ArticlePDF Available

Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons

Authors:

Abstract and Figures

While the exact role of β1 subunit-containing GABA-A receptors (GABARs) in brain function is not well understood, altered expression of the β1 subunit gene (GABRB1) is associated with neurological and neuropsychiatric disorders. In particular, down-regulation of β1 subunit levels is observed in brains of patients with epilepsy, autism, bipolar disorder and schizophrenia. A pathophysiological feature of these disease states is imbalance in energy metabolism and mitochondrial dysfunction. The transcription factor, nuclear respiratory factor 1 (NRF-1), has been shown to be a key mediator of genes involved in oxidative phosphorylation and mitochondrial biogenesis. Using a variety of molecular approaches (including mobility shift, promoter/reporter assays, and overexpression of dominant negative NRF-1), we now report that NRF-1 regulates transcription of GABRB1 and that its core promoter contains a conserved canonical NRF-1 element responsible for sequence specific binding and transcriptional activation. Our identification of GABRB1 as a new target for NRF-1 in neurons suggests that genes coding for inhibitory neurotransmission may be coupled to cellular metabolism. This is especially meaningful as binding of NRF-1 to its element is sensitive to the kind of epigenetic changes that occur in multiple disorders associated with altered brain inhibition.
| In vitro and in vivo binding of NRF-1 to the putative NRF-1 site in GABRB1. (A) 32 P-labeled probes encompassing the NRF-1 binding site were incubated with 20 ?g of DIV7 primary rat cortical nuclear extracts. 100-fold excess of unlabeled probe was added to the binding reaction to assess specificity. NRF-1 Abs were pre-incubated with nuclear extracts and radiolabeled probe to test for "supershift" and protein identification. (Left Panel) The NRF-1 element in the rat cytochrome c (Cyt C) promoter displays NRF-1 specific binding (lane 2) and "supershift" (lane 4). (Right Panel) The proposed NRF-1 element in the human GABRB1 promoter displays a probe specific shift (lane 6; note that excess probe was run off of the gel to provide room for the detection of the shifted probe), competition of complex formation with cold competitor (lane 7), lack of competition with mutant cold competitor (lane 8), and supershift upon addition of NRF-1 specific Ab (lane 9). In contrast, binding to radiolabeled probe for NRF-1 mutant GABRB1 shows markedly reduced signal strength (lanes 11 and 12). " * " Indicates specific interaction between labeled probe and nuclear extract, "?" indicates location of supershift. (B) Chromatin Immunoprecipitation (ChIP) assays were performed using sonicated genomic DNA from DIV7 primary rat cortical neurons and either ChIP grade NRF-1 polyclonal antibody (Abcam, ab34682) that recognizes the full length protein or rabbit IgG (Vector Laboratories, I-1,000). Co-precipitated GABRB1 gene promoter fragments were detected with specific quantitative PCR (qPCR) primers and probe. Data represent the average ? SEM of n = 4 independent primary cultures and co-precipitations. * * * p < 0.001, student t-test. (C) Representative ChIP-seq track from the Strand NGS software platform for GABRB1 in H1-hESC cells after peak detection (MACS version 2.0). Read density profile plots of forward reads (blue) and reverse reads (red) aligned to the UCSC transcript model are depicted; each brown box represents a single 27-bp sequencing read. The NRF-1 motif sequence is shown in black text above its position. Relative position of the Inr in GABRB1 is shown for reference. Chr, chromosome. (A,B) Datasets were originally published in the thesis of Li (2015).
… 
Content may be subject to copyright.
ORIGINAL RESEARCH
published: 21 August 2018
doi: 10.3389/fnmol.2018.00285
Nuclear Respiratory Factor 1 (NRF-1)
Controls the Activity Dependent
Transcription of the GABA-A
Receptor Beta 1 Subunit Gene in
Neurons
Zhuting Li1,2† ,Meaghan Cogswell1† ,Kathryn Hixson 1,Amy R. Brooks-Kayal 3,4
and Shelley J. Russek1,5*
1Laboratory of Translational Epilepsy, Department of Pharmacology and Experimental Therapeutics, School of Medicine,
Boston University, Boston, MA, United States, 2Department of Biomedical Engineering, College of Engineering, Boston
University, Boston, MA, United States, 3Department of Pediatrics, Division of Neurology, School of Medicine, University of
Colorado, Aurora, CO, United States, 4Department of Pharmaceutical Sciences, Skaggs School of Pharmacy and
Pharmaceutical Sciences, University of Colorado Anschutz Medical Campus, Aurora, CO, United States, 5Department of
Biology, Boston University, Boston, MA, United States
Edited by:
Gregg E. Homanics,
University of Pittsburgh,
United States
Reviewed by:
Deep R. Sharma,
SUNY Downstate Medical Center,
United States
Peter Vanhoutte,
Centre National de la Recherche
Scientifique (CNRS), France
*Correspondence:
Shelley J. Russek
srussek@bu.edu
These authors have contributed
equally to this work
Received: 21 March 2018
Accepted: 27 July 2018
Published: 21 August 2018
Citation:
Li Z, Cogswell M, Hixson K,
Brooks-Kayal AR and Russek SJ
(2018) Nuclear Respiratory Factor 1
(NRF-1) Controls the Activity
Dependent Transcription of the
GABA-A Receptor Beta 1 Subunit
Gene in Neurons.
Front. Mol. Neurosci. 11:285.
doi: 10.3389/fnmol.2018.00285
While the exact role of β1 subunit-containing GABA-A receptors (GABARs) in
brain function is not well understood, altered expression of the β1 subunit gene
(GABRB1) is associated with neurological and neuropsychiatric disorders. In particular,
down-regulation of β1 subunit levels is observed in brains of patients with epilepsy,
autism, bipolar disorder and schizophrenia. A pathophysiological feature of these
disease states is imbalance in energy metabolism and mitochondrial dysfunction. The
transcription factor, nuclear respiratory factor 1 (NRF-1), has been shown to be a key
mediator of genes involved in oxidative phosphorylation and mitochondrial biogenesis.
Using a variety of molecular approaches (including mobility shift, promoter/reporter
assays, and overexpression of dominant negative NRF-1), we now report that NRF-1
regulates transcription of GABRB1 and that its core promoter contains a conserved
canonical NRF-1 element responsible for sequence specific binding and transcriptional
activation. Our identification of GABRB1 as a new target for NRF-1 in neurons
suggests that genes coding for inhibitory neurotransmission may be coupled to cellular
metabolism. This is especially meaningful as binding of NRF-1 to its element is sensitive
to the kind of epigenetic changes that occur in multiple disorders associated with altered
brain inhibition.
Keywords: GABA-A receptor, GABRB1, NRF-1, cortical neurons, activity-dependent, mitochondrial biogenesis
Abbreviations: ChIP, Chromatin-immunoprecipitation; DIV, Days in vitro; EMSA, Electrophoretic mobility shift assay;
GABAR, GABA type A receptors; GABRB1, GABA receptor subtype A β1 subunit gene; HRP, Horseradish peroxidase;
Inr, Initiator element; NRF-1, Nuclear respiratory factor 1; PhF1, Polycomb-like protein; TSS, Transcriptional start site;
VP16, Herpes simplex virus virion protein 16.
Frontiers in Molecular Neuroscience | www.frontiersin.org 1August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
INTRODUCTION
The type A γ-aminobutyric acid receptor (GABA-A receptors,
GABAR) is a ligand-gated Clion channel that mediates
inhibitory neurotransmission in the adult mammalian central
nervous system. The majority of GABARs are composed of two
αand two βsubunits, and either a γ2 or δsubunit (Farrar et al.,
1999; Barrera et al., 2008; Patel et al., 2014). For each receptor,
there is the binding of two molecules of GABA, one molecule
at each αand βsubunit interface (Rabow et al., 1995; Connolly
and Wafford, 2004; Olsen and Sieghart, 2009). In the mature
neuron, activation of GABARs leads to hyperpolarization.
Depending on its subunit composition, GABARs may contain
binding sites for barbiturates, benzodiazepines, ethanol, and/or
neuroactive steroids. There are nineteen different subunit genes
to date, grouped into eight classes (i.e., α1–6, β1–3, γ1–3, δ,
ε,θ,π,ρ1–3) that contribute to the diversity and differential
assembly of receptor subtypes. The βsubunits, which contain
the domains that interact with mediators of receptor trafficking
and endocytosis (for reviews see Jacob et al., 2008; Vithlani et al.,
2011), play an important role in the expression of GABARs at the
cell surface.
The human GABA receptor subtype A β1 subunit gene
(GABRB1), located on chromosome 4, is part of a GABAR
gene cluster that contains the genes that encode the α2,
α4 and γ1 subunits. A dysregulation of GABAR-mediated
neurotransmission has been implicated in various neurological
disorders (Hines et al., 2012) that show altered levels of GABAR
subunits, including β1. Through linkage studies, GABRB1 has
been associated with alcohol dependance (Parsian and Zhang,
1999; Sun et al., 1999; Zinn-Justin and Abel, 1999; Song et al.,
2003); and more recently, specific mutations in mouse Gabrb1
have been shown to produce increased alcohol consumption
that is linked to increased tonic inhibition (Anstee et al., 2013).
Interestingly, single nucleotide polymorphisms in GABRB1
are also associated with altered brain responses in human
adolescents susceptible to addictive behaviors (Duka et al.,
2017).
GABRB1 expression is also reduced in the lateral cerebella
of subjects with bipolar disorder, major depression, and
schizophrenia compared to healthy subjects (Fatemi et al.,
2013). Particularly in schizophrenia, a significant association
of GABRB1 has been identified by genome-wide association
studies that were coupled to a protein-interaction-network-
based analysis (Yu et al., 2014). As GABRB1 and GABRA4 lie
within the same GABAR gene cluster and their promoters are
head-to-head, it is interesting to note that the association of
GABRA4 with autism risk increases with a GABRB1 interaction
(Ma et al., 2005; Collins et al., 2006), suggesting that these
genes may be coordinately regulated. Further support for an
association of GABRB1 with autism is evidenced by a decrease in
β1 subunit levels in the brains of autistic subjects (Fatemi et al.,
2009, 2010). In addition, the levels of both β1 and β2 subunit
mRNAs are reduced in a Fragile X mental retardation mouse
model, where the gene Fragile X mental retardation 1 (fmr1)
was removed (D’Hulst et al., 2006). Finally, down-regulation
of β1 subunit mRNAs and protein are observed in the rat
pilocarpine model of epilepsy (Brooks-Kayal et al., 1998). Yet,
despite its prevalent association with brain disorders, there is
still little known about the function and/or regulation of β1 in
neurons.
The TATA-less GABRB1/Gabrb1 promoter (GABRB1-p
(human)/Gabrb1-p (rodent)) contains multiple transcriptional
start sites that lie within a CpG island (Russek et al., 2000;
Saha et al., 2013). In unraveling the molecular determinants
of GABAR β1 subunit gene regulation, our laboratory
demonstrated that the minimal GABRB1-p lies within the
first 500 bp of the 5’ flanking region. Within this region,
there is a conserved initiator element (Inr) that mediates
down-regulation in response to chronic GABA exposure,
implicating an autologous mechanism of transcriptional control.
