Prevalence and molecular diversity of the main viruses infecting cucurbit and solanaceous crops in Azerbaijan

Abstract

Two surveys were conducted in September 2014 and July 2015 in important vegetable-growing areas in Azerbaijan. Cucurbit and solanaceous plants exhibiting symptoms of mosaic, yellowing, leaf curl or necrosis were collected and tested serologically and molecularly for the presence of the major viruses infecting these crops. For cucurbits, the most common viruses in both sampling sets were aphid-transmitted ones, including potyviruses (watermelon mosaic virus, WMV, zucchini yellow mosaic virus, ZYMV), cucumoviruses (cucumber mosaic virus, CMV) and poleroviruses (cucurbit aphid-borne yellows virus, CABYV). Eggplant mottled dwarf (EMDV) was also detected for the first time in Azerbaijan on cucumber at a low prevalence. In solanaceous crops, CMV was the most common virus detected, followed by potato virus Y (PVY). Tomato spotted wilt virus (TSWV), alfalfa mosaic virus (AMV) and tobamoviruses (tomato mosaic virus (TMV), pepper mild mottle virus (PMMoV)) were also detected in 2015. The begomovirus tomato yellow leaf curl virus (TYLCV) was present on tomato only in the Absheron area, where it had a high prevalence and induced important losses. TYLCV-like symptoms on tomato in other areas of Azerbaijan were due to phytoplasma diseases.

Full text

1 23
European Journal of Plant Pathology
Published in cooperation with the
European Foundation for Plant
Pathology
ISSN 0929-1873
Eur J Plant Pathol
DOI 10.1007/s10658-018-1562-0
Prevalence and molecular diversity of
the main viruses infecting cucurbit and
solanaceous crops in Azerbaijan
Cécile Desbiez, Eric Verdin, Benoît
Moury, Hervé Lecoq, Pauline Millot,
Catherine Wipf-Scheibel, Samra
Mirzayeva, Nargiz Sultanova, et al.

1 23
Your article is protected by copyright and
all rights are held exclusively by Koninklijke
Nederlandse Planteziektenkundige Vereniging.
This e-offprint is for personal use only
and shall not be self-archived in electronic
repositories. If you wish to self-archive your
article, please use the accepted manuscript
version for posting on your own website. You
may further deposit the accepted manuscript
version in any repository, provided it is only
made publicly available 12 months after
official publication or later and provided
acknowledgement is given to the original
source of publication and a link is inserted
to the published article on Springer's
website. The link must be accompanied by
the following text: "The final publication is
available at link.springer.com”.

Prevalence and molecular diversity of the main viruses
infecting cucurbit and solanaceous crops in Azerbaijan
Cécile Desbiez &Eric Verdin &Benoît Moury &Hervé Lecoq &Pauline Millot &
Catherine Wipf-Scheibel &Samra Mirzayeva &Nargiz Sultanova &
Gulnara Balakishiyeva &Alamdar Mammadov &Ahmed Kheyr-Pour &
Irada Huseynova
Accepted: 27 July 2018
#Koninklijke Nederlandse Planteziektenkundige Vereniging 2018
Abstract Two surveys were conducted in September
2014 and July 2015 in important vegetable-growing
areas in Azerbaijan. Cucurbit and solanaceous plants
exhibiting symptoms of mosaic, yellowing, leaf curl or
necrosis were collected and tested serologically and
molecularly for the presence of the major viruses infect-
ing these crops. For cucurbits, the most common viruses
in both sampling sets were aphid-transmitted ones, in-
cluding potyviruses (watermelon mosaic virus, WMV,
zucchini yellow mosaic virus, ZYMV), cucumoviruses
(cucumber mosaic virus, CMV) and poleroviruses (cu-
curbit aphid-borne yellows virus, CABYV). Eggplant
mottled dwarf (EMDV) was also detected for the first
time in Azerbaijan on cucumber at a low prevalence. In
solanaceous crops, CMV was the most common virus
detected, followed by potato virus Y (PVY). Tomato
spotted wilt virus (TSWV), alfalfa mosaic virus (AMV)
and tobamoviruses (tomato mosaic virus (TMV), pepper
mild mottle virus (PMMoV)) were also detected in
2015. The begomovirus tomato yellow leaf curl virus
(TYLCV) was present on tomato only in the Absheron
area, where it had a high prevalence and induced impor-
tant losses. TYLCV-like symptoms on tomato in other
areas of Azerbaijan were due to phytoplasma diseases.
Keywords Epidemiology.Geneti c diversi ty .
Cucurbitaceae .To mat o .Pepper
Introduction
Virus and phytoplasma diseases are particularly damag-
ing in vegetable crops, as they affect not only the yield
but also the visual and organoleptic quality of the prod-
ucts, particularly important for these crops. The great
variety of soil and climatic conditions of Azerbaijan
supports a very rich diversity of plant genetic resources
for vegetable growing. Vegetable cultivation is consid-
ered one of the major economically important sectors in
agriculture and accounts for 61% of the crop production
(Sadikhova 2005). About 32 species of vegetables are
widely cultivated (Sadikhova 2005). Leading vegetables
in the country are the solanaceous crops tomato, pepper
and eggplant, as well as cucumber, cabbage, string bean
and onion. Presently, cucurbit and solanaceae crops are
mainly produced in Ganja-Kazakh, Guba-Khachmaz,
Lenkoran-Astara regions and Absheron peninsula. Over
the past decade, tomato yellow leaf curl virus (TYLCV),
Eur J Plant Pathol
https://doi.org/10.1007/s10658-018-1562-0
Electronic supplementary material The online version of this
article (https://doi.org/10.1007/s10658-018-1562-0) contains
supplementary material, which is available to authorized users.
C. Desbiez :E. Verdin :B. Moury :H. Lecoq :P. Millot :
C. Wipf-Scheibel
INRA, UR407, Unité de Pathologie Végétale, 84140 Montfavet,
France
S. Mirzayeva :N. Sultanova :G. Balakishiyeva :
A. Mammadov :I. Huseynova (*)
Azerbaijan National Academy of Sciences, Institute of Molecular
Biology and Biotechnology, 1073 Baku, AZ, Azerbaijan
e-mail: nargizsultanova@mail.ru
A. Kheyr-Pour
Institut des Sciences du Végétal, CNRS, 91198 Gif sur Yvette,
France
Author's personal copy

