 7.1 11.7 – 14.85.0 13.11.2 1.14.8 12.9
Macroplacoid 2 14 2.7 – 6.0 9.7 – 12.64.2 11.21.0 1.04.4 11.8
Macroplacoid 3 14 2.9 – 6.7 10.6 – 14.04.7 12.41.1 0.94.6 12.4
Microplacoid 14 2.4 – 5.5 8.0 – 12.13.8 10.11.0 1.34.2 11.3
Macroplacoid row 14 10.4 – 22.7 37.5 – 47.415.9 42.13.6 2.815.4 41.4
Placoid row 14 13.3 – 29.9 48.5 – 62.420.8 55.04.8 4.020.5 55.1
Claw 1 lengths
External primary branch 11 7.2 – 12.1 23.4 – 27.49.0 24.71.4 1.38.7 23.4
External secondary branch 10 5.1 – 10.6 18.6 – 22.17.4 20.21.7 1.17.7 20.7
Internal primary branch 12 7.1 – 11.1 21.5 – 25.98.4 23.01.2 1.48.5 22.8
Internal secondary branch 9 5.2 – 9.0 18.2 – 20.96.8 19.31.3 1.07.3 19.6
Claw 2 lengths
External primary branch 10 7.4 – 12.6 22.4 – 27.19.5 26.11.5 1.49.9 26.6
External secondary branch 7 5.2 – 8.3 17.3 – 22.37.1 20.31.3 1.87.9 21.2
Internal primary branch 10 6.9 – 12.0 20.0 – 26.48.7 24.11.5 1.89.4 25.3
Internal secondary branch 8 5.2 – 10.0 17.7 – 21.07.0 19.71.5 1.27.8 21.0
Claw 3 lengths
External primary branch 11 7.3 – 13.1 23.4 – 27.39.5 26.41.7 1.110.0 26.9
External secondary branch 9 5.4 – 10.5 16.6 – 23.67.7 21.01.7 2.18.3 22.3
Internal primary branch 12 6.7 – 12.1 20.2 – 26.08.9 24.41.5 1.69.6 25.8
Internal secondary branch 9 5.1 – 8.7 17.7 – 21.27.0 19.51.4 1.27.9 21.2
Claw 4 lengths
Anterior primary branch 10 7.4 – 14.1 24.6 – 29.410.0 27.52.0 1.510.4 28.0
Anterior secondary branch 10 6.5 – 10.1 18.5 – 24.27.8 21.61.1 1.78.1 21.8
Posterior primary branch 12 8.0 – 13.7 25.6 – 29.710.5 28.21.8 1.410.8 29.0
Posterior secondary branch 11 5.0 – 9.6 17.8 – 21.67.6 19.81.4 1.48.0 21.5
https://doi.org/10.1371/journal.pone.0204756.t006
Table 7. Measurements [in μm] of selected morphological structures of eggs of Mesobiotus occultatus sp. nov. mounted in Hoyer’s medium (N—number of speci-
mens/structures measured, RANGE refers to the smallest and the largest structure among all measured eggs; SD—standard deviation).
CHARACTER N RANGE MEAN SD
Egg bare diameter 19 65.9 – 90.5 79.9 7.6
Egg full diameter 19 97.4 – 126.6 114.1 9.3
Process height 81 14.1 – 21.8 17.9 1.8
Process base width 81 13.1 – 20.0 16.0 1.7
Process base/height ratio 81 74% – 106% 90% 7%
Distance between processes 78 1.4 – 4.2 2.6 0.6
Number of processes on the egg circumference 26 13 – 16 14.4 1.0
https://doi.org/10.1371/journal.pone.0204756.t007
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 24 / 43

Institute of Environmental Biology, Adam Mickiewicz University, Poznań, Umultowska 89,
61–614 Poznań(Poland); 12 paratypes (6 specimens and 6 eggs) (slides SV83.7/4, KZ83.7/11)
are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University,
Gronostajowa 9, 30–387, Krako
´w, Poland; 10 paratypes (3 animals and 7 eggs) (slides SV83.7/
1, SV83.7/6) are deposited at the Zoological Museum, Natural History Museum of Denmark,
University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen Ø, Denmark; 3 para-
types (1 animals and 2 eggs) (slide SV83.7/3) are deposited at the collection of Binda and Pilato
in Department of Animal Biology “Marcello La Greca”, University of Catania, Italy.
