ArticlePDF Available

Flor Yeast Diversity and Dynamics in Biologically Aged Wines

Authors:

Abstract and Figures

Wine biological aging is characterized by the development of yeast strains that form a biofilm on the wine surface after alcoholic fermentation. These yeasts, known as flor yeasts, form a velum that protects the wine from oxidation during aging. Thirty-nine velums aged from 1 to 6 years were sampled from “Vin jaune” from two different cellars. We show for the first time that these velums possess various aspects in term of color and surface aspects. Surprisingly, the heterogeneous velums are mostly composed of one species, S. cerevisiae. Scanning electron microscope observations of these velums revealed unprecedented biofilm structures and various yeast morphologies formed by the sole S. cerevisiae species. Our results highlight that different strains of Saccharomyces are present in these velums. Unexpectedly, in the same velum, flor yeast strain succession occurred during aging, supporting the assumption that environmental changes are responsible for these shifts. Despite numerous sample wine analyses, very few flor yeasts could be isolated from wine following alcoholic fermentation, suggesting that flor yeast development results from the colonization of yeast present in the aging cellar. We analyzed the FLO11 and ICR1 sequence of different S. cerevisiae strains in order to understand how the same strain of S. cerevisiae could form various types of biofilm. Among the strains analyzed, some were heterozygote at the FLO11 locus, while others presented two different alleles of ICR1 (wild type and a 111 bp deletion). We could not find a strong link between strain genotypes and velum characteristics. The same strain in different wines could form a velum having very different characteristics, highlighting a matrix effect.
Content may be subject to copyright.
fmicb-09-02235 September 21, 2018 Time: 14:45 # 1
ORIGINAL RESEARCH
published: 25 September 2018
doi: 10.3389/fmicb.2018.02235
Edited by:
Vittorio Capozzi,
University of Foggia, Italy
Reviewed by:
Lucía González-Arenzana,
Instituto de Ciencias de la Vid y del
Vino (ICVV), Spain
Juan Carlos Mauricio,
Universidad de Córdoba, Spain
*Correspondence:
Hervé Alexandre
rvalex@u-bourgogne.fr
Specialty section:
This article was submitted to
Food Microbiology,
a section of the journal
Frontiers in Microbiology
Received: 05 July 2018
Accepted: 03 September 2018
Published: 25 September 2018
Citation:
David-Vaizant V and Alexandre H
(2018) Flor Yeast Diversity
and Dynamics in Biologically Aged
Wines. Front. Microbiol. 9:2235.
doi: 10.3389/fmicb.2018.02235
Flor Yeast Diversity and Dynamics in
Biologically Aged Wines
Vanessa David-Vaizant1,2 and Hervé Alexandre1,2*
1AgroSup Dijon, PAM UMR A 02.102, Université Bourgogne Franche-Comté, Dijon, France, 2Equipe VAlMiS, Institut
Universitaire de la Vigne et du Vin, Dijon, France
Wine biological aging is characterized by the development of yeast strains that form a
biofilm on the wine surface after alcoholic fermentation. These yeasts, known as flor
yeasts, form a velum that protects the wine from oxidation during aging. Thirty-nine
velums aged from 1 to 6 years were sampled from “Vin jaune” from two different cellars.
We show for the first time that these velums possess various aspects in term of color
and surface aspects. Surprisingly, the heterogeneous velums are mostly composed
of one species, S. cerevisiae. Scanning electron microscope observations of these
velums revealed unprecedented biofilm structures and various yeast morphologies
formed by the sole S. cerevisiae species. Our results highlight that different strains of
Saccharomyces are present in these velums. Unexpectedly, in the same velum, flor yeast
strain succession occurred during aging, supporting the assumption that environmental
changes are responsible for these shifts. Despite numerous sample wine analyses, very
few flor yeasts could be isolated from wine following alcoholic fermentation, suggesting
that flor yeast development results from the colonization of yeast present in the aging
cellar. We analyzed the FLO11 and ICR1 sequence of different S. cerevisiae strains in
order to understand how the same strain of S. cerevisiae could form various types of
biofilm. Among the strains analyzed, some were heterozygote at the FLO11 locus, while
others presented two different alleles of ICR1 (wild type and a 111 bp deletion). We
could not find a strong link between strain genotypes and velum characteristics. The
same strain in different wines could form a velum having very different characteristics,
highlighting a matrix effect.
Keywords: flor yeast, biofilm, wine, Saccharomyces cerevisiae, scanning electron microscopy, FLO11, vin jaune
INTRODUCTION
Wine is produced through the action of a complex microbial consortium (Petruzzi et al., 2017)
composed among others of numerous non-Saccharomyces yeast species and a high diversity of
S. cerevisiae (Capece et al., 2016). In the world of S. cerevisiae, flor yeast constitutes an exception.
Flor yeast or flor velum yeasts can grow at the surface of different wines. These flor yeasts can be
found in very specific wine processes known as biological aging practiced in Spain (Andalusia),
Italy (Sardinia), Hungary and France (Jura) to produce Xeres, Vernaccia di Oristano, Szamorodni,
and Vin Jaune wines, respectively.
In the classical wine process, yeast dies in the absence of sugar and oxygen at the end of
the alcoholic fermentation. However, in the case of biological aging, the common characteristic
of these wines is that after alcoholic fermentation, they are transferred into barrels, leaving
Frontiers in Microbiology | www.frontiersin.org 1September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 2
David-Vaizant and Alexandre Flor Yeast Dynamics
an airspace. According to different authors (Esteve-Zarzoso et al.,
2001;Aranda et al., 2002) in these conditions of nitrogen and
sugar depletion encountered at the end of alcoholic fermentation,
the yeast shifts from a fermentative to an oxidative metabolism
favored by the presence of oxygen. Furthermore, at the diauxic
shift, an increase in FLO11 expression is observed which leads
to an increase in cell surface hydrophobicity, facilitating the
aggregation of cells and the entrapment of carbon dioxide,
allowing the cell aggregate to rise to the surface and develop a
biofilm (Zara et al., 2005). Thus, based on this model, yeasts
responsible for alcoholic fermentation could be responsible for
forming biofilm. However, to our knowledge, only two studies
have compared the yeast Saccharomyces present during alcoholic
fermentation to those present in the velum (Esteve-Zarzoso et al.,
2001;Naumova et al., 2005). The first study concluded that
yeasts responsible for alcoholic fermentation are different from
velum yeast. However, the must in this study was inoculated with
commercial yeast (Esteve-Zarzoso et al., 2001) which could have
influenced the development of indigenous yeast. In the second
study, Naumova et al. (2005) demonstrated that among all the
S. cerevisiae yeasts isolated at distinct stages of sherry making
(young wine, solera, and criadera) in various winemaking regions
of Spain, that sherry yeasts diverged from primary winemaking
yeasts. Thus, not all Saccharomyces are able to form a biofilm
(Alexandre, 2013;Legras et al., 2016). The ability to form a
biofilm is closely linked to the specific FLO11 alleles present in
flor yeast (Fidalgo et al., 2006). Indeed, the FLO11 promoter
is 0.1 kb shorter and the coding sequence is 1 kb larger in
flor-forming yeast compared to non-flor-forming yeast (Fidalgo
et al., 2006;Zara et al., 2009;Legras et al., 2014). These changes
reflecting evolutionary adaptations (Fidalgo et al., 2006) result
in increased protein glycosylation and hydrophobicity of the
Flo11 glycoprotein of flor yeast (Zara et al., 2005;Fidalgo et al.,
2006), which allows cells to form a biofilm. Other distinct
genetic features characterize S. cerevisiae flor yeast, including
chromosomal polymorphism and aneuploidy (Bakalinsky and
Snow, 1990;Martinez et al., 1995;Ibeas and Jimenez, 1996;
Guijo et al., 1997;Legras et al., 2014). All the flor strains
share these specificities and can be clustered in the same
group that has evolved to adapt to the specific wine surface
niche encountered during wine biological aging (Legras et al.,
2016).
Recently, genome sequencing and comparative genomic
analysis of the three S. cerevisiae strains used for the production
of sherry-type wines in Russia has been reported (Eldarov
et al., 2018). They observed than gene polymorphism not only
affect FLO11, but also genes involved in yeast morphology,
carbohydrate metabolism, ion homeostasis, response to osmotic
stress, lipid metabolism, DNA repair, cell wall biogenesis. Gene
polymorphism in sherry strains is mainly due to SNP/InDel
accumulation. These authors also report the presence of genes in
the flor strain missing in the reference strain such as MPR1 gene
coding for N-acetyltransferase that is involved in oxidative stress
tolerance via proline metabolism.
Besides these genetic specificities which explain the ability of
the yeast to form biofilm, metabolomics and proteomic studies
have revealed how these yeasts have adapted physiologically and
metabolically to their environment (Moreno-García et al., 2014,
2015, 2017). For example flor yeast are resistant to ethanol and
it has recently been shown that ethanol tolerance could partly
be due to activation of genes related with the unfolded protein
response (UPR) and its transcription factor Hac1p (Navarro-
Tapia et al., 2016). The proteomic studies highlighted the
overexpression of proteins involved in non-fermentable carbon
uptake, glyoxylate and TCA cycle and cellular respiration in flor
yeast under biofilm conditions compared to flor yeast grown
in synthetic media rich in sugar (Moreno-García et al., 2015).
Although the genetic, metabolic and physiological specificities
that allow flor yeasts to develop as biofilms have been described
and reviewed in-depth (Alexandre, 2013;Legras et al., 2016),
knowledge on flor yeast ecology is scarce. The origin of these
yeasts is still unknown, raising the question of whether they are
present on grapes or found in the cellar? As stated above, there
is still no strong evidence that yeasts responsible for alcoholic
fermentation are the same as those present in the velum. It
has been shown that Brettanomyces bruxellensis is sometimes
present with S. cerevisiae (Ibeas et al., 1996); however, this has
never been confirmed and it is still unknown whether other
species are present in the velum. Charpentier et al. (2009)
reported that different S. cerevisiae strains could be present in
one velum but it is still unknown if this is a general feature.
Furthermore, wine aging for Vin Jaune, Xeres, Vernaccia di
Oristano and Szamorodni lasts several years (6 years for vin
jaune). During these 6 years of aging, many changes can occur
in the cellar environment, such as that of the temperature
between summer and winter. To our knowledge, no study
has yet been performed on these changes in environmental
conditions responsible for flor yeast succession and community
shift. The aim of the present study was to try to answer these
questions.
MATERIALS AND METHODS
Velum and Strain Isolation Protocol
All the microorganisms were isolated from French Vin Jaune
originated from the Jura region (France) and made from
Savagnin grape variety which come from two different wine estate
working with indigenous yeasts. The Savagnin wines samples
contained depending on the vintage 12.5–13.5% (v/v) alcohol,
with a pH ranging from 3.1 to 3.4, and the acetic acid ranging
from 200 to 500 mg/L.
Microorganisms were sampled from wine at the end of
alcoholic fermentation, from wine at the beginning of the
biological aging process (when the wine is transfer from
fermentation tank to barrels for aging), and from velum. Thirty-
seven velums were recovered by sliding stainless steel chips
under the velum present at the surface of the wine. To isolate
yeast and bacteria, serial dilutions were performed with each
sample and each dilution was spread either on YPD medium
(5 g.l1yeast extract, 10 g.l1peptone, 20 g.l1glucose, and
20 g.l1agar supplemented with chloramphenicol at 200 ppm
to inhibit the development of bacteria) and LAC medium
pH 5 (7.8% v/v white grape juice, 33 g.l1yeast extract,
Frontiers in Microbiology | www.frontiersin.org 2September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 3
David-Vaizant and Alexandre Flor Yeast Dynamics
0.6 g.l1tween 80, 80 mg.l1MnSO4H2O, and 20 g.l1agar)
supplemented with natacid at 50 ppm, respectively. Cultures were
incubated for 48 h and 1 week at 25C for yeast and bacteria
respectively.
Biological Aging With Isolated Strains
Five strains of S. cerevisiae isolated from five velums with different
morphological characteristics (14.28O, 34.22O, 36.2J, 8.1J, 23.1O)
were cultivated in 10 ml of YPD broth (36 h, 28C). Each
strain was grown in two different synthetic Fornachon media
(Fornachon, 1953) containing either 4 or 10% (v/v) ethanol and
two different French vin jaunes made from Savagnin grapes.
Synthetic Fornachon medium was prepared as follows: yeast
extract 1 g.l1, (NH4)2SO40.5 g.l1, MgSO41 g.l1, CaCl2
0.5 g.l1, adjusted to pH 3.2, autoclaved for 20 min at 120C,
following the addition of 4% or 10% (v/v) ethanol. Each Savagnin
wine and synthetic Fornachon medium was inoculated with
106cell.ml1. Each velum was observed after 1 month. The
identity of each strain from each velum was controlled by PCR
interdelta analysis as described below.