cucumber mosaic virus (CMV), pepper mild mottle
virus (PMMoV), tomato mosaic virus (ToMV), tobacco
mosaic virus (TMV), tomato spotted wilt virus (TSWV)
on tomato and/or pepper crops, as well as CMV, zuc-
chini yellow mosaic virus (ZYMV), squash mosaic
virus (SqMV) in cucurbits have been reported in differ-
ent regions of Azerbaijan (Huseynova et al. 2016;
Huseynova et al. 2017; Verdin et al. 2018). Among the
phytoplasmas widely distributed in Azerbaijan,
‘Candidatus Phytoplasma solani’is the most common
one, causing diseases on many cultivated plants, includ-
ing tomato, pepper, eggplant, cherry, cherry plum, com-
mon medlar trees and grapevine (Balakishiyeva et al.
2010; Balakishiyeva et al. 2016).
The aim of the present study was to investigate the
prevalence and genetic diversity of the main plant vi-
ruses infecting cucurbit and solanaceous crops growing
in Azerbaijan, in order to characterize the major agro-
nomic problems and estimate if the highly damaging
whitefly-transmitted viruses and/or emerging strains of
known viruses now emerging in the Mediterranean Ba-
sin (Lecoq and Desbiez 2012) also threaten vegetable
production in Azerbaijan.
Materials and methods
Surveys and plant sampling
Two surveys were performed in Azerbaijan in Septem-
ber 2014 and July 2015. The sample plants were mostly
cucurbits (cucumber, melon, watermelon and squash)
and Solanaceae (tomato, pepper, eggplant). In 2014,
three important production regions were surveyed:
Absheron, Ganja and Guba areas, in experimental sta-
tions or private farms. Sampling was performed at the
end of the growing season, when the prevalence of viral
diseases is usually highest since viral infection has been
building up throughout the season. Many of the cucurbit
plants showed symptoms of mosaic, vein banding,
yellowing of the older leaves, and occasionally fruit
deformation and discoloration, suggestive of virus in-
fection. Many tomato plants, particularly in the
Absheron region, showed symptoms of yellowing and
upward leaf curl, besides common mosaics and necro-
sis. Pepper plants showed diverse symptoms of mosaic
and yellowing, whereas eggplant plants looked healthy
and symptomless except for one plant showing mosaics.
Few aphids were observed on the plants, but whiteflies
were frequently observed on the leaves of cucurbit and
tomato plants in the three surveyed areas. A total of 171
samples was collected, 96 from cucurbits and 75 from
tomato, pepper and eggplant (only one sample).
In 2015, the same crops were surveyed in four re-
gions: Absheron, Khachmaz, Shamkir and Lankaran
areas, in experimental stations or private farms: 66 cu-
curbit, 91 tomato, 84 pepper and 10 eggplant plants.
Most of the crops were in open fields, but some tomato
and cucumber greenhouses were also sampled in the
Shamkir area. The plants were at different physiological
stages, fromrecently planted to harvesting stage and end
of production. Almost no aphids were observed, how-
ever some whiteflies, which were monitored on the
leaves were present in greenhouse conditions but not
in the open field. The proportions of plants showing
symptoms were usually low. Virus-like symptoms on
cucurbits included mosaic, leaf crispation, yellowing of
the older leaves, and occasionally fruit deformation and
discoloration. On pepper, most symptomatic plants
showed leaf mosaic or yellowing and stunting, some-
times associated with upward leaf curling. Tomato
plants exhibited mostly stunting with leaf curling, leaf
yellowing and flower virescence suggestive of phyto-
plasma infection.
Twenty nine cucurbit samples from a survey per-
formed in 2003 in the Lankaran, Guba and Baku areas,
and previously tested serologically and molecularly
(Lecoq and Desbiez, unpublished) were also added to
the analyses.
Serological tests
All cucurbit samples were tested serologically in
DAS-ELISA, using antisera obtained at the Plant
Pathology Unit of INRA in Avignon, for 16 viruses
frequent in cucurbits worldwide and/or present in
countries neighboring Azerbaijan: watermelon mo-
saic virus (WMV, potyvirus), zucchini yellow mo-
saic virus (ZYMV, potyvirus), cucumber mosaic
virus (CMV, cucumovirus), cucurbit aphid-borne
yellows virus (CABYV, polerovirus), papaya ringspot
virus (PRSV, potyvirus), Moroccan watermelon mosaic
virus (MWMV, potyvirus), cucumber vein yellowing
virus (CVYV, ipomovirus), cucurbit yellow stunting
disorder virus (CYSDV, crinivirus), beet pseudo-
yellows virus (BPYV, crinivirus), melon necrotic spot
virus (MNSV, carmovirus), squash mosaic virus
(SqMV, comovirus), squash leaf curl virus (SLCV,
Eur J Plant Pathol
Author's personal copy

