Available via license: CC BY 4.0
Content may be subject to copyright.
RESEARCH ARTICLE
Evaluation of costimulatory molecules in dogs
with B cell high grade lymphoma
Michihito Tagawa
1
*, Chihiro Kurashima
1
, Satoshi Takagi
2
, Naoya Maekawa
3
,
Satoru Konnai
3
, Genya Shimbo
1
, Kotaro Matsumoto
4
, Hisashi Inokuma
4
,
Keiko Kawamoto
5
, Kazuro Miyahara
1
1Veterinary Medical Center, Obihiro University of Agriculture and Veterinary Medicine, Obihiro, Hokkaido,
Japan, 2Department of Veterinary Clinical Sciences, Faculty of Veterinary Medicine, Hokkaido University,
Veterinary Teaching Hospital, Sapporo, Hokkaido, Japan, 3Department of Disease Control, Faculty of
Veterinary Medicine, Hokkaido University, Sapporo, Hokkaido, Japan, 4Department of Clinical Veterinary
Science, Obihiro University of Agriculture and Veterinary Medicine, Obihiro, Hokkaido, Japan, 5Research
Center for Global Agromedicine, Obihiro University of Agriculture and Veterinary Medicine, Obihiro, Hokkaido,
Japan
*mtagawa@obihiro.ac.jp
Abstract
B cell high grade lymphoma is the most common hematopoietic malignancy in dogs.
Although the immune checkpoint molecules, programmed death-1 (PD-1) and cytotoxic T-
lymphocyte-associated antigen-4 (CTLA-4), and immune checkpoint inhibitors have been
evaluated for the treatment of various human lymphoid malignancies, the expression of
those molecules and their relationship with prognosis remain unknown in canine lymphoma.
The objective of this study was to evaluate the expression of costimulatory molecules on
peripheral blood lymphocytes and tumor infiltrating lymphocytes, in addition to associated
ligand expression in the lymph nodes of patients with B cell multicentric high grade lym-
phoma. Eighteen patients diagnosed with B cell high grade lymphoma and nine healthy con-
trol dogs were enrolled. Flow cytometric analysis revealed that the expression of PD-1 on
CD4+ peripheral and tumor infiltrating lymphocytes and CTLA-4 on CD4+ peripheral lym-
phocytes was significantly higher in the lymphoma group than in the control group. The
expression level of CD80 mRNA was significantly lower in the lymphoma group than in the
control group. In contrast, there were no significant differences in PD-L1,PD-L2, and CD86
expression between the groups. Dogs with CTLA-4 levels below the cutoff values, which
were determined based on receiver operating characteristic curves, on peripheral CD4+,
CD8+, and tumor infiltrating CD4+ lymphocytes had significantly longer survival than dogs
with values above the cutoff. Although it is uncertain whether the expression of immune
checkpoint molecules affect the biological behavior of canine lymphoma, one possible
explanation is that PD-1 and CTLA-4 might be associated with the suppression of antitumor
immunity in dogs with B cell high grade lymphoma, particularly through CD4+ T cells.
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 1 / 14
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Tagawa M, Kurashima C, Takagi S,
Maekawa N, Konnai S, Shimbo G, et al. (2018)
Evaluation of costimulatory molecules in dogs with
B cell high grade lymphoma. PLoS ONE 13(7):
e0201222. https://doi.org/10.1371/journal.
pone.0201222
Editor: Kristy L. Richards, Cornell University,
UNITED STATES
Received: March 19, 2018
Accepted: July 11, 2018
Published: July 24, 2018
Copyright: ©2018 Tagawa et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information
files.
Funding: The authors received no specific funding
for this work.
Competing interests: The authors have declared
that no competing interests exist.
Introduction
Lymphoma is one of the most frequently occurring malignant neoplasms in dogs, and
accounts for approximately 7–24% of all canine neoplasms and 83% of all hematopoietic
malignancies [1]. The multicentric form of B cell lymphoma is most common, with a high per-
centage of cases involving the lymphoreticular system, which includes the lymph nodes, liver,
spleen, and bone marrow [2]. Various combination chemotherapies have been reported to
induce remission in approximately 80–95% of dogs; however, the majority of dogs will relapse
within one year of starting treatment and overall median survival times are limited to 10–12
months [1,3]. Specifically, diffuse large B cell lymphoma (DLBCL) is the most common sub-
type of the canine multicentric form of B cell lymphoma, and its relevance as a spontaneous
model for human DLBCL has been confirmed by molecular and morphological approaches
[4].
T cell functions are regulated by several immune checkpoint molecules [5]. Programmed
cell death 1 (PD-1) is an immune checkpoint molecule that is expressed on both activated and
exhausted T cells. PD-1 has two ligands, namely PD-L1 (B7-H1) and PD-L2 (B7-DC). PD-L1
is widely expressed on non-hematopoietic cells including tumor cells and antigen-presenting
cells, whereas PD-L2 expression is restricted to B cells, macrophages, and dendritic cells [6].
The interactions between PD-1 and PD-Ls provide a negative stimulus for antigen-induced T
cell activation [7]. Cytotoxic T-lymphocyte antigen-4 (CTLA-4), which is expressed on the sur-
face of activated T lymphocytes, is another immune checkpoint molecule that transmits signals
to inhibit T cell activation, through binding to the its ligands, CD80/86, which are expressed
on antigen-presenting cells [8]. These immune checkpoint molecules including PD-1 and
CTLA-4 are highly expressed on tumor infiltrating and peripheral lymphocytes, and their
ligands are up-regulated in many human cancers [9,10]. Immune checkpoint molecules are
believed to represent an important mechanism through which tumor cells evade the host
immune system, and evidence of immune dysregulation has been reported in several human
cancers [9,10,11]. Several reports have demonstrated that the expression of these molecules is
significantly correlated with a worse prognosis [10,11]. In addition, immune checkpoint
inhibitors such as anti-PD-1, anti-PD-L1, and anti-CTLA-4 antibodies have shown promising
effects for several human malignancies [12]. In veterinary medicine, previous studies have
revealed that these immune checkpoint molecules including PD-1 and CTLA-4 are also highly
expressed, with PD-L1 being up-regulated, in several cancers [13,14,15,16].