Nuclear respiratory factor 1 (NRF-1) is a transcription
factor that functions primarily as a positive regulator of
nuclear genes involved in mitochondrial biogenesis and
oxidative phosphorylation, such as Tfam, which moves into the
mitochondria and regulates mitochondrial DNA transcription
(Scarpulla, 2006, 2008). However, it has also been shown that the
binding of NRF-1 to a co-factor, such as SIRT7, can influence
its polarity (from activator to repressor; Mohrin et al., 2015).
In addition, binding of NRF-1 to DNA is regulated by the
methylation state of its regulatory element (Domcke et al., 2015),
suggesting that its role in neuronal gene expression will be
sensitive to the epigenetic changes that occur in neurological and
neuropsychiatric disorders.
It is well known that increased neuronal activity results
in a parallel change in cellular metabolism, as orchestrated
by the synthesis of NRF-1 and its control over mitochondrial
biogenesis. Moreover, it has been reported that NRF-1 is a
transcriptional activator of glutamate receptor subunit genes
under conditions of depolarizing stimulation in neurons (Dhar
and Wong-Riley, 2009) suggesting that in addition to its role in
cellular metabolism, via regulation of the mitochondrial genome,
NRF-1 coordinates activities in the nucleus to couple neuronal
excitability with energy demands of synaptic neurotransmission.
Here, we ask whether NRF-1 may control the transcription
of GABAR subunit genes (GABRs), and in particular the human
β1 subunit gene (GABRB1), a gene that has been associated
with neuronal developmental disorders, the pathophysiology
of epilepsy, and alcohol dependance. In this study, we have
uncovered a functional regulatory element within GABRB1 that
demonstrates sequence specificity and is responsible for the
majority of GABRB1 promoter-reporter activity, as well as a role
for NRF-1 in the activity dependent transcription of endogenous
Gabrb1 in rat primary cortical neurons.
MATERIALS AND METHODS
Cell Culture and Drug Treatment
This study was carried out in accordance with the
recommendations of the Boston University Institutional
Animal Care and Use Committee (IACUC) that oversees and
routinely evaluates the activities conducted by and at BU that
involve animals. All animal care and use protocols must be
Frontiers in Molecular Neuroscience | www.frontiersin.org 2August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
approved by the IACUC before animals are procured and
prior to performing any work with them in or out of the
laboratory.
Primary neocortical neurons were isolated from embryonic
day 18 Sprague-Dawley rat embryos (Charles River
Laboratories). Isolated embryonic brains and the subsequently
dissected cortices were maintained in ice-cold modified
calcium-magnesium free Hank’s Balanced Salt Solution (HBSS;
4.2 mM sodium bicarbonate, 1 mM sodium pyruvate and 20 mM
HEPES, 3 mg/ml BSA) buffering between pH range 7.25–7.3.
Tissues were then separated from HBSS dissection solution and
trypsinized (0.05% trypsin-EDTA) for 10 min in 37C and 5%
CO2. The trypsin reaction was stopped with serum inactivation
using plating medium (Neural Basal Medium, 10% FBS, 10 U/ml
penicillin/streptomycin, 2 mM L-glutamine). Tissues were
triturated with a 1,000 mL micropipette and diluted to a
concentration of 0.5 ×106cells/mL in plating media for plating.
Cells were allowed to adhere onto Poly-L-lysine coated culturing
surface for 1 h prior to changing to serum-free feeding medium
(2% B-27, 2 mM glutamine, 10 U/ml penicillin/streptomycin
supplemented neurobasal medium). Neuronal cultures were
maintained at 37C in a 5% CO2incubator. Primary cortical
neurons (DIV7–8) were treated with either Vehicle or 20 mM
KCl for 6 h before harvesting for analysis.
Expression Constructs
pCDNA 3.1 hygro hNRF-1 herpes simplex virus virion
protein 16 (VP16) was generously provided by Dr. Tod
Gulick (Ramachandran et al., 2008; Sanford-Burnham Medical
Research Institute, Orlando, FL, USA). pcDNA 3.1 hygro
hNRF-1 VP16 encodes a constitutively active form of NRF-1,
consisting of the full-length human NRF-1 and the herpes
simplex virus VP16 transactivation domain. The pcDNA3.0-
NRF-1 DN expresses amino acid residues 1–304 of human
NRF-1, which encodes the DNA-binding, dimerization
and nuclear localization domains of NRF-1, but lacks the
transactivation domain (amino acids 305–503). With the
exception of a single conservative mutation at amino acid
residue 293 (AT), the 304 amino acid residues of NRF-1
are conserved between human and rat. The construct was
created using PCR with the forward primer sequence 5’-
CGGGGTACCACCATGGAGGAACACGGAGTGACCCAAAC-
3’, containing the underlined Kpn1 restriction site and the kozak
sequence on the 5’ end, and the reverse primer 5’GCTCTA
GATCACTGTGATGGTACAAGATGAGCTATACTATGTGT
GGCTGTGGC-3’, containing stop codon and Xba1 restriction
site. PCR products were digested with restriction enzymes
Kpn1 and Xba1, and ligated into pcDNA3.0 vector (Invitrogen).
Electrophoretic Mobility Shift (EMSA) and
Supershift Assays
Briefly, 30 bp DNA probes containing the putative NRF-1
binding sequence were incubated with 25 µg of neocortical
nuclear extracts for electrophoresis under non-denaturing
conditions. Following electrophoresis, the protein-DNA
complexes were detected by autoradiography. The DNA probes
were created from annealing synthesized oligonucleotides1
and 5’ end labeling using [γ32P] ATP (PerkinElmer) in a
T4 polynucleotide kinase (NEB) reaction. Nuclear extracts were
prepared from DIV7 primary neocortical neurons grown on
10-cm plates in the presence of protease inhibitor cocktail.
Protein-DNA binding specificity was determined by adding
poly (dI-dC; Roche) or/and 100-fold excess unlabeled DNA
probe prior to the addition of labeled probe during the room
temperature binding reaction. To generate a supershift complex,
NRF-1 antibody (AbCam ab34682) was added to the reaction
mixture for 15 min. The binding reactions were loaded onto
a 5% polyacrylamide gel in 0.5×TBE buffer and run at 200V
for 2 h at 4C. The positive control probe consisted of a
functional NRF-1 sequence (Evans and Scarpulla, 1990) found
in the Rat cytochrome c(rCycs) gene (Evans and Scarpulla,
1990). Probe and competitor oligonucleotide sequences were:
GABRB1 NRF-1, 5’-agcgcgcTCTGCGCATGCGCAggtccattc-3’
and 5’-gaatggaccTGCGCATGCGCAGAgcgcgct-3’. GABRB1
NRF-1 mutant, 5’-agcgcgcTCTGCcCATGgGCAggtccattc -
3’ and 5’-gaatggaccTGCcCATGgGCAGAgcgcgct-3’. rCycs
NRF-1, 5’-ctgctaGCCCGCATGCGCgcgcacctta-3’and 5’-
taaggtgcgcGCGCATGCGGGCtagcag-3’.
Reporter Plasmids and Promoter
Mutagenesis
The GABRB1p-Luc (pGL2-GABRB1) promoter construct
containing the 5’ flanking region of the human β1 subunit gene
was previously cloned by our laboratory and contains 436 bp
upstream of the initiator sequence and 105 bp downstream
(Russek et al., 2000). The promoter containing a mutated
NRF-1 element (TCTGCcCATGgGCA) within the GABRB1p-
Luc was created by PCR-driven overlap extension. Using
wild-type GABRB1p-Luc as PCR template, two PCR fragments
were amplified using the GL1 primer (Promega) and the
antisense mutant NRF-1 oligonucleotide from electrophoretic
mobility shift (EMSA), and sense mutant NRF-1 oligonucleotide
and the GL2 primer (Promega), resulting in fragments with
30 bp overlapping sequences that contain the mutant NRF-1
element. A second PCR step using GL1, GL2 primers and both
initial PCR products produced the mutant GABRB1 promoter
insert.
Luciferase Reporter Assays
Magnetofection of DNA into primary neuron cultures was
achieved with the NeuroMag transfection reagent according
to the manufacturer’s protocol. Here, 2 ml of resuspended
E18 primary cortical neurons at 0.5 ×106cells/ml were plated in
each well of a 6-well plate. On DIV7, neurons were transfected
with 1 µg of expression construct, 2 µg of promoter reporter
construct, and 3 µl of NeuroMag transfection reagent (1:1 DNA
to reagent ratio). 24 h after transfection, neurons were actively
lysed by scraping. Cell lysates were cleared of precipitates by
centrifugation and then assayed for luciferase activity using
a luciferase assay system (Promega). Luciferase activity was
normalized to total protein as determined using a protein assay
1www.idtdna.com
Frontiers in Molecular Neuroscience | www.frontiersin.org 3August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
kit (ThermoScientific Pierce). All transfections were performed
in sister dishes from three or more plating sessions to produce
true N’s.
Chromatin Immunoprecipitation (ChIP)
Chromatin-immunoprecipitation (ChIP) was performed
according to the Magna ChIP A protocol (Millipore). Briefly,
primary neurons in 100 mm dishes were fixed with a final
concentration of 1% formaldehyde in culturing media.
The remaining unreacted formaldehyde was quenched with
Glycine. Genomic DNA and protein complexes were extracted
from cells using nuclear lysis buffers supplemented with
protease and phosphatase inhibitors. The lysates containing
DNA-protein complexes were sonicated (nine times, 5 min
each at a 30 s on/off interval) in an ice-cold water bath with
a Bioruptor (Diagenode) in order to generate fragments
predominantly in the range of 200–500 bp in size. The
sheared chromatin was immunoprecipitated with either
anti-NRF-1 antibody (Abcam ab34682 ChIP grade antibody) or
normal rabbit IgG overnight at 4C with constant rotation. The
antibody/transcription factor bound chromatin was separated
from unbound chromatin using Protein A conjugated magnetic
beads and magnetic pull-down. The isolated complexes
were washed with a series of salt buffer solutions prior to
eluting. DNA fragments were separated from complexes using
Proteinase K and heating, and recovered through column
purification. The co-precipitated DNA fragments were identified
by quantitative PCR (qPCR) using specific primers and
TaqMan probes that flank putative responsive elements in
gene promoters using the FastStart Universal Probe Master
(Roche) PCR reagent. PCR cycling was performed using the
ABI7900HT Fast Real-Time PCR system. The Gabrb1 promoter
fragment (114 bp) was amplified using: forward primer 5’-
TGTTTGCAAGGCACAAGGTGTC-3’, reverse primer 5’-
TCTGCGAAGATTCAAGGAATGCAACT, TaqManrMGB
probe 5’- GCGCATGCGCAGGTCCATTCGGGAAT-3’.