begomovirus), watermelon chlorotic stunt virus
(WmCSV, begomovirus), Ourmia melon virus (OuMV,
ourmiavirus), eggplant mottle dwarf virus (EMDV,
rhabdovirus) and cucumber green mottle mosaic virus
(CGMMV, tobamovirus).
The Solanaceae samples were tested serologically for
6 viruses frequent in these plants worldwide and/or
present in countries neighboring Azerbaijan: alfalfa mo-
saic virus (AMV, alfamovirus), CMV, EMDV, potato
virus Y (PVY, potyvirus), tomato mosaic virus (ToMV,
tobamovirus), and tomato spotted wilt virus (TSWV,
tospovirus). In 2014, they were also tested for impatiens
necrotic spot virus (INSV, tospovirus) and parietaria
mottle virus (PMoV, ilarvirus). The samples collected
in 2015 were not tested for these two viruses, but they
were tested for pepper mild mottle virus (PMMoV,
tobamovirus), as well as with CABYVantiserum, which
cross reacts in ELISA with poleroviruses infecting
pepper crops (beet western yellows virus, pepper
vein yellows virus) (Buzkan et al. 2013).
Molecular tests
Molecular diagnostic tests by reverse transcription-
polymerase chain reaction (RT-PCR) were performed
for viruses for which no antiserum was available.
RNA was extracted from all cucurbit samples using
TRI-reagent® following the manufacturer’srecommen-
dations, and tested by RT-PCR for the presence of
cucumber chlorotic yellows virus (CCYV, crinivirus),
recently detected in Iran, using primers CCYV-CP-5′
and CCYV-CP-3′(Mohammed et al. 2014).
Plants that appeared positive in ELISA for EMDV
were tested by RT-PCR with primers EMDV-3500-5′
(5’-GCATTTGAGTTYTTCTATGAGGG-3′)and
EMDV-4656-3′(5’-CCTGCTTGATTGACTATCTC-
3′), and the PCR products were sent for direct sequenc-
ing to Genoscreen (Lille, France).
RNA was also extracted from all tomato samples
using TRI-reagent®, and tested by RT-PCR for tomato
chlorosis virus (ToCV, crinivirus) and tomato infectious
chlorosis virus (TICV, crinivirus), with the primers and
protocols defined by Jacquemond et al. (2009). DNA
was also extracted from the tomato samples before
testing by PCR for the presence of begomoviruses with
primers Gem-CP-V-5 and Gem-CP-C-3 (Wyatt and
Brown 1996). For the solanaceous samples from 2015,
phytoplasma detection was also performed by PCR with
the universal primers for phytoplasmas R16mF2/
R16mR1 and R16F2n/R16R2 (Gundersen and Lee
1996), and the amplified fragments were sent for direct
sequencing to Genoscreen.
Diversity analyses
RT-PCR were performed on RNA from all WMV sam-
ples with primers W-VVIAM-5′and WMV-3′(Lecoq
and Desbiez 2012) in order to amplify a 900 nucleotide
fragment corresponding to the C-terminal part of the
RNA-dependent RNA polymerase (RdRp, NIb protein)
and the variable N-terminal part of the coat protein (CP).
In order to characterize further the WMV isolates pres-
ent in Azerbaijan, partial sequences from the HC-Pro
coding region in the 5′part of the genome were obtained
after RT-PCR amplification with primers W-milHC-5
5’-TTGCCATGACACAGTGGTGG-3′and W-finHC-
35’-CTTCCCCACCAACCCTGTA-3′for 29 WMV-
infected samples from the different sampling sites. Par-
tial sequences of the P3 to CI coding regions were also
obtained for 10 samples from 2014 and 3 samples from
2015 after amplification with primers WMV-Xba-5′5’-
TATGAATGCTCAGTCACACC-3′and WMV-debCI-
3′5’-GTYAAATTYGAGGAYTGGTGG-3′.
For ZYMV, a 600-nt fragment corresponding to the
NIb-CP coding region was amplified with primers
ZYMV-CP-5′and ZYMV-CP-3′(Lecoq and Desbiez
2012). For CABYV and other putative poleroviruses, a
fragment encompassing part of the RNA-dependent
RNA polymerase (RdRp), and intergenic region (IR)
and part of the overlapping CP and MP (movement
protein) coding region was amplified by RT-PCR with
polerovirus-polyvalent primers Pol-G-F and Pol-G-R
(Knierim et al. 2010) for 19 isolates from 2014 and 7
isolates from 2015.
For CMV, RT-PCR amplifications were performed
for 18 isolates from the different sampled areas using
primers specific of each genomic component: G1–2.F
(5’-GCTCAGACACGTTCCCC-3′) and G1–2.R (5’-
ACAGTCGGACATTCATTAAG-3′), G2-I.F (5’-
GGCTGCTTTAATGTTAGGCG 3′) and G2-I.R (5’-
GGATGGACAACCCGTTCACC-3′), G3-CP.F (5’-
CTCAGCGGCTACGTCTGACG-3′)andG3-
CP.R-(5’-TCCTCGGACTCACTGCGCGC-3′)(Ben
Tamarziztetal.2013).
The amplified fragments were sent for direct se-
quencing to Genoscreen.
The sequences were aligned using ClustalW included
in MEGA 6.0 (Tamura et al. 2013), with manual
Eur J Plant Pathol
Author's personal copy