Scanning Electron Microscopy
Cells were fixed on stainless steel by a solution of 2.5%
glutaraldehyde in 0.1M phosphate buffer pH 7.2 for 1 h at 4C.
The samples were then washed three times with phosphate buffer
for 20 min at room temperature. Dehydration was performed
by successive immersions in solutions of increasing ethanol
content (70, 90, 100%), then three times for 10 min each
in successive baths of ethanol-acetone solution (70:30, 50:50,
30:70, 100) and air-dried. Afterward, the samples were coated
with a thin carbon layer using a CRESSINGTON 308R and
observed with a JEOL JSM7600F scanning electron microscope
(JEOL, Ltd.). Scanning electron microscopy was performed at
5 kV and the samples were observed at a working distance of
14.9 mm.
Identification of Yeast Isolate
Genomic DNA of yeast was prepared from yeast cultures on
YPD agar after 2 days of incubation with InstaGene Matrix
Bio-Rad. First InstaGene Matrix had to be mixed at moderate
speed on a magnetic stirrer to maintain the matrix in suspension
then briefly pick an isolated yeast colony and suspend it in
30 µL of InstaGene Matrix. The suspension was incubated in
a thermal cycler at 56C for 50 min, then at 100C for 8 min.
Afterward, 30 µL DEPC water was added and the suspension
centrifuged at 16,250 ×gfor 3 min. 3 µL of the resulting
supernatant was used for 30 µL PCR reaction. For species
identification, the 5.8S-ITS region was amplified by PCR with the
primers ITS1 50-TCCGTAGGTGAACCTGCGG-30and ITS4 50-
TCCTCCGCTTATTGATATGC-30. PCR was performed in 40 µl
of 1.5 mM MgCl2, 0.2 mM dNTPs, 1 µM of each primer,
0.025 U of Taq polymerase (Promega Corp., Madison, WI,
United States) and 100 ng of yeast DNA. A T100 thermal cycler
(Bio-Rad, Hercules, CA, United States) was used with a program
described elsewhere (Esteve-Zarzoso et al., 1999). The amplified
PCR products were analyzed by capillary electrophoresis on
a MultiNA MCE 202 (Shimadzu, France) at 37C for 75 s
using the DNA-1000 kit (Shimadzu, France) containing the
separation buffer with SyBer Gold (Invitrogen, France) and an
internal size calibrator. They were automatically injected onto
chips with a maximum rate voltage of 1.5 kV and a maximum
current of 250 mA; the peaks were identified using a LED-
excited (470 nm excitation wavelength) fluorescence detector.
The size of the amplified DNA fragments was calculated on the
MultiNA using the (GeneRuler 100 bp Plus DNA Ladder, Thermo
Fisher Scientific, Inc., Waltham, MA, United States). Then the
PCR products were sequenced with a cycle extension DNA
sequencer (Beckman Coulter Cogenics, Essex, United Kingdom).
The BLASTN algorithm was applied to the GenBank database
for sequence identification1. All sequences are available on NCBI
under accession numbers.
For S. cerevisiae differentiation, PCR interdelta analysis
was performed according to Legras and Karst (2003) using
S. cerevisiae DNA extracted as described below. One fresh colony
was suspended in a microcentrifuge tube with 200 µL buffer
(2% Triton X-100, SDS, 100 mM NaCl, 10 mM Tris-HCl, pH
8.0, 1 mM Na2EDTA). 80 µL of chloroform-alcohol isoamylic
(25:24:1) and 0.3 g glass beads (Sigma, Z250465) were added.
The suspension was vortexed at the maximum setting for 2 min
and place in ice for 2 min., 200 µL Tris-EDTA, pH 8.0, was
added mixed to each tube and the suspension was centrifuged
for 5 min at 12,500 rpm. The supernatant was transferred to a
new microcentrifuge tube and 1 mL absolute ethanol was added
to precipitate the DNA. The pellet was washed with 1 mL of
70% ethanol and centrifuged for 3 min at 12,500 rpm. The DNA
pellet was dried at 90C for 5 min and suspended in 50 µL
of milliQ water. The DNA concentrations of the samples were
then standardized (100 ng/µl) on the basis of optical density at
260 nm, by adding MilliQ water, as appropriate, and the samples
were then stored at 4C.
Total DNA Extraction
At least 100 µL of velum were centrifuged for 5 min at 4C, 12,000
rpm. The total DNA of pelleted microorganisms was extracted
as described by Longin et al. (2016) using CTAB, proteinase K
at 10 mg/mL and PVPP at 10%. The DNA concentrations of
the samples were then standardized (100 ng/µl) on the basis
of optical density at 260 nm, by adding DEPC-treated water, as
appropriate, and the samples were then stored at 20C.
DGGE Analysis
The D1 domain of the fungal 26S rRNA gene was
amplified with the primers NL1-GC (50-CGCCCG
CCGCGCGCGGCGGGCGGGGCGGGGGCCATATCAATAAG
CGGAGGAAAAG-30) and LS2 (50-ATTCCCAAACAACTC
GACTC-30), as reported in a previous study (Cocolin et al.,
2000). The NL1-GC primer had a 39-bp GC-clamp sequence at
its 50end to prevent the complete denaturation of amplicons.
PCR was performed in a reaction volume of 50 µl, with 1.5 mM
MgCl2, 0.2 mM dNTPs, 0.2 µM of each primer, 2.5 U of Taq
polymerase (Promega Corp., Madison, WI, United States) and
10–100 ng of yeast DNA. Reactions were run for 30 cycles of
1http://www.ncbi.nlm.nih.gov/BLAST/
Frontiers in Microbiology | www.frontiersin.org 3September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 4
David-Vaizant and Alexandre Flor Yeast Dynamics
FIGURE 1 | Flor yeast velum characteristic: (A) gray velum with blisters; (B) pink velum with wrinkles; (C) yellow thick and granular velum; (D) mix of white, brown
and yellow velum; (E) mix of gray, black, yellow and white velum; (F) gray fine and smoothy velum; (G) black velum with islands; (H) white velum with wrinkles.
denaturation at 95C for 60 s, annealing at 52C for 45 s and
extension at 72C for 60 s. An initial 5-min denaturation at 95C
and a final 7-min extension at 72C were used. The products
(250 bp) were analyzed by capillary electrophoresis on a MultiNA
MCE 202 (Shimadzu, France).
Vertical polyacrylamide gels (acrylamide-bis acrylamide 37,
5:1, Bio-Rad, Hercules, CA, United States), with a denaturing
gel of 35–50% polyacrylamide, were used for DGGE. The 100%
chemical denaturing solution consisted of 3.5 M urea (Sigma-
Aldrich) and 20% (v/v) formamide (Sigma-Aldrich) in 2 mL TAE
(50×).
APS (Sigma-Aldrich A3678) and TEMED (Sigma-Aldrich
T9281) were added to each gel before being mixed at 4C to
create the denaturing gradient. We mixed 40-µl samples of
PCR amplicons with 10 µl of (100%) glycerol before loading on
the gel. A DCode apparatus (Bio-Rad) was used for DGGE in
1×TAE, at 60C for 5 h 30 min, with a constant voltage of
130 V. The gels were stained 10 min with 10 ×BET (Sigma-
Aldrich E1510) in 1 ×TAE and the bands were visualized
and photographed under UV transillumination. The bands were
excised from the gels and the DNA was eluted overnight in 40 µl
of water MilliQ at 4C. The DNA was re-amplified with the same
pair of primers without the GC-clamp and sequenced with a
cycle extension DNA sequencer (Beckmann Coulter Cogenics,
Essex, United Kingdom). The BLASTN algorithm was applied to
the GenBank database for sequence identification (see footnote
1). All sequences are available on NCBI under the following
accession number from MH276962 to MH276980 and from
MH252537 to MH252566.
FLO11 Polymorphisms
The length of FLO11p was measured from the amplification
of FLO11 alleles with the primers FLO11 (Flo11IntFw
CTCCCTCATCATGTTGTGGTTC), and (Flo11IntRv
AACGACGGTGGTTGAGACAA) according to Legras et al.
(2014). The PCR reaction was performed with Expand High
Fidelity DNA polymerase (Roche) to amplify this long DNA
fragment. The PCR program: 94C for 2 min, followed by 10
cycles: 94C for 15 s, 61C for 30 s, 68C for 5 min and 20 cycles
at 94C for 15 s, 61C for 30 s, and 68C for 5 min +a 5 s cycle
prolongation for each successive cycle. The PCR products were
subjected to electrophoresis for 1 h at 100 V in 0.7% agarose
gels which were then stained with ethidium bromide (14 mg/ml)
for visualization of the DNA bands under UV light. Fragment
sizes were estimated by comparison with DNA size markers
(GeneRuler 1 Kb DNA Ladder, Thermo Fisher Scientific, Inc.,
Waltham, MA, United States), with Quantity One 4.6.5 software
from Bio-Rad.
The FLO11 promoter deletion was performed with the primer
pair Flo11promFw CAGCCCCAGAGTATGTTCTCACAG and
Flo11promRv AATCACCTTCTAAACGCTCGGA. This PCR
was performed with Taq polymerase (Promega Corp., Madison,
WI, United States). The PCR program was 95C for 5 min,
followed by 30 cycles of 95C for 30 s, 56C for 45 s, and
Frontiers in Microbiology | www.frontiersin.org 4September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 5
David-Vaizant and Alexandre Flor Yeast Dynamics
TABLE 1 | Identification of wine and velum yeast by different molecular techniques (5,8S PCR and 26S DGGE).
Wine estates Sample wine velum PCR ITS 5,8S DGGE 26S
A W1AF Saccharomyces cerevisiae
W1 Zygosaccharomyces bailii
Saccharomyces cerevisiae Ascomycota
Debaryomyces carsonii Kregervanrija fluxuum
Zygosaccharomyces lentus Debaryomyces sp.
Kregervanrija fluxuum
A W2AF Saccharomyces cerevisiae
W2 Pichia membranefaciens /
Saccharomyces cerevisiae
Dekkera bruxellensis
A W3AF Saccharomyces cerevisiae
W3 Saccharomyces cerevisiae Pichia membranefaciens
Pichia membranefaciens
Dekkera bruxellensis
A V4 Saccharomyces cerevisiae /
A V5 Saccharomyces cerevisiae Saccharomyces cerevisiae
A V6 Saccharomyces cerevisiae /
A V7 NC /
A V8 Saccharomyces cerevisiae Saccharomyces cerevisiae
A V9 NC /
A V10 NC /
A V11 Saccharomyces cerevisiae /
A V12 Zygosaccharomyces lentus Saccharomyces cerevisiae
Saccharomyces cerevisiae
A V13 NC Saccharomyces cerevisiae
A V14 Saccharomyces cerevisiae /
A V15 Saccharomyces cerevisiae /
A V16 Saccharomyces cerevisiae /
A V17 Saccharomyces cerevisiae Saccharomyces cerevisiae
B W18AF Saccharomyces cerevisiae
W18 Saccharomyces cerevisiae Saccharomyces cerevisiae
Dekkera bruxellensis Dekkera bruxellensis
B V19 Saccharomyces cerevisiae Saccharomyces cerevisiae
B V20 Saccharomyces cerevisiae /
B V21 Saccharomyces cerevisiae Ascomycota
B V22 Saccharomyces cerevisiae Ascomycota
B V23 Saccharomyces cerevisiae Ascomycota
B V24 Saccharomyces cerevisiae /
B V25 Saccharomyces cerevisiae /
B V26 Candida fermenticarens
Pichia anomala Pichia anomala
Pichia farinosa Pichia farinosa
Metschnikowia pulcherrima Candida fermenticarens
Saccharomyces cerevisiae Ascomycota
B V27 Saccharomyces cerevisiae Saccharomyces cerevisiae
B V28 Saccharomyces cerevisiae Saccharomyces cerevisiae
B V29 Saccharomyces cerevisiae /
B V30 Saccharomyces cerevisiae Saccharomyces cerevisiae
B V31 Saccharomyces cerevisiae Saccharomyces cerevisiae
B V32 NC /
B V33 Saccharomyces cerevisiae /
(Continued)
Frontiers in Microbiology | www.frontiersin.org 5September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 6
David-Vaizant and Alexandre Flor Yeast Dynamics
TABLE 1 | Continued
Wine estates Sample wine velum PCR ITS 5,8S DGGE 26S
B V34 Saccharomyces cerevisiae Saccharomyces cerevisiae
B V35 Saccharomyces cerevisiae Dekkera bruxellensis
Dekkera bruxellensis
B V36 Saccharomyces cerevisiae Saccharomyces cerevisiae
B V37 Saccharomyces cerevisiae Saccharomyces cerevisiae
Dekkera bruxellensis Dekkera bruxellensis
B V38 Saccharomyces cerevisiae Saccharomyces cerevisiae
B V39 NC Saccharomyces cerevisiae
B V40 NC Saccharomyces cerevisiae
B V41 NC Saccharomyces cerevisiae
WAF: strains isolated in wine at the end of the alcoholic fermentation. W: strain isolated in the wine at the beginning of the biological aging process. V: strain isolated in
the velum. NC: not cultivable. Ascomycota: Unidentifiable yeast, 100% similar by blast for V21-V22-V23-V26-W1 26S ribosomial RNA gene.
