Rheumatoid Arthritis-Associated Autoimmunity Due to Aggregatibacter actinomycetemcomitans and Its Resolution With Antibiotic Therapy

Abstract

Background: Aggregatibacter actinomycetemcomitans (Aa) is a Gram-negative coccobacillus recognized as a pathogen in periodontitis and infective endocarditis. By producing a toxin (leukotoxin A, LtxA) that triggers global hypercitrullination in neutrophils, Aa has been recently linked to rheumatoid arthritis (RA) pathogenesis. Although mechanistic and clinical association studies implicate Aa infection in the initiation of autoimmunity in RA, direct evidence in humans is lacking.
Case:We describe a 59-year-old man with anti-citrullinated protein antibody (ACPA)-positive RA who presented for evaluation of refractory disease. He was found to have Aa endocarditis. Following antibiotic treatment, joint symptoms resolved and ACPAs normalized. Given the implications for RA immunopathogenesis, we further investigated the bacterial, genetic and immune factors that may have contributed to the patient's clinical and autoimmune phenotypes.
Methods:DNA was extracted from serum and used to amplify the Aa leukotoxin (ltx) promoter region by PCR, which was further analyzed by Sanger sequencing. High-resolution identification of HLA alleles was performed by sequenced based typing (SBT). TNF-α, IFN-γ, GM-CSF, IL-1β, IL-6, IL-8, IL-17A, IL-18, IL-21, and IL-22 were quantified in serum by a multiplex immunoassay. IgG and IgA antibodies to Aa LtxA were assayed by ELISA.
Results:Aa genotyping confirmed infection with a highly leukotoxic strain carrying a 530-bp ltx promoter deletion, shown to result in 10- to 20-fold higher bacterial expression of LtxA. Immuno-phenotyping showed high anti-LtxA antibodies, elevated cytokines implicated in RA pathogenesis (Th1/Th17), and specific host susceptibility conferred by three HLA alleles strongly linked to ACPAs and RA (DRB1*04:04, DRB1*15:01, and DPB1*04:01). One year after eradication of Aa, the patient remained free of arthritis and anti-CCP antibodies.
Conclusion: In the context of genetic risk for RA, systemic subacute infection with a leukotoxic strain of Aa can drive ACPA production and a clinical phenotype similar to RA.

Full text

CASE REPORT
published: 16 October 2018
doi: 10.3389/fimmu.2018.02352
Frontiers in Immunology | www.frontiersin.org 1October 2018 | Volume 9 | Article 2352
Edited by:
Juan-Manuel Anaya,
Universidad del Rosario, Colombia
Reviewed by:
Yovana Pacheco,
Universidad del Rosario, Colombia
Gabriel J. Tobón,
Fundacion Valle del Lili, Colombia
*Correspondence:
Boris Ehrenstein
b.ehrenstein@asklepios.com
Maximilian F. Konig
konig@jhmi.edu
Felipe Andrade
andrade@jhmi.edu
†These authors have contributed
equally to this work
Specialty section:
This article was submitted to
Autoimmune and Autoinflammatory
Disorders,
a section of the journal
Frontiers in Immunology
Received: 03 July 2018
Accepted: 24 September 2018
Published: 16 October 2018
Citation:
Mukherjee A, Jantsch V, Khan R,
Hartung W, Fischer R, Jantsch J,
Ehrenstein B, Konig MF and
Andrade F (2018) Rheumatoid
Arthritis-Associated Autoimmunity
Due to Aggregatibacter
actinomycetemcomitans and Its
Resolution With Antibiotic Therapy.
Front. Immunol. 9:2352.
doi: 10.3389/fimmu.2018.02352
Rheumatoid Arthritis-Associated
Autoimmunity Due to
Aggregatibacter
actinomycetemcomitans and Its
Resolution With Antibiotic Therapy
Amarshi Mukherjee 1†, Vanessa Jantsch 2† , Rida Khan 1, Wolfgang Hartung 2, René Fischer 3,
Jonathan Jantsch 4, Boris Ehrenstein 2
*, Maximilian F. Konig5
*and Felipe Andrade 1
*
1Division of Rheumatology, The Johns Hopkins University School of Medicine, Baltimore, MD, United States, 2Klinik und
Poliklinik für Rheumatologie, Klinische Immunologie, Asklepios Klinikum Bad Abbach, Bad Abbach, Germany, 3Department of
Otorhinolaryngology, University Hospital Regensburg, Regensburg, Germany, 4Institute of Clinical Microbiology and Hygiene,
University Hospital Regensburg and University of Regensburg, Regensburg, Germany, 5Department of Medicine,
Massachusetts General Hospital, Boston, MA, United States
Background: Aggregatibacter actinomycetemcomitans (Aa) is a Gram-negative
coccobacillus recognized as a pathogen in periodontitis and infective endocarditis.