corrections when needed. Reference sequences from
GenBank were added to the analyses. The best nucleo-
tide substitution model was selected with MEGA. Re-
combination analyses were performed with RDP4.0,
using 6 different recombination detection methods.
Distance and maximum-likelihood trees were built
with MEGA using the previously selected model for
nucleotide substitution correction. A bootstrap resam-
pling (n= 500 bootstraps) was performed for each
analysis.
Results
In cucurbits, WMV was the most common virus in the
2014–2015 surveys, infecting 90 out of the 96 samples
(94%) in 2014 and 31 out of 66 samples (47%) in 2015
(Table 1).
CABYV was also frequent (69 and 41% of the sam-
ples in 2014 and 2015 respectively), followed by CMV
(35.4 and 13.6%) and ZYMV (15.6 and 3%). All plants
were negative in ELISA or RT-PCR against MWMV,
PRSV, MNSV, BPYV, CCYV, CYSDV, CVYV, SqMV,
SLCV, WmCSV, OuMV and CGMMV.
Three isolates from 2014 appeared slightly positive
in ELISA for EMDV, but this was not confirmed by RT-
PCR using EMDV-specific primers, and no characteris-
tic bullet-shaped rhabdovirus particle was observed in
transmission electron microscopy on these samples (da-
ta not shown). In contrary, in 2015, four cucumber
samples, originating from all the sampled areas except
Lankaran and exhibiting symptoms of leaf crispation
and downward curling, were positive in ELISA for
EMDV. Observations in transmission electron micros-
copy confirmed the presence of bullet-shaped particles.
RT-PCR amplification with EMDV-specific primers
yielded fragments of the expected size (GenBank
accession MG964325) that exhibited 77% sequence
identity (90% amino-acid identity) with EMDV se-
quences from Greece, Cyprus and Iran. To our knowl-
edge, this is the first description of EMDV in Azerbai-
jan. In the survey from 2003 in the Khachmaz and
Lankaran regions, ZYMV was the most common virus
(86% of the samples) followed by CABYV (69%),
WMV (31%), MNSV (6.9%) and CMV (3.4%) (Fig. 1).
Mechanical inoculations were performed on suscep-
tible cucurbits in a quarantine greenhouse for 30 sam-
ples from 2014 and 9 samples from 2015 infected by
WMV, ZYMV, CMV or EMDV. The viruses initially
present in the original samples were recovered from
most of the inoculated plants, as confirmed by DAS-
ELISA, and symptom type and severity in the inoculat-
ed plants were consistent with those expected from
ELISA. These results suggest that no important
mechanically-transmissible virus had been missed in
the study.
Based on ELISA results, mixed infections of two to
four viruses in the same plant were rather common, par-
ticularly between WMV and CABYV (62/96 (64.6%) and
15/66 (22.7%) samples respectively in 2014 and 2015) or
WMV and CMV (30/96 (31%) and 4/66 (6.1%)).
Tabl e 1 Prevalence (number of infected plants) of viruses on cucurbits in the different sampling areas in Azerbaijan in 2014 and 2015
Number of samples WMV ZYMV CMV CABYV EMDV
2014 2015 2014 2015 2014 2015 2014 2015 2014 2015 2014 2015
Absheron 42 21 40 16 1 1 7 4 20 10 0 1
Ganja 36 26 35 14 2 1 10 4 29 10 0 2
Quba 18 11 15 1 12 0 17 1 17 6 0 1
Lankaran0 8 0000000100
Total 96 66 9031152 349 66270 4
Fig. 1 Prevalence (%) of different viruses on cucurbits in Azer-
baijan in the 2003, 2014 and 2015 surveys
Eur J Plant Pathol
Author's personal copy

In solanaceous plants, CMV was the most common
virus detected in tomato (33/46 (72%) and 29/91 (32%)
in 2014 and 2015 respectively) (Table 2), pepper (12/28
(41%) and 16/84 (19%) (Table 3) and eggplant (1/1 in
2014, 3/10 in 2015). PVY was also detected but at a
lower frequency (12/46 and 5/28 (26%–18%) in 2014
and 8/91 vs. 1/84 (8.8%-1,2%) in 2015) on tomato and
pepper respectively. In 2014, no other viruses were
found by ELISA, whereas in 2015 PMMoV (5/84) and
AMV (3/84) were observed at a low prevalence on
pepper, AMV was present in eggplant (4/10), while
TMV (1/91) and TSWV (1/91) were detected on
tomato.
Mechanical inoculations were performed on suscep-
tible plants (Nicotiana benthamiana, Nicotiana
tabacum cv. xanthi, Capsicum annuum, Solanum
melongena, Solanum lycopersicum, Vigna unguiculata,
Chenopodium quinoa) with 20 samples from 2014
originating from the three prospected regions. The
infected plant species and symptom types observed
on this host range were consistent with those ex-
pected from ELISA results. No other atypical
symptoms were observed, suggesting that no im-
portant mechanically transmissible virus had been
missed.
In addition to viruses, phytoplasma were very fre-
quently detected in 2015, in pepper (57.1%) and tomato
(19.8%) crops and in eggplant (three plants out of 10).
After sequencing of the PCR products obtained from 14
pepper, tomato or eggplant samples, the phytoplasma
corresponded to ‘Candidatus Phytoplasma solani’(the
causal agent ofthe stolbur-related disease) in every case.
Molecular tests did not yield any positive results for
CCYV in cucurbits, nor TICVand ToCV in tomato (data
not shown).
PCR with begomovirus-specific primers followed by
sequence analysis performed on tomato samples re-
vealed the presence of TYLCV in tomato plants exclu-
sively localized in the region of Baku (11/12 positive
samples in 2014 (Verdin et al. 2018) and 9/16 in 2015).
These data were correlated with the symptoms ob-
served: stunting aspect of the plant and strong leaf curl
(Supplementary Fig. 1).
Molecular diversity of cucurbit viruses
in Azerbaijan
Partial NIb-CP coding sequences were obtained for 85
WMV samples in 2014 and 30 samples in 2015
Tabl e 2 Prevalence of viruses on tomato in the different sampling areas in Azerbaijan in 2014 and 2015
Number of samples CMV PVY TMV TSWV TYLCV
2014 2015 2014 2015 2014 2015 2014 2015 2014 2015 2014 2015
Absheron13 16 510070000119
Ganja20 43 20170000000
Quba 13 10 81651010100
Lankaran0 22 0200000000
Total 46 91 33291280101119
Tabl e 3 Prevalence of viruses on pepper in the different sampling areas in Azerbaijan in 2014 and 2015
Number of samples CMV PVY PMMoV AMV
2014 2015 2014 2015 2014 2015 2014 2015 2014 2015
Absheron 12 10 2 5 5 1 nt 0 0 2
Ganja 7 17 2 5 0 0 nt 0 0 0
Quba 9 34 7 5 0 0 nt 2 0 0
Lankaran 0 23 0 1 0 0 nt 3 0 1
Total28841116510503
Eur J Plant Pathol
Author's personal copy

