Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for Diabetes

Abstract

Insulin and IGF signaling require a family of scaffold proteins, also called as Insulin Receptor Substrate (IRS) proteins to integrate extracellular signals into intracellular responses, leading to cellular effects. Two main IRS proteins in humans are IRS1 and IRS2 and are widely expressed in most human and mammalian tissues. In this study, IRS1, IRS2, GLUT4 gene expression is quantified in Umbilical Cord (UC) cell line by semi quantitative- PCR. The internal control β-actin was used to normalize the IRS1, IRS2, GLUT4 gene expression levels. This is the first example of UC cells being induced by a ligand in expressing genes that regulate glucose and insulin levels. Metadichol® treatment at different concentrations on UC cells showed upregulation of IRS1, IRS2 and GLUT4. 100 pg/mL concentrations showed the highest upregulation of IRS1, IRS2 and GLUT4 expression. 1 ng and 100 ng/mL treatment showed marginal. Metadichol® is in addition a TNF alpha inhibitor and also inhibits Plasminogen Activation Inhibitor (PAI1) also known as SERPINE1. These genes play an important role in diabetes. The experimental results fully correlated with curated literature data using Bioinformatics software. Network analysis show the uniqueness of shared genes, IRS1, IRS2, GLUT4, TNF, PAI1, acting through multiple pathways that target multiple diseases.

Full text

Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Open Access
Research Article
Journal of
Stem Cell Research & Therapy
J
o
u
r
n
a
l
o
f
S
t
e
m
C
e
l
l
R
e
s
e
a
r
c
h
&
T
h
e
r
a
p
y
ISSN: 2157-7633
Raghavan, J Stem Cell Res Ther 2018, 8:6
DOI: 10.4172/2157-7633.1000429
Abstract
Insulin and IGF signaling require a family of scaffold proteins, also called as Insulin Receptor Substrate (IRS)
proteins to integrate extracellular signals into intracellular responses, leading to cellular effects. Two main IRS proteins
in humans are IRS1 and IRS2 and are widely expressed in most human and mammalian tissues. In this study, IRS1,
IRS2, GLUT4 gene expression is quantied in Umbilical Cord (UC) cell line by semi quantitative- PCR. The internal
control β-actin was used to normalize the IRS1, IRS2, GLUT4 gene expression levels. This is the rst example of UC
cells being induced by a ligand in expressing genes that regulate glucose and insulin levels. Metadichol® treatment
at different concentrations on UC cells showed upregulation of IRS1, IRS2 and GLUT4. 100 pg/mL concentrations
showed the highest upregulation of IRS1, IRS2 and GLUT4 expression. 1 ng and 100 ng/mL treatment showed
marginal. Metadichol® is in addition a TNF alpha inhibitor and also inhibits Plasminogen Activation Inhibitor (PAI1) also
known as SERPINE1. These genes play an important role in diabetes. The experimental results fully correlated with
curated literature data using Bioinformatics software. Network analysis show the uniqueness of shared genes, IRS1,
IRS2, GLUT4, TNF, PAI1, acting through multiple pathways that target multiple diseases.
Umbilical Cord Cells Treatment with Metadichol IRS Proteins and GLUT4
Expression and Implications for Diabetes
Palayakotai R Raghavan*
Nanorx Inc., PO Box 131, Chappaqua, NY 10514, USA
*Corresponding author: Palayakotai R Raghavan, Nanorx Inc., PO Box 131,
Chappaqua, NY 10514, USA, Tel: 9146710224; E-mail: raghavan@nanorxinc.com
Received May 31, 2018; Accepted June 12, 2018; Published June 18, 2018
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol®
IRS Proteins and GLUT4 Expression and Implications for diabetes. Stem Cell Res
Ther 8: 429. doi: 10.4172/2157-7633.1000429
Copyright: © 2018 Raghavan PR. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and
source are credited.
Keywords: GLUT4; Genes; Diabetes; Glucose uptake; GSK3, IGF1,
PI#K
Abbreviations: IRS: Insulin Receptor Substrate; UC: Umbilical
Cord; PAI: Plasminogen Activation Inhibitor; UBC: Umbilical Cord
Blood; MSC: Mesenchymal Stem Cell; T2DM: Type 2 Diabetes Mellitus;
AKT: Protein Kinase B; PBMCs: Peripheral Blood Mononuclear Cells;
IR: Insulin Resistance; PCR: Polymerase Chain Reaction
Introduction
e increased incidence of Diabetes Mellitus (DM) worldwide
reinforces the search for new approaches to prevent the progression
of diabetes and its complications [1]. Stem cells are the next frontier
in medicine. Stem cells are thought to have signicant therapeutic and
biotechnological potential [2]. Stem cell therapy will not only replace
damaged or dysfunctional cells but deliver therapeutic proteins aer
they have been engineered to do so. is eld is paving the way for
novel therapeutic interventions through cellular therapies and tissue
engineering approaches that are reshaping the biomedical field. e
remarkable exibility of different cell subsets obtained from human
embryonic and adult tissues from sources like bone marrow, UC useful
in evaluating these cells in the treatment of diabetes and its complications
and hold great promise for pancreatic beta cell replacement therapy for
diabetes. Umbilical Cord Blood (UBC) contains Mesenchymal Stem
Cells (MSCs) that are precursors of certain types of cells (e.g., bone,
cartilage, fat or muscle) [3-5].