Recently, several reports have examined the expression of immune checkpoint molecules
on peripheral blood and/or tumor-infiltrating T cells in hematological malignancies, and its
correlation with prognosis has been discussed [17,18,19]. In addition, those inhibitors have
also been evaluated for the treatment of various lymphoid malignancies [17]. PD-1 is expressed
by tumor infiltrating lymphocytes in several types of lymphoma [18] and PD-Ls are also
expressed on lymphoid tumor cells and nonmalignant tumor infiltrating cells, primarily mac-
rophages [19,20]. In addition, it was demonstrated that PD-L1 expression on tumor cells is
correlated with a poor prognosis in B cell malignancies [19]. Several clinical trials of check-
point inhibitors have been conducted, and these have shown remarkable efficacy for some
refractory hematologic malignancies [17]. Recently, canine multicentric high grade lymphoma
has been shown to harbor many similarities to human non-Hodgkin’s lymphoma, and thus it
is considered to be an attractive model for human studies [4,21]. Therefore, these immune
checkpoint molecules might represent new therapeutic targets for the treatment of canine lym-
phoma. However, there are only a few reports regarding immune checkpoint molecules in
dogs with lymphoma, and their association with the disease is relatively unknown [13,14].
The aim of this study was to evaluate the expression of costimulatory molecules on peripheral
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 2 / 14
blood lymphocytes and tumor infiltrating lymphocytes, as well as the expression of their
ligands on tumor cells, from patients with B cell multicentric high grade lymphoma to assess
immune status in these dogs.
Materials and methods
Study population
Eighteen dogs with B cell multicentric high grade lymphoma (lymphoma group) and nine clin-
ically healthy controls (control group) were enrolled in this prospective study. For patients in
the lymphoma group, lymphoma was cytologically or histologically confirmed in a veterinary
medical center at Obihiro University of Agriculture and Veterinary Medicine between Octo-
ber 2015 and August 2017. Staging of lymphoma was performed according to the WHO stag-
ing system [22] including thoracic radiography based on three views, abdominal ultrasound,
and hematological examinations. Substage ‘a’ was defined as no clinical signs and substage ‘b’
was defined as systemic signs related to lymphoma including mild-to-moderate severity of gas-
trointestinal disorders or weight loss. The immunophenotype was determined by PCR antigen
receptor rearrangement using fine needle aspirate (FNA) samples. All dogs received no prior
chemotherapy treatment except for one relapsed case. Dogs in the control group were age-
matched healthy patients who came to the hospital for medical examinations. This study was
approved by the Institutional Animal Care and Use Committees at the Obihiro University of
Agriculture and Veterinary Medicine (Permission number: 27–143, 28–7, and 29–3).
Cell preparation
Heparinized peripheral blood was obtained from all patients and healthy controls. All heparin-
ized blood samples were diluted with an equal volume of 0.9% saline, and peripheral blood
mononuclear cells (PBMCs) were separated by Ficoll-Paque (Lymphoprep; Axis-Shield PoC
AS, Oslo, Norway) density gradient centrifugation [23]. Following centrifugation at 800 ×g
for 20 min at room temperature, PBMCs were collected and washed twice with 0.9% saline.
FNA samples were taken from palpable lymph nodes, and lymph nodes cells (LNCs) were sus-
pended in 500 μl of saline. LNCs were centrifuged for 15 min at 1,500 rpm, and the superna-
tant was discarded. Cells were resuspended in 1 ml of VersaLyse (Beckman Coulter, Marseille
Cedex, France) and incubated for 5 min at room temperature in the dark. Following centrifu-
gation, LNCs were washed and resuspended in 0.9% saline.
Flow cytometric analysis
For flow cytometric analysis, cells were pelleted by centrifugation for 5 min at 1,500 rpm and
washed with phosphate-buffered saline (PBS) containing 10% normal goat serum. Between
0.5 ×10
6
and 1 ×10
6
cells were stained using CD4, CD8, PD-1, and CTLA-4 antibodies for 30
min at 37 ˚C, as previously described [23]. The following antibody conjugates were used: rat
anti-canine CD4 monoclonal antibody (mAb): YKIX302.9 prelabeled with fluorescein isothio-
cyanate; rat anti-canine CD8 mAb: YCATE55.9 prelabeled with r-phycoerythrin (dilution rate
100:2.5, AbD Serotec, Raleigh, NC, USA); mouse anti-human CTLA-4 mAb: ANC152.2 (final
concentration: 0.001 mg/ml, Ancell Corporation, Bayport, MN, USA) [16]; goat anti-human
PD-1 polyclonal antibody (pAb): BAF1086 (0.005 mg/ml, R&D Systems, Minneapolis, MN,
USA) [15,24,25]. Additionally, dye/isotype-matched antibodies were included in all experi-
ments as controls. The cells were immediately analyzed (percentage and mean fluorescence
intensity [MFI]) using BD FACS Cant and FACS Diva software (BD Biosciences, San Jose, CA,
USA). Lymphocytes were first gated through forward and side scatter and then PD-1 and
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 3 / 14
CTLA-4 expression was analyzed in CD4+ and CD8+ lymphocytes populations. A minimum
of 10,000 cells were analyzed for each sample. Detection limits were set based on the isotype
controls such that less than 1% of cells were positive. (S1 Fig).
RNA extraction and cDNA synthesis
Total RNA was isolated from LNCs using TRIzol
1
Reagent (Thermo Fisher Scientific Inc.,
Waltham, MA, USA) according to the manufacturer’s protocol. After the isolation of total
RNA, genomic DNA contamination was removed from the isolated RNA using recombinant
DNase I (TURBO DNA-free™Kit; Thermo Fisher Scientific Inc.) according to the manufactur-
er’s recommended procedure. The RNA concentration was measured using a NanoDrop Lite
(Thermo Fisher Scientific Inc.), and the purity of the extracted RNA was in the range of 1.8–
2.0, as determined by absorbance ratios of A
260
/A
280
. The purified RNA was eluted in nucle-
ase-free water and stored at −80 ˚C until further use.
cDNA was synthesized from 500 ng of total RNA using PrimeScript™RT Master Mix con-
taining Oligo dT primers and random primers (Takara Bio Inc., Kusatsu, Japan) according to
the manufacturer’s protocol.