Phenotypic differential diagnosis. The new species by the shape of egg processes and surface
of eggs is the most similar to M.baltatus (McInnes, 1991) [31], M.coronatus (de Barros, 1942)
[14], M.insuetus (Pilato, Sabella & Lisi, 2014) [33], M.patiens (Pilato, Binda, Napolitano, & Mon-
cada, 2000) [13], M.pseudocoronatus (Pilato, Binda & Lisi, 2006) [73], M.pseudopatiens and M.
simulans (Pilato, Binda, Napolitano, & Moncada, 2000) [13] but differs specifically from:
1. M.baltatus (known only from type locality in Spain [31]) by: cuticle without brown bands
of pigmentation, the presence of occasional short filaments on apices of egg processes, the
presence of large meshes near the apices of egg processes and by a larger number of pro-
cesses on the egg circumference (13–16 in the new species vs ca. 12 in M.baltatus).
2. M.coronatus (known from few localities in South America [69]) by: the absence of supple-
mentary teeth in the oral cavity, a different macroplacoid length sequence (2<31 in the
new species vs 2<3<1 in M.coronatus), much less evident crown of thickenings around
egg processes, the presence of short filaments on top of some egg processes, the presence of
large meshes near the top of egg processes, a larger diameter of eggs without and with pro-
cesses (65.9–90.5 μm and 97.4–126.6 μm respectively, in the new species vs 42.0–55.0 μm
and 55.0–71.0 μm respectively, in M.coronatus), larger egg processes (14.1–21.8 μm in the
new species vs ca. 9.2 μm in M.coronatus) and by wider process bases (13.1–20.0 μm in the
new species vs 9.6–10.4 μm in M.coronatus).
3. M.insuetus (known only from type locality in Italy [33]) by: the presence of eyes, typically
developed claws IV (the basal tract of posterior and anterior claws much longer, primary
and secondary branches forming an almost 90˚ angle in M.insuetus), the occasional pres-
ence of short filaments on egg process apices, the presence of large meshes the apical part of
egg processes, a larger diameter of eggs with processes (97.4–126.6 μm in the new species vs
73.0–86.2 μm in M.insuetus) and by higher egg processes (14.1–21.8 μm in the new species
vs ca. 7.9–8.6 μm in M.insuetus).
4. M.patiens (known from few localities in Italy [13]) by: the presence of eyes, a different
macroplacoid length sequence (2<31 in the new species vs 2<3<1 in M.patiens) and by
the occasional presence of short filaments on egg process apices, and by the presence of
large meshes in the apical part of egg processes.
5. M.pseudocoronatus(known only from type locality on Seychelles [73]) by: the presence of
smooth dorsal cuticle (small tubercles present in M.pseudocoronatus), much less evident
crown of thickenings around egg processes, the absence of dentated lunules under claws
IV, the presence of large meshes in the apical area of egg processes and a by higher egg pro-
cesses (14.1–21.8 μm in the new species vs ca. 10.9–12.7 μm in M.pseudocoronatus).
6. M.pseudopatiens(known only from type locality in Costa Rica [38] by: the presence of
eyes, the presence of granulation on legs I-III, the presence of the first band of teeth in oral
cavity (visible under PCM in the new species vs invisible in M.pseudopatiens), a slightly dif-
ferent macroplacoid length sequence (2<31in the new species vs 2<3<1 in M.
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 25 / 43

pseudopatiens), the presence of large meshes in the apical area of egg processes, the absence
of a long, flexible terminal part of egg process, a larger bare and full egg diameter (65.9–
90.5 μm and 97.4–126.6 μm respectively, in the new species vs 55.5–59.3 μm and 80.4–
88.0 μm respectively, in M.pseudopatiens) and by a larger number of processes on the egg
circumference (13–16 in the new species vs 11–12 in M.pseudopatiens).
7. M.simulans (known from few localities in Italy [13]) by: the absence of dentated lunules
under claws IV, a much less evident crown of thickenings around egg processes, the occa-
sional presence of short filaments on egg process apices, the presence of large meshes in the
apical area of egg process, and by a larger egg processes (14.1–21.8 μm in the new species vs
ca. 11.0 μm in M.simulans).
8. Genotypic differential diagnosis. The ranges of uncorrected genetic p-distances between
the new species and species of the genus Mesobiotus, for which sequences are available from
GenBank, were as follows:
9. 18S rRNA: 0.4–5.5% (3.4% on average), with the most similar being M.harmsworthi from
Spitsbergen (MH197146) and the least similar being M. cf. mottai and M.furciger from the
Antarctic (KT226072 and EU266928 respectively);
10. ITS-2: 9.0–30.0% (19.4% on average), with the most similar being undetermined M.
harmsworthi species from Russia (MH197157) and the least similar being an undeter-
mined M.furciger group species from Norway (MH197156);
11. COI: 18.2–24.8% (20.7% on average), with the most similar being an undetermined M.
furciger group species from Norway (MH195153) and the least similar M.furciger from
the Antarctic (JX865308).
