ArticlePDF Available

Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for Diabetes

Authors:

Abstract and Figures

Insulin and IGF signaling require a family of scaffold proteins, also called as Insulin Receptor Substrate (IRS) proteins to integrate extracellular signals into intracellular responses, leading to cellular effects. Two main IRS proteins in humans are IRS1 and IRS2 and are widely expressed in most human and mammalian tissues. In this study, IRS1, IRS2, GLUT4 gene expression is quantified in Umbilical Cord (UC) cell line by semi quantitative- PCR. The internal control β-actin was used to normalize the IRS1, IRS2, GLUT4 gene expression levels. This is the first example of UC cells being induced by a ligand in expressing genes that regulate glucose and insulin levels. Metadichol® treatment at different concentrations on UC cells showed upregulation of IRS1, IRS2 and GLUT4. 100 pg/mL concentrations showed the highest upregulation of IRS1, IRS2 and GLUT4 expression. 1 ng and 100 ng/mL treatment showed marginal. Metadichol® is in addition a TNF alpha inhibitor and also inhibits Plasminogen Activation Inhibitor (PAI1) also known as SERPINE1. These genes play an important role in diabetes. The experimental results fully correlated with curated literature data using Bioinformatics software. Network analysis show the uniqueness of shared genes, IRS1, IRS2, GLUT4, TNF, PAI1, acting through multiple pathways that target multiple diseases.
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Open Access
Research Article
Journal of
Stem Cell Research & Therapy
J
o
u
r
n
a
l
o
f
S
t
e
m
C
e
l
l
R
e
s
e
a
r
c
h
&
T
h
e
r
a
p
y
ISSN: 2157-7633
Raghavan, J Stem Cell Res Ther 2018, 8:6
DOI: 10.4172/2157-7633.1000429
Abstract
Insulin and IGF signaling require a family of scaffold proteins, also called as Insulin Receptor Substrate (IRS)
proteins to integrate extracellular signals into intracellular responses, leading to cellular effects. Two main IRS proteins
in humans are IRS1 and IRS2 and are widely expressed in most human and mammalian tissues. In this study, IRS1,
IRS2, GLUT4 gene expression is quantied in Umbilical Cord (UC) cell line by semi quantitative- PCR. The internal
control β-actin was used to normalize the IRS1, IRS2, GLUT4 gene expression levels. This is the rst example of UC
cells being induced by a ligand in expressing genes that regulate glucose and insulin levels. Metadichol® treatment
at different concentrations on UC cells showed upregulation of IRS1, IRS2 and GLUT4. 100 pg/mL concentrations
showed the highest upregulation of IRS1, IRS2 and GLUT4 expression. 1 ng and 100 ng/mL treatment showed
marginal. Metadichol® is in addition a TNF alpha inhibitor and also inhibits Plasminogen Activation Inhibitor (PAI1) also
known as SERPINE1. These genes play an important role in diabetes. The experimental results fully correlated with
curated literature data using Bioinformatics software. Network analysis show the uniqueness of shared genes, IRS1,
IRS2, GLUT4, TNF, PAI1, acting through multiple pathways that target multiple diseases.
Umbilical Cord Cells Treatment with Metadichol IRS Proteins and GLUT4
Expression and Implications for Diabetes
Palayakotai R Raghavan*
Nanorx Inc., PO Box 131, Chappaqua, NY 10514, USA
*Corresponding author: Palayakotai R Raghavan, Nanorx Inc., PO Box 131,
Chappaqua, NY 10514, USA, Tel: 9146710224; E-mail: raghavan@nanorxinc.com
Received May 31, 2018; Accepted June 12, 2018; Published June 18, 2018
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol®
IRS Proteins and GLUT4 Expression and Implications for diabetes. Stem Cell Res
Ther 8: 429. doi: 10.4172/2157-7633.1000429
Copyright: © 2018 Raghavan PR. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and
source are credited.
Keywords: GLUT4; Genes; Diabetes; Glucose uptake; GSK3, IGF1,
PI#K
Abbreviations: IRS: Insulin Receptor Substrate; UC: Umbilical
Cord; PAI: Plasminogen Activation Inhibitor; UBC: Umbilical Cord
Blood; MSC: Mesenchymal Stem Cell; T2DM: Type 2 Diabetes Mellitus;
AKT: Protein Kinase B; PBMCs: Peripheral Blood Mononuclear Cells;
IR: Insulin Resistance; PCR: Polymerase Chain Reaction
Introduction
e increased incidence of Diabetes Mellitus (DM) worldwide
reinforces the search for new approaches to prevent the progression
of diabetes and its complications [1]. Stem cells are the next frontier
in medicine. Stem cells are thought to have signicant therapeutic and
biotechnological potential [2]. Stem cell therapy will not only replace
damaged or dysfunctional cells but deliver therapeutic proteins aer
they have been engineered to do so. is eld is paving the way for
novel therapeutic interventions through cellular therapies and tissue
engineering approaches that are reshaping the biomedical field. e
remarkable exibility of different cell subsets obtained from human
embryonic and adult tissues from sources like bone marrow, UC useful
in evaluating these cells in the treatment of diabetes and its complications
and hold great promise for pancreatic beta cell replacement therapy for
diabetes. Umbilical Cord Blood (UBC) contains Mesenchymal Stem
Cells (MSCs) that are precursors of certain types of cells (e.g., bone,
cartilage, fat or muscle) [3-5].
MSCs are multipotent stromal cells that can differentiate into
a variety of cell types which have been shown to improve metabolic
control [6] in experimental models of Type 2 Diabetes (T2D). A recently
published study by Si [7] showed that infusion of autologous MSCs
managed to improve hyperglycemia in T2D rats. Benecial effects of
MSC therapy resulted in enhanced insulin sensitivity via increased
signaling of IRS1. Also, AKT (Protein kinase B PKB) phosphorylation
leads to translocation of GLUT4 or also known as SLC2A4 (glucose
transporter type 4) on cell membrane upon insulin administration in
the muscle, liver, and adipose tissue of MSC treated animals [8,9].
ere are several problems that limit the use of MSCs for diabetes
therapy [10]. Mottaghi [11] showed that poor engrament and limited
differentiation under in vivo conditions are major obstacles for ecient
therapeutic use of MSCs. Hyperglycemia leads to reactive oxygen
species overproduction which triggers apoptosis and thereby decreases
MSC viability aer transplantation.
Another large accessible source of adult stem cells is Peripheral
Blood Mononuclear Cells (PBMCs). It can be frozen and stored for
later use. PBMCs contain many different progenitor cell types and are
expandable as they can be cultured and reprogrammed to produce
Induced Pluripotent Stem Cells (iPSCs) [12] for clinical applications in
regenerative medicine.
Blood glucose concentration is tightly regulated in humans. GLUT4
is what maintains whole-body glucose homeostasis. Both insulin and
exercise acutely stimulate GLUT4 recruitment to the cell surfaces of
muscle and adipose cells independent of transcription or translation
[13]. Insulin and IGF signaling requires a family of IRS proteins to
integrate extracellular signals into intracellular responses, leading to
cellular effects [14]. ere are two main IRS proteins in humans, IRS1
and IRS2, that are widely expressed in most human and mammalian
tissues. IRS1 and IRS2 mediate the control of various cellular processes
by insulin [15]. Insulin binding to the α-subunit of the insulin receptor
results in the phosphorylation of IRS1 and IRS2 which leads, via several
intermediary steps, to activation of AKT (protein kinase B) [16].
Insulin Resistance (IR) can result from decits in any part of the insulin
signaling pathway resulting in inadequate response to insulin [17].