FIGURE 2 | Scanning electron microscopy of velum: (A) ×2,000 (B) ×8,500 ovoid yeast and elongated pseudomycelium yeast; (C) ×3,000 (D) ×6,000 (E) ×8,000
yeast biofilm where yeasts are present in short chains of several cells; (F) ×650 (G) ×7,000 (I) ×5,000 (J,K) ×10,000 very dense biofilm with network of yeast, with
all yeast cells embedded in an extracellular matrix; (H) ×1,000 velum in 3D like structure is visible formed by a sequence of ovoid cells attached together by their
pole in an apparently disorganized manner.
Frontiers in Microbiology | www.frontiersin.org 6September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 7
David-Vaizant and Alexandre Flor Yeast Dynamics
72C for 1 min. The presence of the deletion was detected by
capillary electrophoresis on a MultiNA MCE 202 (Shimadzu,
France).
Cluster Analysis of the Strains
The inter delta sequence patterns obtained after capillary
electrophoresis were used to construct a presence/absence matrix,
taking into account the total number of different bands observed.
All visible bands were assigned a number based on relative
position to the DNA ladder. Each position was then assigned
a “0” or a “1” to indicate the absence or presence of the band,
respectively. Then, 0/1 matrix was used to generate a dissimilarity
dendrogram based on the Dice coefficient using the UPGMA
algorithm with XLstat (Addinsoft, Inc.).
RESULTS AND DISCUSSION
Flor yeasts have been extensively studied from the genomic,
proteomic, and metabolomics angles (Alexandre, 2013;Legras
et al., 2016), because they provide an interesting biological model
for studying the adaptation of yeasts to a specific niche. However,
little information exists on the dynamics of yeast from alcoholic
fermentation until the end of the biological aging process. Jura
“vin jaune” is a sherry like wine whose aging lasts 6 years in partly
filled barrels that allow a velum yeast to develop. The objective of
the present study was to investigate the nature of the yeast present
at the end of alcoholic fermentation until the end of the 6-year
aging process.
Flor Yeast Velum Characteristics
Two thousand five hundred and sixty-five yeast strains were
isolated from two different cellars in Jura vineyard (France) from
41 Savagnin Jura wines from the 2007 to 2013 vintages. Sampling
was done in winter, summer, and autumn. Several examples of
the nature of the velum are given Figure 1. Surprisingly, this is the
first morphological characterization of velum. Indeed, despite the
numerous studies on flor yeast, there are no detailed descriptions
of the velum present on wines. Figure 1 shows the extraordinary
diverse nature of the velum found. White, cream, yellow, pink,
deep gray, brown and black velums were observed. These velums
were not homogenous, and wines could be completely covered
Figures 1C,F or partly covered by velum (Figures 1A,B,D–F).
This might reflect the age of the velum. When the velum starts
to grow, it forms a small island on the surface of the wine
(Figure 1G) and then expands to cover the entire surface of the
wine (Figure 1F). Different velum morphologies could also be
observed, some appear smooth (Figure 1F), others are granular
(Figure 1C), while others present wrinkles (ruffled pattern)
(Figures 1B,H).
Figure 1A presents kinds of blisters which might reflect
the effect of carbon dioxide entrapped in the velum. Another
characteristic of this velum is the presence of different colors
which might reflect the presence of different microorganisms.
For example, in Figure 1F white spots are present on the deep
gray velum; in Figure 1E a mix of gray, black yellow and white
can be seen while Figure 1D is characterized by a mix of white,
FIGURE 3 | Dendrogram derived from UPGMA cluster analysis of inter delta
using dissimilarity coefficients.
brown, and yellow. Thus, our study revealed that contrary to what
is reported in the literature (Charpentier et al., 2009) velums are
not only gray or white.
Flor Yeast Species Identification
Microorganisms present in the velum were isolated either on
bacteria or yeast medium. No bacteria could be recovered from
Frontiers in Microbiology | www.frontiersin.org 7September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 8
David-Vaizant and Alexandre Flor Yeast Dynamics
TABLE 2 | Identification of all the Saccharomyces cerevisiae strains isolated in all the velum according to their ITS RFLP profile.
Wine estates Sample wine velum HaeIII restriction PCR ITS
Velum Fermentation
S. cerevisiae strains S. cerevisiae strains
A W1AF S31f, S1f, S3f, S8f, S1Of, S11f, S12f, S24f, S26f
Wl S1v, S8v, S11v, S12v, S38v S13f, S14f, S15f, S31f
A W2AF S31f, S1f, S2f, S3f, S5f, S6f, S7f, S8f, S16f, S23f, S25f, S27f
W2 S1v, S8v, S11v, S12v, S38v
A W3AF S31f, S13f, S3f, S4f, S16f, S17f, S18f, S19f, S20f, S21f, S22f, S25f
W3 S1v, S8v, S11v, S12v, S38v
A V4 S1v, S2v, S5v, S32v
A V5 S1v, S2v
A V6 S2v
A V7 /
A V8 S6v
A V9 /
A V10 /
A V11 S3v, S6v
A V12 S2v S9f
A V13 /
A V14 S2v, S26v S9f
A V15 S10v, S17v, S37v
A V16 S10v
A V17 S1v, S27v
B W18AF S28f, S29f
W18 S18v, S19v, S20v, S21v, S22v, S23v, S36v
B V19 S7v
B V20 S3v
B V21 S3v, S4v
B V22 S34v
B V23 S7v, S28v, S34v
B V24 S3v
B V25 S3v, S4v
B V26 S24v
B V27 S4v
B V28 S2v, S6v
B V29 S2v, S5v, S35v
B V30 S2v, S5v, S35v
B V31 S3v, S33v, S34v
B V32 /
B V33 S4v, S29v
B V34 S3v
B V35 S3v, S24v
B V36 S4v, S30v
B V37 S25v
B V38 S34v
B V39 /
B V40 /
B V41 /
All strains presenting the typical HaeIII velum yeast pattern are coded (Sv), the others Sf (for fermentation strain).
any of the velums sampled. Two thousand five hundred and
sixty-five yeasts were isolated from these velums to identify the
nature of the species present. However, despite the use of different
media, some of the isolates were not able to recover growth. For
these reasons, DGGE was used to identify the species present
in the velums. Table 1 groups the identification of the species
present in wine at the end of alcoholic fermentation, after the
transfer of the wine into barrels for biological aging, and in
Frontiers in Microbiology | www.frontiersin.org 8September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 9
David-Vaizant and Alexandre Flor Yeast Dynamics
velum. Four different Savagnin Jura wines were sampled: three
in wine estate A and one in wine estate B. As expected, at
the end of alcoholic fermentation, 100% of the yeast present
belonged to S. cerevisiae species (W1AF, W2AF W3AF, W18AF)
(Table 1). After the transfer of the wine from tanks to barrels
for biological aging, different species could be found, as shown
by PCR-ITS and DGGE. As shown in Table 1 most of the
yeasts present in the velum belonged to S. cerevisiae species,
which support previous reports (Martinez et al., 1995;Ibeas
et al., 1997;Charpentier et al., 2009;Pozo-Bayón and Moreno-
Arribas, 2011). However, in rare cases different species could be
identified in the same velum (Table 1). Velum V35 and V37
was composed of both S. cerevisiae and Dekkera bruxellensis
while Velum V12 was formed with Zygosaccharomyces lentus
together with S. cerevisiae. These results demonstrate that other
wine yeast species can form biofilms and survive this harsh
environment. The presence of such species that reflect wine
alteration has already been reported (Ibeas et al., 1996;Suarez-
Lepez and Inigo-Leal, 2004). The most important aspect of
this study is that although most velums were composed of
S. cerevisiae, they presented very different velum characteristics.
This means that a single species can lead to different types of
velum in terms of color, structure and surface characteristic. To
explain these unexpected observations, we investigated the nature
of the differences in velum morphology using scanning electron
microscopy.
Scanning Electron Microscopy of Velum
Surprising images were obtained, highlighting huge differences
between the biofilm structures of velums (Figure 2). Microscopic
observations revealed distinct yeast morphologies (Figure 2A).
Typical yeast shape-like cells (ovoid) together with elongated
yeast could be observed (Figures 2A,B). This velum is
composed of both S. cerevisiae and Dekkera bruxellensis and
identified by the label ITS-RFLP (Table 1). Many different
yeast morphologies were observed in the different velums
under study. Figures 2C–E show a yeast biofilm in which
yeasts are present in short chains of several cells. Yeast cells
are recovered by an extracellular matrix (Figure 2D) and
connected by an extracellular material (Figure 2E). This biofilm
characteristic has already been observed previously (Zara et al.,
2009). However, a third type of velum biofilm never reported
before is presented (Figures 2F,G,I–K). A very dense network
of yeast is observed for this biofilm, with all the yeast cells
embedded in an extracellular matrix. Finally, Figure 2H shows
another model of biofilm in which a 3D like structure is
visible, formed by a sequence of ovoid cells attached together
by their pole in an apparently disorganized manner. Our
results show that there are extensive phenotypic variations
between yeasts regarding biofilm morphology though they all
belong to S. cerevisiae species except the biofilm shown in
Figures 2A,B.
Variations in ploidy have been reported to play a key role
in biofilm phenotypes (Hope and Dunham, 2014) and might
explain the differences observed. However, according to Legras
et al. (2014) most of the flor strains (70 flor strains studied
from different countries) are diploid, which does not support
the idea that biofilm phenotypic differences are linked to ploidy.
On the other hand, aneuploidies are considered to be a potential
mechanism allowing adaptation to flor aging (Guijo et al., 1997;
Infante et al., 2003), but according to Legras et al. (2014) there is
no substantial aneuploidy in flor yeast.
Differences in velum characteristics might be linked to
different S. cerevisiae strains, therefore all the S. cerevisiae strains
sampled from wines (at the end of alcoholic fermentation before
velum formation), at the beginning of the biological aging process
and velum formation were genotyped.
Flor Yeast Strain Genotyping
Among the 2,025 isolates belonging to S. cerevisiae determined
by ITS RFLP, we found 69 different genotypes determined by
subjecting inter delta data to clustering analysis (Figure 3).
Among these 69 different S. cerevisiae strains, 38 of them were
velum yeasts according to their ITS RFLP profile (Table 2).
Indeed, in velum yeast an insertion in the ITS1 region led
to an additional HaeIII site which allowed differentiating
TABLE 3 | Example of the distribution (%) of different Saccharomyces cerevisiae genotypes present in velum (V) showing that several different Saccharomyces cerevisiae
strains could be present in a same velum.
Velum
V4 V11 V14 V15 V23 V28 V29 V30 V31
Saccharomyces cerevisiae
genotype
S1v 88
S2v 81 71 90 75
S3v 34 84
S5v 8 10
S6v 66 29 25
S9f 13
S26v 6
S28v 50
S32v 4
S33v 16
S34v 50
Frontiers in Microbiology | www.frontiersin.org 9September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 10
David-Vaizant and Alexandre Flor Yeast Dynamics
flor-S. cerevisiae from classical S. cerevisiae (Esteve-Zarzoso et al.,
2004;Charpentier et al., 2009). It is noteworthy that none of
the S. cerevisiae strains isolated at the end of the alcoholic
fermentation (samples W1AF, W2AF, W3 AF, W18 AF) gave the
specific flor-Saccharomyces cerevisiae HaeIII restriction pattern
(Table 2). These results underline that the model proposed
by Zara et al. (2005) might not be the general rule. Indeed,
in their model, they propose that at the end of alcoholic
fermentation, an increase of FLO11 expression following diauxic
shift leads to an increase of cell surface hydrophobicity and
consequently favors cell aggregation and biofilm formation.
However, as shown here and as far as we know, flor yeasts
have never been isolated in wine at the end of the alcoholic
fermentation.
The second analysis of yeast strains present in wine was
performed after the transfer of the wine into barrels, at the
beginning of the biological aging process. While there was
still no visible velum at that stage, most of the yeast strains
TABLE 4 | Example of the distribution (%) of different Saccharomyces cerevisiae genotypes present in velum (V) showing the shift from one strain to another according to
the season.