Quantification of PD-L1,PD-L2,CD80, and CD86 mRNA by real-time
RT-PCR
RT-PCR amplification was performed to measure the levels of PD-L1,PD-L2,CD80, and CD86
mRNA. Primers used for quantitative PCR were designed using Primer3Plus (http://www.
bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi/) based on canine GenBank sequences
or previous reports (Table 1). All primer sets were designed to specifically amplify a region
encompassing two exons of each gene. The NormFinder algorithm (https://www.moma.dk/
normfinder-software) was used to identify the most stable gene among three candidate refer-
ence genes (ACTB,RPL13A, and RPL32) [26], and RPL13A was chosen as the reference gene.
PCR products were subjected to Hokkaido System Science (Sapporo, Japan), and the specifici-
ties of these primers were confirmed by sequencing analysis. Nucleotide sequence results were
confirmed using the BLAST search program (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) for
comparison of other known sequences. Each real-time RT-PCR reaction was performed in a
20-μl total volume, containing 200 nM of each primer, 1 μl of cDNA, and GoTaq qPCR Master
Mix (Promega Corporation, Madison, WI, USA), using a StepOne Real-Time PCR System
(Applied Biosystems, South San Francisco, CA, USA). Initial incubation at 95 ˚C for 2 min
was followed by 40 cycles consisting of denaturation at 95 ˚C for 3 sec and annealing/extension
at 60 ˚C for 30 sec. A melt curve (60–95 ˚C) was generated at the end of each run to verify spec-
ificity. Amplification efficiency for each reaction was tested by the series dilution method.
Absolute quantification of each mRNA was performed by converting sample cycle threshold
values to a concentration (copies/μl), based on standard curves, which were generated using
10-fold serial dilutions (10
7
–10
3
copies/μl) of each gene amplicon. The target amount was then
divided by RPL13A levels to obtain a normalized target value. All samples were evaluated in
triplicate.
Statistical analysis
Sexes within each group were compared using the chi-squared test. Continuous variables such
as age and PD-1 and CTLA-4 parameters were analyzed by performing Mann-Whitney U
tests. Survival time was measured as the interval between the sampling day, usually the start of
treatment, and death due to lymphoma. Dogs alive at the end of the study were censored for
survival analysis. The survival curves were examined by the Kaplan-Meier method, which
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 4 / 14
were compared using the log-rank test. Receiver operating characteristic (ROC) curve analysis
was used to determine the optimal cutoff values of continuous variables used for the prediction
of a survival time exceeding a median value. A minimum area under the curve (AUC) of 0.7
was required for the ROC model to be considered. X
2
Fisher’s exact test was used to evaluate
categorical values. All analyses were performed using JMP 13 (SAS Institute Inc., Cary, NC,
USA). Differences were considered statistically significant if the P value was less than 0.05.
Results
Characteristics of the study population
In the lymphoma group, the median age at sampling was 9.5 years (range, 3–14 years). Eleven
dogs were male (five were castrated) and seven dogs were female (five were spayed). In the
control group, the median age at sampling was 8.5 years (range, 1–12 years). Three dogs were
male (one was castrated) and six dogs were female. There were no significant differences in
terms of age or sex between the two groups. According to WHO staging, one dog was classified
as stage II, five as III, six as IV, and six as V. Eleven dogs were classified as substage a and
seven as b. Only two dogs were treated with prednisolone before sampling. Ten dogs were
treated with a CHOP-based protocol and five dogs with prednisolone alone. The others were
treated with L-asparaginase (as outlined in Table 2). Euthanasia was performed only for one
dog, which was in extremis, and all other cases died naturally. The overall median survival
time was 121 days (range, 1–340 days). Two dogs were still alive at the end of the study, repre-
senting survival of 191 and 208 days.
PD-1 and CTLA-4 expression on T cells from PBMCs and LNCs
PBMCs were available from all dogs, and LNCs were available from 17 of 18 dogs with lym-
phoma and from all nine control dogs. The proportion of PD-1- and CTLA-4-expressing cells
was calculated as the percentage of PD-1+ or CTLA-4+ cells in CD4+ and CD8+ lymphocyte
subtypes for each group. The proportions of PD-1+ cells in CD4+ lymphocyte populations
obtained from PBMCs and LNCs were significantly higher in the lymphoma group (PBMCs,
mean ±standard deviation: 46.67% ±18.52%; LNCs, 61.29% ±16.99%) than in the control
group (PBMCs, 30.79% ±7.18%, P = 0.011, Fig 1A; LNCs, 29.48% ±7.90%, P <0.001, Fig 1C).
Table 1. Primer sequences for canine PD-L1,PD-L2,CD80,CD86,ACTB,RPL13A, and RPL32 genes.
Target gene Primer name Sequence (5’–3’) Product length (bp) GenBank accession No.
