Content uploaded by Chao Xu
Author content
All content in this area was uploaded by Chao Xu on Sep 17, 2018
Content may be subject to copyright.
fphys-09-01079 August 30, 2018 Time: 17:3 # 1
ORIGINAL RESEARCH
published: 03 September 2018
doi: 10.3389/fphys.2018.01079
Edited by:
Nour Eissa,
University of Manitoba, Canada
Reviewed by:
Josefina Blasco,
University of Barcelona, Spain
Tiziano Verri,
University of Salento, Italy
*Correspondence:
Xiang-Fei Li
xfli@njau.edu.cn
Specialty section:
This article was submitted to
Aquatic Physiology,
a section of the journal
Frontiers in Physiology
Received: 25 May 2018
Accepted: 19 July 2018
Published: 03 September 2018
Citation:
Xu C, Liu W-B, Zhang D-D, Shi H-J,
Zhang L and Li X-F (2018)
Benfotiamine, a Lipid-Soluble Analog
of Vitamin B1, Improves
the Mitochondrial Biogenesis
and Function in Blunt Snout Bream
(Megalobrama amblycephala) Fed
High-Carbohydrate Diets by
Promoting the AMPK/PGC-1β/NRF-1
Axis. Front. Physiol. 9:1079.
doi: 10.3389/fphys.2018.01079
Benfotiamine, a Lipid-Soluble Analog
of Vitamin B1, Improves the
Mitochondrial Biogenesis and
Function in Blunt Snout Bream
(Megalobrama amblycephala) Fed
High-Carbohydrate Diets by
Promoting the AMPK/PGC-1β/NRF-1
Axis
Chao Xu, Wen-Bin Liu, Ding-Dong Zhang, Hua-Juan Shi, Li Zhang and Xiang-Fei Li*
Key Laboratory of Aquatic Nutrition and Feed Science of Jiangsu Province, College of Animal Science and Technology,
Nanjing Agricultural University, Nanjing, China
This study evaluated the effects of benfotiamine on the growth performance and
mitochondrial biogenesis and function in Megalobrama amblycephala fed high-
carbohydrate (HC) diets. The fish (45.25 ±0.34 g) were randomly fed six diets: the
control diet (30% carbohydrate, C), the HC diet (43% carbohydrate), and the HC diet
supplemented with different benfotiamine levels (0.7125 (HCB1), 1.425 (HCB2), 2.85
(HCB3), and 5.7 (HCB4) mg/kg) for 12 weeks. High-carbohydrate levels remarkably
decreased the weight gain rate (WGR), specific growth rate (SGR), relative feed
intake (RFI), feed conversion ratio (FCR), p-adenosine monophosphate (AMP)-activated
protein kinase (AMPK)α/t-AMPKαratio, peroxisome proliferator-activated receptor-γ
coactivator-1β(PGC-1β) and nuclear respiratory factor-1 (NRF-1) protein expression,
complexes I, III, and IV activities, and hepatic transcriptions of cytochrome b (CYT-
b) and cytochrome c oxidase-2 (COX-2), whereas the opposite was true for plasma
glucose, glycated serum protein, advanced glycation end product and insulin levels,
tissue glycogen and lipid contents, hepatic adenosine triphosphate (ATP) and AMP
contents and ATP/AMP ratio, complexes V activities, and the expressions of AMPKα-2,
PGC-1β, NRF-1, mitochondrial transcription factor A (TFAM), mitofusin-1 (Mfn-1), optic
atrophy-1 (Opa-1), dynamin-related protein-1 (Drp-1), fission-1 (Fis-1), mitochondrial
fission factor (Mff), and ATP synthase-6 (ATP-6). As with benfotiamine supplementation,
the HCB2 diet remarkably increased WGR, SGR, tissue glycogen and lipid contents,
AMP content, p-AMPKα/t-AMPKαratio, PGC-1βand NRF-1 levels, complexes I, III, IV,
and V activities, and hepatic transcriptions of AMPKα-2, PGC-1β, NRF-1, TFAM, Mfn-
1, Opa-1, CYT-b, COX-2, and ATP-6, while the opposite was true for the remaining
indicators. Overall, 1.425 mg/kg benfotiamine improved the growth performance and
Frontiers in Physiology | www.frontiersin.org 1September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 2
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
mitochondrial biogenesis and function in fish fed HC diets by the activation of the
AMPK/PGC-1β/NRF-1 axis and the upregulation of the activities and transcriptions of
mitochondrial complexes as well as the enhancement of mitochondrial fusion coupled
with the depression of mitochondrial fission.
Keywords: benfotiamine, glucose metabolism, mitochondrial biogenesis, mitochondrial function, Megalobrama
amblycephala
INTRODUCTION
As the most economical energy source, carbohydrates are now
being commonly incorporated into aquafeeds to improve the
physical quality of the feed and reduce the catabolism of proteins
and lipids by aquatic animals (Yang et al., 2018). However,
it is generally acknowledged that fish show poor capability
in utilizing carbohydrates for energy purposes than terrestrial
animals (Hemre et al., 2002;Enes et al., 2009). Furthermore, most
species (especially carnivorous ones) often exhibit prolonged
hyperglycemia after an intake of carbohydrate-enriched diets
or a glucose load (Moon, 2001;Kamalam et al., 2017) as is
similar to the symptoms of type 2 diabetes mellitus observed
in mammals. Previous studies have suggested that the poor
carbohydrate utilization or the persistent hyperglycemia in fish
may be attributed to the relatively low number of insulin
receptors, the low affinity of glucose transporter proteins for
glucose, a poor inhibition of postprandial gluconeogenesis, poor
hepatic lipogenesis from glucose, etc (Panserat et al., 2000;Enes
et al., 2009). Recently, several approaches such as metabolomics
and transcriptomics are being employed to assess diet-induced
metabolic syndromes in fish (Miao et al., 2017;Prathomya
et al., 2017;Prisingkorn et al., 2017). Findings from such studies
suggest that the disruption of the energy homeostasis in fish
is closely implicated in the development of disturbances in
the glucose metabolism. Therefore, further biochemical and
molecular investigations of the energy metabolism are necessary
and will undoubtedly facilitate better understanding of the
utilization of carbohydrates by fish.