Western Blot Analysis
Total cellular proteins were extracted from primary neuronal
cultures after KCl treatment with standard procedures and the
use of RIPA lysis buffer (Tris, pH 7.4, 10 mM; Nonidet P-40 1%;
NaCl 150 mM; SDS 0.1%; protease inhibitor mixture (Roche
Applied Science) 1×; EDTA 1 mM; sodium orthovanadate
1 mM; sodium deoxycholate 0.1%; phenylmethylsulfonyl
fluoride 1 mM). Thirty microgram of whole cell extracts
were separated by SDS-PAGE under reducing conditions
on either 10% or 4%–20% Tris-glycine gel according to
mass/size. The electrophoresed samples were transferred to
nitrocellulose membranes. Western blot analysis was performed
using antibodies against NRF-1 (AbCam ab34682, 1:2,000 in
1×TBS-T). Membranes were incubated with peroxidase-
conjugated goat anti-rabbit secondary antibody (Santa Cruz
Biotechnology, 1:5,000) in TBS-T and visualized using the ECL
enhanced chemiluminescence reagent (GE Healthcare Life
Sciences). Data are presented as mean ±SEM. Significance
was determined at p<0.05 using the paired Student’s t-test
(two-tailed).
RNA Extraction and qRT-PCR
Total RNA was isolated from cultured primary neocortical using
the RNeasy Micro Kit (Qiagen). For each reaction, 20 ng of
total RNA was reverse-transcribed to cDNA and PCR amplified
in a single reaction mixture using the TaqManrOne-Step
RT-PCR Master Mix Reagents Kit (Applied Biosystems).
Incubation and thermal cycling conditions were performed
using the ABI7900HT in a 384-well PCR plate format (Applied
Biosystems). The RT reaction was held at 48C for 30 min,
followed by 95C for 10 min to activate the polymerase. The
PCR reaction conditions were: 15 s denaturation at 95C
and coupled annealing and extension for 1 min at 60C
for 40 cycles. Co-detection of rat peptidylprolyl isomerase
A (cyclophilin A) gene served as an internal control for
normalization. Cyclophilin A expression has been shown to be
stable in response to neuronal stimulation in culture (Santos and
Duarte, 2008), which is consistent with our previous studies.
Relative gene expression was quantified using 2(∆∆CT)and
a standard curve was generated based on the amplification
of total RNA extracted from untreated cultured neurons. The
qRT-PCR primers and probes for rat mRNAs were: NRF-1,
57 bp amplicon (Assay ID: Rn01455958_m1, ThermoFisher
Scientific); Gabrb1, 81 bp amplicon (Assay ID: Rn00564146_m1,
ThermoFisher Scientific); Ppia, 60 bp amplicon, forward
primer: 5’- TGCAGACATGGTCAACCCC-3’, reverse primer:
5’- CCCAAGGGCTCGCCA-3’, TaqMan probe with TAMARA
quencher: 5’- CCGTGTTCTTCGACATCACGGCTG-3’.
Statistical Analysis
Data analysis was performed using the statistical package
included with Microsoft Excel (V16.11.1) or Prism software
(Version 7.0d). Experimental values were expressed as a
percentage of or fold change from the mean of control
values, where control was defined at 100% or 1. Values
were reported with a standard error of the mean, which is
the standard deviation divided by the square root of the
number of observations per group. Statistical significance was
evaluated using a 95% confidence interval. For comparison
of two sets of experimental data normalized to the same
control values, statistical analysis was performed using the
Student’s t-test. The ‘‘95% range check’’ was used to test for
normalcy as described in Limpert and Stahel (2011). Each N
was defined as a set of data collected from the average of
2–4 sister dishes of vehicle or drug treated primary cultured
neurons that are plated at a single culturing session with
embryonic cells (E18) obtained from the litter of an individual
pregnant rat. 2–4 replicates (sister dishes) are prepared for
each condition within each N. (See legend of each figure to
obtain experimental N, choice of statistical test, and meaning
of error bars.) A two-way analysis of variance (ANOVA)
was performed to determine statistical significance across two
independent variables (Treatment (water/KCl) vs. Transfected
DNA (empty vector/NRF-1 DN); Figure 5). Values were
considered statistically different if the 95% confidence interval
did not overlap with control values. Differences between all pairs
of means were further compared through post hoc analysis using
the Bonferroni multiple comparison’s test.
Frontiers in Molecular Neuroscience | www.frontiersin.org 4August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
FIGURE 1 | Activity-dependent regulation of nuclear respiratory factor 1 (NRF-1) and GABA receptor subtype A β1 subunit gene (Gabrb1) in primary cortical
neurons. Primary cortical neurons (DIV7–8) were treated with either Vehicle or 20 mM KCl for 6 h. (A) Total protein was extracted from neurons and probed for the
presence of NRF-1 and β-actin. A representative western blot is shown (left) for comparison. NRF-1 levels were quantified by densitometry and normalized to levels
of β-actin. Levels of NRF-1 are expressed relative to vehicle (right;n= 6, paired Student’s t-test, p<0.05 as significant. (B) Levels of mRNAs were quantified by
TaqMan qRT-PCR. Transcripts specific to NRF-1 and Gabrb1 were normalized to Cyclophilin A. Messenger RNA levels are expressed relative to vehicle treated
neurons plated in a six well dish. Data represent the average ±SEM of n= 6 independent neuronal cultures with neurons extracted from different animals and plated
on different days (replicates N= 4). p<0.05; ∗∗p<0.01, paired Student’s t-test. This dataset was originally published in the thesis of Li (2015).
RESULTS
Neuronal Depolarization Increases NRF-1
and GABARβ1 Subunit Gene Transcription
To determine whether Gabrb1 is activity dependent, primary
cortical neurons were treated with KCl. Both NRF-1 protein and
NRF-1 mRNA levels have been previously shown to increase with
KCl-stimulated depolarization (Dhar and Wong-Riley, 2009).
We asked whether under conditions where NRF-1 levels increase
in response to neuronal activity, is it accompanied by increased
levels of Gabrb1 transcripts. As shown in Figures 1A,B, there
is a 2-fold increase in NRF-1 mRNA levels (1.982 ±0.445,
n= 5, paired Student’s t-test, ∗∗p<0.01) upon KCl stimulation
for 6 h that is accompanied by a 30% increase in the
levels of NRF-1 protein (fold change: 1.285 ±0.330, n= 6,
p<0.05) when compared to vehicle control. In parallel to
changes in NRF-1, we now report a 40% increase in levels
of Gabrb1 transcripts (fold change: 1.424 ±0.324, n= 5,
p<0.05).
Identification of a Conserved NRF-1
Element in the GABRB1 Promoter
Our laboratory previously defined the 5’-regulatory region of
the human β1 subunit gene GABRB1, identifying transcriptional
start sites (TSSs) within a 10 bp functional Inr that mediates
the response of the gene to chronic GABA exposure (Russek
et al., 2000; Saha et al., 2013). Now we report that directly
upstream of this Inr is a canonical NRF-1 element spanning
11/+1 relative to the major TSS for the rat homolog Gabrb1
in neocortical neurons. As shown in Figure 2, the location of
the NRF-1 element within the promoter region is conserved
across multiple species. Given the ubiquitous expression of
NRF-1, its conservation across species, and its established role in
cellular respiration and mitochondrial biogenesis, the sequence
comparison presented in Figure 2 strongly suggests that the
NRF-1 element is functionally relevant to β1 subunit expression
in the mammalian brain.
NRF-1 Recognizes the Cis-Element in the
Human GABRB1 Promoter
To determine the specific binding site within GABRB1-p that
binds to NRF-1, we performed an electrophoretic mobility shift
assay (EMSA) with a 32P-labeled probe specific to its NRF-1
consensus element in a binding reaction with nuclear protein
extracts from E18 primary cortical neurons. To validate the
specificity of the NRF-1 antibody for EMSA analysis, nuclear
extracts were incubated with a positive control probe (Dhar et al.,
2008) containing the NRF-1 binding site of the rat cytochrome
cpromoter. As shown in lane 2 of Figure 3A, the control
radiolabeled probe (rat Cyt C) displays specific DNA recognition
from nuclear extracts of cortical neurons that is confirmed
by supershift with the addition of an NRF-1 specific antibody
(Figure 3A, lane 4). Next, specific binding to the putative NRF-1
consensus site in GABRB1 was confirmed using the same nuclear
Frontiers in Molecular Neuroscience | www.frontiersin.org 5August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
FIGURE 2 | Sequence alignment of the 5’ promoter regions of β1 subunit genes. The β1 subunit promoters in mammals contain a conserved NRF-1 element,
indicated in bold type upstream of the major initiator element (Inr) specific to each gene, underlined for reference. Sequences were aligned using ClustalW, where
conserved nucleotides are as indicated “”. Modified from the figure originally published in the thesis of Li (2015).
extracts, with sequence specificity defined by competition with
an unlabeled double stranded oligonucleotide that was identical
to the probe sequence (competitor; Figure 3A, lanes 6 and 7).
Addition of an unlabeled competitor mutant probe, containing
substitutions within the GC core, failed to compete for complex
formation (Figure 3A, lane 8). Presence of endogenous NRF-1
at the GABRB1 NRF-1 consensus site was further confirmed by
supershift analysis using the NRF-1 specific antibody (Figure 3A,
lane 9). Finally, a radiolabeled probe containing the sequence of
the mutant NRF-1 site in GABRB1 shows little or no complex
formation (Figure 3A, lanes 10–12).
To determine whether the endogenous β1 promoter in
neurons is occupied by NRF-1, ChIP was performed using
genomic DNA derived from E18 rat primary cortical cultures
(DIV7) that was precipitated with NRF-1 antibodies. Precipitated
fragments were detected using PCR primers that specifically
amplify DNA encompassing the putative NRF-1 binding site in
rat Gabrb1. As can be seen in Figure 3B, there is a 5-fold increase
(5.045 ±0.981, n= 4, p<0.001) in PCR detection of the
NRF-1 site in Gabrb1 when precipitated using an NRF-1 Ab,
as compared to rabbit IgG. Moreover, NRF-1 is also present at
the core promoter of GABRB1 in human embryonic stem cells
(H1-hESC) as detected in ChIP-sequencing (ChIP-seq) datasets
of the ENCODE project2using our bioinformatic analysis
algorithm (in the Strand NGS pipeline, Model-based Analysis
for ChIP-Seq (MACS, version 2.0, Zhang et al., 2008)) with a
p-value cutoff set to 1.0E-05, quality threshold 30, 99% match
to the sequence, and all duplicates removed (Figure 3C). We
2https://www.encodeproject.org
Frontiers in Molecular Neuroscience | www.frontiersin.org 6August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
FIGURE 3 | In vitro and in vivo binding of NRF-1 to the putative NRF-1 site in GABRB1.(A) 32P-labeled probes encompassing the NRF-1 binding site were
incubated with 20 µg of DIV7 primary rat cortical nuclear extracts. 100-fold excess of unlabeled probe was added to the binding reaction to assess specificity.