MSCs are multipotent stromal cells that can differentiate into
a variety of cell types which have been shown to improve metabolic
control [6] in experimental models of Type 2 Diabetes (T2D). A recently
published study by Si [7] showed that infusion of autologous MSCs
managed to improve hyperglycemia in T2D rats. Benecial effects of
MSC therapy resulted in enhanced insulin sensitivity via increased
signaling of IRS1. Also, AKT (Protein kinase B PKB) phosphorylation
leads to translocation of GLUT4 or also known as SLC2A4 (glucose
transporter type 4) on cell membrane upon insulin administration in
the muscle, liver, and adipose tissue of MSC treated animals [8,9].
ere are several problems that limit the use of MSCs for diabetes
therapy [10]. Mottaghi [11] showed that poor engrament and limited
differentiation under in vivo conditions are major obstacles for ecient
therapeutic use of MSCs. Hyperglycemia leads to reactive oxygen
species overproduction which triggers apoptosis and thereby decreases
MSC viability aer transplantation.
Another large accessible source of adult stem cells is Peripheral
Blood Mononuclear Cells (PBMCs). It can be frozen and stored for
later use. PBMCs contain many different progenitor cell types and are
expandable as they can be cultured and reprogrammed to produce
Induced Pluripotent Stem Cells (iPSCs) [12] for clinical applications in
regenerative medicine.
Blood glucose concentration is tightly regulated in humans. GLUT4
is what maintains whole-body glucose homeostasis. Both insulin and
exercise acutely stimulate GLUT4 recruitment to the cell surfaces of
muscle and adipose cells independent of transcription or translation
[13]. Insulin and IGF signaling requires a family of IRS proteins to
integrate extracellular signals into intracellular responses, leading to
cellular effects [14]. ere are two main IRS proteins in humans, IRS1
and IRS2, that are widely expressed in most human and mammalian
tissues. IRS1 and IRS2 mediate the control of various cellular processes
by insulin [15]. Insulin binding to the α-subunit of the insulin receptor
results in the phosphorylation of IRS1 and IRS2 which leads, via several
intermediary steps, to activation of AKT (protein kinase B) [16].
Insulin Resistance (IR) can result from decits in any part of the insulin
signaling pathway resulting in inadequate response to insulin [17].

Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 2 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
We have recently shown that UBC treatment with Metadichol,
a nano-formulation of long chain lipid alcohols derived from food
sources [18] at picogram levels leads to enriched cells containing CD34
[19]. We present here data that treating UBC cells with Metadichol at
low concentrations leads to multifold increases of IRS1 and IRS2 and
also GLUT4 expressions that potentially have a role as discussed above
in diabetes.
Experimental
e work was commerically outsourced and carried out by Skanda
Life Sciences Pvt. Ltd Bangalore India and Primers (Table 1) synthesized
at Eurons Genomics, India.
Preparation of test samples
Metadichol (5 mg/mL) stock was diluted to obtain desired
concentrations of 0.001, 0.1, 1, 100, 1000 ng/mL test solutions.
Cell lines and treatment
UC cells were cultured in MSC expansion medium with reduced
Serum, 100 units/mL of penicillin G and 100 µg/mL of Streptomycin at
37°C, 5% CO2 incubator.
Treatment for analysis of IRS1, IRS2 and GLUT4 gene
expression by semi quantitative RT and RT PCR
e cells were aspirated from the 80% conuence culture ask and
centrifuged at 1500 rpm for 5 mins. e cell pellet was then resuspended
in 1 mL of complete media and 1 × 106 cells/dish was seeded to each
well of the 96 well microtiter plates. Aer 24 hrs incubation, cells were
treated with Metadichol at various concentrations followed by 48 hrs
incubation. Post incubation, the cells are harvested for RNA isolation.
RNA isolation and sample preparation
UC cells were washed twice with PBS and to the adherent cells 2
mL of TRIzol (per T25 ask) was added and transferred to the tube and
vortexed. Samples were allowed to stand for 5 mins at room temperature.
Added 0.2 mL of chloroform per 1 mL of TRIzol used. Closed the tube
and shaken vigorously for 15 seconds. e tube was allowed to stand at
room temperature for 5 mins. e resulting mixture was centrifuged
at 10,000 rpm for 15 mins at 4°C. e colourless upper aqueous phase
was transferred to a new clean tube. 0.5 mL of isopropanol was added
per 1 mL of TRIzol used, mixed gently by inverting the sample 5 times
and incubated at room temperature for 5 mins. en it was centrifuged
at 10,000 rpm for 10 mins at 4°C. Supernatant was discarded and the
RNA pellet was washed by adding 1 mL of 70% ethanol. Mix gently by
inverting the sample a few times. It was then centrifuged for 5 mins at
14,000 rpm at 4°C. Supernatant was discarded by inverting the tube on
a clean tissue paper. Later, the pellet was dried by incubating in a dry
bath for 5 mins at 55°c. e pellet was then resuspended in 25 µl of
DEPC treated water.
Reverse Transcriptase Polymerase Chain Reaction (RT PCR)
A semi quantitative Reverse Transcriptase Polymerase Chain
Reaction (RT PCR) was carried out using Techno Prime system to
determine the levels of β-actin, IRS1, IRS2, GLUT4 mRNA expressions.
e cDNA was synthesized from 2 µg of RNA using the Verso cDNA
synthesis kit (ermo Fischer Scientic) with oligo dT primer according
to the manufacturer’s instructions. e reaction volume was set to 20 μl
and cDNA synthesis was performed at 42°C for 60 mins, followed by
RT inactivation at 85°C for 5 mins.