In eukaryotes, the mitochondria are regarded as the most
important organelles responsible for cellular ATP synthesis and
metabolism (Scheffler, 2008). Mitochondrial function mainly
depends on the mitochondrial content and shape (Tang et al.,
2014). Generally, increased mitochondrial content has been
observed in response to challenges involving high-energy
demands, such as in electrical stimulation, exercise, cold,
heat, stress, etc. (Booth and Thomason, 1991;Cannon and
Nedergaard, 2004;Bremer and Moyes, 2011;Gao and Moyes,
2016). Mitochondrial biogenesis is a complex and precise process
involving the replication of mitochondrial DNA (mtDNA)
and the expression of nuclear and mitochondrial genes (Tang
et al., 2014). In this regard, adenosine monophosphate (AMP)-
activated protein kinase (AMPK), known as the cellular “fuel
gauge,” may play a central role, since the energy homeostasis
mediated by it is closely related to the biosynthesis and
function of mitochondria (Zhao et al., 2013). Also, the
AMPK can be activated by a variety of metabolic stresses
that typically increase the cellular AMP/ATP ratio, such as
hypoxia, exercise, a glucose load, energy restriction, and so on
(Hardie et al., 2003). Once activated, AMPK phosphorylates
the mitochondrial master regulator: peroxisome proliferator-
activated receptor γcoactivator-1 (especially PGC-1αand PGC-
1βisoforms) (Reznick and Shulman, 2006;Bremer et al.,
2016). Subsequently, the phosphorylated PGC-1 activates the
nuclear respiratory factor-1 (NRF-1), which, in turn, regulates
the expressions of both mitochondrial and nuclear genes
encoding respiratory chain subunits and other proteins that
are responsible for mitochondrial biogenesis and function (Wu
et al., 1999;Tang et al., 2014). However, these activities
have been mainly observed in mammals. Relevant information
in fish has been quite limited until now. Recently, some
differences have been identified between fish and mammals
related to the mitochondrial biogenesis pathway. Accordingly,
PGC-1βhas been demonstrated to be more effective than PGC-
1αwhen the mitochondrial gene expression was observed,
although they have similar capabilities to induce mitochondrial
biogenesis in mammals (Bremer et al., 2016). In addition,
the mitochondrial function in fish also has been reported to
be affected by a large number of factors, including genetics,
growth and/or developmental stages, water temperature, diet
composition, etc. (LeMoine et al., 2008;Eya et al., 2011, 2012,
2017;Liao et al., 2016). However, information concerning
carbohydrate metabolism is still unknown. Considering this, it is
of great significance to investigate the potential effects of high-
carbohydrate (HC) feeding on the mitochondrial function of
fish and characterize the underlying mechanisms. This might
facilitate the discovery of effective approaches to improve the
mitochondrial function in fish as well as open a new approach
to promote its carbohydrate utilization.
Mitochondrial dysfunction is a crucial triggering factor of
metabolic diseases such as insulin resistance and diabetes
(Kelley et al., 2002;Petersen et al., 2003). At present,
accumulating evidence has indicated that the supplementation
of mitochondrial nutrients (mt-nutrients) could bring about
a series of physiological benefits on mitochondrial structure
and function, such as (1) the improvement of mitochondrial
membrane structure; (2) the enhancement of mitochondrial
enzymes activities by elevating cofactors levels; (3) increase
in antioxidant defenses by scavenging excess of free radicals,
and so on (Liu and Ames, 2005). Among these mt-nutrients,
vitamin B1has attracted considerable attention as it can
serve as the essential cofactor to regulate the activity of
various mitochondrial enzymes, thereby, improving intracellular
mitochondrial function (Depeint et al., 2006). However, vitamin
B1is excreted quickly from the body due to its water-
soluble characteristic, which can lead to a reduction in its
Frontiers in Physiology | www.frontiersin.org 2September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 3
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
biological functions (Beltramo et al., 2008). Benfotiamine is a
lipid-soluble analog of vitamin B1with higher absorption and
bioavailability than vitamin B1, and is commonly used as a
food supplement for the treatment of diabetic complications
(Beltramo et al., 2008). It can improve glucose homeostasis by
blocking three major pathways associated with hyperglycemic
damage: the hexosamine, the advanced glycation end products
(AGEs) formation, and the diacylglycerol (DAG)–protein
kinase C pathways (Hammes et al., 2003). In addition,
benfotiamine administration can remarkably enhance the activity
of dehydrogenase enzyme complexes by increasing intracellular
thiamine diphosphate (TPP) levels, thereby increasing glucose
oxidation in mitochondria (Fraser et al., 2012). Moreover,
benfotiamine also has been demonstrated to be able to alleviate
the stress caused by the overproduction of superoxide anion in
the mitochondrial electron transport chain (Chung et al., 2014).
Despite the fact that significant improvements of mitochondrial
function have been confirmed in mammals, such information
in aquatic animals is extremely scarce. Whether benfotiamine
can improve the glucose homeostasis in fish through the
enhancement of mitochondrial function still needs to be
elucidated.
Blunt snout bream (Megalobrama amblycephala) is a
commercially important freshwater fish in China (Xu et al.,
2016). Due to its herbivorous feeding habits, diets formulated
for this fish usually contain large proportions of carbohydrates
to reduce the feed cost and maximize the profit. However,
severe metabolic burden coupled with the compromised glucose
homeostasis is usually observed in this species after the feeding of
HC diets (Li et al., 2014). Previously, our study had demonstrated
that long-term administration of benfotiamine at 2.85 mg/kg
could significantly improve the glucose homeostasis of this
species being fed HC diets. However, the underlying mechanisms
are still poorly understood. In addition, the growth performance
was slightly compromised, suggesting that this dosage might be
too high for this species (Xu et al., 2017a). Hence, we speculated
that (1) a dose-dependent effect of benfotiamine might exist on
the growth performance and intermediary metabolism of fish
and (2) benfotiamine might benefit the glucose homeostasis of
fish through the promotion of mitochondrial function. Bearing
these facts in mind, the present study was conducted to (1)
evaluate the effects of different dietary levels of benfotiamine on
the growth performance, tissue glycogen and lipid deposition,
and levels of plasma metabolites in juvenile blunt snout bream
fed an HC diet and (2) investigate its beneficial effects on
mitochondrial biogenesis and function in the liver of this species
of fish. The findings obtained here might provide us with some
new insights into carbohydrate metabolism in fish as well as
facilitate the development of nutritional strategies to improve the
carbohydrate utilization by aquatic animals.
MATERIALS AND METHODS
Ethics Statement
The care and use of animals in the present study followed
the ethical guidelines of the Nanjing Agriculture University in
China [permit number: SYXK (Su) 2011-0036]. All experimental
procedures involving animals were conducted following the
Guidelines for the Care and Use of Laboratory Animals in
China.