NRF-1 Abs were pre-incubated with nuclear extracts and radiolabeled probe to test for “supershift” and protein identification. (Left Panel) The NRF-1 element in the
rat cytochrome c(Cyt C) promoter displays NRF-1 specific binding (lane 2) and “supershift” (lane 4). (Right Panel) The proposed NRF-1 element in the human
GABRB1 promoter displays a probe specific shift (lane 6; note that excess probe was run off of the gel to provide room for the detection of the shifted probe),
competition of complex formation with cold competitor (lane 7), lack of competition with mutant cold competitor (lane 8), and supershift upon addition of NRF-1
specific Ab (lane 9). In contrast, binding to radiolabeled probe for NRF-1 mutant GABRB1 shows markedly reduced signal strength (lanes 11 and 12). “” Indicates
specific interaction between labeled probe and nuclear extract, “” indicates location of supershift. (B) Chromatin Immunoprecipitation (ChIP) assays were
performed using sonicated genomic DNA from DIV7 primary rat cortical neurons and either ChIP grade NRF-1 polyclonal antibody (Abcam, ab34682) that
recognizes the full length protein or rabbit IgG (Vector Laboratories, I-1,000). Co-precipitated GABRB1 gene promoter fragments were detected with specific
quantitative PCR (qPCR) primers and probe. Data represent the average ±SEM of n= 4 independent primary cultures and co-precipitations. ∗∗∗p<0.001, student
t-test. (C) Representative ChIP-seq track from the Strand NGS software platform for GABRB1 in H1-hESC cells after peak detection (MACS version 2.0). Read
density profile plots of forward reads (blue) and reverse reads (red) aligned to the UCSC transcript model are depicted; each brown box represents a single 27-bp
sequencing read. The NRF-1 motif sequence is shown in black text above its position. Relative position of the Inr in GABRB1 is shown for reference. Chr,
chromosome. (A,B) Datasets were originally published in the thesis of Li (2015).
also found coincident peak detection using ENCODE datasets
from NRF-1 ChIP-seq with genomic DNA from immortalized
cell lines (K562, HepG2, CH12.LX, GM 12878 and HeLa-S3;
data not shown). Note that the detected peak in H1-hESC is
identical to that predicted by Figure 2 and within the wildtype
oligonucleotide sequence that bound nuclear extracts from rat
primary neurons (Figure 3).
Overexpression of NRF-1 Induces
GABRB1 Promoter Activity in Transfected
Primary Cortical Neurons
To evaluate whether there is a functional consequence to NRF-1
binding to its consensus site in GABRB1-p, primary cortical
neurons were transfected with the GABRB1p-luciferase construct
containing the 541 bp 5’ flanking region upstream of the human
β1 subunit gene (Russek et al., 2000). We chose this approach
to study functional relevance of the NRF-1 site to GABRB1
transcription in neurons because NRF-1’s influence on the
genome is difficult to detect by siRNA knockdown due to its
robust expression at baseline and protein stability (Baar et al.,
2003; Scarpulla, 2006; Ramachandran et al., 2008).
As the expression of the NRF-1:VP16 fusion protein has been
shown to induce the promoter activity of NRF-1 responsive
genes in cell lines (Ramachandran et al., 2008; Gonen and
Assaraf, 2010), we transfected primary cortical neurons with
NRF-1:VP16 along with the GABRB1p-luciferase reporter and
found a marked increase (70%, fold change: 1.671 ±0.404,
n= 5, ∗∗p<0.01) above baseline (when compared to
co-transfection with empty vector control, 1.00 ±0.225, n= 5;
Figure 4A). Mutations were introduced into GABRB1-p using
site-directed mutagenesis (based on the loss of specific binding
of NRF-1 as identified in EMSA (see Figure 3, lane 8)). As
can be seen in Figure 4A for mGABRB1-p, with and without
NRF-1:VP16 overexpression, mutation of the NRF-1 regulatory
element in GABRB1-p reduces basal activity to around 30% (fold
change: 0.314 ±0.067, n= 5, ∗∗∗∗p<0.0001) of wild type.
Overexpression of NRF-1:VP16 has no effect on mGABRB1-
p(0.358 ±0.057, n= 5, ns) showing that increased GABRB1
promoter activity directed by NRF-1 is sequence specific; and,
moreover, that NRF-1 may be an important positive regulator
of β1 subunit expression in developing neurons, especially
interesting because β1 is found in the germinal zones and
associated with pre-migrating neurons (Ma and Barker, 1995).
Furthermore, increased mitochondrial biogenesis has also been
associated with neuronal differentiation (Vayssière et al., 1992;
Cheng et al., 2010).
Frontiers in Molecular Neuroscience | www.frontiersin.org 7August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
FIGURE 4 | Evidence for the regulation of the GABAR β1 promoter by NRF-1. (A) Primary cortical neurons were co-transfected with 2 µg of wild type GABRB1p
(wtGABRB1p) or the NRF-1 binding site mutant (mGABRB1p) and 1 µg of empty vector pcDNA3 or the NRF-1:VP16 fusion construct. Cells were assayed for
luciferase activity 24 h after transfection. Data represent the average ±SEM (n= 5 independent transfections) of luciferase activity relative to wild type GABRB1p in
the absence of NRF-1:VP16. ∗∗p<0.01, ∗∗∗∗ p<0.0001, and “ns” (non-specific) represent presence or absence respectively of significance according to one-way
ANOVA with Tukey’s multiple comparisons test. (B) Primary cortical neurons were co-transfected with either pcDNA3 or the dominant negative variant of NRF-1
(NRF-1 DN) and GABRB1p reporter (2 µg). Twenty-four hours after transfection, cells were assayed for luciferase activity. Data represent the average ±SEM of
n= 6 independent transfections (see above), normalized to wtGABRB1p and pcDNA3. p<0.05, Student’s t-test. This dataset was originally published in the thesis
of Li (2015).
Inhibition of NRF-1 Function in Neurons
To evaluate the specific effect of endogenous NRF-1 on GABRB1
transcription, a dominant negative form of NRF-1 was utilized
that contains the DNA binding domain but lacks the NRF-1
trans-activation domain (Gugneja et al., 1996). Co-expression
of this dominant negative NRF-1 represses GABRB1 promoter
activity by 45% (fold change: 0.549 ±0.164, n= 6, Students
t-test, p<0.05, Figure 4B) compared to empty-vector control
(1.000 ±0.235, n= 6). Most importantly, overexpression
of dominant negative NRF-1 blocks the activity dependent
increase of endogenous Gabrb1 mRNA levels in response to
KCl treatment (N= 3, two-way ANOVA, effect of treatment
p= 0.0148, effect of transfected DNA p= 0.0031; Bonferroni
adjusted pvalue for effect of pcDNA3 vs. NRF-1 DN transfected
constructs on the response to KCl treatment is 0.0263, Figure 5).
When taken together with the fact that the NRF-1 element
in the β1 subunit gene is completely conserved across species
(Figure 2), and that there is a mutation-induced loss of binding
(Figure 3) and function (Figure 4), our results strongly suggest
that NRF-1 is an essential feature of β1 subunit expression in
neurons and that it couples transcription to the activity pattern
of individual cells.
DISCUSSION
We now report that the GABAR β1 subunit gene
(GABRB1/Gabrb1) is regulated by NRF-1, a crucial transcription
factor involved in oxidative phosphorylation and mitochondrial
biogenesis. While it is believed that NRF-1 coordinates synaptic
activity and energy metabolism by regulating excitatory
neurotransmission via genes that code for subunits of the
N-methyl-D-aspartate (NMDA) receptor (Dhar and Wong-
Riley, 2009, 2011; Dhar et al., 2009), it is clear that the
this regulatory program is more complex than originally
expected given our observation that elements of inhibitory
neurotransmission may be coordinately regulated with
excitation. This possibility is especially important as a
variety of brain disorders present with a decrease in GABAR
β1 subunit levels, including epilepsy where there is also aberrant
hyperactivity.
Previously, our laboratory mapped the 5’ flanking region
of the human β1 subunit promoter. Within this TATA-less
promoter, we identified the major TSS and described an
Inr that senses the presence of prolonged GABA to mediate
the autologous downregulation of β1 subunit expression
(Russek et al., 2000). Our recent studies have discovered that
such decreases in β1 subunit RNA levels may reflect a change
FIGURE 5 | Overexpression of dominant negative NRF-1 attenuates the
increase in β1 subunit mRNA levels in response to neuronal stimulation of
primary cortical neurons. Primary cortical neurons were transfected with
empty vector (pcDNA3) or dominant negative NRF-1 (NRF-1 DN; using
NucleofectionTM) and plated in 6-well plates. DIV7 cells were treated with
either vehicle or 20 mM KCl for 6 h. Total mRNA was isolated from cells and
quantified by TaqMan qRT-PCR. Gabrb1 mRNA expression was normalized to
Cyclophilin A mRNA levels and is presented relative to its levels in
pcDNA3 transfected neurons that were treated with vehicle (expressed as 1).
Data represent the average ±SEM of n= 3 independent primary neuronal
cultures. Two-way ANOVA was performed (comparison between treatments,
p= 0.0148; comparison between transfected DNA conditions, p= 0.0031)
with Bonferroni post hoc analysis (adjusted pvalue = 0.0263 for KCl vs. water
with pcDNA transfection, not significant for NRF-1 DN).
Frontiers in Molecular Neuroscience | www.frontiersin.org 8August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
in the chromatin state as mediated by PhF1b, a polycomb-like
protein (Saha et al., 2013). In our present work, we have found
a conserved canonical NRF-1 binding element (Figure 2) that
interacts with NRF-1 in vitro as verified by mobility shift assays
(Figure 3). Interestingly, our results in primary rat neurons
are consistent with a peak of NRF-1 binding over the core
promoter of GABRB1 in human embryonic stem cells, as
displayed in Figure 3C, using our bioinformatic analysis of
ENCODE project datasets (Gerstein et al., 2012; Wang et al.,
2012, 2013) with the Strand NGS pipeline (MACS V2 peak
detection). We identified the same peak of binding in additional
NRF-1 ChIP-seq ENCODE datasets from immortalized cell lines.
Interestingly, we did not detect any additional NRF-1 peaks on
the genes that code for other βsubunit genes, suggesting that
NRF-1 regulation may be unique to β1.
It is thought that NRF-1 binds as a homodimer to the
consensus binding sequence (T/C)GCGCA(C/T)GCGC(A/G),
making contact with DNA at the guanine nucleotides (Virbasius
et al., 1993). This model is supported by the results of our
mutational studies which show that a single mutation of G > C
eliminates the ability of a cold double stranded oligonucleotide to
compete for complex formation as assayed by mobility shift. The
location of the NRF-1 element in GABRB1 centers at -12 relative
to the major TTS in neocortical neurons. The GC-rich NRF-1
binding motif is often associated with TATA-less promoters and
found within 100 bp DNA regions around transcriptional start
sites in the human genome (Virbasius et al., 1993; Xi et al.,
2007). The proximity of the NRF-1 element in GABRB1 to the
Inr that binds polycomb-like proteins associated with chromatin
remodeling and DNA methylation (Vire et al., 2006) may
underlie its major role in controlling basal levels of β1 subunit
mRNAs in neurons. Whether GABRB1 is epigenetically regulated
in vivo remains to be determined and could be a feature of why its
transcription decreases in disease, especially since NRF-1 binding
is blocked by DNA methylation (Gebhard et al., 2010).