By producing a toxin (leukotoxin A, LtxA) that triggers global hypercitrullination in
neutrophils, Aa has been recently linked to rheumatoid arthritis (RA) pathogenesis.
Although mechanistic and clinical association studies implicate Aa infection in the
initiation of autoimmunity in RA, direct evidence in humans is lacking.
Case: We describe a 59-year-old man with anti-citrullinated protein antibody
(ACPA)-positive RA who presented for evaluation of refractory disease. He was found to
have Aa endocarditis. Following antibiotic treatment, joint symptoms resolved and ACPAs
normalized. Given the implications for RA immunopathogenesis, we further investigated
the bacterial, genetic and immune factors that may have contributed to the patient’s
clinical and autoimmune phenotypes.
Methods: DNA was extracted from serum and used to amplify the Aa leukotoxin
(ltx) promoter region by PCR, which was further analyzed by Sanger sequencing.
High-resolution identification of HLA alleles was performed by sequenced based typing
(SBT). TNF-α, IFN-γ, GM-CSF, IL-1β, IL-6, IL-8, IL-17A, IL-18, IL-21, and IL-22 were
quantified in serum by a multiplex immunoassay. IgG and IgA antibodies to Aa LtxA were
assayed by ELISA.
Results: Aa genotyping confirmed infection with a highly leukotoxic strain
carrying a 530-bp ltx promoter deletion, shown to result in 10- to 20-fold
higher bacterial expression of LtxA. Immuno-phenotyping showed high anti-
LtxA antibodies, elevated cytokines implicated in RA pathogenesis (Th1/Th17),
and specific host susceptibility conferred by three HLA alleles strongly linked to
ACPAs and RA (DRB1∗04:04, DRB1∗15:01, and DPB1∗04:01). One year after
eradication of Aa, the patient remained free of arthritis and anti-CCP antibodies.

Mukherjee et al. Aggregatibacter actinomycetemcomitans-Induced Rheumatoid Arthritis
Conclusion: In the context of genetic risk for RA, systemic subacute infection with a
leukotoxic strain of Aa can drive ACPA production and a clinical phenotype similar to RA.
Keywords: rheumatoid arthritis, ACPA, anti-CCP, Aggregatibacter actinomycetemcomitans, autoantibodies
INTRODUCTION
Aggregatibacter actinomycetemcomitans (Aa) is a Gram-negative
coccobacillus first described in 1912 as a co-isolate from
actinomycosis lesions (“Bacterium actinomycetem comitans”) (1).
Aa has since been recognized as a pathogen in periodontitis
and, as part of the HACEK group, in rare cases of infective
endocarditis (IE) (2–4). Recently, Aa has been proposed as a link
between periodontitis and autoimmunity in rheumatoid arthritis
(RA) due to its ability to induce citrullinated autoantigens
targeted by anti-citrullinated protein antibodies (ACPAs) (5).
Leukotoxin A (LtxA) is an acylated protein toxin secreted
by Aa and a major virulence factor in periodontitis (4). By
acting as a pore-forming toxin, LtxA induces membranolysis and
cell death in host immune cells, thus permitting escape from
immune surveillance (4). This pathway has been shown to drive
hypercitrullination of RA autoantigens in human neutrophils,
thus linking Aa leukotoxicity to RA immunopathogenesis (5).
Leukotoxic strains of Aa (as measured by antibodies to LtxA)
are highly prevalent in RA. Exposure to Aa is strongly associated
with ACPAs and rheumatoid factor (RF) in individuals carrying
HLA-DRB1 shared epitope (SE) alleles, which confer genetic
susceptibility to RA. Together, these findings have implicated
Aa as a candidate trigger of autoimmunity in individuals at risk
for RA (5). However, experimental evidence to demonstrate a
causative effect is missing. Here, we report a case of early RA
associated with Aa endocarditis and its resolution with antibiotic
therapy. We believe that this case provides direct evidence that in
the setting of genetic susceptibility, Aa is an etiologic agent that
can induce ACPA production and arthritis in humans.
CASE REPORT
A 59-year-old Caucasian man with a history of severe mitral
regurgitation and recent diagnosis of seropositive RA was
admitted to the hospital for evaluation of refractory joint pain
and swelling. Four years prior to admission, the patient had
undergone prosthetic mitral valve replacement. Since then, he
had received deep dental cleanings twice a year. The patient
was in his usual health until 11 months prior to admission,
when he developed intermittent pain and swelling of his knees,
right hip, right elbow, and wrists bilaterally that was associated
with morning stiffness of >1 h. He endorsed 11 lbs. weight
loss and night sweats, but no fevers. Following 6 months of
persistent symptoms, the patient saw a local rheumatologist who
noted synovitis of the 2nd left metacarpophalangeal joint and
tenosynovitis of the extensor tendons of his left hand. Laboratory
workup showed evidence of systemic inflammation [C-reactive
protein (CRP) 100 mg/L, erythrocyte sedimentation rate (ESR)
84 mm/h] and positive ACPAs (measured by the anti-CCP
antibody assay). Testing for RF was negative. The patient was
diagnosed with early seropositive RA, and he was started on
immunosuppression with prednisolone and methotrexate. Given
lack of clinical improvement, leflunomide was added. Due to
persistent joint pain and swelling, the patient was hospitalized 2
months later for evaluation.