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 2 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
We have recently shown that UBC treatment with Metadichol,
a nano-formulation of long chain lipid alcohols derived from food
sources [18] at picogram levels leads to enriched cells containing CD34
[19]. We present here data that treating UBC cells with Metadichol at
low concentrations leads to multifold increases of IRS1 and IRS2 and
also GLUT4 expressions that potentially have a role as discussed above
in diabetes.
Experimental
e work was commerically outsourced and carried out by Skanda
Life Sciences Pvt. Ltd Bangalore India and Primers (Table 1) synthesized
at Eurons Genomics, India.
Preparation of test samples
Metadichol (5 mg/mL) stock was diluted to obtain desired
concentrations of 0.001, 0.1, 1, 100, 1000 ng/mL test solutions.
Cell lines and treatment
UC cells were cultured in MSC expansion medium with reduced
Serum, 100 units/mL of penicillin G and 100 µg/mL of Streptomycin at
37°C, 5% CO2 incubator.
Treatment for analysis of IRS1, IRS2 and GLUT4 gene
expression by semi quantitative RT and RT PCR
e cells were aspirated from the 80% conuence culture ask and
centrifuged at 1500 rpm for 5 mins. e cell pellet was then resuspended
in 1 mL of complete media and 1 × 106 cells/dish was seeded to each
well of the 96 well microtiter plates. Aer 24 hrs incubation, cells were
treated with Metadichol at various concentrations followed by 48 hrs
incubation. Post incubation, the cells are harvested for RNA isolation.
RNA isolation and sample preparation
UC cells were washed twice with PBS and to the adherent cells 2
mL of TRIzol (per T25 ask) was added and transferred to the tube and
vortexed. Samples were allowed to stand for 5 mins at room temperature.
Added 0.2 mL of chloroform per 1 mL of TRIzol used. Closed the tube
and shaken vigorously for 15 seconds. e tube was allowed to stand at
room temperature for 5 mins. e resulting mixture was centrifuged
at 10,000 rpm for 15 mins at 4°C. e colourless upper aqueous phase
was transferred to a new clean tube. 0.5 mL of isopropanol was added
per 1 mL of TRIzol used, mixed gently by inverting the sample 5 times
and incubated at room temperature for 5 mins. en it was centrifuged
at 10,000 rpm for 10 mins at 4°C. Supernatant was discarded and the
RNA pellet was washed by adding 1 mL of 70% ethanol. Mix gently by
inverting the sample a few times. It was then centrifuged for 5 mins at
14,000 rpm at 4°C. Supernatant was discarded by inverting the tube on
a clean tissue paper. Later, the pellet was dried by incubating in a dry
bath for 5 mins at 55°c. e pellet was then resuspended in 25 µl of
DEPC treated water.
Reverse Transcriptase Polymerase Chain Reaction (RT PCR)
A semi quantitative Reverse Transcriptase Polymerase Chain
Reaction (RT PCR) was carried out using Techno Prime system to
determine the levels of β-actin, IRS1, IRS2, GLUT4 mRNA expressions.
e cDNA was synthesized from 2 µg of RNA using the Verso cDNA
synthesis kit (ermo Fischer Scientic) with oligo dT primer according
to the manufacturer’s instructions. e reaction volume was set to 20 μl
and cDNA synthesis was performed at 42°C for 60 mins, followed by
RT inactivation at 85°C for 5 mins.
Semi quantitative PCR reaction
e PCR mixture (nal volume of 20 µL) contained 1 µL of
cDNA, 10 µL of Red Taq Master Mix 2x (Amplicon) and 1 µM of each
complementary primer specic for GLUT4, IRS1 and IRS2 and β-actin
(internal control) sequence (Tables 2-4). e samples were denatured at
94°C for 5 mins and amplied using 30 cycles of 94°C for 30 seconds,
55°C for 30 seconds and 72°C for 1 min for β-actin; for IRS1 and IRS2
renaturation was set to 55°C and for GLUT4 the renaturation was set to
54°C for 30 seconds, followed by a nal elongation at 72°C for 10 mins.
e optimal numbers of cycles have been selected for amplication
of these two genes experimentally so that amplications were in the
exponential range and have not reached a plateau. 10 µL of the nal
amplication product were run on a 2% ethidium-stained agarose gel
and photographed. Quantication of the results was accomplished by
measuring the optical density of the bands, using the computerized
imaging program Image J (Figures 1-4). e values were normalized to
β-actin intensity levels.
Gene Primer pair Sequence Tm Product size (bp)
β-actin FP TCCTCCTGAGCGCAAGTACTCT 62.1 153
RP GCTCAGTAACAGTCCGCCTAGAA 62.4
IRS1 FP CTGCACAACCGTGCTAAGG 58.8 124
RP CGTCACCGTAGCTCAAGTCC 61.4
IRS2 FP CCTACCCTGTAGTGCCTTC 61.4 188
RP AAGTCGATGTTGATGTACTCGC 58.4
GLUT4 FP GCCATGAGCTACGTCTCCATT 59.8 90
RP GGCCACGATGAACCAAGGAA 59.4
Table 1: Primers.
Umbilical cord cells
Metadichol
(Conc.)
Band Intensity of PCR Amplicons Normalized Relative Gene
Expression
β-actin IRS1
0 8919.24 3831.326 0.43 1.00
1 ng 12651.26 6826.095 0.54 1.26
100 ng 8011.61 3952.518 0.49 1.15
1 pg 14065.77 12287.05 0.87 2.03
100 pg 7383.24 11593.78 1.57 3.66
Table 2: Relative expression of IRS1 in treated and untreated Umbilical cord cells.
Umbilical cord cells
Metadichol
(Conc.)
Band Intensity of PCR
Amplicons Normalized Relative Gene
Expression
β-actin IRS2
0 8919.24 4041.225 0.45 1.00
1 ng 12651.26 7869.69 0.62 1.37
100 ng 8011.61 4398.276 0.55 1.21
1 pg 14065.77 15104.88 1.07 2.37
100 pg 7383.24 9425.347 1.28 2.82
Table 3: Relative expression of IRS2 in treated and untreated Umbilical cord cells.
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 3 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
RT PCR conditions
RT PCR conditions for β-actin, GLUT4, IRS1 and IRS2 (Table 5)
Instrument: Stratagene Mx3005P real time PCR
RT PCR conditions:
cDNA=1.00 µl
F Primer=1.00 µl
R Primer=1.00 µl
Sybr green MM=10.00 µl
Water=7.00 µl
Total volume=20 µl
Results and Discussion
Analysis of amplicons by semi quantitative RT PCR
In this study, Metadichol treatment at 100 pg/mL concentration
shows marked upregulation of IRS1, IRS2 and GLUT4 relative gene
expression up to 3.66, 2.82 and 10.50, whereas 1 ng and 100 ng/mL
treatment shows marginal increase Metadichol acts optimally at the
concentrations ranging from 100 ng/mL to 1 pg/mL (Figures 5-7).
Enriched expression of IRS1, IRS2 and GLUT4 on treatment of
UC cells with has not been reported so far and has a role in diabetes
treatment. We recently presented clinical case studies that showed
the effectiveness of Metadichol in treatment of diabetes and related
complications like wound healing [20-22]. IRS1 and IRS2 have been
shown to play an essential role in the insulin signaling pathway [23].
Increase in IRS2 expression in β-cells has been shown to be essential
for growth and function [24]. IRS1 expression is the primary activator
of PI3-kinase in response to insulin in human cells and, is markedly
reduced in insulin-resistant states. Protein expression of IRS1 and
GLUT4 [25] play an essential role in the development of the whole-
body IR by association with increased production of cytokines and
other insulin-antagonistic factors.