Using the sensitivity of the luciferase reporter system, we have
overexpressed NRF-1:VP16 in living neurons and shown that
it indeed regulates the GABRB1p-luciferase reporter construct
and that such regulation is lost upon mutation of the GABRB1
NRF-1 regulatory element (Figure 4A) and upon competition for
endogenous NRF-1 binding to the promoter by overexpression
of a dominant negative NRF-1 expression construct (Figure 4B).
We have also shown that the same mutation in the NRF-1
regulatory element of GABRB1p removes binding of endogenous
NRF-1 to neuronal extracts in a mobility shift assay, as seen in
Figure 3. Finally, and perhaps most importantly, we have shown
that overexpression of dominant negative NRF-1 protein blocks
the activity dependent increase in endogenous Gabrb1 mRNA
levels identifying a key molecular determinant of β1 subunit gene
expression within cells (Figure 5).
Our results are consistent with previous studies from the
Russek laboratory, using the same wild type GABRB1p-luciferase
reporter construct, where promoter truncation and/or deletion
that removes the Inr and at the same time disrupts the element
for NRF-1 results in a 75%–90% decrease in luciferase gene
transcription (Russek et al., 2000;Figure 4). Given that GABAR
blockade by bicuculine has also been shown to drive NRF-1
dependent transcription (Delgado and Owens, 2012) and that
bicuculine reverses GABA-induced downregulation of β1 mRNA
levels (Russek et al., 2000), presumably through PhF1b binding
to the Inr, our new results suggest that the NRF-1 responsive
element and Inr may act synergistically to regulate β1 subunit
levels as neurons adapt to changes in their activity state.
The direct regulation of NRF-1 in GABRB1/Gabrb1 gene
expression in the brain may also have implications in the
initiation of sleep. The use of fragrant dioxane derivatives that
show a 6-fold preference for β1-containing GABARs (Sergeeva
et al., 2010) suggest that the β1 subunit is required for the
modulation of wakefulness that is mediated by the histaminergic
neurons of the posterior hypothalamus (tubermamillary nucleus-
TMN; Yanovsky et al., 2012). Given that energy metabolism is
sensitive to restoration during the sleep cycle and that NRF-1
levels rise with sleep deprivation (Nikonova et al., 2010), it is
interesting that β1-containing GABARs are the major source of
inhibitory control over sleep.
Although differential expression of αsubunits in relationship
to brain disorders has clearly been associated with their region-
specific control over changes in tonic and phasic inhibition, it
is only recently that the importance of differential βsubunit
expression to GABAR function has been noted. This selective
property of GABAR function ascribed to the assembly of
particular βsubunits, however, has been limited to β2 and β3,
with β1 present in only a limited population of receptors in the
brain. However, of all βsubunits, β1 has been most associated
with both neurological and neuropsychiatric disorders. The
reason for this functional relationship remains to be described
and is an active area of investigation in our laboratories.
AUTHOR CONTRIBUTIONS
SR conceived the project, funding and supervision. AB-K: key
collaborator and funding. ZL carried out most experiments
while as a graduate student, helped to interpret datasets,
wrote first draft of the manuscript. MC carried out additional
experiments, edited manuscript with Russek into final form,
reproduced datasets collected by ZL for rigors in science. KH:
graduate student, did bioinformatic analysis, made experimental
contribution to Figure 3.
FUNDING
This work was supported by grants from the National Institutes
of Health (NIH/NINDS R01 NS4236301 to SR and AB-K,
T32 GM00854 to ZL, MC and KH).
ACKNOWLEDGMENTS
We thank Dr. Tod Gulick (Sanford-Burnham Medical Research
Institute, Orlando, FL, USA) for his helpful discussion and
providing us with expression constructs that were invaluable
for our experiments. We also thank Ms. Allison Tipton for her
efforts in the laboratory to provide datasets to better understand
the interaction of endogenous NRF-1 at Gabrb1 during her
laboratory rotation.
Frontiers in Molecular Neuroscience | www.frontiersin.org 9August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
REFERENCES
Anstee, Q. M., Knapp, S., Maguire, E. P., Hosie, A. M., Thomas, P.,
Mortensen, M., et al. (2013). Mutations in the Gabrb1 gene promote alcohol
consumption through increased tonic inhibition. Nat. Commun. 4:2816.
doi: 10.1038/ncomms3816
Baar, K., Song, Z., Semenkovich, C. F., Jones, T. E., Han, D. H., Nolte, L. A.,
et al. (2003). Skeletal muscle overexpression of nuclear respiratory factor
1 increases glucose transport capacity. FASEB J. 17, 1666–1673. doi: 10.1096/fj.
03-0049com
Barrera, N. P., Betts, J., You, H., Henderson, R. M., Martin, I. L., Dunn, S. M.,
et al. (2008). Atomic force microscopy reveals the stoichiometry and subunit
arrangement of the α4β3δGABAAreceptor. Mol. Pharmacol. 73, 960–967.
doi: 10.1124/mol.107.042481
Brooks-Kayal, A. R., Shumate, M. D., Jin, H., Rikhter, T. Y., and Coulter, D. A.
(1998). Selective changes in single cell GABAAreceptor subunit expression and
function in temporal lobe epilepsy. Nat. Med. 4, 1166–1172. doi: 10.1038/2661
Cheng, A., Hou, Y., and Mattson, M. P. (2010). Mitochondria and neuroplasticity.
ASN Neuro 2:e00045. doi: 10.1042/AN20100019
Collins, A. L., Ma, D., Whitehead, P. L., Martin, E. R., Wright, H. H.,
Abramson, R. K., et al. (2006). Investigation of autism and GABA
receptor subunit genes in multiple ethnic groups. Neurogenetics 7, 167–174.
doi: 10.1007/s10048-006-0045-1
Connolly, C. N., and Wafford, K. A. (2004). The Cys-loop superfamily of ligand-
gated ion channels: the impact of receptor structure on function. Biochem. Soc.
Trans. 32, 529–534. doi: 10.1042/bst0320529
Delgado, J. Y., and Owens, G. C. (2012). The cytochrome c gene proximal enhancer
drives activity-dependent reporter gene expression in hippocampal neurons.
Front. Mol. Neurosci. 5:31. doi: 10.3389/fnmol.2012.00031
Dhar, S. S., Liang, H. L., and Wong-Riley, M. T. (2009). Nuclear respiratory
factor 1 co-regulates AMPA glutamate receptor subunit 2 and cytochrome c
oxidase: tight coupling of glutamatergic transmission and energy metabolism in
neurons. J. Neurochem. 108, 1595–1606. doi: 10.1111/j.1471-4159.2009.05929.x
Dhar, S. S., Ongwijitwat, S., and Wong-Riley, M. T. (2008). Nuclear respiratory
factor 1 regulates all ten nuclear-encoded subunits of cytochrome c oxidase in
neurons. J. Biol. Chem. 283, 3120–3129. doi: 10.1074/jbc.M707587200
Dhar, S. S., and Wong-Riley, M. T. (2009). Coupling of energy metabolism and
synaptic transmission at the transcriptional level: role of nuclear respiratory
factor 1 in regulating both cytochrome c oxidase and NMDA glutamate
receptor subunit genes. J. Neurosci. 29, 483–492. doi: 10.1523/JNEUROSCI.
3704-08.2009
Dhar, S. S., and Wong-Riley, M. T. (2011). The kinesin superfamily protein
KIF17 is regulated by the same transcription factor (NRF-1) as its cargo NR2B
in neurons. Biochim. Biophys. Acta 1813, 403–411. doi: 10.1016/j.bbamcr.2010.
12.013
D’Hulst, C., De Geest, N., Reeve, S. P., Van Dam, D., De Deyn, P. P.,
Hassan, B. A., et al. (2006). Decreased expression of the GABAAreceptor in
fragile X syndrome. Brain Res. 1121, 238–245. doi: 10.1016/j.brainres.2006.
08.115
Duka, T., Nikolaou, K., King, S. L., Banaschewski, T., Bokde, A. L. W., Büchel, C.,
et al. (2017). GABRB1 single nucleotide polymorphism associated with altered
brain responses (but not Performance) during measures of impulsivity and
reward sensitivity in human adolescents. Front. Behav. Neurosci. 11:24.
doi: 10.3389/fnbeh.2017.00024
Domcke, S., Bardet, A. F., Adrian Ginno, P., Hartl, D., Burger, L., and Schübeler, D.
(2015). Competition between DNA methylation and transcription factors
determines binding of NRF1. Nature 528, 575–579. doi: 10.1038/nature16462
Evans, M. J., and Scarpulla, R. C. (1990). NRF-1: a trans-activator of nuclear-
encoded respiratory genes in animal cells. Genes Dev. 4, 1023–1034.
doi: 10.1101/gad.4.6.1023
Farrar, S. J., Whiting, P. J., Bonnert, T. P., and McKernan, R. M. (1999).
Stoichiometry of a ligand-gated ion channel determined by fluorescence
energy transfer. J. Biol. Chem. 274, 10100–10104. doi: 10.1074/jbc.274.15.
10100
Fatemi, S. H., Folsom, T. D., Rooney, R. J., and Thuras, P. D. (2013). mRNA
and protein expression for novel GABAAreceptors θand rho2 are altered
in schizophrenia and mood disorders; relevance to FMRP-mGluR5 signaling
pathway. Transl. Psychiatry 3:e271. doi: 10.1038/tp.2013.46
Fatemi, S. H., Reutiman, T. J., Folsom, T. D., Rooney, R. J., Patel, D. H., and
Thuras, P. D. (2010). mRNA and protein levels for GABAAα4, α5, β1 and
GABABR1 receptors are altered in brains from subjects with autism. J. Autism
Dev. Disord. 40, 743–750. doi: 10.1007/s10803-009-0924-z
Fatemi, S. H., Reutiman, T. J., Folsom, T. D., and Thuras, P. D. (2009). GABAA
receptor downregulation in brains of subjects with autism. J. Autism Dev.