At the time of hospital admission, laboratory evaluation
showed CRP 112 mg/L, ESR 79 mm/h, and high-titer anti-
CCP IgG antibodies (262 U/mL; reference range <17 U/mL).
Musculoskeletal ultrasound (US) showed effusion of the 2nd
and 3rd right proximal interphalangeal joints as well as 1st
and 4th right metatarsophalangeal joints. There was evidence
of tenosynovitis of the right wrist extensor tendons, and
inflammation of the flexor tendons of the right ankle and
right Achilles tendon. Radiographs of the hands and feet
showed no erosions. Prednisolone was increased. The patient
was started on etanercept, and leflunomide was discontinued.
Following a brief period of improvement, the pain around
the right Achilles tendon and right wrist flexor tendons
worsened within 3 weeks. US revealed new abscess formation
along the right Achilles tendon. Incision and drainage was
performed with wound cultures demonstrating Aa by PCR
and sequence analysis. Blood cultures grew Aa in 2/3 sets
of bottles, and echocardiography confirmed prosthetic mitral
valve endocarditis. All immunosuppressive medications were
discontinued, and antibiotic therapy with ceftriaxone 2 g IV daily
was started. CRP levels decreased, and the joint pain improved.
After completing a 6 week course of intravenous antibiotics,
the patient’s joint pain and swelling had resolved. Thereafter,
anti-CCP antibody levels started to decline (Figure 1A). A
non-ulcerated squamous cell carcinoma of the tongue was
subsequently diagnosed and treated with radiotherapy. At ∼1
year follow-up, the patient remained free of joint symptoms, and
anti-CCP antibodies and CRP levels had normalized (anti-CCP
13.5 U/mL; CRP 5 mg/L) (Figure 1A).
MATERIALS AND METHODS
Aa Ltx Promoter Genotyping
DNA extracted from patient serum (QIAamp DNA kit, Qiagen),
and DNA from strains Aa HK1651 (serotype b, ATCC 700685)
and Aa SUNY ab75 (serotype a, ATCC 43717) were used to
amplify the Aa ltx promoter region by PCR using primers
ltx3/ltx4 (ltx3:5′-GCCGACACCAAAGACAAAGTCT-3′and ltx4:
5′-GCCCATAACCAAGCCACATAC-3′) as previously described
(6). Aa strains HK1651 and SUNY ab75 were used as a reference
for JP2 and non-JP2 clones, respectively. The PCR product
amplified from patient serum was analyzed by Sanger sequencing
in both 5′and 3′directions using the ltx3 and ltx4 primers,
respectively.
Frontiers in Immunology | www.frontiersin.org 2October 2018 | Volume 9 | Article 2352

Mukherjee et al. Aggregatibacter actinomycetemcomitans-Induced Rheumatoid Arthritis
HLA genotype
A 02:01
B 35:08/57:01
C 04:01/06:02
Bw 6/4
DRB104:04/15:01
DRB4 01:03
DRB5 01:01
DQA1 01:02/03:03
DQB1 06:02/04:02
DPB1 04:01
GCCGACACCAAAGACAAAGTCTTGGCAATTTGTAAACGTCTTCCGGTTTACGCGTAATTTTAATCAAATGAAAAAAAACA
AAGCGGTAATGAAAATTGCCGCTTTTTCTTTTTGAGAAATATGACAGTCAAAATCTTACAGATCAAAACCTGATAACAGT
ATTTTCTCAGTCTAATTTTTGCGTATTAATACAATACGGGATTGCGTAGATAAAGTATTATCAAAAAGACTAATAATTTT
ATGAAATTAAATAATTTTTTCTATTGACTATTAAAGAATCCGGAGTAAATTAGTCTCCAAAATTAACCAAAACTAGGTAA
TTTATCCGGTCAAAGGTTATCTTAAGTATTAACCCTAAGAAAAAGGAAAACGAGTATGTCCAGTACAGAATATGCTCCAT
TTTATCTCCGTTTTATTCAGTTCCCAAGTAATGAAGTTTTACTCTATGAATACTGGAAACTTGTTCAGAATTTTGTACAA
AAGGTTAGTAAAATAACGGTAAGATTAGCACAAATCGTTGGCATTCTCGGCGAAAAAACTATTTGGAAATACCAAAGTAC
TTTTAATGATGGCATGCTGG
aaggtgaagcagctaaacaagaagtttcccgcactttaagaagtagtgctttacttgtcg
caagtgccatagttatccactttaaatctaattttaccaaccttcttatactgtcacagattacacaatattgtagacat
cgccctaaacctaaaaaaagtaaatacttccccctctacctctcttgcttattacgcagacgattaactgaatttaaaat
tacccttctaccgttgccatggggctagctgctatatagctatgaagatcaaatcccggttttcattgtaaatttaaaaa
tatataagaaataatctgaagccgactttatttttacccaactacgaatcactcatttaaattaaataggtttattatgc
aaaataataaagcttgaatatattcctgtaatataaggttaaataagttatatttctatttattgtttaacaataataat