(Genbank accessions MG964114-MG964228). All iso-
lates displayed a low molecular variability, with more
than 98% nucleotide sequence identity between sam-
ples. They were closely related to WMV isolates from
the survey performed in Azerbaijan in 2003, and to
isolates from Iran (Fig. 2). They all belonged to the
same molecular group named BGroup1^or BCL^
(classic) present in several countries of Europe, Asia
and Africa (Lecoq and Desbiez 2012). Sequences were
obtained in the HC-coding region for 29 isolates from
2014 (accessions MG964296-MG964324). Contrary to
the CP-coding region, all isolates belonged to molecular
group BG2^rather than BG1^. This indicates that, like
most isolates considered as BG1^basedonCPse-
quences (Desbiez and Lecoq 2008), they are indeed
recombinant between groups G2 and G1. To further
characterize the recombination breakpoint, 13 se-
quences (accessions MG964283-MG964295) were ob-
tained in the P3 to CI coding region that is considered as
a recombination hotspot for WMV (Desbiez and Lecoq
2008). These sequences revealed that the 13 isolates had
the same recombination breakpoint located in the C-
terminal part of the P3-coding region (data not shown).
As well as for WMV, the molecular diversity among
40 ZYMV isolates from Azerbaijan (GenBank
MG964050-MG964089) was limited, with more than
98% n ucleotide identity among is olates. ZYMV isolates
collected in 2014 and 2015 were closely related or even
identical in the sequenced fragment to isolates collected
in 2003 (Fig. 3). Both in 2003, 2014 and 2015, some of
the isolates were characterized by a unique Bsignature^,
i.e. one extra amino-acid in the CP compared to all
worldwide isolates (data not shown). All ZYMVisolates
collected in 2014 and 2015 belonged to the same mo-
lecular cluster known as group A1 that is the most
common worldwide and contains isolates from all con-
tinents (Lecoq and Desbiez 2012). In 2003, group A1
but also A2 had been detected in Azerbaijan (Fig. 3).
For CMV, fragments of the three RNAs were ampli-
fied for 18 isolates from 2014 (GenBank MG964229-
MG964282). Sequences from RNAs 1 and 2 were high-
ly homogeneous, and for these 2 RNAs the isolates
clustered in the worldwide IA group of CMV. Surpris-
ingly, for RNA 3, while eight isolates clustered in group
IA, the 10 remaining isolates belonged to group IB,
without correlation with their host plant or sampling
place in Azerbaijan (Supplementary Fig. S2). The fact
that the three RNAs belong to different molecular
groups indicates that the isolates are pseudo-
recombinants or reassortants that can be described as
BIA-IA-IB^according to the nature of their three RNAs.
Seventeen and seven polerovirus sequences were
obtained in 2014 and 2015 respectively after amplifica-
tion of cucurbit samples with primers Pol-G-F and Pol-
G-R. All sequences (GenBank MG964090-MG964113)
corresponded to CABYV only, and not to the other
cucurbit-infecting poleroviruses including pepo aphid-
borne yellows virus (PABYV) that is present in Africa
and has been recently detected in Europe (Greece)
(Knierim et al. 2014; Desbiez et al. 2016; Lotos et al.
2016). All Azerbaijan isolates were closely related mo-
lecularly to each other and they shared at least 98%
nucleotide sequence identity in the sequenced fragment.
In the RdRp-intergenic region (IR)-CP fragment used
for phylogenetic analysis, the isolates from Azerbaijan
appeared to constitute a distinct group, different both
from isolates found in Europe (Spain, France) or Eastern
Asia (China, Philippines, Thailand) (Supplementary
Fig. S3).
Discussion
Except for TYLCV on tomato in the Absheron
region, the most common and important viruses
present in cucurbits, tomato, pepper and eggplant
during the 2014–2015 surveys in Azerbaijan were
aphid-transmitted ones, mostly potyviruses and
cucumoviruses. During the surveys, very few aphids
were observed in the crops but they had been noticed
earlier by the growers, whereas whiteflies were present.
The presence of large populations of whiteflies was
consideredas a new situation by the growers,suggesting
that an invasive Bemisia biotype, maybe Med or
MEAM (formerly Q and B) although this was not tested,
has been introduced recently. In cucurbits, the most
common viruses were WMV, CABYV, CMV and
ZYMV, which are also among the most common world-
wide when they are not superseded by whitefly-
transmitted emerging viruses (Lecoq et al. 1998;
Lecoq and Desbiez 2012). Some viruses were not de-
tected in all surveys, like MNSV that had been observed
in 2003 at a low prevalence but not in the 2014–2015, or
like AMV, TSWV and TMV that were observed in
tomato and pepper in 2015 but not in 2014. This may
simply be due to random sampling effects. The preva-
lence of ZYMV was much higher in the 2003 survey
than in 2014–2015, what could suggest an increase in
Eur J Plant Pathol
Author's personal copy