Disord. 39, 223–230. doi: 10.1007/s10803-008-0646-7
Gebhard, C., Benner, C., Ehrich, M., Schwarzfischer, L., Schilling, E., Klug, M.,
et al. (2010). General transcription factor binding at CpG islands in normal cells
correlates with resistance to de novo DNA methylation in cancer cells. Cancer
Res. 70, 1398–1407. doi: 10.1158/0008-5472.CAN-09-3406
Gerstein, M. B., Kundaje, A., Hariharan, M., Landt, S. G., Yan, K. K., Cheng, C.,
et al. (2012). Architecture of the human regulatory network derived from
ENCODE data. Nature 489, 91–100. doi: 10.1038/nature11245
Gonen, N., and Assaraf, Y. G. (2010). The obligatory intestinal folate transporter
PCFT (SLC46A1) is regulated by nuclear respiratory factor 1. J. Biol. Chem. 285,
33602–33613. doi: 10.1074/jbc.M110.135640
Gugneja, S., Virbasius, C. M., and Scarpulla, R. C. (1996). Nuclear respiratory
factors 1 and 2 utilize similar glutamine-containing clusters of hydrophobic
residues to activate transcription. Mol. Cell. Biol. 16, 5708–5716.
doi: 10.1128/mcb.16.10.5708
Hines, R. M., Davies, P. A., Moss, S. J., and Maguire, J. (2012). Functional
regulation of GABAAreceptors in nervous system pathologies. Curr. Opin.
Neurobiol. 22, 552–558. doi: 10.1016/j.conb.2011.10.007
Jacob, T. C., Moss, S. J., and Jurd, R. (2008). GABAAreceptor trafficking and its
role in the dynamic modulation of neuronal inhibition. Nat. Rev. Neurosci. 9,
331–343. doi: 10.1038/nrn2370
Li, Z. (2015). Activity-Dependent Gene Regulation in Neurons: Energy Coupling and
a Novel Biosensor [Dissertation]. Boston, MA: Boston University.
Limpert, E., and Stahel, W. A. (2011). Problems with using the normal
distribution—and ways to improve quality and efficiency of data analysis. PLoS
One 6:e21403. doi: 10.1371/journal.pone.0021403
Ma, W., and Barker, J. L. (1995). Complementary expressions of transcripts
encoding GAD67 and GABAAreceptor α-4, β-1, and γ-1 subunits in the
proliferative zone of the embryonic rat central nervous system. J. Neurosci. 15,
2547–2560. doi: 10.1523/JNEUROSCI.15-03-02547.1995
Ma, D. Q., Whitehead, P. L., Menold, M. M., Martin, E. R., Ashley-Koch, A. E.,
Mei, H., et al. (2005). Identification of significant association and gene-gene
interaction of GABA receptor subunit genes in autism. Am. J. Hum. Genet. 77,
377–388. doi: 10.1086/433195
Mohrin, M., Shin, J., Liu, Y., Brown, K., Luo, H., Xi, Y., et al. (2015). A
mitochondrial UPR-mediated metabolic checkpoint regulates hematopoietic
stem cell aging. Science 347, 1374–1377. doi: 10.1126/science.aaa2361
Nikonova, E. V., Naidoo, N., Zhang, L., Romer, M., Cater, J. R., Scharf, M. T.,
et al. (2010). Changes in components of energy regulation in mouse cortex
with increases in wakefulness. Sleep 33, 889–900. doi: 10.1093/sleep/33.
7.889
Olsen, R. W., and Sieghart, W. (2009). GABAAreceptors: subtypes provide
diversity of function and pharmacology. Neuropharmacology 56, 141–148.
doi: 10.1016/j.neuropharm.2008.07.045
Parsian, A., and Zhang, Z. H. (1999). Human chromosomes 11p15 and 4p12 and
alcohol dependence: possible association with the GABRB1 gene. Am. J. Med.
Genet. 88, 533–538. doi: 10.1002/(sici)1096-8628(19991015)88:5<533::aid-
ajmg18 >3.0.co;2-c
Patel, B., Mortensen, M., and Smart, T. G. (2014). Stoichiometry of δ
subunit containing GABAAreceptors. Br. J. Pharmacol. 171, 985–994.
doi: 10.1111/bph.12514
Rabow, L. E., Russek, S. J., and Farb, D. H. (1995). From ion currents to genomic
analysis: recent advances in GABAAreceptor research. Synapse 21, 189–274.
doi: 10.1002/syn.890210302
Ramachandran, B., Yu, G., and Gulick, T. (2008). Nuclear respiratory factor
1 controls myocyte enhancer factor 2A transcription to provide a mechanism
for coordinate expression of respiratory chain subunits. J. Biol. Chem. 283,
11935–11946. doi: 10.1074/jbc.M707389200
Russek, S. J., Bandyopadhyay, S., and Farb, D. H. (2000). An initiator element
mediates autologous downregulation of the human type A γ-aminobutyric
acid receptor β1 subunit gene. Proc. Natl. Acad. Sci. U S A 97, 8600–8605.
doi: 10.1073/pnas.97.15.8600
Frontiers in Molecular Neuroscience | www.frontiersin.org 10 August 2018 | Volume 11 | Article 285
Li et al. NRF-1 Regulates GABRB1 Transcription in Neurons
Saha, S., Hu, Y., Martin, S. C., Bandyopadhyay, S., Russek, S. J., and Farb, D. H.
(2013). Polycomblike protein PHF1b: a transcriptional sensor for GABA
receptor activity. BMC Pharmacol. Toxicol. 14:37. doi: 10.1186/2050-6511-
14-37
Santos, A. R., and Duarte, C. B. (2008). Validation of internal control genes for
expression studies: effects of the neurotrophin BDNF on hippocampal neurons.
J. Neurosci. Res. 86, 3684–3692. doi: 10.10.1002/jnr.21796
Scarpulla, R. C. (2006). Nuclear control of respiratory gene expression in
mammalian cells. J. Cell. Biochem. 97, 673–683. doi: 10.1002/jcb.20743
Scarpulla, R. C. (2008). Nuclear control of respiratory chain expression by nuclear
respiratory factors and PGC-1-related coactivator. Anna. N Y Acad. Sci. 1147,
321–334. doi: 10.1196/annals.1427.006
Sergeeva, O. A., Kletke, O., Kragler, A., Poppek, A., Fleischer, W., Schubring, S. R.,
et al. (2010). Fragrant dioxane derivatives identify β1-subunit-containing
GABAAreceptors. J. Biol. Chem. 285, 23985–23993. doi: 10.1074/jbc.M110.
103309
Song, J., Koller, D. L., Foroud, T., Carr, K., Zhao, J., Rice, J., et al. (2003).
Association of GABAAreceptors and alcohol dependence and the effects of
genetic imprinting. Am. J. Med. Genet. B Neuropsychiatr. Genet. 117B, 39–45.
doi: 10.1002/ajmg.b.10022
Sun, F., Cheng, R., Flanders, W. D., Yang, Q., and Khoury, M. J. (1999). Whole
genome association studies for genes affecting alcohol dependence. Genet.
Epidemiol. 17, S337–S342. doi: 10.1002/gepi.1370170757
Vayssière, J. L., Cordeau-Lossouarn, L., Larcher, J. C., Basseville, M., Gros, F.,
and Croizat, B. (1992). Participation of the mitochondrial genome in the
differentiation of neuroblastoma cells. In Vitro Cell. Dev. Biol. 28A, 763–772.
doi: 10.1007/bf02631065
Virbasius, C. A., Virbasius, J. V., and Scarpulla, R. C. (1993). NRF-1, an activator
involved in nuclear-mitochondrial interactions, utilizes a new DNA-binding
domain conserved in a family of developmental regulators. Genes Dev. 7,
2431–2445. doi: 10.1101/gad.7.12a.2431
Vire, E., Brenner, C., Deplus, R., Blanchon, L., Fraga, M., Didelot, C., et al. (2006).
The Polycomb group protein EZH2 directly controls DNA methylation. Nature
439, 871–874. doi: 10.1038/nature04431
Vithlani, M., Terunuma, M., and Moss, S. J. (2011). The dynamic modulation
of GABAAreceptor trafficking and its role in regulating the plasticity
of inhibitory synapses. Physiol. Rev. 91, 1009–1022. doi: 10.1152/physrev.
00015.2010
Wang, J., Zhuang, J., Iyer, S., Lin, X. Y., Greven, M. C., Kim, B. H., et al. (2013).
Factorbook.org: a Wiki-based database for transcription factor-binding data
generated by the ENCODE consortium. Nucleic Acids Res. 41, D171–D176.
doi: 10.1093/nar/gks1221
Wang, J., Zhuang, J., Iyer, S., Lin, X., Whitfield, T. W., Greven, M. C., et al.
(2012). Sequence features and chromatin structure around the genomic regions
bound by 119 human transcription factors. Genome Res. 22, 1798–1812.
doi: 10.1101/gr.139105.112
Xi, H., Yu, Y., Fu, Y., Foley, J., Halees, A., and Weng, Z. (2007). Analysis of
overrepresented motifs in human core promoters reveals dual regulatory roles
of YY1. Genome Res. 17, 798–806. doi: 10.1101/gr.5754707
Yanovsky, Y., Schubring, S., Fleischer, W., Gisselmann, G., Zhu, X. R., Lübbert, H.,
et al. (2012). GABAAreceptors involved in sleep and anaesthesia: β1- versus β3-
containing assemblies. Pflugers Arch. 463, 187–199. doi: 10.1007/s00424-011-
0988-4
Yu, H., Bi, W., Liu, C., Zhao, Y., Zhang, J. F., Zhang, D., et al. (2014). Protein-
interaction-network-based analysis for genome-wide association analysis of
schizophrenia in Han Chinese population. J. Psychiatr. Res. 50, 73–78.
doi: 10.1016/j.jpsychires.2013.11.014
Zinn-Justin, A., and Abel, L. (1999). Genome search for alcohol dependence
using the weighted pairwise correlation linkage method: interesting findings
on chromosome 4. Genet. Epidemiol. 17, S421–S426. doi: 10.1002/gepi.13701
70771
Zhang, Y., Liu, T., Meyer, C. A., Eeckhoute, J., Johnson, D. S., Bernstein, B. E.,
et al. (2008). Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9:R137.
doi: 10.10.1186/gb-2008-9-9-r137
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
Copyright © 2018 Li, Cogswell, Hixson, Brooks-Kayal and Russek. This is an
open-access article distributed under the terms of the Creative Commons Attribution
License (CC BY). The use, distribution or reproduction in other forums is permitted,
provided the original author(s) and the copyright owner(s) are credited and that the
original publication in this journal is cited, in accordance with accepted academic
practice. No use, distribution or reproduction is permitted which does not comply
with these terms.
Frontiers in Molecular Neuroscience | www.frontiersin.org 11 August 2018 | Volume 11 | Article 285
... 40 Furthermore, Li et al identified that NRF1 affects sleep initiation and may regulate the human GABA receptor subtype A β1 subunit gene in neurons, which is associated with epilepsy, autism, bipolar disorder, and schizophrenia. 41 Finally, we found three SNPs in LINC01933, encoding a long non-coding RNA. A recent study reported altered expression of LINC01933 in the brain, which was associated with sleeping-related loci 5 in the Neanderthal population. ...