Benfotiamine and Diets
Benfotiamine was obtained from Xian Reain Biomedical
Company (Xian, China) with a purity of at least 98%. Six
isonitrogenous and isolipidic diets were formulated, including
a control diet (30% carbohydrate, C), an HC diet (43%
carbohydrate), and the HC diet supplemented with different
benfotiamine levels [0.7125 (HCB1), 1.425 (HCB2), 2.85 (HCB3),
and 5.7 (HCB4) mg/kg, respectively]. Dietary carbohydrate levels
were adopted according to our previous studies (Li et al.,
2014). Feed formulation and proximate composition of the
experimental diets are presented in Table 1. Proteins were derived
from fish meal, soybean meal, rapeseed meal, and cottonseed
meal. Dietary lipids were derived from fish oil and soybean oil.
Corn starch was adopted to meet the dietary carbohydrate levels
required. Microcrystalline cellulose was included as the filler.
Animals, Experimental Conditions, and
Sampling
Juvenile blunt snout bream were purchased from the National
Fish Hatchery Station in Yangzhou (Jiangsu, China). Before
the experiment, fish were acclimatized to the experimental
conditions for 2 weeks, during which they were fed a commercial
diet (32% protein, 6% lipids, and 33% carbohydrates) to apparent
satiation, manually, three times daily. After acclimatization, 360
fish of similar size (average weight: 45.25 ±0.34 g) were randomly
distributed among 24 indoor tanks (300 L volume) at a number
of 15 fish per tank. Fish in each tank were randomly fed with one
of the six experimental diets. Each diet was tested in four tanks.
Fish were fed to visual satiation thrice daily (07:00, 12:00, and
17:00 h) for 12 weeks. Throughout the experimental period, water
temperature averaged 27.4 ±0.6 ◦C, pH 7.4–7.5, photoperiod 12:
12 h (dark: light), and dissolved oxygen was maintained above
5.0 mg/L.
After the last meal, all the fish in each tank were fasted for
24 h to empty gut content, and then counted and weighed.
Subsequently, 4 fish from each tank were randomly selected and
anesthetized with MS-222 (tricaine methanesulfonate; Sigma,
United States) at 100 mg/L. Blood was drawn into heparinized
tubes as described by Xu et al. (2017b). Liver, muscle, and adipose
tissue were removed and immediately frozen in liquid N2, and
then stored at −80◦C until assayed.
Analysis of Proximate Composition,
Plasma and Liver Metabolites, and
Tissue Glycogen and Lipid Contents
The proximate composition of diets was determined as follows:
dry matter by drying in an oven at 105◦C to a constant weight;
protein content (nitrogen ×6.25) using the Kjeldahl method
after acid digestion (FOSS KT260, Höganäs, Sweden); crude lipid
content by ether extraction in a Soxtec System HT (Soxtec System
HT6, Tecator, Höganäs, Sweden); ash by incineration in a muffle
Frontiers in Physiology | www.frontiersin.org 3September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 4
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
TABLE 1 | Formulation and proximate composition of the experimental diets.
C HC HCB1 HCB2 HCB3 HCB4
Formulation (%)
Fish meal 8.00 8.00 8.00 8.00 8.00 8.00
Soybean meal 26.00 26.00 26.00 26.00 26.00 26.00
Rapeseed meal 17.00 17.00 17.00 17.00 17.00 17.00
Cottonseed meal 17.00 17.00 17.00 17.00 17.00 17.00
Fish oil 2.00 2.00 2.00 2.00 2.00 2.00
Soybean oil 2.00 2.00 2.00 2.00 2.00 2.00
Corn starch 12.00 25.00 25.00 25.00 25.00 25.00
Benfotiamine (mg/kg) 0 0 0.7125 1.425 2.85 5.7
Microcrystalline cellulose 13.00 0.00 0.00 0.00 0.00 0.00
Calcium biphosphate 1.80 1.80 1.80 1.80 1.80 1.80
Premix∗1.20 1.20 1.20 1.20 1.20 1.20
Proximate composition (% air-dry basis)
Moisture 6.96 6.85 6.92 6.95 6.90 6.87
Crude lipid 5.93 5.71 5.78 5.66 5.77 5.87
Ash 8.46 8.28 8.12 8.23 8.34 8.20
Crude protein 29.82 30.12 30.31 30.03 30.02 30.11
Crude fiber 16.97 6.18 6.29 6.30 6.23 6.28
Nitrogen-free extract†31.86 42.75 42.58 42.83 42.74 42.67
Energy (MJ/kg) 19.09 19.24 19.38 19.31 19.23 19.30
C, the control diet; HC, the high-carbohydrate diet; HCB1, the HC diet supplemented with 0.7125 mg/kg benfotiamine; HCB2, the HC diet supplemented with 1.425 mg/kg
benfotiamine; HCB3, the HC diet supplemented with 2.85 mg/kg benfotiamine; HCB4, the HC diet supplemented with 5.7 mg/kg benfotiamine (the same below). ∗Premix
supplied the following minerals and/or vitamins (per kg): CuSO4·5H2O, 2.0 g; FeSO4·7H2O, 25 g; ZnSO4·7H2O, 22 g; MnSO4·4H2O, 7 g; Na2SeO3, 0.04g; KI, 0.026 g;
CoCl2·6H2O, 0.1 g; Vitamin A, 900,000 IU; Vitamin D, 200,000 IU; Vitamin E, 4500 mg; Vitamin K3, 220 mg; Vitamin B1, 320 mg; Vitamin B2, 1090 mg; Vitamin B5,
2000 mg; Vitamin B6, 500 mg; Vitamin B12, 1.6 mg; Vitamin C, 5000 mg; Pantothenate, 1000 mg; Folic acid, 165 mg; Choline, 60,000 mg. †Calculated by difference
(100 - moisture - crude protein - crude lipid - ash - crude fiber).
furnace at 550◦C for 4 h; gross energy content by an adiabatic
bomb calorimeter (PARR 1281, United States), and crude fiber
was determined by the fritted glass crucible method using an
automatic analyzer (ANKOM A2000i, United States).
Plasma glucose level was determined using the glucose
oxidase method (Asadi et al., 2009). Plasma glycated serum
protein (GSP) and AGEs levels were assayed by the method
detailed by David and John (1984) and Monnier et al.
(1986), respectively. Plasma insulin level was measured using a
heterologous radioimmunoassay method using bonito (Thunnus
thynnus) insulin as the standard and rabbit antibonito insulin
as antiserum (Gutierrez et al., 1984). This method has
been confirmed in Cyprinus carpio (Hertz et al., 1989),
which shares the same classification (Cyprinidae family) with
M. amblycephala. Hepatic contents of adenosine triphosphate
(ATP) and AMP were assessed as described by Jaworek et al.