We have previously documented [18] that Metadichol is an
inhibitor of TNF-α and also PAI1 [26,27]. TNF-α is a crucial pro-
inammatory mediator that is involved in the development of IR and
pathogenesis of T2DM. TNF-α is mainly produced in adipocytes and
peripheral tissues and induces tissue-specic inammation through
generation of ROS and activation of various transcriptional mediated
Umbilical cord cells
Metadichol
(Conc.)
Band Intensity of PCR
Amplicons Normalized Relative Gene
Expression
β-actin GLUT4
0 8919.24 2061.853 0.23 1.00
1 ng 12651.26 6909.229 0.55 2.36
100 ng 8011.61 4907.539 0.61 2.65
1 pg 14065.77 10882.66 0.77 3.35
100 pg 7383.24 17915.602 2.43 10.50
Table 4: Relative expression of GLUT4 in treated and untreated Umbilical cord
cells.
Figure 1: Amplication of β-actin gene in umbilical cord cells.
Figure 3: Amplication of IRS2 gene in umbilical cord cells.
Figure 2: Amplication of IRS1 gene in umbilical cord cells.
Figure 4: Amplication of GLUT4 gene in umbilical cord cells.
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 4 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
pathways. e raised level of TNF-α induces IR in adipocytes and
peripheral tissues by impairing the insulin signaling through serine
phosphorylation that leads to the development of T2DM. Blocking
TNF induced inammation is one of the effective strategies for the
treatment of IR and T2DM. Elevated concentrations of PAI1 have been
observed consistently in blood from patients with IR, diabetes [28,29].
PAI1 levels are 5-10 folds higher consistent with direct effects observed
in vitro, increased levels correlate with elevated concentrations in blood
of triglycerides and hyperinsulinemia.
Human diseases are linked via complex gene networks. Literature
curated experimental data show that gene clusters are driving the
core mechanisms among multiple related diseases. Comparative
Toxicogenomics Database (CTD) is a robust, publicly available
database that provides experimentally curated information about gene
– disease relationships [30]. ese data are integrated with biological
processes and pathway data can lead to understanding the mechanisms
of underlying diseases. Complex diseases such as diabetes involve many
genes, and these act through multiple pathways and other target related
diseases. Using CTD soware the diseases, pathways and biological
process [31] impacted by IRS, IRS2, TNF, SERPINE1 (PAI1) and
GLUT4 (SLC2A4) are shown in Tables 6-8.
Fluorophore Target
gene
Treatment
groups Cq or Ct Cq or Ct
Mean
Cq or Ct
Std. Dev
SYBR GLUT4 Control 16.44 16.44 0
SYBR GLUT4 Control 17 17 0
SYBR GLUT4 Control 16.8 16.8 0
SYBR GLUT4 1 ng 15.34 15.34 0
SYBR GLUT4 1 ng 16.19 16.19 0
SYBR GLUT4 1 pg 16.83 16.83 0
SYBR GLUT4 1 pg 17.13 17.13 0
SYBR GLUT4 100 pg 16.87 16.87 0
SYBR GLUT4 100 pg 16.45 16.45 0
SYBR GLUT4 100 pg 15.95 15.95 0
SYBR GLUT4 100 ng 16.02 16.02 0
SYBR GLUT4 100 ng 14.7 14.7 0
SYBR GLUT4 100 ng 15.68 15.68 0
SYBR IRS1 Control 16.46 16.46 0
SYBR IRS1 Control 16.94 16.94 0
SYBR IRS1 Control 16.61 16.61 0
SYBR IRS1 1 ng 15.77 15.77 0
SYBR IRS1 1 ng 16.11 16.11 0
SYBR IRS1 1 ng 15.83 15.83 0
SYBR IRS1 1 pg 16.55 16.55 0
SYBR IRS1 1 pg 16.89 16.89 0
SYBR IRS1 100 pg 18.01 18.01 0
SYBR IRS1 100 pg 16.87 16.87 0
SYBR IRS1 100 pg 16.65 16.65 0
SYBR IRS1 100 ng 15.25 15.25 0
SYBR IRS1 100 ng 14.75 14.75 0
SYBR IRS1 100 ng 15.71 15.71 0
SYBR IRS2 Control 17.23 17.23 0
SYBR IRS2 Control 16.35 16.35 0
SYBR IRS2 1 ng 15.93 15.93 0
SYBR IRS2 1 ng 16.03 16.03 0
SYBR IRS2 1 pg 17.14 17.14 0
SYBR IRS2 1 pg 18.09 18.09 0
SYBR IRS2 100 pg 17.3 17.3 0
SYBR IRS2 100 pg 17.59 17.59 0
SYBR IRS2 100 ng 14.62 14.62 0
SYBR IRS2 100 ng 15.11 15.11 0
SYBR β-actin 100 ng 18.41 18.41 0
SYBR β-actin 1 ng 17.76 17.76 0
SYBR β-actin 1 pg 20.31 20.31 0
SYBR β-actin 100 pg 22.62 22.62 0
SYBR β-actin 100 ng 17.37 17.37 0
SYBR β-actin 1 ng 19.12 19.12 0
SYBR β-actin 1 pg 20.34 20.34 0
SYBR β-actin 100 pg 22.18 22.18 0
SYBR β-actin Control 17.87 17.87 0
SYBR β-actin 100 ng 18.21 18.21 0
SYBR β-actin 1 ng 17.95 17.95 0
SYBR β-actin 100 pg 22.45 22.45 0
SYBR β-actin Control 18.14 18.14 0
Table 5: RT PCR raw data.
Figure 5: Relative expression of IRS1 gene in untreated and treated umbilical
cord cells.
Figure 6: Relative expression of IRS2 gene in untreated and treated
umbilical cord cells.
Figure 7: Relative expression of GLUT4 gene in untreated and treated
umbilical cord cells.
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 5 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Pathway Pathway ID P-value Annotated Genes Quantity Annotated Genes
Type II diabetes mellitus KEGG:hsa04930 5.85E-12 4IRS1, IRS2, SLC2A4, TNF
Adipocytokine signaling pathway KEGG:hsa04920 3.10E-11 4IRS1, IRS2, SLC2A4, TNF
Insulin resistance KEGG:hsa04931 1.85E-10 4IRS1, IRS2, SLC2A4, TNF
IRS activation REACT:R-HSA-74713 1.09E-07 2 IRS1, IRS2
AMPK signaling pathway KEGG:hsa04152 2.15E-07 3 IRS1, IRS2, SLC2A4
FoxO signaling pathway KEGG:hsa04068 2.86E-07 3 IRS1, IRS2, SLC2A4
Insulin signaling pathway KEGG:hsa04910 3.27E-07 3 IRS1, IRS2, SLC2A4
Non-alcoholic fatty liver disease (NAFLD) KEGG:hsa04932 4.12E-07 3 IRS1, IRS2, TNF
Signal attenuation REACT:R-HSA-74749 4.92E-07 2 IRS1, IRS2
Developmental Biology REACT:R-HSA-1266738 1.95E-06 4IRS1, IRS2, SLC2A4, TNF
Growth hormone receptor signaling REACT:R-HSA-982772 3.28E-06 2 IRS1, IRS2
Regulation of lipolysis in adipocytes KEGG:hsa04923 1.56E-05 2 IRS1, IRS2
Signaling by Interleukins REACT:R-HSA-449147 1.84E-05 3 IRS1, IRS2, TNF
Longevity regulating pathway-multiple species KEGG:hsa04213 2.06E-05 2 IRS1, IRS2
Constitutive Signaling by Aberrant PI3K in Cancer REACT:R-HSA-2219530 2.27E-05 2 IRS1, IRS2
PI3K Cascade REACT:R-HSA-109704 3.36E-05 2 IRS1, IRS2
PI5P, PP2A and IER3 Regulate PI3K/AKT Signaling REACT:R-HSA-6811558 4.07E-05 2 IRS1, IRS2
Transcriptional regulation of white adipocyte differentiation REACT:R-HSA-381340 4.17E-05 2SLC2A4, TNF
Longevity regulating pathway KEGG:hsa04211 4.26E-05 2 IRS1, IRS2
PI3K/AKT Signaling in Cancer REACT:R-HSA-2219528 4.36E-05 2 IRS1, IRS2
Negative regulation of the PI3K/AKT network REACT:R-HSA-199418 4.76E-05 2 IRS1, IRS2
AGE-RAGE signaling pathway in diabetic complications KEGG:hsa04933 5.28E-05 2SERPINE1, TNF
Cytokine Signaling in Immune system REACT:R-HSA-1280215 5.44E-05 3 IRS1, IRS2, TNF
Chagas disease (American trypanosomiasis) KEGG:hsa05142 5.61E-05 2SERPINE1, TNF
Table 6: Pathways table.