Mesobiotus skorackii sp. nov
urn:lsid:zoobank.org:act:3C14C322-09B8-470C-B5BB-7C30C2EE4A5B
(Figs 13–17; Tables 8and 9)
Material examined. Type material: Holotype (animal) and 64 paratypes (37 animals and
27 eggs).
Additional material: I) Chuy Region, Alamudun District, Ala Archa National Park: 46)
42˚390N, 74˚280E, ca. 2000 m asl, spruce forest, lichen on rock (15 animals and 3 eggs); II)
Issyk-Kul Region, Issyk-Kul District, Issyk Kul Biosphere Reserve, near Grigorievka: 8) 42˚
470N, 77˚280E, ca. 2000 m asl, spruce forest, moss on rock (3a and 1e); III) Issyk-Kul Region,
Issyk-Kul District, Ak-Suu Valley, northern slope: 26) 42˚510N, 77˚180E, 3100 m asl, spruce
forest, moss from tree (22a and 7e); 72) 42˚530N, 77˚160E, 3900 m asl, above forest line, moss
on rock (21a and 24e); 81) 42˚520N, 77˚160E, 3650 m asl, above forest line, moss on rock (2a
and 1e); 82) 42˚520N, 77˚160E, 4000 m asl, above forest line, moss on rock (1a and 2e); 83) 42˚
520N, 77˚160E, 4000 m asl, above forest line, moss on rock (4a and 1e); 85) 42˚520N, 77˚160E,
3600 m asl, above forest line, moss on rock (15a and 13e); 89) 42˚520N, 77˚160E, 3450 m asl,
above forest line, moss on rock (2a and 9e); 91) 42˚520N, 77˚160E, 3600 m asl, above forest line,
moss on rock (10a and 2e); 93) 42˚520N, 77˚160E, 4000 m asl, above forest line, moss on rock
(5a and 1e); 100) 42˚520N, 77˚160E, 3700 m asl, above forest line, moss on rock (2a and 1e);
102) 42˚520N, 77˚160E, 4000 m asl, above forest line, moss on rock (3s and 2e).
Description of Mesobiotus skorackii sp. nov. Animals (morphometrics in Table 8).
Body white in living specimens and transparent after fixation (Fig 13A and 13B). Eyes present
in 48% studied specimens (see also comments in Remarks below). Cuticle smooth, i.e., without
gibbosities, papillae, spines, sculpture or pores. Granulation present on the external surface of
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 26 / 43

all legs. On legs I–III granulation is hardly visible only in some specimens, whereas granulation
on legs IV always clearly visible (Fig 13C and 13D, arrowheads).
Bucco-pharyngeal apparatus of the Macrobiotus type (Fig 14A), with the ventral lamina and
ten peribuccal lamellae. Mouth antero-ventral. The oral cavity armature well developed and
composed of three bands of teeth (Fig 14B–14D). The first band of teeth is composed of
numerous small granules arranged in a several rows situated anteriorly in the oral cavity, just
behind the bases of the peribuccal lamellae (Fig 14C, arrowhead). The band is hardly detectible
under PCM in small specimens and clearly visible in large individuals. The second band of
teeth is situated between the ring fold and the third band of teeth and comprises of ridges par-
allel to the main axis of the buccal tube larger than those in the first band (Fig 14B, arrow). The
Fig 13. Mesobiotus skorackii sp. nov.–habitus and granulation on legs. A–dorso-ventral projection of the entire
animal (holotype); B–a young specimen hatches from the egg (paratype); C–poorly visible granulation on leg II,
arrowhead (paratype); arrow indicates cuticular bar under claws; D–granulation on leg IV, arrowhead (paratype). Scale
bars in micrometres [μm]. All PCM.
https://doi.org/10.1371/journal.pone.0204756.g013
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 27 / 43

Fig 14. Mesobiotus skorackii sp. nov.—buccal apparatus and the oral cavity armature. A–general view (holotype); B–D–oral cavity
armature; the filled flat arrowhead indicates teeth of the first band, the arrow indicates teeth of the second band, indented arrowheads
indicates teeth of the third band (holotype); E–ventral placoids; the empty arrowhead indicates a subterminal constriction (holotype). Scale
bars in micrometres [μm]. All PCM.