Fig. 2 Distance tree based on a fragment of the NIb-CP coding region of watermelon mosaic virus (WMV). The scale bar represents a
genetic distance of 0.01. Bootstrap values above 70% (500 bootstraps) are indicated for each node
Eur J Plant Pathol
Author's personal copy

Eur J Plant Pathol
Author's personal copy

the relative frequency of WMVand CMVand a decrease
of ZYMV. There may be a sampling bias related to the
necessarily limited number of sites and plants surveyed,
but ZYMV can also display very irregular epidemics,
with important inter-annual fluctuations of prevalence
(Lecoq et al. 2009).
Among the cucurbit-infecting potyviruses WMVand
ZYMV, the molecular diversity of Azeri samples was
very low in 2014–2015 and all isolates belonged to the
most common molecular groups of their respective virus
worldwide, BG1^for WMV and BA1^for ZYMV, even
though ZYMV group BA2^had been observed in 2003.
WMV isolates from2014 to 2015 were closely related to
those collected in Azerbaijan in 2003, and to isolates
from Iran. As in many countries, WMV isolates from
Azerbaijan are indeed recombinants between groups G2
in the 5′part of the genome and G1 in the 3′part
(Desbiez and Lecoq 2008). Isolates from Iran collected
before 2008 belonged mostly to group G1 in the CP-
coding region although one isolate from group G2 was
observed (Sharifi et al. 2008). One isolate from Iran was
found to have a G2/G1 recombination breakpoint locat-
ed in the HC-Pro coding region (Desbiez and Lecoq
2008), but according to the 29 partial HC-Pro sequences
obtained in this study this was not the case for the
Azerbaijan isolates. For 13 Azerbaijan isolates, the re-
combination breakpointwas located in the P3-CI coding
region that was shown to be a recombination hotspot for
G2/G1 recombinants (Desbiez and Lecoq 2008). This
recombination breakpoint is different from those previ-
ously described for isolates from France, Italy, Turkey,
Iran, Pakistan and Chile (Desbiez and Lecoq 2008)but
appears identical to that of some Tunisian isolates
(Yakoubi, Desbiez and Lecoq, unpublished). These re-
sults show that despite their molecular similarity in the
CP coding region with isolates from Iran or other ori-
gins, the AZ14 isolates have no direct relation withthese
since they have a different recombination pattern and
thus a different evolutionary history.
In France and probably in other European and Med-
iterranean countries, strains from Group 1 that had been
present for more than 40 years are now being replaced
by Bemerging^strains from molecular group 3 (G3 or
BEM^), probably originating from South-Eastern Asia
(Desbiez et al. 2009;LecoqandDesbiez2012). Accord-
ing to the molecular characteristics of the isolates from
this survey, EM strains have not yet been introduced in
Azerbaijan or at least have a very low prevalence so far
in the areas surveyed.
Groups A1 and A2 of ZYMV are common in France
and other European and Mediterranean countries, but as
in the case of WMV, emerging strains belonging to other
molecular groups (named A4 and A5) are now also
present (Lecoq et al. 2009; Lecoq and Desbiez 2012).
These emerging strains were not found in this survey.
These data indicate that contrary to many European and
Mediterranean countries, there has been no major change
in ZYMV populations in Azerbaijan in the last decade.
For CMV, sequences from RNAs 1 and 2 were highly
homogeneous, and clustered in the worldwide IA group
of CMV that is the most common in Europe and the
Mediterranean Basin (Jacquemond 2012). However, for
RNA 3, 10/18 isolates belonged to group IB. Subgroup
IB originates from Eastern Asia, but several introduc-
tions have taken place in Europe and the Mediterranean
Basin in the last decade(s) (Jacquemond 2012). The
isolates appear as pseudo-recombinants or reassortants
that can be described as BIA-IA-IB^according to the
nature of their 3 RNAs. Pseudo-recombination has long
been considered as a minor phenomenon in CMV even
if its evolutionary consequences could theoretically be
important (Escriu et al. 2007), but different reassortants
have now been observed worldwide (Ohshima et al.
2016). A large proportion of CMV isolates infecting
pepper in Tunisia has been shown recently to consist
of peudo-recombinants, mostly IB-IA-IB and IB-IA-IA
(Ben Tamarzizt et al. 2013). Isolates belonging to group
IB for their RNA3 have also been observed since 2011
on tomato and cucurbits in Iran (Nematollahi et al. 2012;
Farzadfar et al. 2013). They are closely related molecu-
larly to the isolates from Azerbaijan and from Turkey,
suggesting that they correspond to the same
introduction/reassortment event of IB group in Western
Asia that was estimated to have happened about 80 years
ago (Ohshima et al. 2016).
The lack of whitefly-transmitted viruses, including
some that are present in Iran (CVYV, CCYV, CYSDV,
WmCSV, TLCPaV) (Keshavarz et al. 2014; Bananej
et al. 2014; Esmaeili et al. 2015) in spite of high whitefly
infestations suggests that these viruses have not yet been
introduced in Azerbaijan. It is important to avoid intro-
duction of these very damaging viruses and to control
Fig. 3 Distance tree based on a fragment of the NIb-CP coding
region of zucchini yellow mosaic virus (ZYMV). Isolates from the
2003 and 2014–2015 surveys in Azerbaijan are boxed. The scale
bar represents a genetic distance of 0.01. Bootstrap values above
60% (500 bootstraps) are indicated for each node
R
Eur J Plant Pathol
Author's personal copy