Ontology Highest
GO Level GO Term Name GO Term ID P-value Annotated
Genes Quantity Annotated Genes
Biological Process 9 glucose import GO:0046323 4.85E-11 4IRS1,IRS2,SLC2A4,TNF
Biological Process 8 glucose transmembrane transport GO:1904659 1.99E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 7 hexose transmembrane transport GO:0008645 2.84E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 6 monosaccharide transmembrane transport GO:0015749 3.04E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 5 carbohydrate transmembrane transport GO:0034219 3.25E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 5 carbohydrate transport GO:0008643 7.45E-10 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4cellular response to oxygen-containing
compound GO:1901701 7.31E-09 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 4 regulation of lipid catabolic process GO:0050994 1.50E-08 3 IRS1,IRS2,TNF
Biological Process 6 regulation of glucose import GO:0046324 4.01E-08 3 IRS1,IRS2,TNF
Biological Process 3 response to oxygen-containing compound GO:1901700 4.95E-08 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 5 regulation of glucose transmembrane transport GO:0010827 8.11E-08 3 IRS1,IRS2,TNF
Biological Process 4 cellular response to organonitrogen compound GO:0071417 1.11E-07 4IRS1,IRS2,SLC2A4,TNF
Biological Process 3 carbohydrate metabolic process GO:0005975 1.58E-07 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4 cellular response to nitrogen compound GO:1901699 2.19E-07 4IRS1,IRS2,SLC2A4,TNF
Biological Process 3 positive regulation of lipid metabolic process GO:0045834 2.37E-07 3 IRS1,IRS2,TNF
Biological Process 5 positive regulation of fatty acid beta-oxidation GO:0032000 3.94E-07 2 IRS1,IRS2
Biological Process 5 positive regulation of protein kinase B signaling GO:0051897 4.92E-07 3 IRS1,IRS2,TNF
Biological Process 3 positive regulation of small molecule metabolic
process GO:0062013 5.81E-07 3 IRS1,IRS2,TNF
Biological Process 5 regulation of insulin secretion GO:0050796 5.92E-07 3 IRS1,IRS2,TNF
Biological Process 4 cellular response to organic substance GO:0071310 6.84E-07 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 2positive regulation of transport GO:0051050 8.06E-07 4IRS1,IRS2,SERPINE1,TNF
Biological Process 5 glucose metabolic process GO:0006006 8.31E-07 3 IRS1,IRS2,TNF
Biological Process 4 response to organonitrogen compound GO:0010243 8.68E-07 4IRS1,IRS2,SLC2A4,TNF
Biological Process 6 cellular response to insulin stimulus GO:0032869 9.13E-07 3 IRS1,IRS2,SLC2A4
Biological Process 4 insulin secretion GO:0030073 9.71E-07 3 IRS1,IRS2,TNF
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 6 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Biological Process 4 regulation of peptide hormone secretion GO:0090276 9.86E-07 3 IRS1,IRS2,TNF
Biological Process 5 positive regulation of fatty acid oxidation GO:0046321 9.95E-07 2 IRS1,IRS2
Biological Process 3 response to hormone GO:0009725 1.07E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 5 carbohydrate homeostasis GO:0033500 1.13E-06 3 IRS1,IRS2,SLC2A4
Biological Process 6 glucose homeostasis GO:0042593 1.13E-06 3 IRS1,IRS2,SLC2A4
Biological Process 5 positive regulation of glycogen biosynthetic
process GO:0045725 1.31E-06 2 IRS1,IRS2
Biological Process 5 regulation of fatty acid beta-oxidation GO:0031998 1.31E-06 2 IRS1,IRS2
Biological Process 5 regulation of protein kinase B signaling GO:0051896 1.33E-06 3 IRS1,IRS2,TNF
Biological Process 3 response to nitrogen compound GO:1901698 1.38E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4 hexose metabolic process GO:0019318 1.39E-06 3 IRS1,IRS2,TNF
Biological Process 5 cellular response to cytokine stimulus GO:0071345 1.61E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4positive regulation of glycogen metabolic
process GO:0070875 1.67E-06 2 IRS1,IRS2
Biological Process 5 peptide hormone secretion GO:0030072 1.71E-06 3 IRS1,IRS2,TNF
Biological Process 3 cellular response to chemical stimulus GO:0070887 1.72E-06 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 3 response to organic substance GO:0010033 1.86E-06 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 5 response to insulin GO:0032868 1.89E-06 3 IRS1,IRS2,SLC2A4
Biological Process 4 protein kinase B signaling GO:0043491 2.05E-06 3 IRS1,IRS2,TNF
Biological Process 3 regulation of hormone secretion GO:0046883 2.05E-06 3 IRS1,IRS2,TNF
Biological Process 4 response to cytokine GO:0034097 2.11E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 3 monosaccharide metabolic process GO:0005996 2.23E-06 3 IRS1,IRS2,TNF
Biological Process 4positive regulation of lipid catabolic process GO:0050996 2.29E-06 2 IRS1,IRS2
Biological Process 4positive regulation of mononuclear cell
migration GO:0071677 2.52E-06 2SERPINE1,TNF
Biological Process 2 regulation of biological quality GO:0065008 3.00E-06 5 IRS1,IRS2,SERPINE1,SLC2A4,TNF
Biological Process 4 lipid catabolic process GO:0016042 3.15E-06 3 IRS1,IRS2,TNF
Biological Process 4 hormone secretion GO:0046879 3.31E-06 3 IRS1,IRS2,TNF
Biological Process 5 cellular response to peptide hormone stimulus GO:0071375 3.35E-06 3 IRS1,IRS2,SLC2A4
Biological Process 7 glucose import in response to insulin stimulus GO:0044381 3.55E-06 2IRS1,SLC2A4
Biological Process 4 hormone transport GO:0009914 3.70E-06 3 IRS1,IRS2,TNF
Biological Process 5 regulation of glucan biosynthetic process GO:0010962 3.83E-06 2 IRS1,IRS2
Biological Process 6 regulation of glycogen biosynthetic process GO:0005979 3.83E-06 2 IRS1,IRS2
Biological Process 4positive regulation of cellular catabolic process GO:0031331 3.95E-06 3 IRS1,IRS2,TNF
Biological Process 3 cellular response to endogenous stimulus GO:0071495 3.97E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 5 regulation of fatty acid oxidation GO:0046320 4.13E-06 2 IRS1,IRS2
Biological Process 5 interleukin-7-mediated signaling pathway GO:0038111 4.75E-06 2 IRS1,IRS2
Biological Process 5 cellular response to peptide GO:1901653 5.01E-06 3 IRS1,IRS2,SLC2A4
Biological Process 6 cellular response to interleukin-7 GO:0098761 5.08E-06 2 IRS1,IRS2
Biological Process 4positive regulation of fatty acid metabolic
process GO:0045923 5.08E-06 2 IRS1,IRS2
Biological Process 5 response to interleukin-7 GO:0098760 5.08E-06 2 IRS1,IRS2
Biological Process 2 secretion by cell GO:0032940 5.14E-06 4IRS1,IRS2,SERPINE1,TNF
Biological Process 5 regulation of glycogen metabolic process GO:0070873 5.42E-06 2 IRS1,IRS2
Biological Process 4 regulation of lipid metabolic process GO:0019216 5.79E-06 3 IRS1,IRS2,TNF
Biological Process 5 regulation of polysaccharide biosynthetic
process GO:0032885 6.13E-06 2 IRS1,IRS2
Biological Process 3 positive regulation of catabolic process GO:0009896 6.14E-06 3 IRS1,IRS2,TNF
Biological Process 4 transmembrane transport GO:0055085 6.49E-06 4IRS1,IRS2,SLC2A4,TNF
Biological Process 4positive regulation of glucose metabolic
process GO:0010907 6.50E-06 2 IRS1,IRS2
Table 7: Biological processes.