Saccharomyces cerevisiae genotype
Season Slv S2v S8v S28v S24v S3v S6v S27v S7v S34v S29v S4v S5v S33v S30v
Velum V5 W 100
S 100
A 100
V23 W 100
A 50 50
V12 S 34 66
A 100
V17 S 100
A 100
V23 W 100
A 50 50
V25 W 100
S 100
V31 S 84 16
A 100
V33 S 100
A 100
V35 S 100
A 100
V36 S 100
A 100
W, winter; S, summer; A, autumn.
TABLE 5 | Example of different Saccharomyces cerevisiae genotypes isolated in velum with different colors.
Saccharomyces cerevisiae genotypes
Velum color S2v S3v S4v S5v S6v S7v S24v S34v
White X X X X X
V4, V5, V20, V24, V25,V31, V35, V36
Gray X X X X X
V6, V12, V19, V14, V23,V27, V33, V8, V22
Cream X X X X
V11, V28, V29, V30, V34
Brown X
V34
Yellow X X
V21
Black X
V26
Frontiers in Microbiology | www.frontiersin.org 10 September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 11
David-Vaizant and Alexandre Flor Yeast Dynamics
TABLE 6 | FLO11 promoter size and ORF length variations, velum color and thickness of various flor strains [55 clones belonging to 38 genotypes (S1v to S38v)].
Velum yeast Strain FLO11 diversity Velum color Velum thickness
Promoter FLO11
Lab reference S288c 447 bp 3,300 bp
5.8F 447 bp 3,500 bp White Fine
1.43J 447 bp 3,500 bp nv
2.4O 447 bp 3,500 bp nv
S1v 4.2J 447 bp +350 bp 3,500 bp White Fine
17.4J 447 bp +350 bp 3,400 bp +4,100 bp Cream Fine
2.6J 447 bp +350 bp 3,400 bp +4,100 bp nv
3.16J 447 bp +350 bp 3,400 bp +4,200 bp nv
14.2J 350 bp 3,500 bp Gray Fine
12.3J 350 bp 3,500 bp Gray Fine
5.1J 447 bp +350 bp 6,200 bp White Fine
S2v 14.28O 447 bp +350 bp 6,200 bp Black Fine
29.31O 447 bp +350 bp 6,200 bp Cream Thick
30.5O 447 bp +350 bp 6,200 bp Cream Thick
28.12J 447 bp +350 bp 6,200 bp White Fine
34.22O 350 bp 3,500 bp Brown /
11.8F 350 bp 4,500 bp Cream Thick
S3v 20.1F 350 bp 4,500 bp White Thick
24.1F 350 bp 5,000 bp White /
21.3F 350 bp 4,500 bp Yellow Thick
33.34J 350 bp 3,500 bp Gray Thick
S4v 36.2J 350 bp 3,700 bp White Thick
27.13F 350 bp 3,500 bp Gray Fine
S5v 4.1J 447 bp +350 bp 3,300 bp Cream Fine
S6v 8.1J 447 bp 3,600 bp Gray Fine
11.16F 447 bp 3,600 bp Cream Thick
S7v 19.1J 350 bp 3,700 bp Gray Fine
S8v 1.25F 447 bp 3,500 bp nv
S9f 12.2O 447 bp 2,300 bp +2,900 bp Gray Fine
14.47O 447 bp 2,300 bp +2,900 bp Black Fine
S10v 15.27F 350 bp 4,200 bp White Thick
S11v 2.2O 447 bp 4,800 bp nv
2.3O 447 bp 3,500 bp nv
S12v 2.1J 447 bp 3,700 bp nv
1.30J 447 bp 3,500 bp +4,700 bp nv
2.1J 447 bp 3,700 bp nv
S16v 1.30F 447 bp 4,200 bp nv
S17v 15.26F 340 bp 3,500 bp White Thick
S18v 18.4F 447 bp 3,500 bp +4,200 bp nv
S19v 18.6F 447 bp 4,200 bp nv
S20v 18.29F 447 bp 3,500 bp nv
S21v 18.30F 447 bp 4,000 bp +4,200 bp nv
S22v 18.36F 447 bp 3,400 bp +4,200 bp nv
(Continued)
Frontiers in Microbiology | www.frontiersin.org 11 September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 12
David-Vaizant and Alexandre Flor Yeast Dynamics
TABLE 6 | Continued
Velum yeast Strain FLO11 diversity Velum color Velum thickness
Promoter FLO11
S23v 18.43F 447 bp 3,400 bp +4,200 bp nv
S25v 37.6O 340 bp 4,200 bp +4,300 bp White /
S26v 14.5O 340 bp 4,200 bp +4,300 bp Gray Fine
S27v 17.26O 447 bp +350 bp 3,200 bp +4,500 bp Cream Thick
S28v 23.2O 340 bp 2,800 bp Gray Fine
S29v 33.29O 340 bp 3,200 bp Gray Thick
S30v 36.38O 447 bp 3,100 bp +3,500 bp White Thick
S32v 4.31J 447 bp +350 bp 3,400 bp +4,100 bp White /
23.1O 350 bp 4,500 +4,700 bp Gray Fine
S34v 22.3O 350 bp 4,800 bp White Fine
31.21O 447 bp +350 bp 3,400 +3,600 bp White Thick
S36v 18.1J 350 bp 3,700 bp White Fine
S38v 2.9F 447 bp 4,000 bp +4,200 bp nv
nv, No installed velum.
isolated belonged to S. cerevisiae species and most were flor-
Saccharomyces yeasts (samples W1, W2, W3, W18) (Table 2).
One exception could be observed in wine 1, where classical
S. cerevisiae belonging to four different phenotypes were isolated
(S13f, S14f, S15f, and S31f). This was not unexpected, since
residual fermentation yeasts were present in wine during wine
transfer. However, our results support the view that velum
formation is due more to the implantation of flor yeast present
in the cellar, barrels and materials. Indeed, ITS-RFLP profiles
determined on all the S. cerevisiae strains isolated from velum
(samples V4 to V41) demonstrated that except one strain (S9f)
they all shared the common HaeIII restriction pattern of flor yeast
(Table 2).
Dynamics of Saccharomyces Genotypes
During the Biological Process Aging
To determine seasonal effects, the time of possible community
shifts during aging, and the presence of any dominant genotype,
we analyzed the frequency (%) of all the S. cerevisiae genotypes
according to the wine estate, the vintage, and the seasons
in wines at the beginning of the aging process and in
velums (Supplementary Table S1). For ease of reading, data
where extracted from this important table to present data in
Tables 3,4.
Table 3 clearly shows that velum could be formed by several
different S. cerevisiae strains. For example velums V4, V11, V14,
V15, V23, V28, V29, V30, and V31 possess two or three different
S. cerevisiae strains. It was very puzzling to observe a shift from
one strain to another during aging (Table 4). Indeed, velum
V5 was composed of only one S. cerevisiae strain (S1v) for the
sampling done in winter which was different from the strain
genotype (S2v) present in the same velum in summer and autumn
(Table 4). The same behavior was observed for V23, V25. The
same observations were made when comparing summer and
autumn periods for velums V12, V17, V31, V33, V35, and V36
(Table 4). These results suggest that some flor yeasts are better
adapted than others and could competitively displace them. This
dynamic nature of S. cerevisiae populations has been observed
during alcoholic fermentation (Frezier and Dubourdieu, 1992;
Versavaud et al., 1995; Schuller et al., 2005) but never reported
for flor yeast.
This S. cerevisiae dynamic might be explained by changes
in environmental conditions during the four seasons such as
temperature (5–10C in the cellar in winter and 25–30C in
the cellar in summer: cellars for aging are under the roof)
(Charpentier et al., 2002). Indeed, this succession revealed that
environmental conditions drive community shifts. Some strains
of S. cerevisiae may be better adapted to higher temperatures than
others, explaining their occurrence during summer, for example.
During aging, the velum can sink in the wine because the cells
are not adapted to the medium and changing environmental
conditions which allow a better adapted strain to colonize the
medium and form a new velum composed of a different strain.
Other original information revealed by our study is that the same
strain could be observed in velums from different wines. For
example, the genotype profile S3v (Supplementary Table S1)
was found in velum from vintages 2008, 2010, 2011, 2012
and the genotype profile S2v (Supplementary Table S1) was
found in velum from vintages 2009, 2011, 2012. We could also
observe patterns of sporadic presence, absence and reoccurrence.
Profile S7v was absent from vintage 2008, appeared for the first
time in 2010, though was absent from the 2011 velum and
then reappeared in 2012. A similar dynamic pattern could be
Frontiers in Microbiology | www.frontiersin.org 12 September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 13
David-Vaizant and Alexandre Flor Yeast Dynamics
FIGURE 4 | Structure and color of velum on different matrixes: grape, juice medium (Fornachon, 1953), synthetic [Fornachon 4% and 10% (v/v) ethanol] and two
Savagnin wines (vintage 2010 and 2014) observed after 1 month. The inoculated strains are from different velums: S6: strain 8.1J from very fine gray velum with
islands; S2: 14.2O strain from fine gray velum; S3: 32.22O from brown velum; S4: 36.2J strain from thick white velum and S34: 23.1O strain from very fine gray
velum.
observed for profile S2v. These results reflect that there are a
few dominant strains that are better adapted to the wine than
others. Another surprising observation was the fact that the
same S. cerevisiae genotype profile was found in velums with
very different surface characteristics (Table 5). For example,
S. cerevisiae profile S3v was found in velum with yellow (V21),
white (V20, V25, V36), cream (V11), and brown colors and
with different structures. One explanation could be that color
reflects the evolution of the velum linked both to aging and wine
composition. Indeed, during aging wine phenolic compounds
oxidized (Danilewicz, 2012) and could be adsorbed by yeast
cell walls which would stain the cells (Vasserot et al., 1997).
Depending on wine composition, this oxidation might be more
or less considerable, which could explain the color nuances
from white to yellow and brown. Regarding velum structure
differences, these could reflect differences in cell density, wine
movement inside the barrels due to changes of the atmospheric
pressure and Brownian movements due to temperature variation.
However, strains isolated in thick white, yellow or brown velum
were never isolated in thin gray or black velums which confirms
previous results (Charpentier et al., 2009).
Supplementary Table S1 also reveals that although very rare,
one strain that did not present the typical HaeIII (S9f) profile
was present at 100% and 12% in two different velums from 2009
and 2011, respectively (Table 2). Such observations were reported
before in Jura flor yeast (Charpentier et al., 2009).
All flor yeasts were isolated from two different wine estates
54 km away from each other. It is noteworthy that they did not
share any common S. cerevisiae flor yeast. This result supports the
existence of the geographic distribution of yeast profiles observed
previously (Charpentier et al., 2009).
Phenotype and Genotype Correlation
We determined both the size of the FLO11 gene and IRC1 region
of 55 Saccharomyces clones corresponding to 38 different strains
according to interdelta profiles (Table 6). The amplification of
a short sequence of ICR1 ncRNA for all flor-Saccharomyces
gave two different sizes, 447 bp and 350 bp, corresponding
respectively to the wild and 111 bp deletion of the ICR1 sequence,
as previously reported (Fidalgo et al., 2006). Interestingly, some
strains carried a wild and a deleted allele. On 52 isolates, 12
possessed both alleles, 19 possessed only the allele with the
deletion in the ICR1ncRNA region and 21 possessed only the full
length ICR1ncRNA allele (Table 6). The presence of both alleles
in flor yeast has already been reported for Hungary isolated flor
yeast (Legras et al., 2014). However, contrary to our observations,
the authors did not find either allele in any of the Jura flor
yeast isolates. The length of the core region of FLO11 gene was
sequenced for all the isolates and its size varied from 2.8 to 6.2 kb.
These results agree with a previous report (Legras et al., 2014).
Most of our isolates possessed a FLO11 sequence longer than
the sequence of wine yeast whose average size was 2.9 kb using
Frontiers in Microbiology | www.frontiersin.org 13 September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 14
David-Vaizant and Alexandre Flor Yeast Dynamics
the same primers (Legras et al., 2014). Regarding the promoter
region, many isolates were heterozygote at the FLO11 locus,
which is in line with previous reports (Legras et al., 2014). It
is noteworthy that different isolates that had been characterized
as being the same yeast strain based on interdelta PCR analysis,
could have different FLO11 promoters and lengths (Table 6).
Indeed, not all the clones (14.2J, 12.3J, 5.1J, 14.28O, 29.31O,
30.5O, 28.12J) sharing the profile S2v had the same FLO11
promoter and/or ORF length (Table 6). The same phenomenon
could be observed for clones sharing the same interdelta profile
S1v.