Semi quantitative PCR reaction
e PCR mixture (nal volume of 20 µL) contained 1 µL of
cDNA, 10 µL of Red Taq Master Mix 2x (Amplicon) and 1 µM of each
complementary primer specic for GLUT4, IRS1 and IRS2 and β-actin
(internal control) sequence (Tables 2-4). e samples were denatured at
94°C for 5 mins and amplied using 30 cycles of 94°C for 30 seconds,
55°C for 30 seconds and 72°C for 1 min for β-actin; for IRS1 and IRS2
renaturation was set to 55°C and for GLUT4 the renaturation was set to
54°C for 30 seconds, followed by a nal elongation at 72°C for 10 mins.
e optimal numbers of cycles have been selected for amplication
of these two genes experimentally so that amplications were in the
exponential range and have not reached a plateau. 10 µL of the nal
amplication product were run on a 2% ethidium-stained agarose gel
and photographed. Quantication of the results was accomplished by
measuring the optical density of the bands, using the computerized
imaging program Image J (Figures 1-4). e values were normalized to
β-actin intensity levels.
Gene Primer pair Sequence Tm Product size (bp)
β-actin FP TCCTCCTGAGCGCAAGTACTCT 62.1 153
RP GCTCAGTAACAGTCCGCCTAGAA 62.4
IRS1 FP CTGCACAACCGTGCTAAGG 58.8 124
RP CGTCACCGTAGCTCAAGTCC 61.4
IRS2 FP CCTACCCTGTAGTGCCTTC 61.4 188
RP AAGTCGATGTTGATGTACTCGC 58.4
GLUT4 FP GCCATGAGCTACGTCTCCATT 59.8 90
RP GGCCACGATGAACCAAGGAA 59.4
Table 1: Primers.
Umbilical cord cells
Metadichol
(Conc.)
Band Intensity of PCR Amplicons Normalized Relative Gene
Expression
β-actin IRS1
0 8919.24 3831.326 0.43 1.00
1 ng 12651.26 6826.095 0.54 1.26
100 ng 8011.61 3952.518 0.49 1.15
1 pg 14065.77 12287.05 0.87 2.03
100 pg 7383.24 11593.78 1.57 3.66
Table 2: Relative expression of IRS1 in treated and untreated Umbilical cord cells.
Umbilical cord cells
Metadichol
(Conc.)
Band Intensity of PCR
Amplicons Normalized Relative Gene
Expression
β-actin IRS2
0 8919.24 4041.225 0.45 1.00
1 ng 12651.26 7869.69 0.62 1.37
100 ng 8011.61 4398.276 0.55 1.21
1 pg 14065.77 15104.88 1.07 2.37
100 pg 7383.24 9425.347 1.28 2.82
Table 3: Relative expression of IRS2 in treated and untreated Umbilical cord cells.

Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 3 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
RT PCR conditions
RT PCR conditions for β-actin, GLUT4, IRS1 and IRS2 (Table 5)
Instrument: Stratagene Mx3005P real time PCR
RT PCR conditions:
cDNA=1.00 µl
F Primer=1.00 µl
R Primer=1.00 µl
Sybr green MM=10.00 µl
Water=7.00 µl
Total volume=20 µl
Results and Discussion
Analysis of amplicons by semi quantitative RT PCR
In this study, Metadichol treatment at 100 pg/mL concentration
shows marked upregulation of IRS1, IRS2 and GLUT4 relative gene
expression up to 3.66, 2.82 and 10.50, whereas 1 ng and 100 ng/mL
treatment shows marginal increase Metadichol acts optimally at the
concentrations ranging from 100 ng/mL to 1 pg/mL (Figures 5-7).
Enriched expression of IRS1, IRS2 and GLUT4 on treatment of
UC cells with has not been reported so far and has a role in diabetes
treatment. We recently presented clinical case studies that showed
the effectiveness of Metadichol in treatment of diabetes and related
complications like wound healing [20-22]. IRS1 and IRS2 have been
shown to play an essential role in the insulin signaling pathway [23].
Increase in IRS2 expression in β-cells has been shown to be essential
for growth and function [24]. IRS1 expression is the primary activator
of PI3-kinase in response to insulin in human cells and, is markedly
reduced in insulin-resistant states. Protein expression of IRS1 and
GLUT4 [25] play an essential role in the development of the whole-
body IR by association with increased production of cytokines and
other insulin-antagonistic factors.
We have previously documented [18] that Metadichol is an
inhibitor of TNF-α and also PAI1 [26,27]. TNF-α is a crucial pro-
inammatory mediator that is involved in the development of IR and
pathogenesis of T2DM. TNF-α is mainly produced in adipocytes and
peripheral tissues and induces tissue-specic inammation through
generation of ROS and activation of various transcriptional mediated
Umbilical cord cells
Metadichol
(Conc.)
Band Intensity of PCR
Amplicons Normalized Relative Gene
Expression
β-actin GLUT4
0 8919.24 2061.853 0.23 1.00
1 ng 12651.26 6909.229 0.55 2.36
100 ng 8011.61 4907.539 0.61 2.65
1 pg 14065.77 10882.66 0.77 3.35
100 pg 7383.24 17915.602 2.43 10.50
Table 4: Relative expression of GLUT4 in treated and untreated Umbilical cord
cells.
Figure 1: Amplication of β-actin gene in umbilical cord cells.
Figure 3: Amplication of IRS2 gene in umbilical cord cells.
Figure 2: Amplication of IRS1 gene in umbilical cord cells.
Figure 4: Amplication of GLUT4 gene in umbilical cord cells.

Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 4 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
pathways. e raised level of TNF-α induces IR in adipocytes and
peripheral tissues by impairing the insulin signaling through serine
phosphorylation that leads to the development of T2DM. Blocking
TNF induced inammation is one of the effective strategies for the
treatment of IR and T2DM. Elevated concentrations of PAI1 have been
observed consistently in blood from patients with IR, diabetes [28,29].