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 7 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
Disease Name P-value Annotated Genes Quantity Annotated Genes
Diabetes Mellitus, Experimental 9.35E-14 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Insulin Resistance 2.43E-11 4IRS1, IRS2, SLC2A4, TNF
Diabetes Mellitus 4.78E-11 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Hyperinsulinism 5.11E-11 4IRS1, IRS2, SLC2A4, TNF
Glucose Metabolism Disorders 5.40E-11 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Diabetes Mellitus, Type 2 2.27E-09 4IRS1, IRS2, SLC2A4, TNF
Endocrine System Diseases 9.94E-09 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Liver Neoplasms 4.68E-08 4IRS1, IRS2, SERPINE1, TNF
Metabolic Diseases 5.36E-08 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Nutritional and Metabolic Diseases 7.80E-08 5 IRS1, IRS2, SERPINE1, SLC2A4, TNF
Arteriosclerosis 1.94E-07 3 IRS1, SERPINE1, TNF
Arterial Occlusive Diseases 2.31E-07 3 IRS1, SERPINE1, TNF
Overweight 8.99E-07 3 IRS1, SERPINE1, TNF
Heart Diseases 9.75E-07 4IRS1, SERPINE1, SLC2A4, TNF
Obesity 1.11E-06 3 IRS1, SERPINE1, TNF
Over-nutrition 1.11E-06 3 IRS1, SERPINE1, TNF
Carcinoma, Hepatocellular 1.69E-06 3 IRS1, IRS2, TNF
Nutrition Disorders 2.20E-06 3 IRS1, SERPINE1, TNF
Digestive System Neoplasms 2.37E-06 4IRS1, IRS2, SERPINE1, TNF
Stomach Neoplasms 2.93E-06 3 IRS2, SERPINE1, TNF
Stomach Diseases 3.66E-06 3 IRS2, SERPINE1, TNF
Cardiovascular Diseases 4.01E-06 4IRS1, SERPINE1, SLC2A4, TNF
Body Weight 4.03E-06 3 IRS1, SERPINE1, TNF
Liver Diseases 1.02E-05 4IRS1, IRS2, SERPINE1, TNF
Kidney Failure, Chronic 1.18E-05 2SERPINE1, TNF
Skin Diseases, Vascular 1.28E-05 2SERPINE1, TNF
Renal Insufciency, Chronic 1.39E-05 2SERPINE1, TNF
Atherosclerosis 1.68E-05 2SERPINE1, TNF
Thrombosis 2.06E-05 2SERPINE1, TNF
Table 8: Diseases.
Figure 8: Metadichol’s proposed mechanism of action.
Figure 9: Metadichol expressed gene network.
e highly signicant p values suggest that the genes have more
interactions among themselves than what would be expected for a
random set of proteins of similar size, drawn from the genome. Such
enrichment indicates that the proteins are biologically connected, as
a group. e curated experimental results indicate that the disease
predictions correlate with experimental results that clinical case studies
we have reported [18,32-35]. e top 5 processes of pathways, biological
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 8 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
processes and diseases are all pointing to a clear role in diabetes-related
symptoms.
Based on a proposed model by Benito [36] on this we postulate
Metadichol’s mode of actions in diabetes as shown in Figure 8. e
mechanism shows that downeld genes like IGF1, AKT1, PIK and
GSK3 have important roles by their interactions with the Metadichol
expressed genes.
We further analysed the gene cluster (Figure 9) using CoolGen
soware [37] which shows the importance of the interactions of
genes/enzymes. Based on our proposed mechanism (Figure 8) the key
genes/enzymes, IRS, IRS2, SLC2A4, IGF, PI3k, INSR, GSK3 are highly
connected to multiple genes and enzymes that have an important role
in insulin signaling. e network also suggests that it will be useful
in cardiovascular diseases (CVD) and kidney diseases and we have
conrmed through clinical case studies, Metadichols role in these
diseases as well [38].
Conclusion
Since adult stem cells are present in PBMCs which have similar
expression proles to UBC [39], one could expect similar actions by
Metadichol on these cells leading to observed improvements that we
have documented in diabetes patients [21-23]. e study shows highly
related biologically functional gene clusters are the key in targeting
diseases. A paradigm shi has been proposed in designing drug design
from “one drug one target” to “one drug multiple targets” [40-42]. Our
results show that network-based approach clearly seems to be more
viable [43-45]. Our work reveals the unique complex interactions
between Metadichol which is a nano formulation of mixture of straight
chain aliphatic alcohols and cellular proteins but also the inuence
of their interactions on the function and behaviour of the system.
Metadichol is the rst in a class of molecules that targets multiple genes
and through multiple pathways and thus multiple disease targets which
could be the next wave of the future of drug discovery [46].
References
1. Weir GC, Cavelti-Weder C, Bonner-Weir S (2011) Stem cell approaches for
diabetes: towards beta cell replacement. Genome Med 3: 61. [PubMed]
2. Bernardi S, Severini GM, Zauli G, Secchiero P (2012) Cell-based therapies for
diabetic complications. Exp Diabetes Res 2012: 1-10.
3. Arutyunyan I, Elchaninov A, Makarov A, Fatkhudinov T (2016) Umbilical Cord
as Prospective Source for Mesenchymal Stem Cell-Based Therapy. Stem
Cells Int 2016: 1-17
4. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, et al. (1999)
Multilineage potential of adult human mesenchymal stem cells. Science 284:
143-147
5. Salem HK, Thiemermann C (2010) Mesenchymal stromal cells: current
understanding and clinical status. Stem Cells 28: 585-596
6. Pileggi A (2012) Mesenchymal stem cells for the treatment of diabetes.
Diabetes 61: 1355-1336
7. Si Y, Zhao Y, Hao H, Liu J, Guo Y, et al. (2012) Infusion of mesenchymal stem
cells ameliorates hyperglycemia in type 2 diabetic rats: identication of a novel
role in improving insulin sensitivity. Diabetes 61: 1616-1625
8. Huang S, Czech MP (2007) The GLUT4 Glucose Transporter. Cell Metab 5:
237-252
9. Herman MA, Kahn BB (2006) Glucose transport and sensing in the maintenance
of glucose homeostasis and metabolic harmony. J Clin Invest 116: 1767-1775.