taaatcatagtctatttgatttcgtaatgagtttggcattttctgtcatgcgatcgtgtaagttattttgt
ATATTGTGG
TTTGGTTATCTTATTCAAAATAAATTATTAACAAGGAGATTTAATATGGAGAAAAATAATAATTTTGAAGTGTTAGGGTA
TGTGGCTTGGTTATGGGC
5
7b
a
YNU
S
aA
1561KH
aA
eitaP
aA t
n
1.2 kb
0.7 kb
B
C
A
0520 20010050 150 300 350
0
250
100
150
200
50
)
L/
gm( P
R
C
)Lm
/
U( PCC-itnA
Days
Anti-CCP
CRP
300
100
200
0
FIGURE 1 | Autoimmune, genetic, and microbial factors associated with Aa-induced early RA. (A) Serial measurements of C-reactive protein (CRP) and anti-cyclic
citrullinated peptide (CCP) antibodies. Day 0 marks the diagnosis of Aa endocarditis. Anti-CCP was determined in serum using an automated
electrochemiluminescence immunoassay platform (Elecsys, Roche). The dotted line marks the cut-off for anti-CCP antibody positivity (17 U/mL). (B) DNA extracted
from patient serum was used to amplify the Aa ltx promoter region by PCR. PCR products of strains Aa HK1651 and Aa SUNY ab75 were used as a reference for JP2
and non-JP2 clones, respectively. The PCR product amplified from patient serum was analyzed by Sanger sequencing. The resulting nucleotide sequence is shown in
black. The missing nucleotide sequence corresponding to the 530-bp deletion (1530) previously described in Aa JP2 clones is shown in gray. (C) HLA genotype. HLA
risk alleles linked to ACPA production and RA are marked in red.
HLA Typing
Sequenced based typing (SBT) was used for high-resolution
identification of alleles of HLA-A, -B, -C, - DRB1, -DQB1, and
-DPB1. SBT uses PCR to amplify the locus of interest and Sanger
sequencing to determine the nucleotide sequence. HLA-typing
was performed at the Johns Hopkins University Immunogenetics
Laboratory.
Quantification of Cytokines and Anti-LtxA
Antibodies in Serum
Serial measurements of TNF-α, IFN-γ, GM-CSF, IL-1β, IL-6, IL-
8, IL-17A, IL-18, IL-21, and IL-22 were quantified in patient
serum by multiplex immunoassay (Meso Scale Diagnostics). IgG
and IgA antibodies to LtxA were assayed in serial serum samples
by ELISA as previously described (5) using a recombinant
immunodominant peptide of LtxA (amino acids 730-1055) as
antigen (5).
RESULTS
Bacterial Virulence of Aa
The virulence factor LtxA generates citrullinated autoantigens in
human neutrophils (5). Expression of LtxA varies considerably
among Aa strains and is regulated by both environmental factors
and genetic variation within the ltx promoter (7,8). To define
potential variations in the ltx promoter region associated with
highly virulent strains, bacterial DNA from patient serum was
amplified by PCR (Figure 1B). The amplified ltx promoter
contained a 530-bp deletion (1530), which has been shown to
result in 10- to 20-fold higher expression of LtxA compared
to wild-type Aa strains due to deletion of a transcriptional
terminator (6,8,9). These data indicate that the patient was
infected with a highly leukotoxic strain of Aa.
Genetic Susceptibility
Since the presence of autoantibodies in RA patients carrying
HLA-DRB1 susceptibility alleles is strongly linked to Aa exposure
(5), HLA-typing was performed at high resolution (Figure 1C).
The patient’s haplotypes revealed at least 3 HLA alleles strongly
associated with seropositive RA: two heterozygous DRB1 risk
alleles (∗04:04 and ∗15:01) and one homozygous DPB1 risk
allele (∗04:01) (10,11). DRB1∗04:04 confers strong disease
susceptibility by the presence of residues Val, Arg and Ala
at positions 11, 71, and 74, respectively. In DRB1∗15:01 and
DPB1∗04:01, risk is defined by amino acid positions 74 (Ala)
and 9 (Phe), respectively. These residues are located within the
antigen-binding groove of the HLA class II molecule (10), and
may facilitate presentation of citrullinated self-peptides (12).