(1974) and Lund et al. (1975), respectively. Tissue glycogen
and lipid contents were analyzed following the methods
detailed by Folch et al. (1957) and Keppler et al. (1974),
respectively.
Analysis of Mitochondrial Respiratory
Chain Complex Enzyme Activities
Liver mitochondria isolation was performed using a commercial
kit (G006, Nanjing Jiancheng Bioengineering Institute, Nanjing,
China). Briefly, after the last meal, fresh liver samples
were obtained from another tank with 4 fish, and were
then placed immediately in the ice-cold extraction medium
consisting of 10 mM KH2PO4, 250 mM sucrose, and 5 mM
ethylenediaminetetraacetic acid. Subsequently, 1 g of liver tissue
was homogenized in 10 mL of cold medium. The homogenates
were spun down for 10 min at 1,500 gin a refrigerated centrifuge.
The supernatants were retained in a new centrifuge tube. For
the preparation of the mitochondrial fraction, the remaining
supernatants were centrifuged by a second spin. The sediment
was washed three times with the previously mentioned medium,
and was then resuspended in a small volume of medium
plus fatty acid-free bovine serum albumin (1 mg/mL). The
mitochondrial suspensions were immediately stored at −80◦C
for subsequent analysis. Mitochondrial protein concentration
was determined using the method of Bradford and Dodd (1977).
The activities of complex I–III were measured following the
methods detailed by Jeejeebhoy (2002). Furthermore, complex IV
and V activities were analyzed following the methods of Kirby
et al. (2007).
Western Blot and Quantitative
Polymerase Chain Reaction (qPCR)
Analysis
Hepatic protein extraction was performed according to our
previous study (Xu et al., 2018). Subsequently, protein lysates
(20 µg of protein) were separated on a sodium dodecyl
sulfate–polyacrylamide gel electrophoresis gel using a Mini-
PROTEAN system (BioRad, Spain) for 1–2 h at 100 V. Then,
the electroblotted proteins were transferred to a polyvinylidene
Frontiers in Physiology | www.frontiersin.org 4September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 5
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
difluoride (PVDF) membrane (Millipore Corp., Bedford, MA,
United States). The specific primary antibodies used were
anti-β-actin (BM3873, Boster, China, 1:5000 dilution), anti-
AMPKα(#2532, Cell Signaling Technology, United States,
1:2000 dilution), anti-phospho-AMPKα(#2535, Cell Signaling
Technology, United States, 1:2000 dilution), anti-PGC-1β
(22378-1-AP, Proteintech, United States, 1:1000 dilution), and
anti-NRF1 (ab34682, Abcam, Cambridge, MA, United States,
1:1000 dilution). After washing, PVDF membranes were
incubated with anti-rabbit (#7074, Cell Signaling Technology,
United States, 1:2000 dilution) and anti-rabbit (BA1054, Boster,
China, 1:50,000 dilution) secondary antibodies, respectively.
Immune complexes were detected by a chemiluminescent
substrate (Gel Imagine CHEMI-SMART-3126, France) based
on the manufacturer’s instructions, and visualized with a
luminescent image analyzer (Fujifilm LAS-3000, Japan). The
protein levels were normalized by β-actin, and the intensities
of each lane were quantified using the densitometry band
analysis tool in Image J 1.44p (U.S. National Institutes of Health,
Bethesda, MD, United States).
Total RNA extraction and cDNA synthesis were performed
using the liver samples according to our previous studies
(Xu et al., 2017a, 2018). Briefly, the quantity and purity of
isolated RNA were determined by absorbance measures at 260
and 280 nm, and its integrity was tested by electrophoresis in
1.0% formaldehyde denaturing agarose gels. Specific primers for
PGC-1β, NRF-1, Mfn-1, Mfn-2, Opa-1, Drp-1, Fis-1, Mff, and
uncoupling protein (UCP)-2 were designed using primer premier
5.0 based on the partial cDNA sequences of the target genes
using the transcriptome analysis of blunt snout bream (Gao et al.,
2012). The AMPKα-1, AMPKα-2, TFAM, ND-1, CYT B, COX-1,
COX-2, and ATP-6 were designed using the published sequences
of blunt snout bream (Table 2). All primers were synthesized
by Invitrogen BioScience & Technology Company (Shanghai,
China). Subsequently, the real-time qPCR was run on an ABI
7500 real-time PCR system (Applied Biosystems, Carlsbad, CA,
United States) using the SYBR Green II Fluorescence Kit (Takara
Bio. Inc., Japan). The fluorescent quantitative PCR reaction
solution consisted of 2.00 µL template (equivalent to 500 ng
cDNA), 10.00 µL SYBRR
premix Ex TaqTM (2×), 0.40 µL
Rox Reference Dye II, 0.40 µL PCR Forward Primer (10 µM),
0.40 µL PCR Reverse Primer (10 µM), and 6.80 µL dH2O. The
qPCR consisted of 40 cycles with the first step of denaturation
at 95◦C for 30 s and a final extension of 95◦C for 5 s and
annealing at 60◦C for 34 s. All amplicons were initially separated
by agarose gel electrophoresis to ensure that they were of the
correct size. Finally, the relative transcripts of target mRNA were
analyzed by elongation factor 1 α(EF1α) gene using the 2−11CT
method.
Statistical Analysis
All results are presented as mean ±standard error of the mean
(SEM). Before statistical analysis, all data were tested for the
normality of distribution and homogeneity of variances among
different treatments. Then, data were subjected to one-way
ANOVA and Tukey’s multiple tests. Differences were considered
significant if a P-value of less than 0.05 was obtained. All the
statistical analyses were done with SPSS 22.0 for Windows (SPSS
Inc, Chicago, IL, United States).
RESULTS
Growth Performance
Growth performances of blunt snout bream are shown in Table 3.
During a 12-week feeding trial, no mortality was observed
among all the groups. The final weights (FWs), weight gain rate
(WGR), specific growth rate (SGR), relative feed intake (RFI),
feed conversion ratio (FCR), and hepatosomatic index (HIS) of
fish fed the HC diet were all lower than that of the C group,
but significant differences were observed in FW, RFI, and FCR
(P<0.05). Additionally, FW, WGR, and SGR all increased
significantly (P<0.05) as benfotiamine levels increased from
0 to 1.425 mg/kg, but decreased with further increasing levels.
However, both RFI and FCR showed an opposite trend, but
no significant difference (P>0.05), with the minimum value
observed in fish fed the HCB2 diet. Moreover, benfotiamine
supplementation further increased HIS.