[PubMed]
10. Tolar J, Nauta AJ, Osborn MJ, Mortari AP, McElmurry RT, et al. (2007) Sarcoma
derived from cultured mesenchymal stem cells. Stem Cells 25: 371-379.
[PubMed]
11. Mottaghi S, Larijani B, Shari AM (2012) A novel approach to enhance efcacy
of hypoxic preconditioned mesenchymal stem cells for cell therapy of diabetes.
Med Hypotheses 79: 717-718
12. Staerk J, Dawlaty MM, Gao Q, Maetzel D, Hanna J, et al. (2010) Reprogramming
of human peripheral blood cells to induced pluripotent stem cells. Cell Stem
Cell 7: 20-24
13. Copps KD, White MF (2012) Regulation of insulin sensitivity by serine/
threonine phosphorylation of insulin receptor substrate proteins IRS1 and
IRS2. Diabetologia 55: 2565-2582
14. White MF (2006) Regulating insulin signaling and b-cell function through IRS
proteins. Can J Physiol Pharmacol 84: 725-737
15. Samuel VT, Shulman GI (2012) Mechanisms for insulin resistance: common
threads and missing links. Cell 148: 852-871
16. Boura-Halfon S, Zick Y (2009) Phosphorylation of IRS proteins, insulin action,
and insulin resistance. Am J Physiol Endocrinol Metab 296: 581-591
17. Kahn SE, Hull RL, Utzschneider KM (2006) Mechanisms linking obesity to
insulin resistance and type 2 diabetes. Nature 444: 840-846
18. Raghavan PR, US Patents: 8,722,093 (2014); 9,034,383 (2015); 9,006,292
(2015).
19. Raghavan PR (2018) Metadichol® and CD34 Expression in Umbilical Cord
Cells. J Stem Cell Res Ther 8: 409.
20. Raghavan PR (2016) Metadichol and Type 2 Diabetes A case report. Journal of
the Science of Healing Outcomes 8: 5-10.
21. Raghavan PR (2010) Case Report of Type1. Diabetes. Journal of the Science
of Healing Outcomes 2: 24.
22. Raghavan PR (2018) Metadichol® and Healthy Skin: One Approach many
Possible Cures. J Clin Exp Dermatol Res 9: 1.
23. Lavin DP, White MF, Brazil DP (2016) IRS proteins and diabetic complications.
Diabetologia 59: 2280-2291
24. Withers DJ, Burks DJ, Towery HH, Altamuro SL, Flint CL, et al. (1999) IRS-
2 coordinates IGF-1 receptor-mediated beta-cell development and peripheral
insulin signaling. Nat Genet 23: 32-40
25. Kampmann U, Christensen B, Nielsen TS, Pedersen SB, Ørskov L, et al.
(2011) GLUT4 and UBC9 Protein Expression Is Reduced in Muscle from Type
2 Diabetic Patients with Severe Insulin Resistance. PLoS One 6: e27854.
[PubMed]
26. Akash MSH, Rehman K, Liaqat A (2018) Tumor Necrosis Factor-Alpha: Role
in Development of Insulin Resistance and Pathogenesis of Type 2 Diabetes
Mellitus. J Cell Biochem 119: 105-110
27. Juhan-Vague I, Vague P, Alessi MC, Badier C, Valadier J, et al. (1987)
Relationships between plasma insulin triglyceride, body mass index, and
plasminogen activator inhibitor-1. Diabete Metab 13: 331-336
28. Vague P, Juhan-Vague I, Aillaud MF, Badier C, Viard R, et al. (1986) Correlation
between blood brinolytic activity, plasminogen activator inhibitor level,
plasma insulin level, and relative body weight in normal and obese subjects.
Metabolism 35: 250-253.
29. Smith U (2002) Impaired (‘diabetic’) insulin signaling and action occur in fat
cells long before glucose intolerance. Is insulin resistance initiated in the
adipose tissue? Int J Obes Relat Metab Disord 26: 897-904
30. Davis AP, Grondin CJ, Johnson RJ, Sciaky D, King BL, et al. (2017) The
Comparative Toxicogenomics Database: update 2017. Nucleic Acids Res 45:
D972-D978
31. Curated data were retrieved from the Comparative Toxicogenomics Database
(CTD), MDI Biological Laboratory, Salisbury Cove, Maine, and NC State
University, Raleigh, North Carolina. World Wide Web, (May 2018).
32. Raghavan PR (2017) Systolic and Diastolic BP Control in Metabolic Syndrome
Patients with Metadichol® a Novel Nano Emulsion Lipid. J Cardiol & Cardiovasc
Ther 5: 555660.
33. Raghavan PR (2017) Metadichol® Induced High Levels of Vitamin C: Case
Studies. Vitam Miner 6: 169.
34. Raghavan PR (2017) Metadichol® and Red Cell Distribution Width (RDW) in
CKD patients. J Stem Cell Res Ther 7: 392.
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
Citation: Raghavan PR (2018) Umbilical Cord Cells Treatment with Metadichol® IRS Proteins and GLUT4 Expression and Implications for diabetes.
Stem Cell Res Ther 8: 429. doi: 10.4172/2157-7633.1000429
Page 9 of 9
Volume 8 • Issue 6 • 1000429
J Stem Cell Res Ther, an open access journal
ISSN: 2157-7633
35. Raghavan PR (2017) Metadichol® and Vitamin C Increase In Vivo, an Open-
Label Study. Vitam Miner 6: 163.
36. Benito M (2011) Tissue specicity on insulin action and resistance: past to
recent mechanisms. Acta Physiol 201: 297-312
37. Cancer Research Institute of Southern Medical University.
38. Raghavan PR (2017) Metadichol® and Red Cell Distribution Width (RDW) in
CKD patients. J Stem Cell Res Ther 7: 392.
39. Salomon H, Belmonte A, Nguyen K, Gu Z, Gelfand M, et al. (1994) Comparison
of cord blood and peripheral blood mononuclear cells as targets for viral
isolation and drug sensitivity studies involving human immunodeciency virus
type 1. J Clin Microbiol 32: 2000-2002
40. Hopkins AL (2008) Network pharmacology: the next paradigm in drug discovery.
Nat Chem Biol 4: 682-690. [Pubmed]
41. Hopkins AL (2009) Drug discovery: Predicting promiscuity. Nature 462: 167-
168
42. Apsel B, Blair JA, Gonzalez B, Nazif TM, Feldman ME, et al. (2008) Targeted
polypharmacology: discovery of dual inhibitors of tyrosine and phosphoinositide
kinases. Nat Chem Biol 4: 691-699. [PubMed]
43. Carson MB, Liu C, Lu Y, Jia C, Lu H (2017) A disease similarity matrix based on
the uniqueness of shared genes. BMC Med Genomics 10: 26.