Interestingly, among the strains isolated in the velums, two
clones (12.2O; 14.47O) sharing the same genotype (S9f) present
in velums 12 and 14 had neither a long FLO11 nor a deletion
in ICR1 (Table 6) and, as mentioned before, they did not have
the typical HaeIII profile. However, they were able to form
a velum. Although a very rare event, this is not surprising.
Indeed, although the expression of FLO11 has been shown to
be the key event for biofilm formation, other genes, i.e., FLO5,
FLO9,FLO10 encoding Flo5p, Flo9p, and Flo10p confer cell–
cell adhesion. Moreover, it cannot be excluded that FLO11
expression and cell hydrophobicity could be linked to factors
other than ICR1 deletion or a long FLO11 gene. Indeed, the
regulation of FLO11 is complex and depends on different specific
pathways: the cAMP-protein kinase A (PKA) pathway; the
mitogen-activated protein kinase (MAPK) pathway; and the TOR
pathway (Braus et al., 2003;Vinod et al., 2008). Moreover, it has
been shown that biofilm formation is also dependent on fatty
acid biosynthesis (Zara et al., 2012). Fierro-Risco et al. (2013)
also reported that the expression of stress-related genes (SOD1,
SOD2,HSP12) could favor velum formation and thickness. More
recently, Coi et al. (2017) demonstrated that flor yeasts possess
specific SFL1,RGA2 alleles that enhance flor formation. These
results support the view that although FLO11 polymorphism is
an important characteristic of flor yeast and plays a key role in
velum formation, other genes might be involved, and that the
environment probably influences the nature of the velum.
To check the link between yeast flor phenotypes, especially
the thickness of the velum and the polymorphism of FLO11,
we compared the size of ICR1 and FLO11 with the velum
characteristics. As shown in Table 6, there is no clear link between
yeast phenotypes, especially the thickness of the velum and the
polymorphism of FLO11.
Strains with a wild type ICR1 ncRNA and a long Flo11p are
expected to develop thin velum (Legras et al., 2014). However,
in our study, S. cerevisiae clones classified in genotype S3v
(11.8F, 20.1F, and 21.3F possessed a deletion in the ICR1nc RNA
sequence but were isolated from thick velum (Table 6). On the
other hand, S6 8.1J and S1 5.8F was isolated from thin velum
but possessed a wild ICR1 allele (Table 6). Strain 33.29O formed
thick velum and possessed the deletion in its ICR1 promoter.
These results show that the presence of the 111 bp deletion
in the ICR1 ncRNA was not always related to thin velum, as
suggested previously (Legras et al., 2014). Our results support
recent findings in which flor formation ability was shown to be
variable in a flor strain with a specific deletion in the promoter of
the FLO11 gene (Kishkovskaia et al., 2017).
In these conditions, we wondered why some velums were
thin and others thick. We hypothesized that the velum thickness
might be related to the wine matrix. Indeed, according to our
results, the same flor yeast could give different velums. For
example, two isolates, namely 14.28O and 29.31O which were
isolated in two different velums, one thin and one thick, presented
the same inter delta pattern and the same ICR1 and FLO11
sequence. The same characteristics could be observed for the two
strains 8.1J and 11.16F (Table 6). These results suggest that the
same strain in two different matrixes can give different velums.
In order to confirm this, we inoculated different synthetic
wines and Savagnin wine (vin jaune) with five different yeast
strains 34.22O, 36.2J, 23.1O, 8.1J, 14.28O) possessing either a
deletion in the promoter or a long FLO11 gene or both (Figure 4).
The color of the velum depended on both the medium and the age
of the wine (Figure 4). While strain 34.22O gave a thick velum
as expected (ICR1 deletion), strain 8.1J sampled in a fine gray
velum gave a thin pale gray velum in Fornachon medium [4 and
10% (v/v)] and a thick yellow/brown velum in a 2010 Savagnin
wine and a thick white/cream velum in a 2014 Savagnin wine.
Strain 14.28O gave a thick and thin velum in Fornachon and
Savagnin, respectively. Strain 36.2J developed a thick pale gray
velum in Fornachon 4%, a thin pale gray velum in Fornachon
(10%) and a thick yellow velum in Savagnin 2010. Interestingly,
the aspect of the velum differed as a function of the medium.
While the velum developed with strain 34.22O was very smooth
in Fornachon 4%, the velum presented wrinkles (ruffled pattern)
in Savagnin 2010. Differences in velum aspects could also be
observed for strain 36.2J when comparing all media, the major
difference being between Fornachon and Savagnin Wine. These
observations could be explained by the fact that biofilm formation
is affected by nitrogen availability (Mauricio et al., 2001;Berlanga
et al., 2006;Zara et al., 2011). Inositol availability has also been
shown to influence biofilm formation (Zara et al., 2012). Thus,
velum formation and velum characteristic are influenced by
complex mechanisms involving both the genetic background of
the yeast and wine composition.
CONCLUSION
Our results show that Savagnin wine velums present very
different characteristics never reported before in terms of color
and morphology. Scanning electron microscopy analysis revealed
remarkable differences in biofilm structure with distinct yeast
morphologies and the presence of extracellular matrix. Despite all
the differences observed, flor yeast genotyping demonstrated that
most of the strains present in the velums belong to S. cerevisiae
species and present the typical HaeIII ITS-RFLP flor yeast
pattern. The genotyping analyses also demonstrate that a velum
could be formed either of several different S. cerevisiae strains
or one strain. Furthermore, a same strain could be present
in velums presenting very different characteristics, supporting
the view that wine composition plays a key role on velum
characteristics. Our study also revealed population shifts during
aging which reflects the fact that a strain could competitively
displace another strain which could be linked to environmental
Frontiers in Microbiology | www.frontiersin.org 14 September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 15
David-Vaizant and Alexandre Flor Yeast Dynamics
changes during aging such as drastic temperature changes for
example.
Finally, we confirmed in the present study the polymorphism
of FLO11 gene but we did not find any correlation between velum
characteristic and FLO11 polymorphism.
AUTHOR CONTRIBUTIONS
VD-V made all the laboratory experiments and made some
wine sampling. HA sampled the wine, designed the experiments,
and wrote the article. Interpretations were done by VD-V
and HA.
FUNDING
This work was supported by the Conseil Régional de Bourgogne
through the plan d’actions régional pour l’innovation (PARI) and
the European Union through the PO FEDER-FSE Bourgogne
2014/2020 programs.
SUPPLEMENTARY MATERIAL
The Supplementary Material for this article can be found
online at: https://www.frontiersin.org/articles/10.3389/fmicb.
2018.02235/full#supplementary-material
REFERENCES
Alexandre, H. (2013). Flor yeasts of Saccharomyces cerevisiae-their ecology,
genetics and metabolism. Int. J. Food Microbiol. 167, 269–275. doi: 10.1016/j.
ijfoodmicro.2013.08.021
Aranda, A., del Querol, A., and Olmo, M. L. (2002). Correlation between
acetaldehyde and ethanol resistance and expression of HSP genes in yeast
strains isolated during the biological aging of sherry wines. Arch. Microbiol. 177,
304–312. doi: 10.1007/s00203-001-0391-1
Bakalinsky, A. T., and Snow, R. (1990). The chromosomal constitution
of wine strains of Saccharomyces cerevisiae.Yeast 6, 367–382.
doi: 10.1002/yea.320060503
Berlanga, T. M., Millàn, C., Mauricio, J. C., and Ortega, J. M. (2006). Influence of
nitrogen on the biological aging of sherry wine. J. Sci. Food Agric. 86, 2113–2118.
doi: 10.1002/jsfa.2584
Braus, G. H., Grundmann, O., Bruckner, S., and Mosch, H. U. (2003). Amino-acid
starvation and Gcn4p regulate adhesive growth and FLO11 gene expression in
Saccharomyces cerevisiae.Mol. Biol. Cell 14, 4272–4284. doi: 10.1091/mbc.e03-
01-0042
Capece, A., Granchi, L., Guerrini, S., Mangani, S., Romaniello, R., Vincenzini, M.,
et al. (2016). Diversity of Saccharomyces cerevisiae strains isolated from two
italian wine-producing regions. Front. Microbiol. 7:1018. doi: 10.3389/fmicb.
2016.01018
Charpentier, C., Colin, A., Alais, A., and Legras, J.-L. (2009). French Jura flor yeasts:
genotype and technological diversity. Antonie Van Leeuwenhoek 95, 263–273.
doi: 10.1007/s10482-009- 9309-8
Charpentier, C., Dos Santos, A.-M., and Feuillat, M. (2002). Contribution à l’étude
du métabolisme des levures à voile dans l’élaboration des vins jaunes du Jura.
Rev. Fr. Œnol. 195, 33–36.
Cocolin, L., Bisson, L. F., and Mills, D. A. (2000). Direct profiling of the yeast
dynamics in wine fermentations. FEMS Microbiol. Lett. 189, 81–87. doi: 10.
1111/j.1574-6968.2000.tb09210.x
Coi, A. L., Bigey, F., Mallet, S., Marsit, S., Zara, G., Gladieux, P., et al. (2017).
Genomic signatures of adaptation to wine biological ageing conditions in
biofilm-forming flor yeasts. Mol. Ecol. 26, 2150–2166. doi: 10.1111/mec.14053
Danilewicz, J. C. (2012). Review of oxidative processes in wine and value of
reduction potentials in enology. Am. J. Enol. Vitic. 63, 1–10. doi: 10.5344/ajev.
2011.11046
Eldarov, M. A., Beletsky, A. V., Tanashchuk, T. N., Kishkovskaya, S. A., Ravin,
N. V., and Mardanov, N. V. (2018). Whole-genome analysis of three yeast
strains used for production of sherry-like wines revealed genetic traits specific
to flor yeasts. Front. Microbiol. 9:965. doi: 10.3389/fmicb.2018.00965
Esteve-Zarzoso, B., Belloch, C., Uruburu, F., and Querol, A. (1999). Identification
of yeasts by RFLP analysis of the 5,8S rRNA gene and the two ribosomal internal
transcribed spacers. Int. J. Syst. Bacteriol. 49, 329–337. doi: 10.1099/00207713-
49-1- 329
Esteve-Zarzoso, B., Fernandez-Espinar, T., and Querol, A. (2004). Authentication
and identification of Saccharomyces cerevisiae ‘flor’ yeast races in sherry ageing.
Antonie Van Leeuwenhoek 85, 151–158. doi: 10.1023/B:ANTO.0000020282.
83717.bd
Esteve-Zarzoso, B., Peris-Toran, M. J., Garcia-Maiquez, E., Uruburu, F., and
Querol, A. (2001). Yeasts population dynamics during the fermentation and
biological aging of sherry wines. Appl. Environ. Microbiol. 67, 2056–2061.
doi: 10.1128/AEM.67.5.2056-2061.2001
Fidalgo, M., Barrales, R. R., Ibeas, J., and Jimenez, J. (2006). Adaptive evolution by
mutations in the FLO11 gene. Proc. Natl. Acad. Sci. U.S.A. 103, 11228–11233.
doi: 10.1073/pnas.0601713103
Fierro-Risco, J., Rincon, A. M., Benitez, T., and Codon, A. C. (2013).
Overexpression of stress-related genes enhances cell viability and velum
formation in Sherry wine yeasts. Appl. Microbiol. Biotechnol. 97, 6867–6881.
doi: 10.1007/s00253-013- 4850-9
Fornachon, J. G. M. (1953). Studies on the Sherry Flor. Adelaide: Australian Wine
Board.
Frezier, V., and Dubourdieu, D. (1992). Ecology of yeast strain Saccharomyces
cerevisiae during spontaneous fermentation in a Bordeaux winery. Am. J. Enol.
Vitic. 43, 375–380.
Guijo, S., Mauricio, J. C., Salmon, J. M., and Ortega, J. M. (1997). Determination
of the relative ploidy in different Saccharomyces cerevisiae strains used for
fermentation and ‘flor’ film ageing of dry sherry-type wines. Yeast 13, 101–117.
doi: 10.1002/(SICI)1097-0061(199702)13:2< 101::AID-YEA66>3.0.CO;2-H
Hope, E. A., and Dunham, M. J. (2014). Ploidy-regulated variation in biofilm-
related phenotypes in natural isolates of Saccharomyces cerevisiae.G3 4, 1773–
1786. doi: 10.1534/g3.114.013250
Ibeas, J. I., and Jimenez, J. (1996). Genomic complexity and chromosomal
rearrangements in wine-laboratory yeast hybrids. Curr. Genet. 30, 410–416.
doi: 10.1007/s002940050150
Ibeas, J. I., Lozano, I., Perdigones, F., and Jimenez, J. (1996). Detection of Dekkera-
Brettanomyces strains in sherry by a nested PCR method. Appl. Environ.