PD-L1 f600 TGGCAAAACCACCATCACTA 214 NM001291972
r813 CAGGAAAGGTCCCAGAATCA
PD-L2 F2 AAGACCTCCCAAGGCCTCTA 172 XM847012
R2 CATGAAGCAGCCAGTTTGAA
CD80 FATGGATTACACAGCGAAGTGGAGAA 323 AF106824
RAGGCGCAGAGCCATAATCACGAT
CD86 FATGTATCTCAGATGCACTATGGAAC 221 AF106824
RTTCTCTTTGCCTCTGTATAGCTCGT
ACTB FCCGCGAGAAGATGACCCAGA 237 Z70044
RGTGAGGATCTTCATGAGGTAGTCGG
RPL13A FGCCGGAAGGTTGTAGTCGT 87 AJ388525
RGGAGGAAGGCCAGGTAATTC
RPL32 FTGGTTACAGGAGCAACAAGAA 100 XM848016
RGCACATCAGCAGCACTTCA
https://doi.org/10.1371/journal.pone.0201222.t001
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 5 / 14
Regarding, PD-1 expression in CD8+ lymphocytes obtained from PBMCs and LNCs, there
were no significant differences between the groups (Fig 1B and 1D). The proportion of CTLA-
4+ cells in CD4+ lymphocyte populations obtained from PBMCs was significantly higher in
the lymphoma group (1.40% ±0.92%) than in the control group (0.62% ±0.26%, P = 0.018,
Fig 1E). Regarding CTLA-4 expression in CD8+ lymphocytes obtained from PBMCs and CD4
+ and CD8+ lymphocytes obtained from LNCs, there were no significant differences between
the groups (Fig 1F, 1G and 1H). MFIs of PD-1 on the surface of CD4+ lymphocytes obtained
from PBMCs and LNCs were significantly higher in the lymphoma group (PBMCs,
1169 ±573, P = 0.004; LNCs, 2655 ±1116, P <0.001) than in the control group (PBMCs,
617 ±262; LNCs, 933 ±375; S2 Fig).
PD-L1,PD-L2,CD80, and CD86 mRNA expression levels in LNCs
Based on sequence analysis, PCR products of PD-L1,PD-L2,CD80,CD86,ACTB,RPL13A, and
RPL32 were shown to have 100% identity with each reference gene. By analyzing the linearity
of amplification for successively diluted cDNA, the efficiency for all the reactions was deter-
mined. The slopes ranged from −3.37 to −3.84, the R
2
values ranged from 0.96 to 0.99, and the
efficiencies ranged from 82.1% to 98.0%. The expression levels of PD-L1,PD-L2,CD80, and
CD86 mRNA in LNCs were evaluated by real-time PCR. RNA samples were available from 17
of 18 dogs with lymphoma and for all nine control dogs. The PD-L1 transcript was expressed
in all dogs, whereas PD-L2,CD80, and CD86 were detected in 25 of 26 dogs. The expression
level of CD80 was significantly lower in the lymphoma group than in the control group
(P = 0.004, Fig 2C). In contrast, there were no significant differences in terms of PD-L1,
PD-L2, and CD86 expression between the groups (Fig 2A, 2B and 2D).
Relationship between expression of immune checkpoints and survival time
Optimal cutoff values were determined based on each ROC curve (Table 3). Regarding CTLA-
4 expression on CD4+ and CD8+ lymphocytes, dogs with levels below the cutoff value had sig-
nificantly longer survival time than the dogs with values above the cutoff (CD4+ CTLA-4+ in
Table 2. Clinical parameters of 18 dogs diagnosed with B cell lymphoma.
Clinical parameters Case Percentage (%)
Age
<10 9 50
10 9 50
Sex
Male 11 61.1
Female 7 38.9
Stage
II–III 6 33.3
IV–V 12 66.7
Substage
a 11 61.1
b 7 38.9
Therapy
CHOP-based 10 55.6
L-asparaginase 3 16.7
Prednisolone 5 27.8
https://doi.org/10.1371/journal.pone.0201222.t002
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 6 / 14
PBMCs, median survival times below and above the cutoff = 138 days and 11 days, respec-
tively, P <0.001, Fig 3A; CD8+ CTLA-4+ in PBMCs, 138.5 days and 15.5 days, respectively,
P = 0.002, Fig 3B; CD4+ CTLA-4+ in LNCs, 138 days and 16.5 days, respectively, P = 0.026,
Fig 3C). In addition, for CTLA-4+ cells in CD8+ populations and PD-1+ cells in CD4+ lym-
phocytes obtained from LNCs, dogs with levels below the cutoff value had significantly longer
survival time than dogs with values above the cutoff (CD8+ CTLA-4+ in LNCs, 121 days and
44 days, respectively, P = 0.048; CD4+ PD-1+ in LNCs, 127.5 days and 13 days, respectively,
P = 0.023); however, their AUC values were below 0.7 (data not shown). Except for CD4+ PD-
1+ in LNCs, the expressions of PD-1+ on lymphocytes did not correlate with survival time.
Regarding mRNA expression, no correlation was found with survival time (data not shown).
The clinical features and treatment modality for dogs with each parameter level below or
above the cutoff values are summarized in S1 Table. Higher proportions of CD4+ PD-1+
(P = 0.047), CD4+ CTLA-4+ (P = 0.003), and CD8+ CTLA-4+ (P = 0.013) cells in PBMCs
were significantly correlated with substage b.
Fig 1. Proportion of PD-1+ and CTLA-4+ cells in CD4+ and CD8+ lymphocyte populations from dogs with B cell lymphoma and control animals. Results
were obtained by performing flow cytometry. Each dot represents a patient and the bar represents the median. P values are shown.
https://doi.org/10.1371/journal.pone.0201222.g001
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 7 / 14
Discussion
In this study, we evaluated the expression of immune checkpoint molecules including PD-1
and CTLA-4 and their ligands in canine lymphoma patients. In these lymphoma samples, sig-
nificantly higher expression of CTLA-4 was observed on CD4+ lymphocytes obtained from
PBMCs. In addition, the expression of PD-1 on CD4+ lymphocytes obtained from PBMCs
and LNCs was also significantly higher in the lymphoma group. CTLA-4, a costimulatory
receptor expressed on the surface of activated T cells, is a negative regulator of T cell activation.
Fig 2. Relative quantity of PD-L1,PD-L2,CD80, and CD86 transcript levels in lymph node cells from dogs with B cell lymphoma and control animals.
Expression of each target mRNA was obtained by real-time PCR, normalizing to the target gene RPL13A. Each dot represents a patient and the bar represents the
median. P value is shown. ND, not detected.
https://doi.org/10.1371/journal.pone.0201222.g002
Table 3. Cutoff and area under the curve (AUC) values obtained from receiver operating characteristic (ROC)
curves for each parameter.