44. Choudhary N, Singh V (2018) A census of P. longum’s phytochemicals and their
network pharmacological evaluation for identifying novel drug-like molecules
against various diseases, with a special focus on neurological disorders. PLoS
One 13: e0191006. [PubMed]
45. Vitali F, Mulas F, Marini P, Bellazzi R (2013) Network-based target ranking for
polypharmacological therapies. J Biomed Inform 46: 876-881. [PubMed]
46. Reddy AS, Zhang S (2013) Polypharmacology: drug discovery for the future.
Expert Rev Clin Pharmacol 6: 41-47. [PubMed]
. [PubMed]
. [PubMed]
. [PubMed]
... Metadichol increases Ascorbic to levels far above what can be achieved by oral Vitamin C supplementation. Metadichol increases Glut-4 expression tenfold, and this can recycle oxidized ascorbic acid [59]. In some cases increased telomerase activity is correlated with upregulation of Telomerase (h-TERT) mRNA [60]. ...
Article
Full-text available
Humans are keenly aware of their mortality. Given a limited time what we do with our life is a reflection of knowledge of our mortality. In 2009 the Nobel prize in medicine to Jack W Szostak, Elizabeth Blackburn, Carol W Greider for their work on Telomerase and scientific research exploded in this area. Telomere protect chromosome ends the Telomerase enzyme maintains Teleomere length. This activity of Telomerase is essential in aging and stem cells and achieving longer life spans. Telomerase is expressed in 85% of human cancer cell lines, but its enzymatic activity is not detectable in most human somatic cells which constitute the vast majority of the cells in the human body. There is a need for increased telomerase activity in stem cells for use in the treatment of therapies where there is an active role for telomerase. Umbilical Cord Blood (UCB) provides an attractive source of stem cells for research and therapeutic uses. Work shown here characterizes the gene expression changes from Umbilical cord cells differentiate toward telomerase on treatment with Metadichol ®. Metadichol ® is a nanoemulsion of long-chain alcohols that is nontoxic. It is a mixture of long-chain alcohols derived from food. The work presented here is about the effect of Metadichol ® on Telomerase expression profile in Umbilical cord cells. Our results using q-RT-PCR show increases of mRNA telomerase expression by Sixteen-fold at one picogram but down-regulates expression at higher concentrations of 100 pg, 1 ng, 100 ng and one microgram per ml concentration. Western blot studies showed expression of Telomerase protein which is slightly higher than control at one picogram, i.e., Telomerase protein expression continues at replacement level. Since it is devoid of toxic effects, it can be directly tested on humans and is in use today as an immune boosting supplement. Metadichol ® increases expression of Klotho an anti-aging gene expression in cancer cell lines by Four to Tenfold , and Klotho gene has been documented to inhibits the growth of cancer cells. Metadichol ® also inhibits TNF, ICAM1, CCL2, and BCAT1 which that is associated with proliferation in yeast and increased metastatic potential in human cancers. It paves the way for safe clinical testing and research and study of Telomerase biology and its use in humans.
... Diseases are connected through closely related gene networks, and this is an approach that can be exploited to modulate multiple targets to enhance therapeutic effect as ligands today are focused on a single target and limited by their efficacy. Metadichol is a safe therapeutic that target multiple genes, pathways and multiple diseases that confirms the relevance of network-based approach of polypharmacology [77] and this has been demonstrated by our studies on other diseases [78][79][80][81][82][83][84][85][86][87][88][89][90][91]. ...
Article
Full-text available
Liver diseases are becoming a major health concern. In the developing countries it is due to microbial infection. In the rest of the developed world it is due to alcohol abuse. Chronic liver disease and cirrhosis are a significant health concern in western countries. It is the fifth most common cause of death, after heart disease, cancer, stroke, and chest disease. The liver is capable of regeneration, but it can be overwhelmed leading to liver diseases like cirrhosis and hepatocellular cancer (HCC). Vitamin D levels are low in most patients with liver diseases, and this suggests possible therapeutic benefits with use of vitamin D or its analogues. Vitamin D, through the vitamin D nuclear receptor (VDR) plays a crucial role in mineral ion homeostasis. The liver has a central role in vitamin D synthesis and there is a need for an agent that will not lead to hypercalcemia. Metadichol, a nano emulsion of long-chain alcohols derived from food, is an inverse agonist of Vitamin D can fill this void. In Diabetic rat studies, it inhibits TNF alpha, ICAM1 (intracellular adhesion molecule), CCL2 (chemokine CC motif) also referred to as monocyte chemoattractant protein 1 (MCP1). All these cytokines, chemokines are known to have important role in liver diseases. We show that Metadichol indeed does work in liver disease patients by normalizing essential liver enzymes ALT, AST and ALP, and GGT. This approach is an example where Metadichol targets multiple genes and via multiple pathways to bring about homeostasis of the liver and is a useful, safe, non-toxic product in treating liver diseases and alleviating a global threat.
... We recently showed that UCB cells on ex vivo treatment with Metadichol ® a Nanoemulsion of long-chain alcohols showed enriched CD34+ cells [20]. Metadichol ® is an inverse agonist [21] of Vitamin D Receptor (VDR), a TNF-α inhibitor [22] and anti-diabetic agent as well as anti-microbial agent [23,24]. ...
Article
Full-text available
CD33 also known as Siglec-3 is endogenously expressed in stem cells and is a marker for the myeloid lineage of cells. Increased expression of CD33 thus allows it to bind to any Sialic Acids (SIAs). These acids are binding sites for pathogens and toxins. By binding to these acids, CD33 can prevent invasion of hosts by these pathogens. Down-regulation of CD33, increase the release of the pro-inflammatory cytokine TNF-α by monocytes that increases reactive oxygen species that are involved in diseases like diabetes mellitus, Alzheimer's, cardiovascular diseases asthma, and in various cancers. The up-regulation of CD33 using Metadichol ® was studied using Wharton's Jelly Mesenchymal Stem Cells (MSCs) isolated from human umbilical cord and were grown in p-35 dishes until confluent and treatment was carried out with different concentrations. One dish was untreated and considered as control. The treated and untreated cells were analyzed using Flow Cytometry. The cells treated at 100 pg of Metadichol ® has shown the highest increase (>400 fold) in CD33++ expression (48.77%) compared to untreated control (0.11%).
Article
Full-text available
Metadichol ® is a nano formulation of long-chain lipid alcohols derived from food It is a inverse agonist of Vitamin D receptor (VDR), Aryl hydrocarbon receptor (AHR), and ROR gamma (RORC) that could have beneficial effects on skin diseases. We now present case studies of patients with various skin diseases who has symptoms mitigated on treatment with Metadichol. The proposed mechanism is that Metadichol by its actions on the above mentioned nuclear receptors affects Th1, TH2,Th 17, IL 17 and IL22 and IL 23 pathways that exacerbate many Skin diseases. Metadichol is the first molecule to successfully navigate around the problems involved with promiscuous ligands and targets. It fulfills the goals of the emerging field of Polypharmacology i.e a single drug is able to bind to multiple targets beyond the "one drug, one target" concept. We show how Metadichol is an innovative treatment for treating multiple skin diseases like eczema, acne, diabetic wounds viral and bacterial infection and also improving skin texture. Metadichol ® is a safe non toxic low cost solution and is an alternative to numerous clinical candidates in combating over 3000 skin diseases.