Microbiol. 62, 998–1003.
Ibeas, J. I., Lozano, I., Perdigones, F., and Jimenez, J. (1997). Dynamics of flor yeast
populations during the biological ageing of Sherry wines. Am. J. Enol. Vitic. 48,
75–79.
Infante, J. J., Dombek, K. M., Rebordinos, L., Cantoral, J. M., and Young, E. T.
(2003). Genome-wide amplifications caused by chromosomal rearrangements
play a major role in the adaptive evolution of natural yeast. Genetics 165,
1745–1759.
Kishkovskaia, S. A., Eldarov, M. A., Dumina, M. V., Tanashchuk, T. N., Ravin,
N. V., and Mardanov, A. V. (2017). Flor yeast strains from culture collection:
genetic diversity and physiological and biochemical properties. Appl. Biochem.
Microbiol. 53, 359–367. doi: 10.1134/S0003683817030085
Legras, J. L., Erny, C., and Charpentier, C. (2014). Population structure and
comparative genome hybridization of European flor yeast reveal a unique group
of Saccharomyces cerevisiae strains with few gene duplications in their genome.
PLoS One 9:e108089. doi: 10.1371/journal.pone.0108089
Legras, J. L., and Karst, F. (2003). Optimisation of interdelta analysis for
Saccharomyces cerevisiae strain characterisation. FEMS Microbiol. Lett. 221,
249–255. doi: 10.1016/S0378-1097(03)00205- 2
Legras, J. L., Moreno-Garcia, J., Zara, S., Zara, G., Garcia-Martinez, T., Mauricio,
J. C., et al. (2016). Flor yeast: new perspectives beyond wine aging. Front.
Microbiol. 7:503. doi: 10.3389/fmicb.2016.00503
Frontiers in Microbiology | www.frontiersin.org 15 September 2018 | Volume 9 | Article 2235
fmicb-09-02235 September 21, 2018 Time: 14:45 # 16
David-Vaizant and Alexandre Flor Yeast Dynamics
Longin, C., Guilloux-Benatier, M., and Alexandre, H. (2016). Design and
performance testing of a DNA extraction assay for sensitive and reliable
quantification of acetic acid bacteria directly in red wine using real time PCR.
Front. Microbiol. 7:831. doi: 10.3389/fmicb.2016.00831
Martinez, P., Codon, A. C., Pérez, L., and Benitez, T. (1995). Physiological
and molecular characterisation of flor yeasts: polymorphism of flor yeast
populations. Yeast 11, 1399–1411. doi: 10.1002/yea.320111408
Mauricio, J. C., Valero, E., Millan, C., and Ortega, J. M. (2001). Changes in
nitrogen compounds in must and wine during fermentation and biological
aging by flor yeasts. J. Agric. Food Chem. 49, 3310–3315. doi: 10.1021/jf01
0005v
Moreno-García, J., García-Martínez, T., Moreno, J., and Mauricio, J. C.
(2015). Proteins involved in flor yeast carbon metabolism under biofilm
formation conditions. Food Microbiol. 46, 25–33. doi: 10.1016/j.fm.2014.
07.001
Moreno-García, J., García-Martínez, T., Moreno, J., Millán, M. C., and Mauricio,
J. C. (2014). A proteomic and metabolomic approach for understanding the role
of the flor yeast mitochondria in the velum formation. Int. J. Food Microbiol.
172, 21–29. doi: 10.1016/j.ijfoodmicro.2013.11.030
Moreno-García, J., Mauricio, J. C., Moreno, J., and García-Martínez, T. (2017).
Differential proteome analysis of a flor yeast strain under biofilm formation.
Int. J. Mol. Sci. 18:E720. doi: 10.3390/ijms18040720
Naumova, E. S., Ivannikova, Y. V., and Naumov, G. I. (2005). Genetic
differentiation of the sherry yeasts Saccharomyces cerevisiae.Appl. Biochem.
Microbiol. 41, 578–582. doi: 10.1007/s10438-005-0105- 6
Navarro-Tapia, E., Nana, R. K., Querol, A., and Perez-Torrado, R. (2016). Ethanol
cellular defense induce unfolded protein response in yeast. Front. Microbiol.
7:189. doi: 10.3389/fmicb.2016.00189
Petruzzi, L., Capozzi, V., Berbegal, C., Corbo, M. R., Bevilacqua, A., and Spano, G.
(2017). Microbial resources and enological significance: opportunities and
benefits. Front. Microbiol. 8:995. doi: 10.3389/fmicb.2017.00995
Pozo-Bayón, A., and Moreno-Arribas, V. (2011). Sherry wines. Adv. Food Nutr.
Res. 63, 17–40. doi: 10.1016/B978-0- 12-384927- 4.00002-6
Schuller, D., Alves, H., Dequin, S., and Casal, M. (2005). Ecological survey of
Saccharomyces cerevisiae strains from vineyards in the Vinho Verde Region of
Portugal. FEMS Microbiol. Ecol. 51, 167–177. doi: 10.1016/j.femsec.2004.08.003
Suarez-Lepez, J. A., and Inigo-Leal, B. (2004). Microbiologia Enological.
Fundamentos de Vinificaciòn. Madrid: Ediciones Mundi-Prensa,
673–716.
Vasserot, Y., Caillet, S., and Maujean, A. (1997). Study of anthocyanin adsorption
by yeast lees. Effect of some physicochemical parameters. Am. J. Enol. Vitic. 48,
433–437.
Versavaud, A., Courcoux, P., Roulland, C., Dulau, L., and Hallet, J.-N. (1995).
Genetic diversity and geographical distribution of wild Saccharomyces cerevisiae
strains from the wine-producing area of Charentes, France. Appl. Environ.
Microbiol. 61, 3521–3529.
Vinod, P. K., Sengupta, N., Bhat, P. J., and Venkatesh, K. V. (2008). Integration of
global signalling pathways, cAMP-PKA, MAPK and TOR in the regulation of
FLO11. PLoS One 3:e1663. doi: 10.1371/journal.pone.0001663
Zara, G., Budroni, M., Mannazzu, I., and Zara, S. (2011). Air–liquid biofilm
formation is dependent on ammonium depletion in a Saccharomyces cerevisiae
flor strain. Yeast 28, 809–8014. doi: 10.1002/yea.1907
Zara, G., Goffrini, P., Lodi, T., Zara, S., and Manazzu, I. (2012). FLO11 expression
and lipid biosynthesis are required for air–liquid biofilm formation in a
Saccharomyces cerevisiae flor strain. FEMS Yeast Res. 12, 864–866. doi: 10.1111/
j.1567-1364.2012.00831.x
Zara, G., Zara, S., Pinna, C., Marceddu, S., and Budroni, M. (2009). FLO11 gene
length and transcriptional level affect biofilm-forming ability of wild flor strains
of Saccharomyces cerevisiae.Microbiology 159, 3838–3846. doi: 10.1099/mic.0.
028738-0
Zara, S., Bakalinsky, A. T., Zara, G., Pirino, G., Demontis, M. A., and Budroni, M.
(2005). FLO11- based model for air–liquid interfacial biofilm formation by
Saccharomyces cerevisiae.Appl. Environ. Microbiol. 71, 2934–2939. doi: 10.1128/
AEM.71.6.2934-2939.2005
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
The handling Editor declared a past co-authorship with one of the authors HA.
Copyright © 2018 David-Vaizant and Alexandre. This is an open-access article
distributed under the terms of the Creative Commons Attribution License (CC BY).
The use, distribution or reproduction in other forums is permitted, provided the
original author(s) and the copyright owner(s) are credited and that the original
publication in this journal is cited, in accordance with accepted academic practice.
No use, distribution or reproduction is permitted which does not comply with these
terms.
Frontiers in Microbiology | www.frontiersin.org 16 September 2018 | Volume 9 | Article 2235

Supplementary resource (1)

... The process for the elaboration of biologically aged white wines through the so-called "criaderas" system can be considered as the most important contribution of the South of Spain to the enology field worldwide (Moreno-Garcia, Raposo, & Moreno, 2013). The "flor yeast film" is a biological film composed of a mixture of microorganisms, mainly yeasts of the genus Saccharomyces (David-Vaizant & Alexandre, 2018;Zara, Gross, Zara, Budroni, & Bakalinsky, 2010), which form a velum on the surface (film), which can reach 1-cm thick (Marin-Menguiano, Romero-Sanchez, Barrales, & Ibeas, 2017), which protects it from the oxidative action of air. In this way, the evolution or aging of the wine does not occur in an oxidative but biological way. ...
... Flor yeast or flor velum yeasts can grow at the surface of different wines. These flor yeasts can be found in very specific wine processes known as biological aging practiced in Spain (Andalusia), Italy (Sardinia), Hungary and France (Jura) to produce Xeres, Vernaccia di Oristano, Szamorodni, and Vin Jaune wines, respectively (David-Vaizant & Alexandre, 2018). ...
Article
Full-text available
The present work analyzed the hygrothermal environment of several prestigious warehouses where sherry wines of “Fino” and “Manzanilla” type are made. Through descriptive statistics, frequency histograms and psychrometric diagrams of temperature and relative humidity variations have been obtained. In addition, other factors such as the stability and uniformity of the interior environment have been quantified. The results showed significant temperature variations throughout the year (limit values of 5 °C and 31 °C), with a more stable relative humidity (between 60% and 90% for most of the year). Indoor conditions varied much more rapidly than in wineries for the aging of red wine, as a result of constant ventilation. Therefore, the annual average stability was 2.0 ± 0.8 °C per day and 0.14 ± 0.12 °C per hour. Vertical uniformity decreased in spring and summer, with stratification values close to 0.5 °C/m and 3% r.h./m. The monitored indoor environment is outside the comfort ranges described in the literature for extended periods of time (in the most extreme case, 96% of the time outside the recommended interval). For that reason, a reference psychrometric comfort diagram was proposed. Industrial relevance For the first time, the hygrothermal behavior of several wineries producing high quality wines (very high scores in the oenological guides) was extensively analyzed. The results of the study, which include monthly comfort intervals, should be a very useful tool for the sherry wine industry, in order to control and ensure optimal development of the flor yeast film. It should also be taken into account for the correct design of new wineries or the rehabilitation of abandoned warehouses.
... In addition to Spain, Denominación de Origen (DO) sherry wines have been registered in the European Union in Italy (Sardinia), France (Jura), and Hungary (Tokay Hegyal) under the brands Vernaccia di Oristano [19], Vin Jaune [20], and Szamorodni [21], respectively ( Figure 1, Table 1). To make these, winemakers use local white grape varieties Vernaccia and Savagnin in Italy and France, as well as Furmint, Harslevelű, and Sárga Muskotály varieties in Hungary. ...
Article
Full-text available
first_page settings Open AccessReview Sherry Wines: Worldwide Production, Chemical Composition and Screening Conception for Flor Yeasts by Daria Avdanina * and Alexander Zghun * [ORCID] Group of Fungal Genetic Engineering, Federal Research Center “Fundamentals of Biotechnology” of the Russian Academy of Sciences, Leninsky Prosp. 33-2, 119071 Moscow, Russia * Authors to whom correspondence should be addressed. Academic Editor: Agustín Aranda Fermentation 2022, 8(8), 381; https://doi.org/10.3390/fermentation8080381 Received: 22 July 2022 / Revised: 5 August 2022 / Accepted: 7 August 2022 / Published: 10 August 2022 (This article belongs to the Special Issue Wine Microbiology) Download PDF Browse Figures Review Reports Citation Export Abstract The manufacturing of sherry wines is a unique, carefully regulated process, from harvesting to quality control of the finished product, involving dynamic biological aging in a “criadera-solera” system or some other techniques. Specialized “flor” strains of the yeast Saccharomyces cerevisiae play the central role in the sherry manufacturing process. As a result, sherry wines have a characteristic and unique chemical composition that determines their organoleptic properties (such as color, odor, and taste) and distinguishes them from all other types of wine. The use of modern methods of genetics and biotechnology contributes to a deep understanding of the microbiology of sherry production and allows us to define a new methodology for breeding valuable flor strains. This review discusses the main sherry-producing regions and the chemical composition of sherry wines, as well as genetic, oenological, and other selective markers for flor strains that can be used for screening novel candidates that are promising for sherry production among environmental isolates.
... In addition to Spain, Denominación de Origen (DO) sherry wines have been registered in the European Union in Italy (Sardinia), France (Jura), and Hungary (Tokay Hegyal) under the brands Vernaccia di Oristano [19], Vin Jaune [20], and Szamorodni [21], respectively ( Figure 1, Table 1). To make these, winemakers use local white grape varieties Vernaccia and Savagnin in Italy and France, as well as Furmint, Harslevelű, and Sárga Muskotály varieties in Hungary. ...