Article
Full-text available
Purpose: Although insomnia and migraine are often comorbid, the genetic association between insomnia and migraine remains unclear. This study aimed to identify susceptibility loci associated with insomnia and migraine comorbidity. Patients and methods: We performed a genome-wide association study (GWAS) involving 1063 clinical outpatients at a tertiary hospital in Taiwan. Migraineurs with and without insomnia were genotyped using the Affymetrix Axiom Genome-Wide TWB 2.0. We performed association analyses for the entire cohort and stratified patients into the following subgroups: episodic migraine (EM), chronic migraine (CM), migraine with aura (MA), and migraine without aura (MoA). Potential correlations between SNPs and clinical indices in migraine patients with insomnia were examined using multivariate regression analysis. Results: The SNP rs1178326 in the gene HDAC9 was significantly associated with insomnia. In the EM, CM, MA, and MoA subgroups, we identified 30 additional susceptibility loci. Multivariate regression analysis showed that SNP rs1178326 also correlated with higher migraine frequency and the Migraine Disability Assessment (MIDAS) questionnaire score. Finally, two SNPs that had been previously reported in a major insomnia GWAS were also significant in our migraineurs, showing a concordant effect. Conclusion: In this GWAS, we identified several novel loci associated with insomnia in migraineurs in a Han Chinese population in Taiwan. These results provide insights into the possible genetic basis of insomnia and migraine comorbidity.
... In addition, Drosophila erect wing (ewg) (Nrf1 homologue) mutants show aberrant axonal projection and absent or reduced indirect flight muscles [34], and zebrafish nrf (Nrf1 homologue) mutants exhibit loss of retinal photoreceptors and reduced brain size [35]. Also in the neural context, reduced transcriptional activity of NRF1 has been associated with fragile X mental retardation syndrome [36] and with GABAassociated neuronal disorders [37], and functional NRF1 has been shown to be necessary for neurite outgrowth of human neuroblastoma cells [38,39]. Other non-neuronal roles attributed to NRF1 are the regulation of oncogenesis [40][41][42][43], stem cell aging [44], telomere transcription [45] and oxidative stress protection and lipid homeostasis in the liver; liverspecific Nrf1 conditional knockout mice develop steatohepatitis and spontaneous liver cancer [43]. ...
Article
Full-text available
We have established a genome-wide N-ethyl-N-nitrosourea (ENU) mutagenesis screen to identify novel genes playing a role in epigenetic regulation in mammals. We hypothesize that the ENU mutagenesis screen will lead to the discovery of unknown genes responsible of the maintenance of the epigenetic state as the genes found are modifiers of variegation of the transgene green fluorescent protein (GFP) expression in erythrocytes, which are named MommeD. Here we report the generation of a novel mutant mouse line, MommeD46, that carries a new missense mutation producing an amino acid transversion (L71P) in the dimerization domain of Nuclear Respiratory Factor 1 (Nrf1). The molecular characterization of the mutation reveals a decrease in the Nrf1 mRNA levels and a novel role of Nrf1 in the maintenance of the DNA hypomethylation in vivo. The heritability of the mutation is consistent with paternal imprinting and haploinsufficiency. Homozygous mutants display embryonic lethality at 14.5 days post-coitum and developmental delay. This work adds a new epi-regulatory role to Nrf1 and uncovers unknown phenotypical defects of the Nrf1 hypomorph. The generated mouse line represents a valuable resource for studying NRF1-related diseases.
... In fact, CREB positively regulates the transcription of the GABA A receptor α1 subunit gene via a protein kinase C (PKC)-dependent mechanism [33] in rat cortical neurons. It has been reported that neuronal depolarization induces NRF-1 in rat cortical neurons, which stimulates the transcription of the GABA A receptor β1 subunit gene [34], and Sp4 in murine visual cortical neurons, which stimulates GABA A receptor α1/α2 subunit genes [35]. A positive excitatory feedback mechanism was demonstrated in adult mouse hippocampal stem/progenitor cells, in which the stimulation of GABA A receptors induces neuronal depolarization that produces an enhancement in the intracellular calcium concentration. ...
Article
Full-text available
GABAA receptors are pentameric ion channels that mediate most synaptic and tonic extrasynaptic inhibitory transmissions in the central nervous system. There are multiple GABAA receptor subtypes constructed from 19 different subunits in mammals that exhibit different regional and subcellular distributions and distinct pharmacological properties. Dysfunctional alterations of GABAA receptors are associated with various neuropsychiatric disorders. Short- and long-term plastic changes in GABAA receptors can be induced by the activation of different intracellular signaling pathways that are triggered, under physiological and pathological conditions, by calcium entering through voltage-gated calcium channels. This review discusses several mechanisms of regulation of GABAA receptor function that result from the activation of L-type voltage gated calcium channels. Calcium influx via these channels activates different signaling cascades that lead to changes in GABAA receptor transcription, phosphorylation, trafficking, and synaptic clustering, thus regulating the inhibitory synaptic strength. These plastic mechanisms regulate the interplay of synaptic excitation and inhibition that is crucial for the normal function of neuronal circuits.
... Besides its role in the regulation of mitochondrial functions, NRF1 is also a crucial player in histone gene expression and acts as a regulator of cell growth and proliferation [13,14]. Accumulating evidences also implicate that NRF1 expression and its transcription factor activity may contribute to the pathogenesis of breast cancer, glioblastoma, and neuronal dysfunction [15][16][17]. ...
Article
Full-text available
SMAD4, a key regulator of transforming growth factor-β (TGF-β) signaling, plays a major role in cell growth, migration, and apoptosis. In particular, TGF-β/SMAD induces growth arrest, and SMAD4 induces the expression of target genes such as p21WAF1 and p15INK4b through its interaction with several cofactors. Thus, inactivating mutations or the homozygous deletion of SMAD4 could be related to tumorigenesis or malignancy progression. However, in some cancer types, SMAD4 is neither mutated nor deleted. In the current study, we demonstrate that TGF-β signaling with a preserved SMAD4 function can contribute to cancer through associations with negative pathway regulators. We found that nuclear respiratory factor-1 (NRF1) is a novel interaction SMAD4 partner that inhibits TGF-β/SMAD4-induced p15INK4b mRNA expression by binding to SMAD4. Furthermore, we confirmed that NRF1 directly binds to the core region of the SMAD4 promoter, thereby decreasing SMAD4 mRNA expression. On the whole, our data suggest that NRF1 is a negative regulator of SMAD4 and can interfere with TGF-β/SMAD-induced tumor suppression. Our findings provide a novel perception into the molecular basis of TGF-β/SMAD4-signaling suppression in tumorigenesis.
... In the nervous system, PGC-1α-dependent mitochondrial biogenesis is coupled with dendritic sprouting, dendritic spine formation, and synaptogenesis [17,18]. By activating NRF1, PGC-1α regulates the expression of NMDAR, GABAR, and synaptic plasticity [19,20]. PGC-1α exerts antioxidant, antiapoptotic, anti-inflammatory, and trophic effects, mediates the reparative polarization of macrophages and microglia, and promotes angiogenesis and neurogenesis-the underlying mechanisms of neural cell survival that increase the brain's tolerance to ischemia [21][22][23][24][25][26][27][28][29] ( Figure 1). ...
Article
Full-text available
The pharmacological induction and activation of peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1α), a key regulator of ischemic brain tolerance, is a promising direction in neuroprotective therapy. Pharmacological agents with known abilities to modulate cerebral PGC-1α are scarce. This study focused on the potential PGC-1α-modulating activity of Mexidol (2-ethyl-6-methyl-3-hydroxypyridine succinate) and Semax (ACTH(4–7) analog) in a rat model of photochemical-induced thrombosis (PT) in the prefrontal cortex. Mexidol (100 mg/kg) was administered intraperitoneally, and Semax (25 μg/kg) was administered intranasally, for 7 days each. The expression of PGC-1α and PGC-1α-dependent protein markers of mitochondriogenesis, angiogenesis, and synaptogenesis was measured in the penumbra via immunoblotting at Days 1, 3, 7, and 21 after PT. The nuclear content of PGC-1α was measured immunohistochemically. The suppression of PGC-1α expression was observed in the penumbra from 24 h to 21 days following PT and reflected decreases in both the number of neurons and PGC-1α expression in individual neurons. Administration of Mexidol or Semax was associated with preservation of the neuron number and neuronal expression of PGC-1α, stimulation of the nuclear translocation of PGC-1α, and increased contents of protein markers for PGC-1α activation. This study opens new prospects for the pharmacological modulation of PGC-1α in the ischemic brain.
... 2 [4] within a retrospective review of many cohort-based clinical studies, increased risks of epilepsy, autism, bipolar disorder and schizophrenia [216] ← only simultaneous silencing of gabrb1 expression and gabrb1-protein inhibition lows the prion protein level in neuroblastoma cells [217] ← ...
Article
Full-text available
Earlier, after our bioinformatic analysis of single-nucleotide polymorphisms of TATA-binding protein-binding sites within gene promoters on the human Y chromosome, we suggested that human reproductive potential diminishes during self-domestication. Here, we implemented bioinformatics models of human diseases using animal in vivo genome-wide RNA-Seq data to compare the effect of co-directed changes in the expression of orthologous genes on human reproductive potential and during the divergence of domestic and wild animals from their nearest common ancestor (NCA). For example, serotonin receptor 3A (HTR3A) deficiency contributes to sudden death in pregnancy, consistently with Htr3a underexpression in guinea pigs (Cavia porcellus) during their divergence from their NCA with cavy (C. aperea). Overall, 25 and three differentially expressed genes (hereinafter, DEGs) in domestic animals versus 11 and 17 DEGs in wild animals show the direction consistent with human orthologous gene-markers of reduced and increased reproductive potential. This indicates a reliable association between DEGs in domestic animals and human orthologous genes reducing reproductive potential (Pearson’s χ2 test p < 0.001, Fisher’s exact test p < 0.05, binomial distribution p < 0.0001), whereas DEGs in wild animals uniformly match human orthologous genes decreasing and increasing human reproductive potential (p > 0.1; binomial distribution), thus enforcing the norm (wild type).
... Interestingly, bioinformatics analysis of the promoters of these genes revealed enrichment of consensus binding sites for NRF-1, and NRF1 mRNA expression was reduced in the cortex of these patients [252]. It's possible that NRF-1 can mediate PGC-1α-dependent or independent regulation of neuron-enriched genes; while NRF-1 was initially identified as one of seven factors with consensus binding sites enriched in ubiquitously-expressed genes [253], multiple studies have shown that NRF-1 and/or NRF-2 are involved in the regulation of genes enriched in neurons such as neuronal nitric oxide synthase [254], AMPA receptor subunit 2 (GRIA2; [255,256]), NMDA receptor subunits NR1 (GRIN1) and NR2B (GRIN2B; [257]) and GABA receptor B1 (GABRB1; [258]). NRF-1 could serve as a critical transcription factor for the induction of cell-type-specific programs, depending on what combination of coactivators are present. ...