PAI1 levels are 5-10 folds higher consistent with direct effects observed
in vitro, increased levels correlate with elevated concentrations in blood
of triglycerides and hyperinsulinemia.
Human diseases are linked via complex gene networks. Literature
curated experimental data show that gene clusters are driving the
core mechanisms among multiple related diseases. Comparative
Toxicogenomics Database (CTD) is a robust, publicly available
database that provides experimentally curated information about gene
– disease relationships [30]. ese data are integrated with biological
processes and pathway data can lead to understanding the mechanisms
of underlying diseases. Complex diseases such as diabetes involve many
genes, and these act through multiple pathways and other target related
diseases. Using CTD soware the diseases, pathways and biological
process [31] impacted by IRS, IRS2, TNF, SERPINE1 (PAI1) and
GLUT4 (SLC2A4) are shown in Tables 6-8.
Fluorophore Target
gene
Treatment
groups Cq or Ct Cq or Ct
Mean
Cq or Ct
Std. Dev
SYBR GLUT4 Control 16.44 16.44 0
SYBR GLUT4 Control 17 17 0
SYBR GLUT4 Control 16.8 16.8 0
SYBR GLUT4 1 ng 15.34 15.34 0
SYBR GLUT4 1 ng 16.19 16.19 0
SYBR GLUT4 1 pg 16.83 16.83 0
SYBR GLUT4 1 pg 17.13 17.13 0
SYBR GLUT4 100 pg 16.87 16.87 0
SYBR GLUT4 100 pg 16.45 16.45 0
SYBR GLUT4 100 pg 15.95 15.95 0
SYBR GLUT4 100 ng 16.02 16.02 0
SYBR GLUT4 100 ng 14.7 14.7 0
SYBR GLUT4 100 ng 15.68 15.68 0
SYBR IRS1 Control 16.46 16.46 0
SYBR IRS1 Control 16.94 16.94 0
SYBR IRS1 Control 16.61 16.61 0
SYBR IRS1 1 ng 15.77 15.77 0
SYBR IRS1 1 ng 16.11 16.11 0
SYBR IRS1 1 ng 15.83 15.83 0
SYBR IRS1 1 pg 16.55 16.55 0
SYBR IRS1 1 pg 16.89 16.89 0
SYBR IRS1 100 pg 18.01 18.01 0
SYBR IRS1 100 pg 16.87 16.87 0
SYBR IRS1 100 pg 16.65 16.65 0
SYBR IRS1 100 ng 15.25 15.25 0
SYBR IRS1 100 ng 14.75 14.75 0
SYBR IRS1 100 ng 15.71 15.71 0
SYBR IRS2 Control 17.23 17.23 0
SYBR IRS2 Control 16.35 16.35 0
SYBR IRS2 1 ng 15.93 15.93 0
SYBR IRS2 1 ng 16.03 16.03 0
SYBR IRS2 1 pg 17.14 17.14 0
SYBR IRS2 1 pg 18.09 18.09 0
SYBR IRS2 100 pg 17.3 17.3 0
SYBR IRS2 100 pg 17.59 17.59 0
SYBR IRS2 100 ng 14.62 14.62 0
SYBR IRS2 100 ng 15.11 15.11 0
SYBR β-actin 100 ng 18.41 18.41 0
SYBR β-actin 1 ng 17.76 17.76 0
SYBR β-actin 1 pg 20.31 20.31 0
SYBR β-actin 100 pg 22.62 22.62 0
SYBR β-actin 100 ng 17.37 17.37 0
SYBR β-actin 1 ng 19.12 19.12 0
SYBR β-actin 1 pg 20.34 20.34 0
SYBR β-actin 100 pg 22.18 22.18 0
SYBR β-actin Control 17.87 17.87 0
SYBR β-actin 100 ng 18.21 18.21 0
SYBR β-actin 1 ng 17.95 17.95 0
SYBR β-actin 100 pg 22.45 22.45 0
SYBR β-actin Control 18.14 18.14 0
Table 5: RT PCR raw data.
Figure 5: Relative expression of IRS1 gene in untreated and treated umbilical
cord cells.
Figure 6: Relative expression of IRS2 gene in untreated and treated
umbilical cord cells.
Figure 7: Relative expression of GLUT4 gene in untreated and treated
umbilical cord cells.

Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 5 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Pathway Pathway ID P-value Annotated Genes Quantity Annotated Genes
Type II diabetes mellitus KEGG:hsa04930 5.85E-12 4IRS1, IRS2, SLC2A4, TNF
Adipocytokine signaling pathway KEGG:hsa04920 3.10E-11 4IRS1, IRS2, SLC2A4, TNF
Insulin resistance KEGG:hsa04931 1.85E-10 4IRS1, IRS2, SLC2A4, TNF
IRS activation REACT:R-HSA-74713 1.09E-07 2 IRS1, IRS2
AMPK signaling pathway KEGG:hsa04152 2.15E-07 3 IRS1, IRS2, SLC2A4
FoxO signaling pathway KEGG:hsa04068 2.86E-07 3 IRS1, IRS2, SLC2A4
Insulin signaling pathway KEGG:hsa04910 3.27E-07 3 IRS1, IRS2, SLC2A4
Non-alcoholic fatty liver disease (NAFLD) KEGG:hsa04932 4.12E-07 3 IRS1, IRS2, TNF
Signal attenuation REACT:R-HSA-74749 4.92E-07 2 IRS1, IRS2
Developmental Biology REACT:R-HSA-1266738 1.95E-06 4IRS1, IRS2, SLC2A4, TNF
Growth hormone receptor signaling REACT:R-HSA-982772 3.28E-06 2 IRS1, IRS2
Regulation of lipolysis in adipocytes KEGG:hsa04923 1.56E-05 2 IRS1, IRS2
Signaling by Interleukins REACT:R-HSA-449147 1.84E-05 3 IRS1, IRS2, TNF
Longevity regulating pathway-multiple species KEGG:hsa04213 2.06E-05 2 IRS1, IRS2
Constitutive Signaling by Aberrant PI3K in Cancer REACT:R-HSA-2219530 2.27E-05 2 IRS1, IRS2
PI3K Cascade REACT:R-HSA-109704 3.36E-05 2 IRS1, IRS2
PI5P, PP2A and IER3 Regulate PI3K/AKT Signaling REACT:R-HSA-6811558 4.07E-05 2 IRS1, IRS2
Transcriptional regulation of white adipocyte differentiation REACT:R-HSA-381340 4.17E-05 2SLC2A4, TNF
Longevity regulating pathway KEGG:hsa04211 4.26E-05 2 IRS1, IRS2
PI3K/AKT Signaling in Cancer REACT:R-HSA-2219528 4.36E-05 2 IRS1, IRS2
Negative regulation of the PI3K/AKT network REACT:R-HSA-199418 4.76E-05 2 IRS1, IRS2
AGE-RAGE signaling pathway in diabetic complications KEGG:hsa04933 5.28E-05 2SERPINE1, TNF
Cytokine Signaling in Immune system REACT:R-HSA-1280215 5.44E-05 3 IRS1, IRS2, TNF
Chagas disease (American trypanosomiasis) KEGG:hsa05142 5.61E-05 2SERPINE1, TNF
Table 6: Pathways table.
Ontology Highest
GO Level GO Term Name GO Term ID P-value Annotated
Genes Quantity Annotated Genes
Biological Process 9 glucose import GO:0046323 4.85E-11 4IRS1,IRS2,SLC2A4,TNF
Biological Process 8 glucose transmembrane transport GO:1904659 1.99E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 7 hexose transmembrane transport GO:0008645 2.84E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 6 monosaccharide transmembrane transport GO:0015749 3.04E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 5 carbohydrate transmembrane transport GO:0034219 3.25E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 5 carbohydrate transport GO:0008643 7.45E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4cellular response to oxygen-containing
compound GO:1901701 7.31E-09 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 4 regulation of lipid catabolic process GO:0050994 1.50E-08 3 IRS1,IRS2,TNF
Biological Process 6 regulation of glucose import GO:0046324 4.01E-08 3 IRS1,IRS2,TNF
Biological Process 3 response to oxygen-containing compound GO:1901700 4.95E-08 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 5 regulation of glucose transmembrane transport GO:0010827 8.11E-08 3 IRS1,IRS2,TNF
Biological Process 4 cellular response to organonitrogen compound GO:0071417 1.11E-07 4IRS1,IRS2,SLC2A4,TNF
Biological Process 3 carbohydrate metabolic process GO:0005975 1.58E-07 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4 cellular response to nitrogen compound GO:1901699 2.19E-07 4IRS1,IRS2,SLC2A4,TNF
Biological Process 3 positive regulation of lipid metabolic process GO:0045834 2.37E-07 3 IRS1,IRS2,TNF
Biological Process 5 positive regulation of fatty acid beta-oxidation GO:0032000 3.94E-07 2 IRS1,IRS2
Biological Process 5 positive regulation of protein kinase B signaling GO:0051897 4.92E-07 3 IRS1,IRS2,TNF
Biological Process 3 positive regulation of small molecule metabolic
process GO:0062013 5.81E-07 3 IRS1,IRS2,TNF
Biological Process 5 regulation of insulin secretion GO:0050796 5.92E-07 3 IRS1,IRS2,TNF
Biological Process 4 cellular response to organic substance GO:0071310 6.84E-07 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 2positive regulation of transport GO:0051050 8.06E-07 4IRS1,IRS2,SERPINE1,TNF
Biological Process 5 glucose metabolic process GO:0006006 8.31E-07 3 IRS1,IRS2,TNF
Biological Process 4 response to organonitrogen compound GO:0010243 8.68E-07 4IRS1,IRS2,SLC2A4,TNF
Biological Process 6 cellular response to insulin stimulus GO:0032869 9.13E-07 3 IRS1,IRS2,SLC2A4
Biological Process 4 insulin secretion GO:0030073 9.71E-07 3 IRS1,IRS2,TNF

Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 6 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Biological Process 4 regulation of peptide hormone secretion GO:0090276 9.86E-07 3 IRS1,IRS2,TNF
Biological Process 5 positive regulation of fatty acid oxidation GO:0046321 9.95E-07 2 IRS1,IRS2
Biological Process 3 response to hormone GO:0009725 1.07E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 5 carbohydrate homeostasis GO:0033500 1.13E-06 3 IRS1,IRS2,SLC2A4
Biological Process 6 glucose homeostasis GO:0042593 1.13E-06 3 IRS1,IRS2,SLC2A4
Biological Process 5 positive regulation of glycogen biosynthetic
process GO:0045725 1.31E-06 2 IRS1,IRS2
Biological Process 5 regulation of fatty acid beta-oxidation GO:0031998 1.31E-06 2 IRS1,IRS2
Biological Process 5 regulation of protein kinase B signaling GO:0051896 1.33E-06 3 IRS1,IRS2,TNF