Plasma Metabolites, Tissue Glycogen
and Lipid Contents, and Liver
Biochemistry Parameters
As can be seen from Table 4 and Figure 1, plasma glucose, GSP,
AGES and insulin levels, ATP and AMP contents and ATP/AMP
ratio as well as liver and muscle tissue glycogen and lipid contents
of fish fed the HC diet were all significantly (P<0.05) higher than
that of the C group. As for the HC groups, the supplementation
of benfotiamine led to a significant (P<0.05) increase of
plasma insulin levels, tissue glycogen and lipid contents and
AMP contents, whereas the opposite was true for plasma glucose,
GSP and AGES levels, and ATP contents and the ATP/AMP
ratio.
Hepatic Protein Expressions of AMPKα,
PGC-1β, and NRF-1
As can be seen from Figure 2, fish fed the HC diet had
significantly (P<0.05) lower p-AMPKα/t-AMPKαratio and
PGC-1βprotein expressions than that of the C group. As for the
HC groups, the supplementation of benfotiamine significantly
increased (P<0.05) the p-AMPKα/t-AMPKαratio and PGC-1β
protein expression, while little difference (P>0.05) was observed
in the NRF-1 content.
Hepatic Transcriptions of the Genes
Involved in Mitochondrial Biogenesis
As can be seen from Figure 3, no statistical difference (P>0.05)
was observed in the transcriptions of AMPKα-1 and Mfn-2
among all the treatments. Fish fed the HC diet had significantly
(P<0.05) higher transcriptional levels of AMPKα-2, Drp-
1, Fis-1, and Mff than that of the C group, whereas the
opposite was true for PGC-1βexpression. As for the HC groups,
the supplementation of benfotiamine significantly increased
Frontiers in Physiology | www.frontiersin.org 5September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 6
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
TABLE 2 | Nucleotide sequences of the primers used to assay gene expressions by real-time PCR.
Target gene Forward (50-30) Reverse (50-30) Accession numbers or reference
AMPKα-1 AGTTGGACGAGAAGGAG AGGGCATACAAAATCAC ARF07712.1
AMPKα-2 ACAGCCCTAAGGCACGATG TGGGTCGGGTAGTGTTGAG KX061841
PGC-1βGTGAGGAACGGGGAGATTG AGGGGGGTGAACAGGAAAC Gao et al., 2012
NRF-1 CACAAGCCCTGAGGACTA ACCTGTATGAGCGAGACG Gao et al., 2012
TFAM TCCGAAAGTTAGCAGAGA ATGAAGATGTTGAAGGCG KT380498.1
Mfn-1 CTCCAGATGCTCATTCCCT TTCCTTGGCTTTGGTTGTC Gao et al., 2012
Mfn-2 ACGCCTCTCCGCTCAAACAC CTTCCCCAATCCCTGCCACT Gao et al., 2012
Opa-1 CTTGTTGACTTGCCTGG TTCATTACGGATGTGCT Gao et al., 2012
Drp-1 CAGAGGGACTGCGAGGTT GGCTTGAGCAAAAGGGAA Gao et al., 2012
Fis-1 ATACAAGCAAAAAAGACGAT ATACAAAATAAAAAAAGGGG Gao et al., 2012
Mff CCCGAGAGAATCGTAGTGG GGCGTCTTGAGGGACAGTG Gao et al., 2012
ND-1 CTGACCACTAGCCGCAATA GGAAGAAGAGGGCGAAGG NC010341
CYT-b CATACACTATACCTCCGACAT TCTACTGAGAAGCCACCT NC010341
COX-1 CATACTTTACATCCGCAACA TCCTGTCAATCCACCCAC NC010341
COX-2 AACCCAGGACCTTACACCC CCCGCAGATTTCAGAACA NC010341
ATP-6 TGCTGTGCCACTATGACT ATTATTGCCACTGCGACT NC010341
UCP-2 CCAAAGGTCCTGCGAACA AACCCTACTGCCAATCCC Gao et al., 2012
EF1αCTTCTCAGGCTGACTGTGC CCGCTAGCATTACCCTCC X77689.1
AMPKα-1, AMP-activated protein kinase α-1; AMPKα-2, AMP-activated protein kinase α-2; PGC-1β, Peroxisome proliferator activated receptor-γcoactivator-1β; NRF-
1, Nuclear respiratory factor-1; TFAM, Mitochondrial transcription factor A; Mfn-1 and 2, Mitofusin-1 and 2; Opa-1, Optic atrophy-1; Drp-1, Dynamin-related protein-1;
Fis-1, Fission-1; Mff, Mitochondrial fission factor; ND-1, NADH dehydrogenase-1; CYT-b, Cytochrome-b; COX-1 and 2, Cytochrome c oxidase-1 and 2; ATP-6, ATP
synthase-6; UCP-2, uncoupling protein 2; EF1α, Elongation factor 1α.
TABLE 3 | Growth performance of blunt snout bream fed different experimental diets∗.
Parameters Diets
C HC HCB1 HCB2 HCB3 HCB4
IW 46.38 ±0.63 45.17 ±0.72 44.81 ±0.78 47.15 ±1.11 43.11 ±1.32 44.79 ±0.64
FW 167.76 ±9.54b140.53 ±9.36d152.62 ±7.61c185.08 ±7.75a129.71 ±8.45e120.30 ±8.81e
WGR †241.71 ±6.49ab 218.19 ±9.72bc 232.84 ±7.77ab 262.03 ±11.11a218.10 ±12.41bc 195.20 ±10.86c
SGR § 1.46 ±0.02ab 1.38 ±0.03bc 1.43 ±0.03ab 1.53 ±0.02a1.38 ±0.02bc 1.29 ±0.05c
RFI | | 2.46 ±0.03a2.00 ±0.09b1.96 ±0.07b1.90 ±0.07b1.94 ±0.09b1.99 ±0.05b
FCR ¶ 1.89 ±0.03a1.61 ±0.08bc 1.53 ±0.05bc 1.41 ±0.04c1.57 ±0.07bc 1.70 ±0.06ab
HSI †† 1.06 ±0.07 1.15 ±0.11 1.21 ±0.15 1.23 ±0.16 1.21 ±0.19 1.23 ±0.12
IW, Initial weights; FW, Final weights. ∗Values are means ±SEM of four replications. Values in the same line with superscripts are significantly different (P <0.05). †Weight
gain rate (WGR, %) = (Wt- W0)×100 / W0.§Specific growth rate (SGR, % / day) = (LnWt– LnW0)×100 / T, where W0and Wtare the initial and final body weights,
and T is the culture period in days. ||Relative feed intake (RFI, % body weight d−1) = Feed intake (g) ×100/[(initial fish weight (g) +final fish weight (g) +dead fish weight
(g)) ×days reared/2]. ¶Feed conversion ratio (FCR) = Feed consumption (g)/fish weight gain (g). ††Hepatosomatic index (HSI, %) = liver weight (g) ×100/body weight (g).