Inflammatory Milieu
To define the inflammatory milieu that may have contributed to
loss of immune tolerance and arthritis, a panel of cytokines was
quantified in samples collected longitudinally after diagnosis of
Aa infection (Figures 2A–J). The cytokine profile induced by Aa
was characterized by expression of several cytokines implicated
in autoimmunity and RA (13). These included TNF-α, IFN-γ,
Frontiers in Immunology | www.frontiersin.org 3October 2018 | Volume 9 | Article 2352

Mukherjee et al. Aggregatibacter actinomycetemcomitans-Induced Rheumatoid Arthritis
0
75
50
25
0
300
200
100
0
6000
4000
2000
0
1.0
0.8
0.6
0.2
0.4
0
10
8
6
2
4
0
1.0
0.8
0.6
0.2
0.4
0
50
40
30
10
20
0
250
200
150
50
100
0
50
40
30
10
20
0
10
8
6
2
4
0
600
400
300
100
200
500
8210 6432
16 6528
IgA
IgG
8210 643216 6528 8210 6432
16 6528 8210 6432
16 6528 8210 6432
16 6528 8210 6432
16 6528
8210 643216 6528 8210 6432
16 6528 8210 6432
16 6528 8210 6432
16 6528 8210 6432
16 6528
)
UA(
A
xtL-it
n
AFSC-MG
TNF
α
6
-
LI
γ-NFI
8
1
-
LI
IL-8
IL-1βIL-21
IL-17AIL-22
CA B
F
ED
IHG
K
J
Days DaysDaysDaysDays
Days DaysDaysDaysDays
Days
FIGURE 2 | Serum cytokines and anti-LtxA antibodies during Aa infection and after initiation of antibiotic treatment. (A–J), Serial measurements of TNF-α, IFN-γ,
IL-18, IL-1β, IL-17A, GM-CSF, IL-6, IL-8, IL-21, and IL-22 (pg/mL), respectively. (K) Serial quantification of IgG and IgA antibodies to LtxA. Dotted lines mark cut-offs
for anti-LtxA positivity, which were established using a cohort of healthy individuals without periodontitis (5). Cytokine and anti-LtxA antibody levels were assayed in
triplicate and duplicate, respectively. Mean values are shown. Day 0 marks the diagnosis of Aa endocarditis.
IL-1β, IL-17A, and IL-18 (Figures 2A–E). Levels decreased
progressively within weeks to months after initiation of antibiotic
treatment, which coincided with clinical improvement. Other
cytokines did not show similar dynamics, including GM-CSF,
IL-6, IL-8, IL-21, and IL-22 (Figures 2F–J).
Humoral Immunity to Aa
Although IgA and IgG antibodies to LtxA were positive at the
time of IE diagnosis, levels markedly increased several days after
initiation of antibiotic treatment (Figure 2K). This coincided
with a decline in peripheral cytokine levels (Figures 2A–E). The
increase in anti-LtxA antibody levels suggests a more efficient
humoral immune response against Aa, which may have aided
pathogen clearance. Anti-LtxA antibody levels decreased with
time, but remained positive at lower titers. Similar dynamics of
the anti-Aa antibody response have previously been reported
with initiation of periodontal treatment (14).
DISCUSSION
Autoimmune diseases result from the interplay of genetic
susceptibility, environmental factors, and stochastic events
that together determine an individual’s risk of developing
disease. Loss of tolerance to peptidylcitrulline is an immune
hallmark of RA (15), and pathogens with the potential to
provoke autoantigen citrullination have emerged as putative
agents that may trigger or sustain the anti-CCP response in
RA (16). An association between RA and Aa is supported by
mechanistic and clinical evidence (5). We believe this case
provides proof of concept that in the genetically predisposed
individual, Aa can induce the autoimmune responses associated
with RA. The resolution of RA-associated symptoms (i.e.,
morning stiffness, polyarthritis, tenosynovitis) and anti-
CCP antibodies with antibiotic therapy further supports
an etiological role of Aa in driving autoimmunity in this
patient.
Aa endocarditis is an insidious disease with a subacute
or chronic course, which can have a prolonged period of
symptoms before diagnosis (up to 60 weeks) (17). The presence
of prosthetic heart valves, oral infection and dental procedures
are among the risk factors associated with this illness (17).
Since periodontal infection was not documented in the case
presented here, it is possible to suggest that Aa may have reached
the vascular compartment as result of inoculation during deep
dental cleaning. Different to other cases of Aa endocarditis
that present with prominent systemic features (fever, weight
loss, rash, hepatosplenomegaly, hematological abnormalities, and
hematuria) and often severe complications such as heart failure,
renal failure, mycotic aneurysms, and septic embolization (17),
the clinical course in this patient was exceptionally defined by
arthritis and anti-CCP antibodies.