Parameters Cutoff AUC 95% CI P value
PBMCs
CD4+ PD-1+ 56.2 0.575 0.261–0.889 0.419
CD8+ PD-1+ 55.2 0.638 0.353–0.922 0.400
CD4+ CTLA-4+ 1.9 0.781 0.538–1.000 0.011
CD8+ CTLA-4+ 1.9 0.806 0.572–1.000 0.021
LNCs
CD4+ PD-1+ 75.9 0.639 0.345–0.932 0.183
CD8+ PD-1+ 38.5 0.861 0.672–1.000 0.003
CD4+ CTLA-4+ 0.9 0.785 0.543–1.000 0.043
CD8+ CTLA-4+ 2.3 0.535 0.235–0.834 0.559
mRNA
PD-L1 182.7 0.500 0.179–0.821 0.228
PD-L2 232.4 0.458 0.133–0.783 0.562
CD80 67.7 0.472 0.164–0.781 0.390
CD86 142.5 0.472 0.161–0.784 0.711
PBMC, peripheral blood mononuclear cells; LNCs, lymph nodes cells.
https://doi.org/10.1371/journal.pone.0201222.t003
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 8 / 14
PD-1 is also an immunoinhibitory receptor expressed by chronically stimulated CD4+ and
CD8+ T cells after T cell activation [8,9]. Up-regulation of the expression of checkpoint regu-
lators plays an important role in the evasion of immune surveillance by malignant cells [17]. In
humans, PD-1 expression has been evaluated in different lymphoma types including B cell
lymphoma [27,28,29,30]. CTLA-4 is highly expressed on tumor-infiltrating lymphocytes in
lymphoid malignancies [31,32]. There have also been some reports on the PD-1/PD-L1 axis in
dogs with different malignancies [13,14,33]. Recently, high expression of PD-1 on tumor
infiltrating T cells was reported in dogs with B and T cell lymphoma [34]. In this study, signifi-
cantly higher expression of PD-1 was observed on CD4+ T cells obtained from LNCs from
dogs with lymphoma, and CD8+ T cells tended to up-regulate these molecules. In addition,
PD-1 expression on peripheral CD4+ T cells obtained from dogs with lymphoma was signifi-
cantly higher compared to that in control animals. In veterinary medicine, although previous
studies revealed high expression of CTLA-4 in dogs with oligodendroglioma and histiocytic
sarcoma [15,16], the expression of this marker in lymphoma had not previously been
reported. We found that CTLA-4 expression on CD4+ T cells obtained from PBMCs was
Fig 3. Kaplan-Meier curves of survival time in dogs with B cell lymphoma according to each cutoff value based on CTLA-4 expression. Expression of each
marker was determined in CD4+ and CD8+ cell populations. Cutoff and P values are shown. + censored case.
https://doi.org/10.1371/journal.pone.0201222.g003
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 9 / 14
significantly higher in the lymphoma group than in the control group. Lymphocytes including
T and B cells are the major cells of the adaptive immune system. CD8+ T cells destroy virus-
infected cells and tumor cells. CD4+ T lymphocytes have no cytotoxic or phagocytic activity
and cannot kill infected cells or clear pathogens; however, they do manage the immune
response by directing other cells to perform these tasks [35]. This study suggested that PD-1
and CTLA-4 might be associated with the suppression of antitumor immunity in dogs with B
cell lymphoma, and particularly through CD4+ T cells.
To further evaluate the immune checkpoint pathway, mRNA expression levels of PD-L1,
PD-L2,CD80, and CD86 were measured in LNCs. Although there was no significant differ-
ence, PD-L1 expression was variable between the lymphoma group and the control group.
Maekawa et al. observed that canine DLBCL samples did not express PD-L1 [13]. Shosu and
Kumar et al. reported the expression of PD-L1 in few lymphoma tissues and cell lines [14,33].
Our results are in agreement with those from the previous reports. In humans, the proportion
of DLBCL tumor cells that express PD-L1 was ranged from 10.0 to 49.0% [36,37]. Further
studies are needed to clarify the expression of PD-L1 and the role of the PD-1/PD-L1 axis in
canine B cell lymphoma using a large sample size. Interestingly, low expression of CD80 was
observed in canine lymphoma samples. CD80, also known as B7.1, is a coregulatory receptor
expressed on the surface of antigen presenting cells, activated T cells, and myeloid-derived
suppressor cells. Full activation of T cells requires binding of the CD28 receptor by CD80 or
CD86 on antigen-presenting cells [38]. It was reported that CD80 is expressed in the majority
of human DLBCL cases and is also present on nonmalignant stromal cells [39]. In contrast,
one study revealed that acute lymphoblastic leukemia cells have low expression of costimula-
tory molecules including CD80 and suggested that this probably contributes to the absence of
a host T cell-stimulated immune response [40]. This is the first report of the evaluation of
CD80 expression in canine B cell lymphomas. Further understanding of the expression of this
marker, as well as other immune coregulatory molecules that control immune cell function,
will be needed to better understand the complexity and functional implications of the tumor
microenvironment in canine B cell high grade lymphoma.
In this study, CTLA-4 expression on peripheral CD4+ and CD8+ lymphocytes and CD4
+ lymphocytes obtained from LNCs was found to be associated with poor prognosis in canine
B cell high grade lymphomas. Especially, high expression of CTLA-4 in PBMCs was signifi-
cantly correlated with substage b, which has been identified as an indicator of poor prognosis.
Although the prognostic role and clinical application of CTLA-4 in tumors are still controver-
sial, increased CTLA-4 expression on T cells contributes to poor prognosis in various cancers
including DLBCL [41,42]. In addition, CTLA-4 is a negative immunomodulatory factor that
is known to be expressed by effector regulatory T cells, which mainly suppress antitumor
immunity, but not by non-Tregs [41]. It was thought that expression of CTLA-4 on T cells
might be associated with a worse prognosis and might represent a prognostic factor for canine
B cell high grade lymphoma. In contrast, PD-1 expression on peripheral and tumor infiltrating
T cells was not associated with prognosis. In humans, the relationship between PD-1 expres-
sion and prognosis in lymphoid malignancies is also complex [43]. To the best of our knowl-
edge, this is the first report to explore the relationship between immune checkpoint molecules
and B cell lymphoma prognosis in dogs. However, we did not control for treatment and stage/
substage for each analysis, and the small sample size of this study might affects the reliability of
the results. Further studies using larger cohorts and controlled patients are needed to evaluate
the association between immune checkpoint molecule expression and prognosis in canine B
cell high grade lymphomas.