whitefly populations, all the more since highly damag-
ing whitefly-transmitted viruses are present in tomato
crops.
In solanaceous crops, the only whitefly-transmitted
virus detected was TYLCV, in the Absheron area only
(Verdin et al. 2018). TYLCV-like symptoms of leaf
curling and yellowing in the Ganja and Guba regions
were related to phytoplasma infections. As in cucurbits,
the major viruses present were mostly aphid-transmitted
ones, even if TSWV and tobamoviruses were observed
at a low prevalence. Several important viruses that are
now emerging and/or very common in tomato and pep-
per crops in the Mediterranean Basin (particularly
poleroviruses and criniviruses) (Buzkan et al. 2013;
Moury and Verdin 2012;HanssenandLapidot2012)
were not detected in Azerbaijan during this survey. It is
thus particularly important to avoid introducing them
through exchanges of plant material.
The high prevalence of agronomical important aphid-
transmitted viruses highlights the need for aphid control
measures, appropriate cultural practices including
weeding to remove virus and vector reservoirs and space
management to avoid planting young crops close to old
infected ones, and use of resistant varieties when they
are available.
Acknowledgments This work was supported by the Science
Development Foundation under the President of the Republic of
Azerbaijan (EİF-2014-9(24)-KETPL-14/11/3-M-10) and by Pre-
sidium of Azerbaijan National Academy of Sciences (decision №
7/3 dated on 14.03.2018). We thank Isabelle Bornard at the Mi-
croscopy Platform of INRA-Montfavet for the electron micro-
scope observations, the Experimental Infrastructure team in
Montfavet for their help in the greenhouse experiments, and Dr.
Michel Pitrat for his participation in the 2003 survey.
Compliance with ethical standards
Conflict of interest The authors declare that they have no con-
flicts of interest.
Ethical approval This article does not contain any studies with
human participants or animals performed by any of the authors.
References
Balakishiyeva, G., Danet, J. L., Qurbanov, M., Mamedov, A.,
Kheyr-Pour, A., & Foissac, X. (2010). First report of phyto-
plasma infections in several temperate fruit trees and vegeta-
ble crops in Azerbaijan. Journal of Plant Pathology, 92, 115.
Balakishiyeva, G., Mamedov, A., Foissac, X., Huseynova, I., &
Aliyev, J. (2016). First report of grapevine ‘bois noir’in
Azerbaijan. Plant Disease, 100, 2522.
Bananej, K., Kianfar, N., Winter, S., & Menzel, W. (2014).
The status of cucumber vein yellowing virus in Iran.
Phytopathologia Mediterranea, 53, 269–276.
Ben Tamarzizt, H., Montarry, J., Girardot, G., Fakhfakh, H.,
Tepfer, M., & Jacquemond, M. (2013). Cucumber mosaic
virus populations in Tunisian pepper crops are mainly com-
posed of virus reassortants with resistance-breaking proper-
ties. Plant Pathology, 62,1415–1428.
Buzkan, N., Arpaci, B., Simon, V., Fakhfakh, H., & Moury, B.
(2013). High prevalence of poleroviruses in field-grown
pepper in Turkey and Tunisia. Archives of Virology,
158,881–885.
Desbiez, C., & Lecoq, H. (2008). Evidence for multiple intraspe-
cific recombinants in natural populations of watermelon mo-
saic virus (WMV, Potyvirus). Archives of Virology, 153,
1749–1754.
Desbiez, C., Joannon, B., Wipf-Scheibel, C., Chandeysson, C., &
Lecoq, H. (2009). Emergence of new strains of watermelon
mosaic virus in South-Eastern France: evidence for limited
spread but rapid local population shift. Virus Research, 141,
201–208.
Desbiez, C., Millot, P., Wipf-Scheibel, C., Blancard, D., Chesneau,
T., & Lecoq, H. (2016). First report of Pepo aphid-borne
yellows virus in cucurbits in Tanzania and Mayotte. New
Disease Reports, 33,20.
Escriu, F., Fraile, A., & Garcia-Arenal, F. (2007). Constraints to
genetic exchange support gene coadaptation in a tripartite
RNA virus. PLoS Pathogens, 3,e8.https://doi.org/10.1371
/journal.ppat.0030008.
Esmaeili, M., Heydarnejad, J., Massumi, H., & Varsani, A. (2015).
Analysis of watermelon chlorotic stunt virus and tomato leaf
curl Palampur virus mixed and pseudo-recombination infec-
tions. Vi ru s G e nes , 5 1,408–416.
Farzadfar, S., Pourrahim, R., & Arafati, N. (2013). Molecular
identification of cucumber mosaic virus subgroup 1B isolates
in South Iran. Journal of Plant Pathology, 95,423–428.
Gundersen, D. E., & Lee, I. M. (1996). Ultrasensitive detection of
phytoplasmas by nested-PCR assays using two universal
primer pairs. Phytopathologia Mediterranea, 35,144–151.
Hanssen, I. M., & Lapidot, M. (2012). Major tomato viruses in
the Mediterranean Basin. Advances in Virus Research, 84,
31–66.
Huseynova, I. M., Sultanova, N. F., Mirzoyeva, S. T., & Aliyev, J.
A. (2016). Serological and molecular detection of virus in-
fections of tomato (Solanum lycopersicum L.) plants in
Azerbaijan. Reports of ANAS, 3,73–78.
Huseynova, I. M., Mirzayeva, S. M., Sultanova, N. F., Aliyeva, D.
R., Mustafayev, N. S., & Aliyev, J. A. (2017). Virus-induced
changes in photosynthetic parameters and peroxidase isoen-
zyme contents in tomato (Solanum lycopersicum L.) plants.
Photosynthetica, 55,1–10.
Jacquemond, M. (2012). Cucumber mosaic virus. Advance in
Virus Research, 84,439–504.
Jacquemond, M., Verdin, E., Dalmon, A., Guilbaud, L., &
Gognalons, P. (2009). Serological and molecular detection
of tomato chlorosis virus and tomato infectious chlorosis
virus in tomato. Plant Pathology, 58,210–220.
Eur J Plant Pathol
Author's personal copy