Frontiers in Immunology | www.frontiersin.org 4October 2018 | Volume 9 | Article 2352

Mukherjee et al. Aggregatibacter actinomycetemcomitans-Induced Rheumatoid Arthritis
It is possible that several factors may have contributed to the
patient’s risk of developing loss of tolerance to peptidylcitrulline
and RA-associated symptoms in the setting of (sub-)acute Aa
infection. First, we identified a strong genetic susceptibility for
seropositive RA as conferred by 3 distinct HLA-class II risk alleles
in 2 loci (DRB1∗04:04, DRB1∗15:01, and DPB1∗04:01). Distinct
alleles are thought to confer additional disease risk by expanding
the repertoire of possible RA autoantigens presented on HLA-
class II molecules (18). In this patient, the different risk alleles
likely conferred independent susceptibility to RA through the
presence of distinct amino acid residues within the HLA class II
binding groove (10).
Second, the patient was found to be infected with a highly
leukotoxic Aa strain that carries a 1530 ltx promoter deletion
(8). This genotype of Aa, first described in the highly leukotoxic
strain JP2 (8), is endemic in various populations originating
in North and Central Africa and associated with aggressive
periodontitis (4). The prevalence of JP2-like strains in Aa
endocarditis is unknown, but to our knowledge, no cases are
reported to date. In a study of 35 blood isolates of Aa, no JP2
promoter deletions were identified (19). As the generation of
citrullinated autoantigens by Aa is dependent on LtxA alone
(5), the identification of the highly leukotoxic JP2 genotype
may explain why loss of immunologic tolerance to citrullinated
proteins and clinical autoimmunity occurred in this patient.
Although certain autoantibodies including RF are common in IE,
anti-CCP antibodies have only been reported in one case of IE in
which the pathogen was not identified (20). Indeed, the unlikely
co-incidence of infection with a rare, highly virulent genotype of
Aa in a patient uniquely predisposed to make ACPAs may explain
why anti-CCPs and RA have not been reported in other cases of
Aa endocarditis.
A third factor that may have facilitated the induction of
arthritis is the unique pro-inflammatory milieu associated with
Aa JP2 infection. Aa serotype b, which includes JP2 clones (8),
is a potent inducer of Th1 (TNF-αand IFN-γ) and Th17 (IL-
17A) immune phenotypes (21). LtxA also induces production
of IL-1βand IL-18 by macrophages (22). These cytokines,
which are central mediators in the immunopathogenesis of RA
(13), also characterized the systemic cytokine profile identified
in this patient during active Aa infection (Figures 2A–E).
Although it is difficult to define whether these cytokines played
a role in the patient’s clinical presentation, it is interesting that
although the addition of etanercept transiently improved the
joint symptoms, it may also have allowed for abscess formation
which help to unmask the underlying infection with Aa. Thus, it
is possible that the cytokine milieu induced by the Aa JP2 strain
helped to limit bacterial dissemination and the development
of common complications associated with Aa endocarditis, but
also contributed (together with Aa-induced anti-CCPs) to the
development of arthritis in this patient. TNFαblockade may
indeed have changed the clinical course of the disease from
an indolent infection with RA phenotype to a more typical
presentation of Aa endocarditis (e.g., septic emboli).
Although the patient fulfilled the 2010 ACR/EULAR
classification criteria for RA [8/10 points based on synovitis of
at least 4 small joints (3 pt.); ACPA >3xULN (3 pt.); duration
>6 weeks [1 pt.]; and abnormal CRP and ESR (1 pt.)] (23), his
disease course is not classic. In RA, the transition from pre-
clinical autoimmunity to overt arthritis often takes several years
(24). This is consistent with a model of indolent infection such
as periodontitis or bronchiectasis leading to chronic antigenic
simulation (25). In cases of RA potentially associated with Aa
periodontitis, the production of citrullinated autoantigens would
represent a chronic, localized process which may result in long
preclinical phase. During this phase, amplification pathways
may be established that maintain disease. In this case of systemic
Aa infection, widespread production of RA autoantigens
triggered by a highly leukotoxic strain of Aa may have resulted
in acute autoantibody production and arthritis, which rapidly
resolved after the driver of autoantigen production (i.e., Aa) was
eradicated.
It is now appreciated that the relationship between infectious
agents and autoimmune arthritis is more complex than the
one pathogen-one disease model that built the conceptual
framework for Koch’s postulates. The existence of a single
pathogen that acts as a driver of autoimmunity in all patients
with RA is unlikely. Similarly, only a fraction of individuals
infected with a microbial species of arthritogenic potential
will develop RA. This case underscores the importance of
both genetic susceptibility and environmental agents for the
induction of autoimmune pathology, and in a human model
provides direct evidence that leukotoxic strains of Aa can trigger
autoimmune features found in RA. Moreover, it suggests that
in some cases, this pathogen can be a reversible cause of RA.