Article
Full-text available
Substantial evidence indicates that mitochondrial impairment contributes to neuronal dysfunction and vulnerability in disease states, leading investigators to propose that the enhancement of mitochondrial function should be considered a strategy for neuroprotection. However, multiple attempts to improve mitochondrial function have failed to impact disease progression, suggesting that the biology underlying the normal regulation of mitochondrial pathways in neurons, and its dysfunction in disease, is more complex than initially thought. Here, we present the proteins and associated pathways involved in the transcriptional regulation of nuclear-encoded genes for mitochondrial function, with a focus on the transcriptional coactivator peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC-1α). We highlight PGC-1α’s roles in neuronal and non-neuronal cell types and discuss evidence for the dysregulation of PGC-1α-dependent pathways in Huntington’s Disease, Parkinson’s Disease, and developmental disorders, emphasizing the relationship between disease-specific cellular vulnerability and cell-type-specific patterns of PGC-1α expression. Finally, we discuss the challenges inherent to therapeutic targeting of PGC-1α-related transcriptional programs, considering the roles for neuron-enriched transcriptional coactivators in co-regulating mitochondrial and synaptic genes. This information will provide novel insights into the unique aspects of transcriptional regulation of mitochondrial function in neurons and the opportunities for therapeutic targeting of transcriptional pathways for neuroprotection.
... The detected variations of luciferase activity due to mutagenesis or silencing are biologically significant and fall within the typically observed range (Xiong et al., 2012;Singh et al., 2017). Moreover, as β5 is also regulated by other transcriptional factors such Nrf1 (Li et al., 2018), we did not expect that the mutation of the FoxO1 binding site would totally abolish β5 expression. Importantly, β5 in addition to being responsible for the ratelimiting chymotrypsin-like proteolytic activity of the proteasome (Kisselev et al., 1999), was shown to be sufficient to induce the expression of additional proteasome subunits and consequently to enhance 26/30S proteasome assembly and activity when overexpressed in human fibroblasts (Chondrogianni et al., 2005), in human mesenchymal stem cells (Kapetanou et al., 2017) and in C. elegans (Chondrogianni et al., 2015a). ...
Article
Full-text available
Proteostasis collapses during aging resulting, among other things, in the accumulation of damaged and aggregated proteins. The proteasome is the main cellular proteolytic system and plays a fundamental role in the maintenance of protein homeostasis. Our previous work has demonstrated that senescence and aging are related to a decline in proteasome content and activities, while its activation extends lifespan in vitro and in vivo in various species. However, the mechanisms underlying this age-related decline of proteasome function and the down-regulation in expression of its subunits remain largely unclear. Here, we demonstrate that the Forkhead box-O1 (FoxO1) transcription factor directly regulates the expression of a 20S proteasome catalytic subunit and, hence, proteasome activity. Specifically, we demonstrate that knockout of FoxO1, but not of FoxO3, in mice severely impairs proteasome activity in several tissues, while depletion of IRS1 enhances proteasome function. Importantly, we show that FoxO1 directly binds on the promoter region of the rate-limiting catalytic β5 proteasome subunit to regulate its expression. In summary, this study reveals the direct role of FoxO factors in the regulation of proteasome function and provides new insight into how FoxOs affect proteostasis and, in turn, longevity.
Article
Genetic perturbations of cortical development can lead to neurodevelopmental disease, including autism spectrum disorder (ASD). To identify genomic regions crucial to corticogenesis, we mapped the activity of gene-regulatory elements generating a single-cell atlas of gene expression and chromatin accessibility both independently and jointly. This revealed waves of gene regulation by key transcription factors (TFs) across a nearly continuous differentiation trajectory, distinguished the expression programs of glial lineages, and identified lineage-determining TFs that exhibited strong correlation between linked gene-regulatory elements and expression levels. These highly connected genes adopted an active chromatin state in early differentiating cells, consistent with lineage commitment. Base-pair-resolution neural network models identified strong cell-type-specific enrichment of noncoding mutations predicted to be disruptive in a cohort of ASD individuals and identified frequently disrupted TF binding sites. This approach illustrates how cell-type-specific mapping can provide insights into the programs governing human development and disease.
Article
Hypoxia‐induced cardiomyocyte apoptosis is one of the leading causes of heart failure. Nuclear respiratory factor 1 (NRF‐1) was suggested as a protector against cell apoptosis. however, the mechanism is not clear. Therefore, the aim of this study was to elucidate the role of NRF‐1 in hypoxia‐induced H9C2 cardiomyocyte apoptosis, and to explore its effect on regulating the death receptor pathway and mitochondrial pathways. NRF‐1 was overexpressed or knocked‐down in H9C2 cells, which were then exposed to a hypoxia condition for 0, 3, 6, 12, and 24 h. Changes in cell proliferation, cell viability, reactive oxygen species (ROS) generation, and mitochondrial membrane potential (MMP) were investigated. The activities of caspase‐3, ‐8, and ‐9, apoptosis rate, and the gene and protein expression levels of the death receptor pathway and mitochondrial pathway were analyzed. Under hypoxia exposure, NRF‐1 overexpression improved the proliferation and viability of H9C2 cells, and decreased ROS generation, MMP loss, caspase activities, and the apoptosis rate. However, the NRF‐1 knockdown group showed the opposite results. Additionally, NRF‐1 upregulated the expression of anti‐apoptotic molecules involved in the death receptor and mitochondrial pathways, such as CASP8 and FADD‐like apoptosis regulator, B‐cell lymphoma 2, B‐cell lymphoma‐extra‐large, and cytochrome‐C. Conversely, the expression of pro‐apoptotic molecules such as caspase‐8, BH3‐interacting domain death agonist, Bcl‐2‐associated X protein, caspase‐9, and caspase‐3 was down‐regulated by NRF‐1 overexpression in hypoxia‐induced H9C2 cells. These results suggest that NRF‐1 functions as an anti‐apoptotic factor in the death receptor and mitochondrial pathways to mitigate hypoxia‐induced apoptosis in H9C2 cardiomyocytes. This article is protected by copyright. All rights reserved.
Article
Full-text available
Variations in genes encoding several GABAA receptors have been associated with human drug and alcohol abuse. Among these, a number of human studies have suggested an association between GABRB1, the gene encoding GABAA receptor β1 subunits, with Alcohol dependence (AD), both on its own and comorbid with other substance dependence and psychiatric illnesses. In the present study, we hypothesized that the GABRB1 genetically-associated increased risk for developing alcoholism may be associated with impaired behavioral control and altered sensitivity to reward, as a consequence of altered brain function. Exploiting the IMAGEN database (Schumann et al., 2010), we explored in a human adolescent population whether possession of the minor (T) variant of the single nucleotide polymorphism (SNP) rs2044081 is associated with performance of tasks measuring aspects of impulsivity, and reward sensitivity that are implicated in drug and alcohol abuse. Allelic variation did not associate with altered performance in either a stop-signal task (SST), measuring one aspect of impulsivity, or a monetary incentive delay (MID) task assessing reward anticipation. However, increased functional magnetic resonance imaging (fMRI) blood-oxygen-level dependent (BOLD) response in the right hemisphere inferior frontal gyrus (IFG), left hemisphere caudate/insula and left hemisphere inferior temporal gyrus (ITG) during MID performance was higher in the minor (T) allelic group. In contrast, during SST performance, the BOLD response found in the right hemisphere supramarginal gyrus, right hemisphere lingual and left hemisphere inferior parietal gyrus indicated reduced responses in the minor genotype. We suggest that β1-containing GABAA receptors may play a role in excitability of brain regions important in controlling reward-related behavior, which may contribute to susceptibility to addictive behavior.
Article
Full-text available
Eukaryotic transcription factors (TFs) are key determinants of gene activity, yet they bind only a fraction of their corresponding DNA sequence motifs in any given cell type. Chromatin has the potential to restrict accessibility of binding sites; however, in which context chromatin states are instructive for TF binding remains mainly unknown. To explore the contribution of DNA methylation to constrained TF binding, we mapped DNase-I-hypersensitive sites in murine stem cells in the presence and absence of DNA methylation. Methylation-restricted sites are enriched for TF motifs containing CpGs, especially for those of NRF1. In fact, the TF NRF1 occupies several thousand additional sites in the unmethylated genome, resulting in increased transcription. Restoring de novo methyltransferase activity initiates remethylation at these sites and outcompetes NRF1 binding. This suggests that binding of DNA-methylation-sensitive TFs relies on additional determinants to induce local hypomethylation. In support of this model, removal of neighbouring motifs in cis or of a TF in trans causes local hypermethylation and subsequent loss of NRF1 binding. This competition between DNA methylation and TFs in vivo reveals a case of cooperativity between TFs that acts indirectly via DNA methylation. Methylation removal by methylation-insensitive factors enables occupancy of methylation-sensitive factors, a principle that rationalizes hypomethylation of regulatory regions.
Article
Full-text available
Deterioration of adult stem cells accounts for much of aging-associated compromised tissue maintenance. How stem cells maintain metabolic homeostasis remains elusive. Here, we identified a regulatory branch of the mitochondrial unfolded protein response (UPR(mt)), which is mediated by the interplay of SIRT7 and NRF1 and is coupled to cellular energy metabolism and proliferation. SIRT7 inactivation caused reduced quiescence, increased mitochondrial protein folding stress (PFS(mt)), and compromised regenerative capacity of hematopoietic stem cells (HSCs). SIRT7 expression was reduced in aged HSCs, and SIRT7 up-regulation improved the regenerative capacity of aged HSCs. These findings define the deregulation of a UPR(mt)-mediated metabolic checkpoint as a reversible contributing factor for HSC aging. Copyright © 2015, American Association for the Advancement of Science.
Article
Although the stoichiometry of the major synaptic αβγ subunit-containing GABAA receptors has consensus support for 2α:2β:1γ, a clear view of the stoichiometry of extrasynaptic receptors containing δ subunits has remained elusive. Here we examine the subunit stoichiometry of recombinant α4β3δ receptors using a reporter mutation and a functional electrophysiological approach.
Article
Schizophrenia is a severe neuropsychiatric disorder with a strong and complex genetic background. Recent genome-wide association studies (GWAS) have successfully identified several susceptibility loci of schizophrenia. In order to interpret the functional role of the genetic variants and detect the combined effects of some of these genes on schizophrenia, protein-interaction-network-based analysis (PINBA) has emerged as an effective approach. In the current study, we conducted a PINBA of our previous GWAS data taken from the Han Chinese population. In order to do so, we used dense module search (DMS), a method that locates densely connected modules for complex diseases by integrating the association signal from GWAS datasets into the human protein-protein interaction (PPI) network. As a result, we identified one gene set with a joint effect significantly associated with schizophrenia and gene expression profiling analysis suggested that they were mainly neuro- and immune-related genes, such as glutamatergic gene (GRM5), GABAergic genes (GABRB1, GABARAP) and genes located in the MHC region (HLA-C, TAP2, HIST1H1B). Further pathway enrichment analysis suggested that these genes are involved in processes related to neuronal and immune systems, such as the Adherens junction pathway, the Neurotrophin signaling pathway and the Toll-like receptor signaling pathway. In our study, we identified a set of susceptibility genes that had been missed in single-marker GWAS, and our findings could promote the study of the genetic mechanisms in schizophrenia.