Keshavarz, T., Shams-Bakhsh, M., Izadpanah, K., & Malboobi,
M. A. (2014). Occurrence and genome analysis of cucurbit
chlorotic yellows virus in Iran. Journal of Phytopathogy, 162,
523–526.
Knierim, D., Deng, T. C., Tsai, W. S., Green, S. K., & Kenyon, L.
(2010). Molecular identification of three distinct Polerovirus
species and a recombinant cucurbit aphid-borne yellows
virus strain infecting cucurbit crops in Taiwan. Plant
Pathology, 59,991–1002.
Knierim, D., Tsai, W. S., Maiss, E., & Kenyon, L. (2014).
Molecular diversity of poleroviruses infecting cucurbit crops
in four countries reveals the presence of members of six
distinct species. Archives of Virology, 159,1459–1465.
Lecoq, H., & Desbiez, C. (2012). Viruses of cucurbit crops in the
Mediterranean region: an ever-changing picture. Advances in
Virus Research, 84,67–126.
Lecoq, H., Wisler, G., & Pitrat, M. (1998). Cucurbit viruses: The
classics and the emerging. In J. D. McCreight (Ed.),
Cucurbitaceae '98. Evaluation and enhancement of cucurbit
germplasm (pp. 126–142). Alexandria: ASHS Press.
Lecoq, H., Wipf-Scheibel, C., Chandeysson, C., Le Van, A.,
Fabre, F., & Desbiez, C. (2009). Molecular epidemiology of
zucchini yellow mosaic virus in France: an historical over-
view. Virus Research, 141,190–200.
Lotos,L.,Maliogka,V.I.,&Katis,N.I.(2016).New
poleroviruses associated with yellowing symptoms in differ-
ent vegetable crops in Greece. Archives of Virology, 161,
431–436.
Mohammed, H. S., Zicca, S., Manglli, A., Mohamed, M. E., El
Siddig, M. A., Tomassoli, L., & El Hussein, A. A. (2014).
Identification and phylogenetic analysis of common pump-
kin viruses in Sudan. Journal of Plant Pathology, 96,77–84.
Moury, B., & Verdin, E. (2012). Viruses of pepper crops in the
Mediterranean Basin: a remarkable stasis. Advances in Virus
Research, 84,127–162.
Nematollahi, S., Bashir, N. S., Rakhshandehroo, F., & Zamanizadeh,
H. R. (2012). Phylogenetic analysis of new isolates of cucum-
ber mosaic virus from Iran on the basis of different genomic
regions. Plant Pathology Journal, 28,381–389.
Ohshima, K., Matsumoto, K., Yasaka, R., Nishiyama, M.,
Soejima, K., Korkmaz, S., Ho, S. Y. W., Gibbs, A. J., &
Takeshita, M. (2016). Temporal analysis of reassortment and
molecular evolution of cucumber mosaic virus: Extra clues
from its segmented genome. Virology, 487,188–197.
Sadikhova, L. (2005). Research and development of the vegetable
system in azerbaijan. In: Increasing Market –oriented vege-
table production in Central Asia and the Caucasus through
collaborative research and development. Workshop
Proceedings, 25-27 April 2005, Tashkent, Uzbekistan.
AVRDC –The World Vegetable Center, Shanhua, Taiwan,
p.29–36.
Sharifi, M., Massumi, H., Heydarnejad, J., Hosseini Pour, A.,
Shaabanian, M., & Rahimian, H. (2008). Analysis of the
biological and molecular variability of Watermelon mosaic
virus isolates from Iran. Virus Genes, 37,304–313.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S.
(2013). MEGA6: Molecular evolutionary genetics anal-
ysis version 6.0. Molecular Biology and Evolution, 30,
2725–2729.
Verdin, E., Desbiez, C., Wipf-Scheibel, C., Gognalons, P., Kheyr-
Pour, A., Gronenborn, B., Mirzayeva, S., Sultanova, N.,
Mammadov, A., & Huseynova, I. (2018). First report of
tomato yellow leaf curl virus infecting tomato in
Azerbaijan. Journal of Plant Pathology, 100,335.
https://doi.org/10.1007/s42161-018-0050-x.
Wyatt, S. D., & Brown, J. K. (1996). Detection of subgroup III
geminiviruses isolates in leaf extracts by degenerate
primers and polymerase chain reaction. Phytopathology,
86,1288–1293.
Eur J Plant Pathol
Author's personal copy