PD-1-and CTLA-4-blocking antibodies (ipilimumab and nivolumab) were shown to pro-
duce robust responses and improve overall survival in human patients with various lymphoid
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 10 / 14
malignancies [43]. Interestingly, in canine visceral leishmaniasis, high level of PD-1 on T cells
and in vitro efficacy of monoclonal antibodies that block PD-1 and its ligands have been
reported [24,25]. Recently, in veterinary medicine, a pilot study demonstrated promising anti-
cancer activity with tolerable toxicity profiles using an anti-PD-L1 antibody for canine malig-
nancies [44]. The results of the present study indicated that such immunotherapy regimens
might also be effective for patients with canine B cell high grade lymphoma.
Several limitations should be noted when interpreting the results of this study. First, the
small sample size for each analysis might limit the power to detect differences between groups.
Therefore, our findings should be verified in a larger population, as this study represents a
pilot study. Second, the treatment modality for the dogs with lymphoma was not unified. A
future prospective study using standardized treatment is thus necessary for adequate evalua-
tion. Another limitation of our method is the lack of protein quantification of the immune
checkpoint ligands. Finally, it remains unclear whether the expression of immune checkpoint
molecules on tumor cells or other nonmalignant cells is associated with the anti-tumor
immune response and clinical outcome in canine lymphoma patients. Future functional analy-
ses are necessary to elucidate the complex roles of this pathway.
In summary, this study indicates that PD-1 expression is up-regulated on both peripheral
and tumor infiltrating T cells and that CTLA-4 expression is up-regulated on CD4+ T cells
from peripheral blood obtained from dogs with B cell high grade lymphoma. CTLA-4 expres-
sion on T cells was also associated with a poor prognosis. Our findings support the hypothesis
that these molecules might represent new therapeutic targets for the treatment of canine B cell
high grade lymphoma, and could serve as prognostic factors. Future investigations and clinical
trials are needed to develop therapeutic strategies based on the mechanisms of immune check-
point molecule-induced tumor immune evasion and the modulation of host immune
responses for canine B cell high grade lymphoma.
Supporting information
S1 Fig. Analysis of a PBMC sample for PD-1 expression in the CD4+ and CD8+ lymphocyte
gate. A representative sample of forward versus side scatter identified the predominant lym-
phocyte population captured in region P1. The proportions of CD4 (P2) and CD8 (P3) cells in
P1 are indicated (A). The proportions of PD-1 expression cells in P2 and P3 are indicated in
the middle panels (B). The under panels show each isotype control (C). SSC, side scatter; FSC,
forward scatter; PE, phycoerythrin; FITC, fluorescein isothiocyanate; APC, allophycocyanin.
(TIF)
S2 Fig. MFI of PD-1+ and CTLA-4+ cells in CD4+ and CD8+ lymphocyte populations
from dogs with B cell lymphoma and control animals. Each dot represents a patient and the
bar represents the median. P values are shown.
(TIF)
S1 Table. Clinical features and treatment modality comparisons between dogs with each
parameter level below and above the cutoff values. Chemotherapy included CHOP-based
and L-asparaginase.
(XLSX)
Acknowledgments
We thank the veterinary technicians at the veterinary medical center of Obihiro University of
Agriculture and Veterinary Medicine for assistance with sample collection.
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 11 / 14
Author Contributions
Conceptualization: Michihito Tagawa.
Data curation: Chihiro Kurashima.
Formal analysis: Michihito Tagawa.
Investigation: Michihito Tagawa, Chihiro Kurashima.
Methodology: Michihito Tagawa, Chihiro Kurashima, Naoya Maekawa, Kotaro Matsumoto,
Keiko Kawamoto.
Supervision: Satoshi Takagi, Naoya Maekawa, Satoru Konnai, Genya Shimbo, Kotaro Matsu-
moto, Hisashi Inokuma, Keiko Kawamoto, Kazuro Miyahara.
Validation: Satoshi Takagi, Naoya Maekawa, Satoru Konnai, Genya Shimbo, Kotaro Matsu-
moto, Hisashi Inokuma, Keiko Kawamoto, Kazuro Miyahara.
Writing – original draft: Michihito Tagawa.
Writing – review & editing: Michihito Tagawa.
References
1. Vail DM, Pinkerton ME, Young KM: Hematopoietic tumors. In: Withrow SJ, Vail DM, editors. Withrow
and MacEwen’s Small Animal Clinical Oncology. 5th ed: Saunders Elsevier, St Louis, MO, 2013. pp.
608–678.
2. Siedlecki CT, Kass PH, Jakubiak MJ, Dank G, Lyons J, Kent MS. Evaluation of an actinomycin-D-con-
taining combination chemotherapy protocol with extended maintenance therapy for canine lymphoma.
Can Vet J. 2006; 47: 52–59. PMID: 16536229
3. Lenz JA, Robat CS, Stein TJ. Vinblastine as a second rescue for the treatment of canine multicentric
lymphoma in 39 cases (2005 to 2014). J Small Anim Pract. 2016; 57: 429–434. https://doi.org/10.1111/
jsap.12500 PMID: 27251593
4. Aresu L. Canine Lymphoma, More Than a Morphological Diagnosis: What We Have Learned about Dif-
fuse Large B-Cell Lymphoma. Front Vet Sci. 2016; 3: 77. https://doi.org/10.3389/fvets.2016.00077
PMID: 27630997
5. Greenwald RJ, Freeman GJ, Sharpe AH. The B7 family revisited. Annu Rev Immunol. 2005; 23: 515–
548. https://doi.org/10.1146/annurev.immunol.23.021704.115611 PMID: 15771580
6. Keir ME, Butte MJ, Freeman GJ, Sharpe AH. PD-1 and its ligands in tolerance and immunity. Annu Rev
Immunol. 2008; 26: 677–704. https://doi.org/10.1146/annurev.immunol.26.021607.090331 PMID:
18173375
7. Folkl A, Bienzle D. Structure and function of programmed death (PD) molecules. Vet Immunol Immuno-
pathol. 2010; 15: 33–38.