Although the idea of definitive treatment of early autoimmunity
in RA is enticing, it remains uncertain whether established RA
associated with Aa periodontitis may be modifiable by antibiotic
therapy.
ETHICS STATEMENT
The patient gave written informed consent prior presentation of
the case. The case report is not part of a clinical trial.
AUTHOR CONTRIBUTIONS
AM, JJ, and RK performed in vitro studies. VJ, WH, RF, and
BE clinically followed the patient. FA supervised experiments.
MK and FA wrote the manuscript and prepared the figures.
All authors contributed to the preparation of the final
manuscript.
FUNDING
Funding for this project was provided by the Jerome L.
Greene Foundation, and National Institute of Arthritis,
and Musculoskeletal and Skin Diseases (NIAMS)/National
Institutes of Health (NIH) grant R01 AR069569. The
content is solely the responsibility of the authors and does
not necessarily represent the official views of NIAMS or
the NIH.
Frontiers in Immunology | www.frontiersin.org 5October 2018 | Volume 9 | Article 2352

Mukherjee et al. Aggregatibacter actinomycetemcomitans-Induced Rheumatoid Arthritis
REFERENCES
1. Kingler R. Untersuchungen über menschliche Aktinomycose. Zentralbl
Bakteriol. (1912) 62:191–200.
2. Geraci JE, Wilson WR. Symposium on infective endocarditis. III. Endocarditis
due to gram-negative bacteria. Report of 56 cases. Mayo Clin Proc. (1982)
57:145–8.
3. Tanner AC, Haffer C, Bratthall GT, Visconti RA, Socransky SS. A study of the
bacteria associated with advancing periodontitis in man. J Clin Periodontol.
(1979) 6:278–307. doi: 10.1111/j.1600-051X.1979.tb01931.x
4. Johansson A. Aggregatibacter actinomycetemcomitans leukotoxin: a powerful
tool with capacity to cause imbalance in the host inflammatory response.
Toxins (2011) 3:242–59. doi: 10.3390/toxins3030242
5. Konig MF, Abusleme L, Reinholdt J, Palmer RJ, Teles RP, Sampson K,
et al. Aggregatibacter actinomycetemcomitans-induced hypercitrullination
links periodontal infection to autoimmunity in rheumatoid arthritis. Sci
Transl Med. (2016) 8:369ra176. doi: 10.1126/scitranslmed.aaj1921
6. Poulsen K, Ennibi OK, Haubek D. Improved PCR for detection of
the highly leukotoxic JP2 clone of Actinobacillus actinomycetemcomitans
in subgingival plaque samples. J Clin Microbiol. (2003) 41:4829–32.
doi: 10.1128/JCM.41.10.4829-4832.2003
7. Hoglund AC, Haubek D, Kwamin F, Johansson A, Claesson
R. Leukotoxic activity of Aggregatibacter actinomycetemcomitans
and periodontal attachment loss. PLoS ONE (2014) 9:e104095.
doi: 10.1371/journal.pone.0104095
8. Brogan JM, Lally ET, Poulsen K, Kilian M, Demuth DR. Regulation of
Actinobacillus actinomycetemcomitans leukotoxin expression: analysis of the
promoter regions of leukotoxic and minimally leukotoxic strains. Infect
Immun. (1994) 62:501–8.
9. Sampathkumar V, Velusamy SK, Godboley D, Fine DH. Increased
leukotoxin production: Characterization of 100 base pairs within
the 530 base pair leukotoxin promoter region of Aggregatibacter
actinomycetemcomitans.Sci Rep. (2017) 7:1887. doi: 10.1038/s41598-017-0
1692-6
10. Raychaudhuri S, Sandor C, Stahl EA, Freudenberg J, Lee HS, Jia X, et al. Five
amino acids in three HLA proteins explain most of the association between
MHC and seropositive rheumatoid arthritis. Nat Genet. (2012) 44:291–6.
doi: 10.1038/ng.1076
11. Terao C, Suzuki A, Ikari K, Kochi Y, Ohmura K, Katayama M,
et al. An association between amino acid position 74 of HLA-DRB1
and anti-citrullinated protein antibody levels in Japanese patients with
anti-citrullinated protein antibody-positive rheumatoid arthritis. Arthritis
Rheumatol. (2015) 67:2038–45. doi: 10.1002/art.39133
12. Scally SW, Petersen J, Law SC, Dudek NL, Nel HJ, Loh KL, et al.
A molecular basis for the association of the HLA-DRB1 locus,
citrullination, and rheumatoid arthritis. J Exp Med. (2013) 210:2569–82.
doi: 10.1084/jem.20131241
13. McInnes IB, Buckley CD, Isaacs JD. Cytokines in rheumatoid arthritis -
shaping the immunological landscape. Nat Rev Rheumatol. (2016) 12:63–8.
doi: 10.1038/nrrheum.2015.171
14. Sjostrom K, Ou J, Whitney C, Johnson B, Darveau R, Engel D, et al. Effect
of treatment on titer, function, and antigen recognition of serum antibodies
to Actinobacillus actinomycetemcomitans in patients with rapidly progressive
periodontitis. Infect Immun. (1994) 62:145–51.