https://doi.org/10.1371/journal.pone.0204756.g014
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 28 / 43

Fig 15. Mesobiotus skorackii sp. nov.–claws. A–claws III with smooth lunules; arrow indicates cuticular bar under claws (paratype); B–claws IV with
indented lunules (empty arrowhead) (holotype). Scale bars in micrometres [μm]. All PCM.
https://doi.org/10.1371/journal.pone.0204756.g015
Fig 16. Mesobiotus skorackii sp. nov.–eggs. A–C–egg chorion visible in PCM and SEM; D–E–the surface between egg processes visible in PCM; F–the surface between
egg processes visible in SEM. Scale bars in micrometres [μm].
https://doi.org/10.1371/journal.pone.0204756.g016
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 29 / 43

teeth of the third band are located within the posterior portion of the oral cavity, between the
second band of teeth and the buccal tube opening (Fig 14B and 14D, indented arrowhead).
The third band of teeth is divided into the dorsal and the ventral portion. Under PCM, both
dorsal and ventral teeth are visible as two lateral and one median transverse ridges (Fig 14B
and 14D, indented arrowhead). Pharyngeal bulb spherical, with triangular apophyses, three
rod-shaped macroplacoids and a triangular microplacoid. Macroplacoid length sequence
2<3<1. The first macroplacoid narrower anteriorly, the second without constrictions and the
third with a small, subterminal constriction (Fig 14E, empty arrowhead).
Claws of the Mesobiotus type (Fig 15A and 15B). Primary branches with distinct accessory
points. Lunules under claws I–III smooth and slightly dentated under claws IV (Fig 15B,
empty arrowhead). Thin cuticular bars under claws I–III present (Figs 13C and 15A, arrow).
Other cuticular structures on legs absent.
Eggs (morphometrics in Table 9). Laid freely, white, spherical and ornamented, with pro-
cesses and delicate areolation (Fig 16A–16C). Egg processes in the shape of short and wide
sharpened cones (Figs 16A,16B and 17A–17F). In PCM, processes reticulated with mesh size
0.3–1.8 μm in diameter, slightly increased in size from the base to the top (Fig 17B). In SEM
processes smooth, but with well visible small pores present mainly at the processes bases (Fig
17D–17F, arrows). Each process surrounded by six areolae delimited by thin brims (Fig 16B
and 16D–16F). The brims are very often discontinuous, thus areolae are not always fully
formed (Fig 16D and 16E). Surface inside the areolae with clearly visible wrinkles, in PCM
(Fig 16D and 16E), and small pores and wrinkles in SEM (Fig 16F).
Etymology. We dedicate this species to our friend and a distinguished and prominent Pol-
ish acarologist, Professor Maciej Skoracki, a discoverer of many new species of Syringophilidae
mites.
Fig 17. Mesobiotus skorackii sp. nov.–egg processes morphology. A–C–egg processes morphology seen in PCM; D–F–egg processes morphology seen in SEM; arrows
indicate small pores at the processes base. Scale bars in micrometres [μm].
https://doi.org/10.1371/journal.pone.0204756.g017
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 30 / 43

Type Locality. Kyrgyz Republic; 42˚520N, 77˚160E, 3500 m asl, Issyk-Kul Region, Issyk-Kul
District, Ak-Suu Valley, northern slope, above forest line, moss on rock.
Type depositories. Holotype (slide KZ79/9) and 25 paratypes (13 animals and 12 eggs)
(slides KZ79/6, KZ79/7, KZ79/9,) are deposited at the Department of Animal Taxonomy and
Ecology, Institute of Environmental Biology, Adam Mickiewicz University, Poznań, Umul-
towska 89, 61–614 Poznań(Poland); 24 paratypes (17 animals and 7 eggs) (slides KZ79/1,
KZ79/2) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian Uni-
versity, Gronostajowa 9, 30–387, Krako
´w, Poland; 7 paratypes (2 animals and 5 eggs) (slides
KZ79/5, KZ79/8) are deposited at the Zoological Museum, Natural History Museum of Den-
mark, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen Ø, Denmark;
7 paratypes (5 animals and 3 eggs) (slides KZ79/3, KZ79/4) are deposited at the collection of
Binda and Pilato in Department of Animal Biology “Marcello La Greca”, University of Catania,
Italy.