(P<0.05) the transcriptional levels of AMPKα-2, PGC-1β, NRF-
1, TFAM, Mfn-1, and Opa-1 (with the maximum values all
observed in fish fed the HCB2 diet), whereas the opposite was
true for Drp-1, Fis-1, and Mff.
Hepatic Activities of the Enzymes
Involved in Mitochondrial Function
As can be seen from Figure 4, no significant difference (P>0.05)
was observed in the activities of complex II among all the
treatments. Fish fed the HC diet had significantly (P<0.05)
lower activities of complex I, III, and IV than that of the C
group, whereas the opposite was true for complex V activities.
As for the HC groups, the supplementation of benfotiamine
significantly increased (P<0.05) the activities of complexes
I–V, with the maximum values all observed in fish fed the
HCB2 diet.
Hepatic Transcriptions of the Enzymes
Involved in Mitochondrial Function
As can be seen from Figure 5, no significant difference (P>0.05)
was observed in the transcriptions of ND-1 and COX-1 among all
the treatments. Fish fed the HC diet had significantly (P<0.05)
lower transcriptional level of CYT-b than that of the C group,
whereas the opposite was true for ATP-6 and UCP-2 expression.
As for the HC groups, the supplementation of benfotiamine
significantly increased (P<0.05) the mRNA levels of CYT-b,
COX-2, and ATP-6, with the maximum values all observed in fish
fed the HCB2 diet.
Frontiers in Physiology | www.frontiersin.org 6September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 7
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
TABLE 4 | Plasma metabolites and tissue glycogen and lipid contents of blunt snout bream fed different experimental diets∗.
Parameters Diets P-value
C HC HCB2 HCB3
Glucose (mmol/L) 3.13 ±0.02b5.32 ±0.11a3.31 ±0.02b3.11 ±0.13b<0.05
GSP (mmol/L) 14.32 ±0.12b21.02 ±0.13a13.27 ±0.03bc 12.76 ±0.06bc <0.05
AGEs (ng/mL) 3.46 ±0.03b4.89 ±0.04a3.31 ±0.01b3.34 ±0.02b<0.05
Insulin (ng/mL) 42.31 ±0.54c73.20 ±0.82b96.57 ±0.61a98.19 ±0.91a<0.05
Tissue glycogen contents (µmol glycosyl units/g wet tissue)
Liver 14.31 ±0.38c23.32 ±0.30b45.81 ±0.34a40.44 ±0.23a<0.05
Muscle 2.46 ±0.03c3.23 ±0.02b3.67 ±0.03a3.81 ±0.02a<0.05
Adipose tissue 1.42 ±0.04b1.79 ±0.15ab 2.12 ±0.07a2.05 ±0.01a<0.05
Tissue lipid contents (percentage of wet weight)
Liver 5.92 ±0.02c7.54 ±0.03b8.86 ±0.08a8.72 ±0.05a<0.05
Muscle 5.42 ±0.32c7.22 ±0.11b7.55 ±0.21b9.13 ±0.45a<0.05
Adipose tissue 76.03 ±0.41ab 81.21 ±0.15ab 85.23 ±0.20a84.58 ±0.19a<0.05
GSP, glycated serum protein; AGEs, advanced glycation end products. ∗Values are means ±SEM of four replications. Values in the same line with superscripts are
significantly different (P <0.05).
FIGURE 1 | Hepatic ATP (A) and AMP (B) contents and the ATP/AMP ratio (C) of blunt snout bream fed different experimental diets. Each data represent the
means ±SEM of four replicates. Bars assigned with different superscripts are significantly different (P<0.05). ATP, adenosine triphosphate; AMP, adenosine
monophosphate.
DISCUSSION
In the present study, HC intake led to a decreased value of
FW, WGR, SGR, RFI, and FCR in blunt snout bream, but
HSI is on the opposite trend. This result is consistent with the
fact that high-energy diets easily reduce feed palatability, and
usually accelerate animal satiety, thereby, leading to low feed
consumption (Ali and Jauncey, 2004). Moreover, high dietary
carbohydrates usually results in persistent hyperglycemia, which
is regarded as a physiological stress response, retarding the
growth of fish (Hemre et al., 2002). As for the HIS, it showed
similar trends as the results of liver glycogen and lipid contents
although no statistical difference was observed, which is similar
to the results of our previous study (Xu et al., 2017a). This may
Frontiers in Physiology | www.frontiersin.org 7September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 8
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
FIGURE 2 | The protein expressions of AMPKα(A), PGC-1β(B), and NRF-1
(C) in the liver of blunt snout bream fed different experimental diets. Two blots
were presented for each treatment. Gels were loaded with 20 µg total protein
per lane. Each data represent the means ±SEM of four biological replicates.
Bars assigned with different superscripts are significantly different (P<0.05).
be ascribed to the fact that as a herbivorous species, blunt snout
bream has higher glucose tolerance, which can quickly remove
excessive glycogen and lipid from the liver. In addition, FW,
WGR, and SGR were significantly improved by benfotiamine
supplementation with increasing level up to 1.425 mg/kg, while
the opposite was observed in RFI and FCR. These findings
suggested a beneficial effect of benfotiamine on the growth
performance of fish fed the HC diet at a suitable dosage (namely
1.425 mg/kg). According to a previous study, adequate thiamine
(the analog of benfotiamine) levels could promote the activities
of intestinal digestive and brush border enzymes of fish, thus
improving nutrients absorption and feed efficiency, and this
might promote the growth performance (Huang et al., 2011).