Article
Full-text available
Piper longum (P. longum, also called as long pepper) is one of the common culinary herbs that has been extensively used as a crucial constituent in various indigenous medicines, specifically in traditional Indian medicinal system known as Ayurveda. For exploring the comprehensive effect of its constituents in humans at proteomic and metabolic levels, we have reviewed all of its known phytochemicals and enquired about their regulatory potential against various protein targets by developing high-confidence tripartite networks consisting of phytochemical—protein target—disease association. We have also (i) studied immunomodulatory potency of this herb; (ii) developed subnetwork of human PPI regulated by its phytochemicals and could successfully associate its specific modules playing important role in diseases, and (iii) reported several novel drug targets. P10636 (microtubule-associated protein tau, that is involved in diseases like dementia etc.) was found to be the commonly screened target by about seventy percent of these phytochemicals. We report 20 drug-like phytochemicals in this herb, out of which 7 are found to be the potential regulators of 5 FDA approved drug targets. Multi-targeting capacity of 3 phytochemicals involved in neuroactive ligand receptor interaction pathway was further explored via molecular docking experiments. To investigate the molecular mechanism of P. longum’s action against neurological disorders, we have developed a computational framework that can be easily extended to explore its healing potential against other diseases and can also be applied to scrutinize other indigenous herbs for drug-design studies.
Article
Full-text available
Vitamin C, also known as ascorbic acid, is a water-soluble antioxidant. Today we meet our requirements of vitamin C through consumption of fruits and vegetables or by supplementation. Homo sapiens cannot produce vitamin C like many other species that can convert glucose to vitamin C. The gene for enzyme production is dormant in humans. The gene, GULO, that we all carry converts glucose to Vitamin C. in other species but not in humans and primates. The open-label study showed Metadichol ® raised levels of vitamin C by 3 fold, endogenously without supplementation of Vitamin C. Possible mechanisms for the increased Vitamin C levels through antioxidant pathways are presented. Metadichol ® [1] is a nano-formulation of long chain alcohols derived from sugar cane. In addition to increased Vitamin C levels reduction in Potassium and uric acid, and decreased blood pressure and improvement in quality of life issues were also observed.
Article
Full-text available
Red blood cells originate in the bone marrow. Red cell distribution width (RDW) show sizes of circulating erythrocytes (RBC) and has been explored in several large clinical databases to be a robust marker of adverse clinical outcomes in patients. The prognostic value of RDW is seen in other conditions with end-organ dysfunction such as renal failure or. Elevated RDW levels are of significance in diseases such as kidney diseases. The high RDW levels are an indication of increased oxidative stress and closely related to the presence and poor prognosis of the disease. No known therapy exists that can normalize RDW levels. In this paper, we present here case studies using Metadichol® [1] that leads to normal RDW levels in patients with CKD and PKD.
Article
Full-text available
Background Complex diseases involve many genes, and these genes are often associated with several different illnesses. Disease similarity measurement can be based on shared genotype or phenotype. Quantifying relationships between genes can reveal previously unknown connections and form a reference base for therapy development and drug repurposing. Methods Here we introduce a method to measure disease similarity that incorporates the uniqueness of shared genes. For each disease pair, we calculated the uniqueness score and constructed disease similarity matrices using OMIM and Disease Ontology annotation. Results Using the Disease Ontology-based matrix, we identified several interesting connections between cancer and other disease and conditions such as malaria, along with studies to support our findings. We also found several high scoring pairwise relationships for which there was little or no literature support, highlighting potentially interesting connections warranting additional study. Conclusions We developed a co-occurrence matrix based on gene uniqueness to examine the relationships between diseases from OMIM and DORIF data. Our similarity matrix can be used to identify potential disease relationships and to motivate further studies investigating the causal mechanisms in diseases.
Article
Full-text available
The paper presents current evidence on the properties of human umbilical cord-derived mesenchymal stem cells, including origin, proliferative potential, plasticity, stability of karyotype and phenotype, transcriptome, secretome, and immunomodulatory activity. A review of preclinical studies and clinical trials using this cell type is performed. Prospects for the use of mesenchymal stem cells, derived from the umbilical cord, in cell transplantation are associated with the need for specialized biobanking and transplant standardization criteria.
Article
Full-text available
IRS proteins are cellular adaptor molecules that mediate many of the key metabolic actions of insulin. When tyrosine is phosphorylated by the activated insulin receptor, IRS proteins recruit downstream effectors, such as phosphoinositide 3-kinase and mitogen-activated protein kinase, in order to elicit cellular responses such as glucose uptake, lipid metabolism and cell proliferation. There are two main IRS proteins in humans (IRS1 and IRS2), both of which are widely expressed. Given their central role in the insulin signalling pathway, it is not surprising that male mice lacking Irs1 or Irs2 present with elevated blood glucose or type 2 diabetes, respectively. For reasons yet to be identified, female Irs2−/− mice do not develop type 2 diabetes. A number of organs are affected by complications of diabetes; macrovascular complications include stroke and coronary artery disease, while nephropathy, neuropathy and retinopathy fall into the category of microvascular complications. Given the serious consequences of these complications on patient morbidity and mortality, it is essential to identify the molecular pathogenesis underlying diabetic complications, with a view to improving therapeutic intervention and patient outcomes. A number of recently published papers have converged on the hypothesis that the loss of insulin signalling and IRS proteins is instrumental to the development and/or progression of diabetic complications. This review will summarise some highlights from the published work in which this hypothesis is discussed.
Article
Full-text available
Background Metadichol (1,2) is a Nano emulsion of long-chain alcohols called policosanols which are found in many foods like rice, wheat, grapes, sugar cane, apple and many others (3). It acts on membrane receptors in cells throughout the body to stimulate the immune system and inhibit a variety of disease processes, including those that result in metabolic diseases such as diabetes, obesity and hypertension. Methods A 38-year-old male of middle eastern origin was diagnosed as diabetic after complaining of tiredness and bouts of hunger. He was not on any medication and chose to be treated with Metadichol @ 10 mg per day. Findings Metadichol helped to lower his fasting blood sugar level from 300 mg/dl to normal in 6 weeks. His HBA1C was reduced from 9.8% to 6.2% in 12 weeks. After 32 more months, his diabetic indicators remain normal. Interpretation Metadichol is safe and effective in controlling blood sugar and HbA1C levels in humans. Metadichol has been shown to bind to the vitamin D receptor (2) as an inverse agonist. However, it acts more like a protean agonist ligand (4) to increase or decrease activity depending on the system. Since Metadichol has no known negative side effects and consists of natural components of common foods, Metadichol has the potential to serve as a novel treatment for type 2 diabetes.
Article
With the growing understanding of complex diseases, the focus of drug discovery has shifted from the well-accepted "one target, one drug" model, to a new "multi-target, multi-drug" model, aimed at systemically modulating multiple targets. In this context, polypharmacology has emerged as a new paradigm to overcome the recent decline in productivity of pharmaceutical research. However, finding methods to evaluate multicomponent therapeutics and ranking synergistic agent combinations is still a demanding task. At the same time, the data gathered on complex diseases has been progressively collected in public data and knowledge repositories, such as protein-protein interaction (PPI) databases. The PPI networks are increasingly used as universal platforms for data integration and analysis. A novel computational network-based approach for feasible and efficient identification of multicomponent synergistic agents is proposed in this paper. Given a complex disease, the method exploits the topological features of the related PPI network to identify possible combinations of hit targets. The best ranked combinations are subsequently computed on the basis of a synergistic score. We illustrate the potential of the method through a study on Type 2 Diabetes Mellitus. The results highlight its ability to retrieve novel target candidates, which role is also confirmed by the analysis of the related literature.
In recent years, even with remarkable scientific advancements and a significant increase of global research and development spending, drugs are frequently withdrawn from markets. This is primarily due to their side effects or toxicities. Drug molecules often interact with multiple targets, coined as polypharmacology, and the unintended drug-target interactions could cause side effects. Polypharmacology remains one of the major challenges in drug development, and it opens novel avenues to rationally design the next generation of more effective, but less toxic, therapeutic agents. This review outlines the latest progress and challenges in polypharmacology studies.