Fig 18. The Bayesian Inference (BI) phylogeny constructed from concatenated sequences(18S rRNA + 28S rRNA + ITS-2 + COI) of the genus Mesobiotus.
Numbers at nodes indicate Bayesian posterior probability, values below 0.90 are not shown. Please see Table 3 and the “Phylogenetic analysis” subsection in Material and
Methods for details on species and sequences used in the analysis. Scale bar represents substitutions per position.
https://doi.org/10.1371/journal.pone.0204756.g018
Mesobiotus harmsworthi redescription
PLOS ONE | https://doi.org/10.1371/journal.pone.0204756 October 17, 2018 31 / 43

Table 8. Measurements and pt values of selected morphological structures of Mesobiotus skorackii sp. nov. mounted in Hoyer’s medium (N—number of specimens/
structures measured, RANGE refers to the smallest and the largest structure among all measured specimens; SD—standard deviation).
CHARACTER N RANGE MEAN SD Holotype
μmpt μmpt μmpt μmpt
Body length 25 206 – 440 –351 –66 –378 –
Buccal tube
Buccal tube length 25 26.6 – 47.1 – 38.3 –4.7 –40.0 –
Stylet support insertion point 25 20.4 – 36.0 76.0 – 79.629.8 77.63.7 1.030.9 77.3
Buccal tube external width 25 4.3 – 7.8 15.6 – 17.86.4 16.70.9 0.67.0 17.5
Buccal tube internal width 25 2.9 – 6.0 10.5 – 13.04.5 11.70.7 0.75.0 12.5
Ventral lamina length 25 17.0 – 30.0 61.1 – 64.924.2 63.03.0 1.225.0 62.5
Placoid lengths
Macroplacoid 1 25 3.5 – 6.5 12.1 – 15.15.3 13.70.8 0.85.3 13.3
Macroplacoid 2 25 2.7 – 5.1 9.7 – 11.84.2 10.90.7 0.64.4 11.0
Macroplacoid 3 25 2.9 – 6.1 10.9 – 13.94.9 12.60.8 0.85.1 12.8
Microplacoid 25 2.5 – 4.8 9.1 – 11.13.9 10.10.6 0.64.2 10.5
Macroplacoid row 25 10.8 – 21.2 40.6 – 46.416.8 43.62.5 1.717.7 44.3
Placoid row 25 13.2 – 27.6 49.6 – 59.121.5 55.83.3 2.422.4 56.0
Claw 1 lengths
External primary branch 23 6.3 – 11.7 22.3 – 27.09.4 24.51.4 1.19.9 24.8
External secondary branch 15 5.7 – 9.0 17.6 – 23.37.6 19.61.0 1.67.3 18.3
Internal primary branch 23 6.1 – 10.9 19.4 – 24.78.8 22.81.3 1.29.2 23.0
Internal secondary branch 18 5.7 – 8.7 16.4 – 21.67.4 18.70.9 1.57.0 17.5
Claw 2 lengths
External primary branch 21 7.0 – 12.9 21.3 – 27.49.6 25.11.4 1.510.4 26.0
External secondary branch 14 6.1 – 9.1 17.6 – 23.67.8 20.41.1 1.88.6 21.5
Internal primary branch 22 6.5 – 10.9 19.9 – 24.48.7 22.71.2 1.29.0 22.5
Internal secondary branch 11 4.9 – 9.4 16.6 – 21.77.0 18.81.4 1.57.2 18.0
Claw 3 lengths
External primary branch 22 7.1 – 12.0 21.0 – 28.29.8 25.61.3 1.410.5 26.3
External secondary branch 18 6.2 – 8.9 18.1 – 23.37.5 20.31.0 1.58.4 21.0
Internal primary branch 22 6.9 – 10.4 20.2 – 26.38.9 23.31.1 1.39.6 24.0
Internal secondary branch 15 5.5 – 9.4 16.9 – 21.77.4 19.31.1 1.47.0 17.5
Claw 4 lengths
Anterior primary branch 20 7.7 – 14.8 24.3 – 31.411.0 28.11.8 2.111.9 29.8
Anterior secondary branch 19 6.1 – 11.7 19.0 – 24.88.8 22.61.5 1.79.2 23.0
Posterior primary branch 20 8.7 – 15.0 25.3 – 32.511.4 29.81.8 1.912.8 32.0
Posterior secondary branch 19 6.1 – 11.0 17.8 – 23.78.2 21.41.5 1.99.1 22.8
https://doi.org/10.1371/journal.pone.0204756.t008
Table 9. Me