In addition, benfotiamine administration could also diminish
the hyperglycemic damage in mammals through the inhibition
of AGEs formation and other metabolic pathways (Hammes
et al., 2003). It is possible that a similar mechanism also exists
in fish. However, further studies are warranted to elucidate
these facts. Together, these effects might be beneficial to the
glucose homeostasis of fish fed carbohydrate-enriched diets,
thereby, improving the carbohydrate utilization by fish. In
addition, benfotiamine supplementation further increased the
HIS, but with no significant difference, indicating benfotiamine
can accelerate the removal of excessive nutrients deposited in the
liver. This result is also beneficial for enhancing liver metabolic
function, since the excessive accumulation of nutrients will result
in histological and pathological damage of the liver (Hilton and
Hodson, 1983;Caballero et al., 2004). Meanwhile, the HCB3
diet led to a decrease of FW, WGR, RFI, and FCR compared
with the HC group. This showed similar trends to the results
of our previous work (Xu et al., 2017a), although no statistical
difference was observed here. Generally, this difference may be
ascribed to the following differences between the previous and the
current study, which might include the initial body size of fish, the
stocking density, the feed consumption, the coefficient variation
of the data collected within each treatment, the water temperature
during the feeding trial, and so on. Furthermore, both the
WGR and SGR decreased significantly with further increasing
benfotiamine levels, indicating that the overdose of this substance
could impair the growth performance of fish. The physiological
basis for such growth retardation is still absent in fish until now.
To further characterize the underlying mechanisms, molecular
investigations were conducted in certain groups (namely the C,
HC, HCB2, and HCB3).
In this study, fish fed the HC diet exhibited relatively high
values of plasma glucose, GSP, AGES, and insulin as well as
tissue glycogen and lipid compared with the control group.
This suggested that high dietary carbohydrate intake induced
a hyperglycemic state of fish. It is generally acknowledged that
high glucose levels induced by HC intake usually stimulate
the synthesis and release of insulin, thus accelerating glucose
disposal in peripheral insulin target tissues by enhancing
glycolysis and glycogenesis (Polakof et al., 2012;Kamalam
et al., 2017). Meanwhile, the elevated intracellular glucose
levels also enhanced the Maillard reaction, thereby, increasing
AGES levels (Beltramo et al., 2008). In addition, the results of
GSP, an accurate and easily detectable intermediate marker of
Frontiers in Physiology | www.frontiersin.org 8September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 9
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
FIGURE 3 | Continued
glycemia, in this study, further supported the afore-mentioned
facts (Selvaraj et al., 2008). The enhanced tissue glycogen and
lipid deposition is also justifiable, since HC intake generally
promotes the glycogenesis and lipogenesis of fish (Enes et al.,
2009). In addition, dietary supplementation of benfotiamine
further increased plasma insulin levels and tissue glycogen
and lipid content, whereas the opposite was true for plasma
glucose, GSP, and AGES levels. These results suggested that
benfotiamine could improve the glucose homeostasis of blunt
snout bream fed a HC diet. This may be due to the following
facts: (1) benfotiamine could stimulate insulin synthesis by
improving the function of pancreatic β-cells, thus resulting
in low plasma glucose and GSP levels (Rathanaswami and
Pourany, 1991); (2) benfotiamine could accelerate the removal
of intracellular glycerhaldeyde-3-phosphate (G3P), thereby
decreasing the formation of AGES (Beltramo et al., 2008); and (3)
benfotiamine could enhance the pentose phosphate pathway and
fatty acid synthesis, thus increasing lipid accumulation (Berrone
et al., 2006;Beltramo et al., 2008). However, these are the
cases for mammals. Whether fish show a similar mechanism is
still uncertain, and this warrants further study. Meanwhile, the
elevated insulin levels usually enhance the activities of glycogen
synthase (GSase) and the dephosphorylation of glycogen
phosphorylase (GPase), which might promote glycogen storage
in tissues in fish (Moon, 2001).
Generally, ATP is the major energy “currency” in cells, and
the ATP/AMP ratio is a sensitive indicator of the alterations of
the energy status (Yoshida et al., 2012). In the present study, the
hepatic ATP and AMP contents and ATP/AMP ratio of fish fed
the HC diet were all significantly higher than that of the control
group. The most plausible explanation would be that high dietary
carbohydrate intake usually elevates the energy state of cells, thus
increasing ATP contents (Sathanoori et al., 2015). The excessive
ATP was hydrolyzed consequently, thus leading to the increased
Frontiers in Physiology | www.frontiersin.org 9September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 10
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
FIGURE 3 | The relative transcriptions of mitochondrial biogenesis-related genes in the liver of blunt snout bream fed different diets. The transcriptional levels of
AMP-activated protein kinase α-1 and 2 (AMPKα-1 and 2) (A,B), Peroxisome proliferator activated receptor-γcoactivator-1β(PGC-1β)(C), Nuclear respiratory
factor-1 (NRF-1) (D), Mitochondrial transcription factor A (TFAM) (E), Mitofusin-1 and 2 (Mfn-1 and 2) (F,G), Optic atrophy-1 (Opa-1) (H), Dynamin-related protein-1
(Drp-1) (I), Fission-1 (Fis-1) (J) and Mitochondrial fission factor (Mff) (K) were all evaluated using real-time RT-PCR. Expression levels were normalized to
EF1α-expressed transcripts and are presented as fold-change against the control (C) group set to 1. Each data represent the means ±SEM of four replicates. Bars
assigned with different superscripts are significantly different (P<0.05).
AMP content. Moreover, dietary benfotiamine supplementation
led to the increased AMP contents, while the opposite was true
for ATP contents and the ATP/AMP ratio. This indicated that
benfotiamine could modify the intracellular energy state of fish.
According to a previous study, as a thiamin analog, benfotiamine
could accelerate ATP hydrolysis via the following reaction:
thiamine +ATP →thiamine diphosphate (ThDP) +AMP,
thereby decreasing the ATP/AMP ratio (Makarchikov, 2009).
In addition, the decreased ATP/AMP ratio by benfotiamine
administration is regarded as a positive signal for glucose
homeostasis, since it could activate some specific energy sensors
(such as AMPK), thereby coordinating the glycolipid metabolism
of fish (Rutter and Leclerc, 2009).