Biological Process 3 response to nitrogen compound GO:1901698 1.38E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4 hexose metabolic process GO:0019318 1.39E-06 3 IRS1,IRS2,TNF
Biological Process 5 cellular response to cytokine stimulus GO:0071345 1.61E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4positive regulation of glycogen metabolic
process GO:0070875 1.67E-06 2 IRS1,IRS2
Biological Process 5 peptide hormone secretion GO:0030072 1.71E-06 3 IRS1,IRS2,TNF
Biological Process 3 cellular response to chemical stimulus GO:0070887 1.72E-06 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 3 response to organic substance GO:0010033 1.86E-06 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 5 response to insulin GO:0032868 1.89E-06 3 IRS1,IRS2,SLC2A4
Biological Process 4 protein kinase B signaling GO:0043491 2.05E-06 3 IRS1,IRS2,TNF
Biological Process 3 regulation of hormone secretion GO:0046883 2.05E-06 3 IRS1,IRS2,TNF
Biological Process 4 response to cytokine GO:0034097 2.11E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 3 monosaccharide metabolic process GO:0005996 2.23E-06 3 IRS1,IRS2,TNF
Biological Process 4positive regulation of lipid catabolic process GO:0050996 2.29E-06 2 IRS1,IRS2
Biological Process 4positive regulation of mononuclear cell
migration GO:0071677 2.52E-06 2SERPINE1,TNF
Biological Process 2 regulation of biological quality GO:0065008 3.00E-06 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 4 lipid catabolic process GO:0016042 3.15E-06 3 IRS1,IRS2,TNF
Biological Process 4 hormone secretion GO:0046879 3.31E-06 3 IRS1,IRS2,TNF
Biological Process 5 cellular response to peptide hormone stimulus GO:0071375 3.35E-06 3 IRS1,IRS2,SLC2A4
Biological Process 7 glucose import in response to insulin stimulus GO:0044381 3.55E-06 2IRS1,SLC2A4
Biological Process 4 hormone transport GO:0009914 3.70E-06 3 IRS1,IRS2,TNF
Biological Process 5 regulation of glucan biosynthetic process GO:0010962 3.83E-06 2 IRS1,IRS2
Biological Process 6 regulation of glycogen biosynthetic process GO:0005979 3.83E-06 2 IRS1,IRS2
Biological Process 4positive regulation of cellular catabolic process GO:0031331 3.95E-06 3 IRS1,IRS2,TNF
Biological Process 3 cellular response to endogenous stimulus GO:0071495 3.97E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 5 regulation of fatty acid oxidation GO:0046320 4.13E-06 2 IRS1,IRS2
Biological Process 5 interleukin-7-mediated signaling pathway GO:0038111 4.75E-06 2 IRS1,IRS2
Biological Process 5 cellular response to peptide GO:1901653 5.01E-06 3 IRS1,IRS2,SLC2A4
Biological Process 6 cellular response to interleukin-7 GO:0098761 5.08E-06 2 IRS1,IRS2
Biological Process 4positive regulation of fatty acid metabolic
process GO:0045923 5.08E-06 2 IRS1,IRS2
Biological Process 5 response to interleukin-7 GO:0098760 5.08E-06 2 IRS1,IRS2
Biological Process 2 secretion by cell GO:0032940 5.14E-06 4IRS1,IRS2,SERPINE1,TNF
Biological Process 5 regulation of glycogen metabolic process GO:0070873 5.42E-06 2 IRS1,IRS2
Biological Process 4 regulation of lipid metabolic process GO:0019216 5.79E-06 3 IRS1,IRS2,TNF
Biological Process 5 regulation of polysaccharide biosynthetic
process GO:0032885 6.13E-06 2 IRS1,IRS2
Biological Process 3 positive regulation of catabolic process GO:0009896 6.14E-06 3 IRS1,IRS2,TNF
Biological Process 4 transmembrane transport GO:0055085 6.49E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4positive regulation of glucose metabolic
process GO:0010907 6.50E-06 2 IRS1,IRS2
Table 7: Biological processes.

Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 7 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Disease Name P-value Annotated Genes Quantity Annotated Genes
Diabetes Mellitus, Experimental 9.35E-14 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Insulin Resistance 2.43E-11 4IRS1, IRS2, SLC2A4, TNF
Diabetes Mellitus 4.78E-11 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Hyperinsulinism 5.11E-11 4IRS1, IRS2, SLC2A4, TNF
Glucose Metabolism Disorders 5.40E-11 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Diabetes Mellitus, Type 2 2.27E-09 4IRS1, IRS2, SLC2A4, TNF
Endocrine System Diseases 9.94E-09 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Liver Neoplasms 4.68E-08 4IRS1, IRS2, SERPINE1, TNF
Metabolic Diseases 5.36E-08 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Nutritional and Metabolic Diseases 7.80E-08 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Arteriosclerosis 1.94E-07 3 IRS1, SERPINE1, TNF
Arterial Occlusive Diseases 2.31E-07 3 IRS1, SERPINE1, TNF
Overweight 8.99E-07 3 IRS1, SERPINE1, TNF
Heart Diseases 9.75E-07 4IRS1, SERPINE1, SLC2A4, TNF
Obesity 1.11E-06 3 IRS1, SERPINE1, TNF
Over-nutrition 1.11E-06 3 IRS1, SERPINE1, TNF
Carcinoma, Hepatocellular 1.69E-06 3 IRS1, IRS2, TNF
Nutrition Disorders 2.20E-06 3 IRS1, SERPINE1, TNF
Digestive System Neoplasms 2.37E-06 4IRS1, IRS2, SERPINE1, TNF
Stomach Neoplasms 2.93E-06 3 IRS2, SERPINE1, TNF
Stomach Diseases 3.66E-06 3 IRS2, SERPINE1, TNF
Cardiovascular Diseases 4.01E-06 4IRS1, SERPINE1, SLC2A4, TNF
Body Weight 4.03E-06 3 IRS1, SERPINE1, TNF
Liver Diseases 1.02E-05 4IRS1, IRS2, SERPINE1, TNF
Kidney Failure, Chronic 1.18E-05 2SERPINE1, TNF
Skin Diseases, Vascular 1.28E-05 2SERPINE1, TNF
Renal Insufciency, Chronic 1.39E-05 2SERPINE1, TNF
Atherosclerosis 1.68E-05 2SERPINE1, TNF
Thrombosis 2.06E-05 2SERPINE1, TNF
Table 8: Diseases.