15. Schellekens GA, de Jong BA, van den Hoogen FH, van de Putte LB, van
Venrooij WJ. Citrulline is an essential constituent of antigenic determinants
recognized by rheumatoid arthritis-specific autoantibodies. J Clin Invest.
(1998) 101:273–81. doi: 10.1172/JCI1316
16. Theofilopoulos AN, Kono DH, Baccala R. The multiple pathways to
autoimmunity. Nat Immunol. (2017) 18:716–24. doi: 10.1038/ni.3731
17. Paturel L, Casalta JP, Habib G, Nezri M, Raoult D.
Actinobacillus actinomycetemcomitans endocarditis. Clin Microbiol
Infect. (2004) 10:98–118. doi: 10.1111/j.1469-0691.2004.00
794.x
18. Lenz TL, Deutsch AJ, Han B, Hu X, Okada Y, Eyre S, et al. Widespread
non-additive and interaction effects within HLA loci modulate the risk of
autoimmune diseases. Nat Genet. (2015) 47:1085–90. doi: 10.1038/ng.3379
19. Paju S, Carlson P, Jousimies-Somer H, Asikainen S. Heterogeneity
of Actinobacillus actinomycetemcomitans strains in various human
infections and relationships between serotype, genotype, and antimicrobial
susceptibility. J Clin Microbiol. (2000) 38:79–84.
20. Bojalil R, Mazon-Gonzalez B, Carrillo-Cordova JR, Springall R, Amezcua-
Guerra LM. Frequency and clinical significance of a variety of autoantibodies
in patients with definite infective endocarditis. J Clin Rheumatol. (2012)
18:67–70. doi: 10.1097/RHU.0b013e318247caf0
21. Diaz-Zuniga J, Melgar-Rodriguez S, Alvarez C, Monasterio G, Benitez
A, Ciuchi P, et al. T-lymphocyte phenotype and function triggered by
Aggregatibacter actinomycetemcomitans is serotype-dependent. J Periodontal
Res. (2015) 50:824–35. doi: 10.1111/jre.12270
22. Kelk P, Abd H, Claesson R, Sandstrom G, Sjostedt A, Johansson A.
Cellular and molecular response of human macrophages exposed to
Aggregatibacter actinomycetemcomitans leukotoxin. Cell Death Dis. (2011)
2:e126. doi: 10.1038/cddis.2011.6
23. Aletaha D, Neogi T, Silman AJ, Funovits J, Felson DT, Bingham CO III,
et al. 2010 rheumatoid arthritis classification criteria: an American College
of Rheumatology/European League Against Rheumatism collaborative
initiative. Arthritis Rheum. (2010) 62:2569–81. doi: 10.1002/art.27584
24. Nielen MM, van SD, Reesink HW, van de Stadt RJ, van der Horst-Bruinsma
IE, de Koning MH, et al. Specific autoantibodies precede the symptoms of
rheumatoid arthritis: a study of serial measurements in blood donors. Arthritis
Rheum. (2004) 50:380–6. doi: 10.1002/art.20018
25. Catrina AI, Svensson CI, Malmstrom V, Schett G, Klareskog L.
Mechanisms leading from systemic autoimmunity to joint-specific
disease in rheumatoid arthritis. Nat Rev Rheumatol. (2017) 13:79–86.
doi: 10.1038/nrrheum.2016.200
Conflict of Interest Statement: FA received a grant from Medimmune and is
author on issued Patent No. 8,975,033 entitled “Human Autoantibodies Specific
for PAD3 which are Cross-reactive with PAD4 and their Use in the Diagnosis
and Treatment of Rheumatoid Arthritis and Related Diseases.” FA has served as
consultant for Bristol-Myers Squibb Company and Pfizer.
The remaining authors declare that the research was conducted in the absence of
any commercial or financial relationships that could be construed as a potential
conflict of interest.
The reviewer YP and handling Editor declared their shared affiliation at the time
of the review.
Copyright © 2018 Mukherjee, Jantsch, Khan, Hartung, Fischer, Jantsch, Ehrenstein,
Konig and Andrade. This is an open-access article distributed under the terms
of the Creative Commons Attribution License (CC BY). The use, distribution or
reproduction in other forums is permitted, provided the original author(s) and the
copyright owner(s) are credited and that the original publication in this journal
is cited, in accordance with accepted academic practice. No use, distribution or
reproduction is permitted which does not comply with these terms.
Frontiers in Immunology | www.frontiersin.org 6October 2018 | Volume 9 | Article 2352