8. Wu¨lfing C, Tunbridge HM, Wraith DC. New inhibitory signaling by CTLA-4. Nat Immunol. 2014; 15:
408–409. https://doi.org/10.1038/ni.2870 PMID: 24747703
9. Topalian SL, Drake CG, Pardoll DM. Immune checkpoint blockade: a common denominator approach
to cancer therapy. Cancer Cell. 2015; 27: 450–461. https://doi.org/10.1016/j.ccell.2015.03.001 PMID:
25858804
10. Waki K, Yamada T, Yoshiyama K, Terazaki Y, Sakamoto S, Matsueda S, et al. PD-1 expression on
peripheral blood T-cell subsets correlates with prognosis in non-small cell lung cancer. Cancer Sci.
2014; 105: 1229–1235. https://doi.org/10.1111/cas.12502 PMID: 25117757
11. Nakanishi J, Wada Y, Matsumoto K, Azuma M, Kikuchi K, Ueda S. Overexpression of B7-H1 (PD-L1)
significantly associates with tumor grade and postoperative prognosis in human urothelial cancers.
Cancer Immunol. Immunother. 2007; 56: 1173–1182 https://doi.org/10.1007/s00262-006-0266-z
PMID: 17186290
12. Callahan MK, Postow MA, Wolchok JD. Targeting T cell co-receptors for cancer therapy. Immunity.
2016; 44: 1069–1078. https://doi.org/10.1016/j.immuni.2016.04.023 PMID: 27192570
13. Maekawa N, Konnai S, Okagawa T, Nishimori A, Ikebuchi R, Izumi Y, et al. Immunohistochemical Anal-
ysis of PD-L1 Expression in Canine Malignant Cancers and PD-1 Expression on Lymphocytes in
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 12 / 14
Canine Oral Melanoma. PLoS One. 2016; 11: e0157176. https://doi.org/10.1371/journal.pone.0157176
PMID: 27276060
14. Shosu K, Sakurai M, Inoue K, Nakagawa T, Sakai H, Morimoto M, et al. Programmed Cell Death Ligand
1 Expression in Canine Cancer. In Vivo. 2016; 30: 195–204. PMID: 27107075
15. Filley A, Henriquez M, Bhowmik T, Tewari BN, Rao X, Wan J, et al. Immunologic and gene expression
profiles of spontaneous canine oligodendrogliomas. J Neurooncol. 2018 Jan 12. https://doi.org/10.
1007/s11060-018-2753-4 PMID: 29330750
16. Tagawa M, Maekawa N, Konnai S, Takagi S. Evaluation of Costimulatory Molecules in Peripheral
Blood Lymphocytes of Canine Patients with Histiocytic Sarcoma. PLoS One. 2016; 11: e0150030.
https://doi.org/10.1371/journal.pone.0150030 PMID: 26901565
17. Thanarajasingam G, Thanarajasingam U, Ansell SM. Immune checkpoint blockade in lymphoid malig-
nancies. FEBS J. 2016; 283: 2233–2244. https://doi.org/10.1111/febs.13668 PMID: 26807978
18. Bryan LJ, Gordon LI. Blocking tumor escape in hematologic malignancies: the anti-PD-1 strategy.
Blood Rev. 2015; 29: 25–32. https://doi.org/10.1016/j.blre.2014.09.004 PMID: 25260226
19. Kiyasu J, Miyoshi H, Hirata A, Arakawa F, Ichikawa A, Niino D, et al. Expression of programmed cell
death ligand 1 is associated with poor overall survival in patients with diffuse large B-cell lymphoma.
Blood. 2015; 126: 2193–2201. https://doi.org/10.1182/blood-2015-02-629600 PMID: 26239088
20. Rosenwald A, Wright G, Leroy K, Yu X, Gaulard P, Gascoyne RD, et al. Molecular diagnosis of primary
mediastinal B cell lymphoma identifies a clinically favorable subgroup of diffuse large B cell lymphoma
related to Hodgkin lymphoma. J Exp Med. 2003; 198: 851–862. https://doi.org/10.1084/jem.20031074
PMID: 12975453
21. Vail DM, MacEwen EG. Spontaneously occurring tumors of companion animals as models for human
cancer. Cancer Invest. 2000: 18: 781–792. PMID: 11107448
22. Owen LN. TNM Classification of Tumours in Domestic Animals, World Health Organization, Geneva,
Switzerland; 1980
23. Rydbirk R, Folke J, Winge K, Aznar S, Pakkenberg B, Brudek T. Assessment of brain reference genes
for RT-qPCR studies in neurodegenerative diseases. Sci Rep. 2016; 6:37116. https://doi.org/10.1038/
srep37116 PMID: 27853238
24. Esch KJ, Juelsgaard R, Martinez PA, Jones DE, Petersen CA. Programmed death 1-mediated T cell
exhaustion during visceral leishmaniasis impairs phagocyte function. J Immunol. 2013; 191: 5542–
5550. https://doi.org/10.4049/jimmunol.1301810 PMID: 24154626
25. Chiku VM, Silva KL, de Almeida BF, Venturin GL, Leal AA, de Martini CC, et al. PD-1 function in apopto-
sis of T lymphocytes in canine visceral leishmaniasis. Immunobiology. 2016: 221: 879–888. https://doi.
org/10.1016/j.imbio.2016.03.007 PMID: 27016050
26. Peters IR, Peeters D, Helps CR, Day MJ. Development and application of multiple internal reference
(housekeeper) gene assays for accurate normalisation of canine gene expression studies. Vet Immunol
Immunopathol. 2007; 117: 55–66. https://doi.org/10.1016/j.vetimm.2007.01.011 PMID: 17346803
27. Xu-Monette ZY, Zhou J, Young KH. PD-1 expression and clinical PD-1 blockade in B-cell lymphomas.
Blood. 2018; 131: 68–83. https://doi.org/10.1182/blood-2017-07-740993 PMID: 29118007
28. Bai JF, Zuo MX, Zhang Y, Feng J, Han X, Zhou DB, et al. PD-1 expression on the surface of peripheral
blood CD4+ T cell and its association with the prognosis of patients with peripheral T/NK cell lymphoma.