Figure 8: Metadichol’s proposed mechanism of action.
Figure 9: Metadichol expressed gene network.
e highly signicant p values suggest that the genes have more
interactions among themselves than what would be expected for a
random set of proteins of similar size, drawn from the genome. Such
enrichment indicates that the proteins are biologically connected, as
a group. e curated experimental results indicate that the disease
predictions correlate with experimental results that clinical case studies
we have reported [18,32-35]. e top 5 processes of pathways, biological

Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 8 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
processes and diseases are all pointing to a clear role in diabetes-related
symptoms.
Based on a proposed model by Benito [36] on this we postulate
Metadichol’s mode of actions in diabetes as shown in Figure 8. e
mechanism shows that downeld genes like IGF1, AKT1, PIK and
GSK3 have important roles by their interactions with the Metadichol
expressed genes.
We further analysed the gene cluster (Figure 9) using CoolGen
soware [37] which shows the importance of the interactions of
genes/enzymes. Based on our proposed mechanism (Figure 8) the key
genes/enzymes, IRS, IRS2, SLC2A4, IGF, PI3k, INSR, GSK3 are highly
connected to multiple genes and enzymes that have an important role
in insulin signaling. e network also suggests that it will be useful
in cardiovascular diseases (CVD) and kidney diseases and we have
conrmed through clinical case studies, Metadichol’s role in these
diseases as well [38].
Conclusion
Since adult stem cells are present in PBMCs which have similar
expression proles to UBC [39], one could expect similar actions by
Metadichol on these cells leading to observed improvements that we
have documented in diabetes patients [21-23]. e study shows highly
related biologically functional gene clusters are the key in targeting
diseases. A paradigm shi has been proposed in designing drug design
from “one drug one target” to “one drug multiple targets” [40-42]. Our
results show that network-based approach clearly seems to be more
viable [43-45]. Our work reveals the unique complex interactions
between Metadichol which is a nano formulation of mixture of straight
chain aliphatic alcohols and cellular proteins but also the inuence
of their interactions on the function and behaviour of the system.
Metadichol is the rst in a class of molecules that targets multiple genes
and through multiple pathways and thus multiple disease targets which
could be the next wave of the future of drug discovery [46].
References
1. Weir GC, Cavelti-Weder C, Bonner-Weir S (2011) Stem cell approaches for
diabetes: towards beta cell replacement. Genome Med 3: 61. [PubMed]
2. Bernardi S, Severini GM, Zauli G, Secchiero P (2012) Cell-based therapies for
diabetic complications. Exp Diabetes Res 2012: 1-10.
3. Arutyunyan I, Elchaninov A, Makarov A, Fatkhudinov T (2016) Umbilical Cord
as Prospective Source for Mesenchymal Stem Cell-Based Therapy. Stem
Cells Int 2016: 1-17
4. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, et al. (1999)
Multilineage potential of adult human mesenchymal stem cells. Science 284:
143-147
5. Salem HK, Thiemermann C (2010) Mesenchymal stromal cells: current
understanding and clinical status. Stem Cells 28: 585-596
6. Pileggi A (2012) Mesenchymal stem cells for the treatment of diabetes.
Diabetes 61: 1355-1336
7. Si Y, Zhao Y, Hao H, Liu J, Guo Y, et al. (2012) Infusion of mesenchymal stem
cells ameliorates hyperglycemia in type 2 diabetic rats: identication of a novel
role in improving insulin sensitivity. Diabetes 61: 1616-1625
8. Huang S, Czech MP (2007) The GLUT4 Glucose Transporter. Cell Metab 5:
237-252
9. Herman MA, Kahn BB (2006) Glucose transport and sensing in the maintenance
of glucose homeostasis and metabolic harmony. J Clin Invest 116: 1767-1775.
[PubMed]
10. Tolar J, Nauta AJ, Osborn MJ, Mortari AP, McElmurry RT, et al. (2007) Sarcoma
derived from cultured mesenchymal stem cells. Stem Cells 25: 371-379.
[PubMed]
11. Mottaghi S, Larijani B, Shari AM (2012) A novel approach to enhance efcacy
of hypoxic preconditioned mesenchymal stem cells for cell therapy of diabetes.
Med Hypotheses 79: 717-718
12. Staerk J, Dawlaty MM, Gao Q, Maetzel D, Hanna J, et al. (2010) Reprogramming
of human peripheral blood cells to induced pluripotent stem cells. Cell Stem
Cell 7: 20-24
13. Copps KD, White MF (2012) Regulation of insulin sensitivity by serine/
threonine phosphorylation of insulin receptor substrate proteins IRS1 and
IRS2. Diabetologia 55: 2565-2582
14. White MF (2006) Regulating insulin signaling and b-cell function through IRS
proteins. Can J Physiol Pharmacol 84: 725-737
15. Samuel VT, Shulman GI (2012) Mechanisms for insulin resistance: common
threads and missing links. Cell 148: 852-871
16. Boura-Halfon S, Zick Y (2009) Phosphorylation of IRS proteins, insulin action,
and insulin resistance. Am J Physiol Endocrinol Metab 296: 581-591
17. Kahn SE, Hull RL, Utzschneider KM (2006) Mechanisms linking obesity to
insulin resistance and type 2 diabetes. Nature 444: 840-846
18. Raghavan PR, US Patents: 8,722,093 (2014); 9,034,383 (2015); 9,006,292
(2015).