Article
Full-text available
The manufacturing of sherry wines is a unique, carefully regulated process, from harvesting to quality control of the finished product, involving dynamic biological aging in a “criadera-solera” system or some other techniques. Specialized “flor” strains of the yeast Saccharomyces cerevisiae play the central role in the sherry manufacturing process. As a result, sherry wines have a characteristic and unique chemical composition that determines their organoleptic properties (such as color, odor, and taste) and distinguishes them from all other types of wine. The use of modern methods of genetics and biotechnology contributes to a deep understanding of the microbiology of sherry production and allows us to define a new methodology for breeding valuable flor strains. This review discusses the main sherry-producing regions and the chemical composition of sherry wines, as well as genetic, oenological, and other selective markers for flor strains that can be used for screening novel candidates that are promising for sherry production among environmental isolates.
... Indeed, all flor strains present specific restriction patterns. In a recent study, a PCR ITS analysis of a large yeast sample isolated after alcoholic fermentation in the velum of Savagnin Jura wines showed that none of the S. cerevisiae strains isolated at the end of alcoholic fermentation were flor strains (David-Vaizant and Alexandre, 2018). Similar conclusions were made following a study dedicated to the yeast population evolution during sherry winemaking (Esteve-Zarzoso et al., 2001). ...
Article
Full-text available
Biofilms are sessile microbial communities whose lifestyle confers specific properties. In recent years, they have attracted great interest in many research fields. Biofilms are indeed the cause of recurrent industrial problems, while microbial contaminations can finally impact the quality of a finished product or human health. However, these same properties can be interesting for several applications. Oenology is no exception, whether for potential damages to wine quality caused by biofilms or their beneficial effects through winemaking steps, from grape to bottle. This paper reviews yeast and bacterial biofilms in oenology, their nature, their negative effects, as well as the applications linked to their presence in wine and the mechanisms involved in their formation.
... Ainsi, les biofilms deviennent problématiques dans le cas de microorganismes d'altération et/ou pathogènes qui peuvent potentiellement mieux persister dans l'environnement via cette stratégie. Dans l'industrie agro-alimentaire, les biofilms peuvent représenter une source de contamination récurrente des aliments et sont donc un véritable challenge sanitaire et économique(Abdallah et al., 2014;Zara et al., 2020).La levure d'altération Brettanomyces bruxellensis a été isolée sur diverses surfaces dans l'industrie agro-alimentaire(Abdo, 2020;Oro et al., 2019;Suiker et al., 2021) ou au sein de biofilms associés à des produits fermentés(David-Vaizant and Alexandre, 2018;Harrison and Curtin, 2021). Cependant, peu d'études se sont intéressées à la caractérisation des biofilms formés par B. bruxellensis et se sont principalement focalisées sur la quantification de cellules adhérées (de 5 heures à 15 jours) sans décrire la structure du biofilm(Dimopoulou et al., 2019;Joseph et al., 2007;Poupault, 2015; Tristezza et al., 2010). ...
Thesis
La gestion des contaminations par la levure d’altération Brettanomyces bruxellensis est un véritable défi pour la filière viti-vinicole. Le mode de vie biofilm, connu pour accroitre la résistance des micro-organismes et permettre leur persistance dans l’environnement, est une stratégie pouvant être adoptée par B. bruxellensis.Dans ce projet de thèse, des observations microscopiques ont permis de mettre en évidence la présence de matrice autour des cellules, un élément essentiel de la définition d’un biofilm. L’étude a également révélé que différents morphotypes sont impliqués dans la structure du biofilm, en particulier des filaments formant un véritable réseau. Des chlamydospore-like jusque-là jamais décrites chez l’espèce B. bruxellensis, ont été observées au sein du biofilm mais également dans des cultures planctoniques. La production de tels éléments pourrait être une stratégie de la levure pour mieux persister dans les environnements stressants. Des différences notables dans la quantité de cellules adhérées ont été observées en fonction de la nature des supports et des milieux utilisés, démontrant l’impact de l’environnement sur la formation de biofilm chez B. bruxellensis. En particulier, l’absence de glucose semble diminuer la capacité d’adhésion de plusieurs souches de B. bruxellensis.De plus, l’invasion de gélose chez B. bruxellensis nouvellement décrite au cours de ce travail se caractérise par le développement de structures multicellulaires diverses à l’intérieur du milieu gélosé, composées notamment de filaments. L’analyse optimisée à travers un pipeline d’acquisition et de traitement d’images révèle que la présence de glucose et d’oxygène favorise l’invasion de gélose. B. bruxellensis semble également capable de former des structures biofilm-like telles que des biofilms air-liquide et des colonies complexes.Enfin, les capacités d’adhésion, de formation de biofilm et d’invasion semblent souche dépendantes, étayant les connaissances à propos de l’importante diversité intraspécifique chez B. bruxellensis. Deux méthodologies rapides et fiables ont été adaptées afin de discriminer des souches au sein de groupes génétiques précédemment définis : un protocole de RAPD-PCR et un outil de deep learning. Ce dernier se base sur la diversité de morphologie cellulaire pour prédire le groupe génétique d’un isolat avec une précision de 96,6%. Cette approche nouvelle ouvre la voie pour la mise en place de méthodes de routine simples et accessibles aux acteurs de la filière viti-vinicole pour la prévention des risques de contamination par B. bruxellensis.
... The same authors also reported the occurrence of non-Saccharomyces species after molecular identification. Similar results were obtained by amplifying the 5.8S-ITS and interdelta regions to identify S. cerevisiae strains in Jura (France) from the isolates of flor samples, revealing that flor biofilms could be formed by single or multiple strains (David-Vaizant and Alexandre, 2018). Another limitation in the characterization of the flor velum microbiota is the scarce capability of some microorganisms to proliferate under laboratory conditions, thus hindering their detection. ...
Article
Full-text available
Flor yeast velum is a biofilm formed by certain yeast strains that distinguishes biologically aged wines such as Sherry wine from southern Spain from others. Although Saccharomyces cerevisiae is the most common species, 5.8 S-internal transcribed spacer (ITS) restriction fragment length polymorphism analyses have revealed the existence of non-Saccharomyces species. In order to uncover the flor microbiota diversity at a species level, we used ITS (internal transcribed spacer 1)-metabarcoding and matrix-assisted laser desorption/Ionization time of flight mass spectrometry techniques. Further, to enhance identification effectiveness, we performed an additional incubation stage in 1:1 wine:yeast extract peptone dextrose (YPD) before identification. Six species were identified: S. cerevisiae, Pichia manshurica, Pichia membranifaciens, Wickerhamomyces anomalus, Candida guillermondii, and Trichosporon asahii, two of which were discovered for the first time (C. guillermondii and Trichosporon ashaii) in Sherry wines. We analyzed wines where non-Saccharomyces yeasts were present or absent to see any potential link between the microbiota and the chemical profile. Only 2 significant volatile chemicals (out of 13 quantified), ethanol and ethyl lactate, and 2 enological parameters (out of 6 quantified), such as pH and titratable acidity, were found to differ in long-aged wines. Although results show a low impact where the non-Saccharomyces yeasts are present, these yeasts isolated from harsh environments (high ethanol and low nutrient availability) could have a potential industrial interest in fields such as food microbiology and biofuel production.
... For ensuring their development, they activate particular metabolic pathways (active neoglucogenesis and respiration metabolism) that are the opposite of those developed by wine yeasts during the alcoholic fermentation. Such metabolic differences have been previously reported at the metabolomic and the proteomic levels (Alexandre, 2013;Moreno-García et al., 2015a,b;David-Vaizant and Alexandre, 2018). In order to have a broad overview of the metabolic peculiarities of the SB strain, we reanalyzed a proteomic dataset previously generated in our laboratory Blein-Nicolas et al., 2013. ...
Article
Full-text available
The identification of natural allelic variations controlling quantitative traits could contribute to decipher metabolic adaptation mechanisms within different populations of the same species. Such variations could result from human-mediated selection pressures and participate to the domestication. In this study, the genetic causes of the phenotypic variability of the central carbon metabolism of Saccharomyces cerevisiae were investigated in the context of the enological fermentation. The genetic determinism of this trait was found out by a quantitative trait loci (QTL) mapping approach using the offspring of two strains belonging to the wine genetic group of the species. A total of 14 QTL were identified from which 8 were validated down to the gene level by genetic engineering. The allelic frequencies of the validated genes within 403 enological strains showed that most of the validated QTL had allelic variations involving flor yeast specific alleles. Those alleles were brought in the offspring by one parental strain that contains introgressions from the flor yeast genetic group. The causative genes identified are functionally linked to quantitative proteomic variations that would explain divergent metabolic features of wine and flor yeasts involving the tricarboxylic acid cycle (TCA), the glyoxylate shunt and the homeostasis of proton and redox cofactors. Overall, this work led to the identification of genetic factors that are hallmarks of adaptive divergence between flor yeast and wine yeast in the wine biotope. These results also reveal that introgressions originated from intraspecific hybridization events promoted phenotypic variability of carbon metabolism observed in wine strains.
Article
Full-text available
The phyllosphere (i.e., the aerial parts of plants) harbors a rich microbial life, including bacteria, fungi, viruses, and yeasts. Current knowledge of yeasts stems primarily from industrial and medical research on Saccharomyces cerevisiae and Candida albicans, both of which can be found on plant tissues. For most other yeasts found in the phyllosphere, little is known about their ecology and functions. Here, we explore the diversity, dynamics, interactions, and genomics of yeasts associated with plant leaves and how tools and approaches developed for model yeasts can be adopted to disentangle the ecology and natural functions of phyllosphere yeasts. A first genomic survey exemplifies that we have only scratched the surface of the largely unexplored functional potential of phyllosphere yeasts.
Article
Aging is essential for improving the quality of wine, especially for red wine and special wine types. High-quality wines are traditionally produced by ageing them in oak barrels, some special wines also produced by aging on lees, temperature aging method, biological aging, etc. They are very time-consuming and expensive, which seriously affects the production capacity and economic benefits of wineries. In this review, the principles and changing process of oak aging and other traditional aging methods were first discussed. Then, improving the aging effect and the influential factors of modern technologies that can simulate oak aging, such as micro-oxygenation, oak products, and coupling technology, etc., are analyzed. In short, using artificial aging technology to shorten the aging time, improve wine quality and reduce production costs and meet market demand has become an inevitable tendency. However, unclear reaction principles and changing process and unstable quality restrict the commercialization of artificial aging technology. Therefore, we identify future research necessary to further clarify, regulate, and optimize artificial aging technologies that perfectly simulate the traditional barrel maturation environment to truly promote applications in the wine industry.
Article
Full-text available
Flavor, composition and quality of wine are influenced by microorganisms present on the grapevine surface which are transferred to the must during vinification. The microbiota is highly variable with a prevalence of non- Saccharomyces yeasts, whereas Saccharomyces cerevisiae is present at low number. For wine production an essential step is the fermentation carried out by different starter cultures of S. cerevisiae alone or in mixed fermentation with non- Saccharomyces species that produce wines with significant differences in chemical composition. During vinification wine color can be influenced by yeasts interacting with anthocyanin. Yeasts can influence wine phenolic composition in different manners: direct interactions—cell wall adsorption or enzyme activities—and/or indirectly—production of primary and secondary metabolites and fermentation products. Some of these characteristics are heritable trait in yeast and/or can be strain dependent. For this reason, the stability, aroma, and color of wines depend on strain/strains used during must fermentation. Saccharomyces cerevisiae or non- Saccharomyces can produce metabolites reacting with anthocyanins and favor the formation of vitisin A and B type pyranoanthocyanins, contributing to color stability. In addition, yeasts affect the intensity and tonality of wine color by the action of β-glycosidase on anthocyanins or anthocyanidase enzymes or by the pigments adsorption on the yeast cell wall. These activities are strain dependent and are characterized by a great inter-species variability. Therefore, they should be considered a target for yeast strain selection and considered during the development of tailored mixed fermentations to improve wine production. In addition, some lactic acid bacteria seem to influence the color of red wines affecting anthocyanins’ profile. In fact, the increase of the pH or the ability to degrade pyruvic acid and acetaldehyde, as well as anthocyanin adsorption by bacterial cells are responsible for color loss during malolactic fermentation. Lactic acid bacteria show different adsorption capacity probably because of the variable composition of the cell walls. The aim of this review is to offer a critical overview of the roles played by wine microorganisms in the definition of intensity and tonality of wines’ color.