Zhonghua Xue Ye Xue Za Zhi. 2016; 37: 916–918. PMID: 27801329
29. Zhang W, Bai JF, Zuo MX, Cao XX, Chen M, Zhang Y, et al. PD-1 expression on the surface of periph-
eral blood CD4+ T cell and its association with the prognosis of patients with diffuse large B-cell lym-
phoma. Cancer Med. 2016; 5: 3077–3084. https://doi.org/10.1002/cam4.874 PMID: 27709793
30. Yang ZZ, Grote DM, Ziesmer SC, Xiu B, Novak AJ, Ansell SM. PD-1 expression defines two distinct T-
cell sub-populations in follicular lymphoma that differentially impact patient survival. Blood Cancer J.
2015; 5: e281. https://doi.org/10.1038/bcj.2015.1 PMID: 25700246
31. Motta M, Rassenti L, Shelvin BJ, Lerner S, Kipps TJ, Keating MJ, et al. Increased expression of CD152
(CTLA-4) by normal T lymphocytes in untreated patients with B-cell chronic lymphocytic leukemia. Leu-
kemia. 2005; 19: 1788–1793. https://doi.org/10.1038/sj.leu.2403907 PMID: 16094420
32. Yang ZZ, Novak AJ, Stenson MJ, Witzig TE, Ansell SM. Intratumoral CD4+CD25+ regulatory T-cell-
mediated suppression of infiltrating CD4+ T cells in B-cell non-Hodgkin lymphoma. Blood. 2006; 107:
3639–3646. https://doi.org/10.1182/blood-2005-08-3376 PMID: 16403912
33. Kumar SR, Kim DY, Henry CJ, Bryan JN, Robinson KL, Eaton AM. Programmed death ligand 1 is
expressed in canine B cell lymphoma and downregulated by MEK inhibitors. Vet Comp Oncol. 2017;
15: 1527–1536. https://doi.org/10.1111/vco.12297 PMID: 28111882
34. Hartley G, Elmslie R, Dow S, Guth A. Checkpoint molecule expression by B and T cell lymphomas in
dogs. Vet Comp Oncol. 2018 Jan 30. https://doi.org/10.1111/vco.12386 PMID: 29380929
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 13 / 14
35. Kamphorst AO, Ahmed R. CD4 T-cell immunotherapy for chronic viral infections and cancer. Immuno-
therapy. 2013; 5: 975–987. https://doi.org/10.2217/imt.13.91 PMID: 23998732
36. Panjwani PK, Charu V, DeLisser M, Molina-Kirsch H, Natkunam Y, Zhao S. Programmed death-1
ligands PD-L1 and PD-L2 show distinctive and restricted patterns of expression in lymphoma subtypes.
Hum Pathol. 2018; 71: 91–99. https://doi.org/10.1016/j.humpath.2017.10.029 PMID: 29122656
37. Hu LY, Xu XL, Rao HL, Chen J, Lai RC, Huang HQ, et al. Expression and clinical value of programmed
cell death-ligand 1 (PD-L1) in diffuse large B cell lymphoma: a retrospective study. Chin J Cancer.
2017; 36: 94. https://doi.org/10.1186/s40880-017-0262-z PMID: 29246182
38. Wu¨lfing C, Tunbridge HM, Wraith DC. New inhibitory signaling by CTLA-4. Nat Immunol. 2014; 15:
408–409. https://doi.org/10.1038/ni.2870 PMID: 24747703
39. Dakappagari N, Ho SN, Gascoyne RD, Ranuio J, Weng AP, Tangri S. CD80 (B7.1) is expressed on
both malignant B cells and nonmalignant stromal cells in non-Hodgkin lymphoma. Cytometry B Clin
Cytom. 2012; 82: 112–119. https://doi.org/10.1002/cyto.b.20631 PMID: 22076940
40. Luczyński W, Stasiak-Barmuta A, Iłendo E, Kovalchuk O, Krawczuk-Rybak M, Malinowska I, et al. Low
expression of costimulatory molecules and mRNA for cytokines are important mechanisms of immuno-
suppression in acute lymphoblastic leukemia in children? Neoplasma. 2006; 53: 301–304. PMID:
16830056
41. Nakayama S, Yokote T, Akioka T, Hiraoka N, Nishiwaki U, Miyoshi T, et al. Infiltration of effectorregula-
tory T cells predicts poor prognosis of diffuse large B-cell lymphoma, not otherwise specified. Blood
Adv. 2017; 1: 486–493. https://doi.org/10.1182/bloodadvances.2016000885 PMID: 29296965
42. Hu P, Liu Q, Deng G, Zhang J, Liang N, Xie J, et al. The prognostic value of cytotoxic T-lymphocyte anti-
gen 4 in cancers: a systematic review and meta-analysis. Sci Rep. 2017; 7: 42913. https://doi.org/10.
1038/srep42913 PMID: 28211499
43. Hude I, Sasse S, Engert A, Bro
¨ckelmann PJ. The emerging role of immune checkpoint inhibition in
malignant lymphoma. Haematologica. 2017; 102: 30–42. https://doi.org/10.3324/haematol.2016.
150656 PMID: 27884973
44. Maekawa N, Konnai S, Takagi S, Kagawa Y, Okagawa T, Nishimori A, et al. A canine chimeric monoclo-
nal antibody targeting PD-L1 and its clinical efficacy in canine oral malignant melanoma or undifferenti-
ated sarcoma. Sci Rep. 2017; 7: 8951. https://doi.org/10.1038/s41598-017-09444-2 PMID: 28827658
Costimulation in dogs with B cell lymphoma
PLOS ONE | https://doi.org/10.1371/journal.pone.0201222 July 24, 2018 14 / 14