19. Raghavan PR (2018) Metadichol® and CD34 Expression in Umbilical Cord
Cells. J Stem Cell Res Ther 8: 409.
20. Raghavan PR (2016) Metadichol and Type 2 Diabetes A case report. Journal of
the Science of Healing Outcomes 8: 5-10.
21. Raghavan PR (2010) Case Report of Type1. Diabetes. Journal of the Science
of Healing Outcomes 2: 24.
22. Raghavan PR (2018) Metadichol® and Healthy Skin: One Approach many
Possible Cures. J Clin Exp Dermatol Res 9: 1.
23. Lavin DP, White MF, Brazil DP (2016) IRS proteins and diabetic complications.
Diabetologia 59: 2280-2291
24. Withers DJ, Burks DJ, Towery HH, Altamuro SL, Flint CL, et al. (1999) IRS-
2 coordinates IGF-1 receptor-mediated beta-cell development and peripheral
insulin signaling. Nat Genet 23: 32-40
25. Kampmann U, Christensen B, Nielsen TS, Pedersen SB, Ørskov L, et al.
(2011) GLUT4 and UBC9 Protein Expression Is Reduced in Muscle from Type
2 Diabetic Patients with Severe Insulin Resistance. PLoS One 6: e27854.
[PubMed]
26. Akash MSH, Rehman K, Liaqat A (2018) Tumor Necrosis Factor-Alpha: Role
in Development of Insulin Resistance and Pathogenesis of Type 2 Diabetes
Mellitus. J Cell Biochem 119: 105-110
27. Juhan-Vague I, Vague P, Alessi MC, Badier C, Valadier J, et al. (1987)
Relationships between plasma insulin triglyceride, body mass index, and
plasminogen activator inhibitor-1. Diabete Metab 13: 331-336
28. Vague P, Juhan-Vague I, Aillaud MF, Badier C, Viard R, et al. (1986) Correlation
between blood brinolytic activity, plasminogen activator inhibitor level,
plasma insulin level, and relative body weight in normal and obese subjects.
Metabolism 35: 250-253.
29. Smith U (2002) Impaired (‘diabetic’) insulin signaling and action occur in fat
cells long before glucose intolerance. Is insulin resistance initiated in the
adipose tissue? Int J Obes Relat Metab Disord 26: 897-904
30. Davis AP, Grondin CJ, Johnson RJ, Sciaky D, King BL, et al. (2017) The
Comparative Toxicogenomics Database: update 2017. Nucleic Acids Res 45:
D972-D978
31. Curated data were retrieved from the Comparative Toxicogenomics Database
(CTD), MDI Biological Laboratory, Salisbury Cove, Maine, and NC State
University, Raleigh, North Carolina. World Wide Web, (May 2018).
32. Raghavan PR (2017) Systolic and Diastolic BP Control in Metabolic Syndrome
Patients with Metadichol® a Novel Nano Emulsion Lipid. J Cardiol & Cardiovasc
Ther 5: 555660.
33. Raghavan PR (2017) Metadichol® Induced High Levels of Vitamin C: Case
Studies. Vitam Miner 6: 169.
34. Raghavan PR (2017) Metadichol® and Red Cell Distribution Width (RDW) in
CKD patients. J Stem Cell Res Ther 7: 392.
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]

Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 9 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
35. Raghavan PR (2017) Metadichol® and Vitamin C Increase In Vivo, an Open-
Label Study. Vitam Miner 6: 163.
36. Benito M (2011) Tissue specicity on insulin action and resistance: past to
recent mechanisms. Acta Physiol 201: 297-312
37. Cancer Research Institute of Southern Medical University.
38. Raghavan PR (2017) Metadichol® and Red Cell Distribution Width (RDW) in
CKD patients. J Stem Cell Res Ther 7: 392.
39. Salomon H, Belmonte A, Nguyen K, Gu Z, Gelfand M, et al. (1994) Comparison
of cord blood and peripheral blood mononuclear cells as targets for viral
isolation and drug sensitivity studies involving human immunodeciency virus
type 1. J Clin Microbiol 32: 2000-2002
40. Hopkins AL (2008) Network pharmacology: the next paradigm in drug discovery.
Nat Chem Biol 4: 682-690. [Pubmed]
41. Hopkins AL (2009) Drug discovery: Predicting promiscuity. Nature 462: 167-
168
42. Apsel B, Blair JA, Gonzalez B, Nazif TM, Feldman ME, et al. (2008) Targeted
polypharmacology: discovery of dual inhibitors of tyrosine and phosphoinositide
kinases. Nat Chem Biol 4: 691-699. [PubMed]
43. Carson MB, Liu C, Lu Y, Jia C, Lu H (2017) A disease similarity matrix based on
the uniqueness of shared genes. BMC Med Genomics 10: 26.
44. Choudhary N, Singh V (2018) A census of P. longum’s phytochemicals and their
network pharmacological evaluation for identifying novel drug-like molecules
against various diseases, with a special focus on neurological disorders. PLoS
One 13: e0191006. [PubMed]
45. Vitali F, Mulas F, Marini P, Bellazzi R (2013) Network-based target ranking for
polypharmacological therapies. J Biomed Inform 46: 876-881. [PubMed]
46. Reddy AS, Zhang S (2013) Polypharmacology: drug discovery for the future.
Expert Rev Clin Pharmacol 6: 41-47. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]