Article
Full-text available
Flor yeast strains represent a specialized group of Saccharomyces cerevisiae yeasts used for biological wine aging. We have sequenced the genomes of three flor strains originated from different geographic regions and used for production of sherry-like wines in Russia. According to the obtained phylogeny of 118 yeast strains, flor strains form very tight cluster adjacent to the main wine clade. SNP analysis versus available genomes of wine and flor strains revealed 2,270 genetic variants in 1,337 loci specific to flor strains. Gene ontology analysis in combination with gene content evaluation revealed a complex landscape of possibly adaptive genetic changes in flor yeast, related to genes associated with cell morphology, mitotic cell cycle, ion homeostasis, DNA repair, carbohydrate metabolism, lipid metabolism, and cell wall biogenesis. Pangenomic analysis discovered the presence of several well-known “non-reference” loci of potential industrial importance. Events of gene loss included deletions of asparaginase genes, maltose utilization locus, and FRE-FIT locus involved in iron transport. The latter in combination with a flor-yeast-specific mutation in the Aft1 transcription factor gene is likely to be responsible for the discovered phenotype of increased iron sensitivity and improved iron uptake of analyzed strains. Expansion of the coding region of the FLO11 flocullin gene and alteration of the balance between members of the FLO gene family are likely to positively affect the well-known propensity of flor strains for velum formation. Our study provides new insights in the nature of genetic variation in flor yeast strains and demonstrates that different adaptive properties of flor yeast strains could have evolved through different mechanisms of genetic variation.
Article
Full-text available
Among the innovative trends in the wine sector, the continuous exploration of enological properties associated with wine microbial resources represents a cornerstone driver of quality improvement. Since the advent of starter cultures technology, the attention has been focused on intraspecific biodiversity within the primary species responsible for alcoholic fermentation (Saccharomyces cerevisiae) and, subsequently, for the so-called ‘malolactic fermentation’ (Oenococcus oeni). However, in the last decade, a relevant number of studies proposed the enological exploitation of an increasing number of species (e.g. non-Saccharomyces yeasts) associated with spontaneous fermentation in wine. These new species/strains may provide technological solutions to specific problems and/or improve sensory characteristics, such as complexity, mouth-feel and flavours. This review offers an overview of the available information on the enological/protechnological significance of microbial resources associated with winemaking, summarizing the opportunities and the benefits associated with the enological exploitation of this microbial potential. We discuss proposed solutions to improve quality and safety of wines (e.g alternative starter cultures, multistrains starter cultures) and future perspectives.
Article
Full-text available
Several Saccharomyces cerevisiae strains (flor yeasts) form a biofilm (flor velum) on the surface of Sherry wines after fermentation, when glucose is depleted. This flor velum is fundamental to biological aging of these particular wines. In this study, we identify abundant proteins in the formation of the biofilm of an industrial flor yeast strain. A database search to enrich flor yeast “biological process” and “cellular component” according to Gene Ontology Terminology (GO Terms) and, “pathways” was carried out. The most abundant proteins detected were largely involved in respiration, translation, stress damage prevention and repair, amino acid metabolism (glycine, isoleucine, leucine and arginine), glycolysis/gluconeogenesis and biosynthesis of vitamin B9 (folate). These proteins were located in cellular components as in the peroxisome, mitochondria, vacuole, cell wall and extracellular region; being these two last directly related with the flor formation. Proteins like Bgl2p, Gcv3p, Hyp2p, Mdh1p, Suc2p and Ygp1p were quantified in very high levels. This study reveals some expected processes and provides new and important information for the design of conditions and genetic constructions of flor yeasts for improving the cellular survival and, thus, to optimize biological aging of Sherry wine production.
Article
Full-text available
Numerous studies, based on different molecular techniques analysing DNA polymorphism, have provided evidence that indigenous Saccharomyces cerevisiae populations display biogeographic patterns. Since the differentiated populations of S. cerevisiae seem to be responsible for the regional identity of wine, the aim of this work was to assess a possible relationship between the diversity and the geographical origin of indigenous S. cerevisiae isolates from two different Italian wine-producing regions (Tuscany and Basilicata). For this purpose, sixty-three isolates from Aglianico del Vulture grape must (main cultivar in the Basilicata region) and from Sangiovese grape must (main cultivar in the Tuscany region) were characterized genotypically, by mitochondrial DNA restriction analysis and MSP-PCR by using (GTG)5 primers, and phenotypically, by determining technological properties and metabolic compounds of oenological interest after alcoholic fermentation. All the S. cerevisiae isolates from each region were inoculated both in must obtained from Aglianico grape and in must obtained from Sangiovese grape to carry out fermentations at laboratory-scale. Numerical analysis of DNA patterns resulting from both molecular methods and principal component analysis of phenotypic data demonstrated a high diversity among the S. cerevisiae strains. Moreover, a correlation between genotypic and phenotypic groups and geographical origin of the strains was found, supporting the concept that there can be a microbial aspect to terroir. Therefore, exploring the diversity of indigenous S. cerevisiae strains can allow developing tailored strategies to select wine yeast strains better adapted to each viticultural area.
Article
Full-text available
Although strategies exist to prevent AAB contamination, the increased interest for wines with low sulfite addition leads to greater AAB spoilage. Hence there is a real need for a rapid, specific, sensitive and reliable method for detecting these spoilage bacteria. All these requirements are met by real time Polymerase Chain Reaction (or quantitative PCR; qPCR). Here, we compare existing methods of isolating DNA and their adaptation to a red wine matrix. Two different protocols for isolating DNA and three PCR mix compositions were tested to select the best method. The addition of insoluble polyvinylpolypyrrolidone (PVPP) at 1% (v/v) during DNA extraction using a protocol succeeded in eliminating PCR inhibitors from red wine. We developed a bacterial internal control which was efficient in avoiding false negative results due to decreases in the efficiency of DNA isolation and/or amplification. The specificity, linearity, repeatability and reproducibility of the method were evaluated. A standard curve was established for the enumeration of AAB inoculated into red wines. The limit of quantification in red wine was 3.7 log AAB/mL and about 2.8 log AAB/mL when the volume of the samples was increased from 1 mL to 10 mL. Thus the DNA extraction method developed in this paper allows sensitive and reliable AAB quantification without underestimation thanks to the presence of an internal control. Moreover, monitoring of both the AAB population and the amount of acetic acid in ethanol medium and red wine highlighted that a minimum about 6.0 log cells/mL of AAB is needed to significantly increase the production of acetic acid leading to spoilage.
Article
Full-text available
The most important dogma in white-wine production is the preservation of the wine aroma and the limitation of the oxidative action of oxygen. In contrast, the aging of Sherry and Sherry-like wines is an aerobic process that depends on the oxidative activity of flor strains of Saccharomyces cerevisiae. Under depletion of nitrogen and fermentable carbon sources, these yeast produce aggregates of floating cells and form an air-liquid biofilm on the wine surface, which is also known as velum or flor. This behavior is due to genetic and metabolic peculiarities that differentiate flor yeast from other wine yeast. This review will focus first on the most updated data obtained through the analysis of flor yeast with -omic tools. Comparative genomics, proteomics, and metabolomics of flor and wine yeast strains are shedding new light on several features of these special yeast, and in particular, they have revealed the extent of proteome remodeling imposed by the biofilm life-style. Finally, new insights in terms of promotion and inhibition of biofilm formation through small molecules, amino acids, and di/tri-peptides, and novel possibilities for the exploitation of biofilm immobilization within a fungal hyphae framework, will be discussed.
Article
Full-text available
Ethanol is a valuable industrial product and a common metabolite used by many cell types. However, this molecule produces high levels of cytotoxicity affecting cellular performance at several levels. In the presence of ethanol, cells must adjust some of their components, such as the membrane lipids to maintain homeostasis. In the case of microorganism as Saccharomyces cerevisiae, ethanol is one of the principal products of their metabolism and is the main stress factor during fermentation. Although many efforts have been made, mechanisms of ethanol tolerance are not fully understood and very little evidence is available to date for specific signaling by ethanol in the cell. This work studied two Saccharomyces cerevisiae strains, CECT10094 and Temohaya-MI26, isolated from flor wine and agave fermentation (a traditional fermentation from Mexico) respectively, which differ in ethanol tolerance, in order to understand the molecular mechanisms underlying the ethanol stress response and the reasons for different ethanol tolerance. The transcriptome was analyzed after ethanol stress and, among others, an increased activation of genes related with the unfolded protein response (UPR) and its transcription factor, Hac1p, was observed in the tolerant strain CECT10094. We observed that this strain also resist more UPR agents than Temohaya-MI26 and the UPR-ethanol stress correlation was corroborated observing growth of 15 more strains and discarding UPR correlation with other stresses as thermal or oxidative stress. Furthermore, higher activation of UPR pathway in the tolerant strain CECT10094 was observed using a UPR mCherry reporter. Finally, we observed UPR activation in response to ethanol stress in other S. cerevisiae ethanol tolerant strains as the wine strains T73 and EC1118. This work demonstrates that the UPR pathway is activated under ethanol stress occurring in a standard fermentation and links this response to an enhanced ethanol tolerance. Thus, our data suggest that there is a room for ethanol tolerance improvement by enhancing UPR response.
Article
The relative importance of gross chromosomal rearrangements to adaptive evolution has not been precisely defined. The Saccharomyces cerevisiae flor yeast strains offer significant advantages for the study of molecular evolution since they have recently evolved to a high degree of specialization in a very restrictive environment. Using DNA microarray technology, we have compared the genomes of two prominent variants of S. cerevisiae flor yeast strains. The strains differ from one another in the DNA copy number of 116 genomic regions that comprise 38% of the genome. In most cases, these regions are amplicons flanked by repeated sequences or other recombination hotspots previously described as regions where double-strand breaks occur. The presence of genes that confer specific characteristics to the flor yeast within the amplicons supports the role of chromosomal rearrangements as a major mechanism of adaptive evolution in S. cerevisiae. We propose that nonallelic interactions are enhanced by ethanol- and acetaldehyde-induced double-strand breaks in the chromosomal DNA, which are repaired by pathways that yield gross chromosomal rearrangements. This mechanism of chromosomal evolution could also account for the sexual isolation shown among the flor yeast.
Article
Sixteen flor yeast strains from the Magarach Collection of the Microorganisms for Winemaking (Yalta, Crimea), which are used for production of sherry, were analyzed for morphophysiological, cultural, and biochemical properties. Long-term storage did not affect their viability or the preservation of major properties, such as their flor- and aldehyde-forming abilities, and the ability to produce wines with typical sherry properties. Significant variation in the strains was observed mainly in the aldehyde-forming and flor-forming abilities and flor properties. Interdelta typing was shown to be the most informative technique to study the genetic diversity of flor yeast strains. Certain correlations between genetic polymorphisms and the enological properties of the strains were observed. The presence of a 24-bp long deletion in the ITS1 spacer of the ribosomal gene cluster, a typical feature of Spanish flor yeast strains, is correlated with a high level of production of aldehydes and acetales, efficient flor formation, and the ability to produce high quality sherry. The presence of a specific deletion in the promoter of the FLO11 gene appeared to be less informative, since the aldehyde and acetal production and flor formation abilities of such strains were variable. The studies of intraspecies genetic polymorphism by various molecular markers have revealed a high degree of phylogenetic closeness of some yeast flor strains from different geographic regions.
Article
The molecular and evolutionary processes underlying fungal domestication remain largely unknown despite the importance of fungi to bioindustry and for comparative adaptation genomics in eukaryotes. Wine fermentation and biological aging are performed by strains of S. cerevisiae with, respectively, pelagic fermentative growth on glucose, and biofilm aerobic growth utilizing ethanol. Here, we use environmental samples of wine and flor yeasts to investigate the genomic basis of yeast adaptation to contrasted anthropogenic environments. Phylogenetic inference and population structure analysis based on single nucleotide polymorphisms (SNPs) revealed a group of flor yeasts separated from wine yeasts. A combination of methods revealed several highly differentiated regions between wine and flor yeasts, and analyses using codon-substitution models for detecting molecular adaptation identified sites under positive selection in the high affinity transporter gene ZRT1. The Cross Population Composite Likelihood Ratio (XP-CLR) revealed selective sweeps at three regions, including in the hexose transporter gene HXT7, the yapsin gene YPS6 and the membrane protein coding gene MTS27. Our analyses also revealed that the biological aging environment has led to the accumulation of numerous mutations in proteins from several networks, including Flo11 regulation and divalent metal transport. Together, our findings suggest that the tuning of FLO11 expression and zinc transport networks are a distinctive feature of the genetic changes underlying the domestication of flor yeasts. Our study highlights the multiplicity of genomic changes underlying yeast adaptation to man-made habitats, and reveals that flor/wine yeast lineage can serve as a useful model for studying the genomics of adaptive divergence. This article is protected by copyright. All rights reserved.