Current studies have demonstrated that mitochondrial fusion
and fission processes play a prominent role in the modulation
of mitochondrial biogenesis and function (Rossignol and
Karbowski, 2009;Su et al., 2009). Additionally, mitochondrial
fusion and fission enzymes have also attracted considerable
attention due to their critical roles in controlling the dynamic
events mentioned earlier (Su et al., 2009). However, such
information in fish is still barely understood. In this study,
hepatic transcriptions of AMPKα-1, Drp-1, Fis-1, and Mff
were all upregulated by the intake of carbohydrate-rich diets
compared with the control group, whereas the opposite was
true for PGC-1βand NRF-1 transcriptions as well as PGC-1β
and NRF-1 protein expressions and the p-AMPKα/t-AMPKα
ratio. According to previous studies, the increased intracellular
ATP contents by HC intake usually inhibit the activity of
AMPK in fish (Polakof et al., 2011a,b). Subsequently, the inactive
AMPK could weaken mitochondrial biogenesis signals by
Frontiers in Physiology | www.frontiersin.org 10 September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 11
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
FIGURE 4 | The activities of mitochondrial respiratory chain complexes (Complex I (A),II(B), III (C),IV(D) and V (E)) in the liver of blunt snout bream fed different
experimental diets. Each data represent the means ±SEM of four replicates. Bars assigned with different superscripts are significantly different (P<0.05). Complex
I: NADH–ubiquinone oxidoreductase; Complex II: Succinate–ubiquinone oxidoreductase; Complex III: Ubiquinone–ferricytochrome-c oxidoreductase; Complex IV:
Cytochrome c oxidase; Complex V: F1F0–ATP synthase. They were expressed as nanomolars per minute per milligram protein.
reducing the activity of the PGC-1/NRF-1 pathway, resulting
in a decrease of mitochondrial content in cells (Yu and
Yang, 2010). Meanwhile, excessive carbohydrate intake also
amplifies mitochondrial oxidative stress by increasing the
generation of intracellular reactive oxygen species (ROS),
thereby accelerating mitochondrial fission characterized by
the upregulation of related genes (namely Drp-1, Fis-1, and
Mff) (Zhuang et al., 2017). In addition, dietary supplementation
of benfotiamine at 1.425 mg/kg significantly upregulated the
transcriptions of AMPKα-2, PGC-1β, NRF-1, TFAM, Mfn-
1, and Opa-1, the protein contents of PGC-1βas well as
the p-AMPKα/t-AMPKαratio, whereas the opposite was true
for Drp-1, Fis-1, and Mff. These results indicated that a
long-term administration of benfotiamine at the appropriate
dosages effectively enhanced the mitochondrial biosynthesis
of fish fed the HC diet. According to a previous study,
benfotiamine could decrease the ATP/AMP ratio by accelerating
ATP hydrolysis, thereby increasing the activity of AMPK
(Makarchikov, 2009). Once activated, AMPK conveys its signals
to induce mitochondrial biogenesis via targeting the PGC-
1β/NRF-1 pathway that regulates mtDNA replication and
expression (Wu et al., 1999). Furthermore, these results were
further supported by the fact that AMPK activation can prevent
high glucose-induced mitochondrial fission by inhibiting the
activity of the proteins involved in mitochondrial fission (such
as Drp-1 and Mff), thus coordinating this organelle shape and
function (Wikstrom et al., 2013;Ducommun et al., 2015;Craig
et al., 2017). It should be stated here that this information was
mainly derived from mammals. The underlying mechanisms
in fish still need further in-depth studies. Nevertheless, the
enhanced mitochondrial biogenesis by benfotiamine may be
helpful for the maintenance of glucose homeostasis in this fish,
thus improving its carbohydrate utilization.
Mitochondrion is the main site of energy production in
cells, and responsible for the production of ATP for the basic
activities of life (Wang et al., 2017). Generally, ATP synthesis
in mitochondria depends on the oxidative phosphorylation
(OXPHOS) by means of an enzyme pathway consisting
of five multisubunit enzyme complexes located within the
mitochondrial inner membrane (Vedel et al., 1999). Therefore,
investigations of these enzyme complexes will facilitate our
understanding of the mitochondrial function. In the present
Frontiers in Physiology | www.frontiersin.org 11 September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 12
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
FIGURE 5 | The relative transcriptions of mitochondrial function-related genes in the liver of blunt snout bream fed different diets. The transcriptional levels of NADH
dehydrogenase-1 (ND-1) (A), Cytochrome-b (CYT-b) (B), Cytochrome c oxidase-1 and 2 (COX-1 and 2) (C,D), ATP synthase-6 (ATP-6) (E), and Uncoupling protein
2 (UCP-2) (F) were all evaluated using real-time RT-PCR. Expression levels were normalized to EF1α-expressed transcripts and are presented as fold-change against
the control (C) group set to 1. Each data represent the means ±SEM of four replicates. Bars assigned with different superscripts are significantly different (P<0.05).
study, the hepatic complexes I–IV activities of fish fed the HC
diet were all significantly lower than that of the control group,
whereas the opposite was true for the activities of complex V.
These results might be attributed to the fact that the oxidative
stress induced by HC intake would cause mitochondrial damage,
then leading to the decreases in mitochondrial respiratory
enzyme activities (Li et al., 2001;Lin et al., 2009). As for
the increased complex V activities, it might be a result of
the increased energy intake by fish due to HC feeding, which
is in line with the trend of ATP content. This is due to
the fact that complex V (ATP synthase) is the last rate-
limiting enzyme in ATP synthesis, driving the phosphorylation
of ADP to ATP (Vedel et al., 1999;Tang et al., 2014).
These trends were supported by the fact that high energy
consumption generally causes the mitochondria to increase
oxidative phosphorylation rate and ATP production (Jonathan
et al., 2010), thereby enhancing the activities of complex V
(namely the ATP synthase) (Hatefi, 1985). Similar results were
also reported in rainbow trout (Oncorhynchus mykiss) (Eya
et al., 2017) and channel catfish (Ictalurus punctatus) (Jonathan
et al., 2010). Moreover, dietary benfotiamine supplementation
led to the increased complexes I–V activities. This indicated
that benfotiamine could enhance mitochondrial function of
fish. According to a previous study, benfotiamine could
prevent mitochondria from oxidative stress by scavenging free
radicals and inhibiting oxidants production, thus enhancing
the mitochondrial respiratory enzyme activities (Liu and Ames,
2005). Furthermore, a previous study investigating the effects
of the B vitamin family on mitochondrial function further
supported this by demonstrating that vitamin B1is an
important cofactor for various mitochondrial enzyme complexes
(Depeint et al., 2006). Meanwhile, we further evaluated the
mitochondrial function by detecting the transcriptional levels
of related genes. The transcription of CYT-b in liver decreased
remarkably with increasing dietary carbohydrate levels, whereas
the opposite was true for ATP-6 expression. In addition, the
transcripts of ND-1, COX-1, and COX-2 were all downregulated
by the HC diet, although no significance was detected.
Frontiers in Physiology | www.frontiersin.org 12 September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 13
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
These results were in accordance with that of the mitochondrial
complexes activities, suggesting that a long-term intake of the
HC diet could result in an impaired mitochondrial function
in this fish. This was supported by the fact that the decreased
expressions of ND-1, CYT-b, COX-1, and COX-2 might affect
the assembly of mitochondrial complexes, then reducing the
catalytic ability of OXPHOS (Eya et al., 2012;Wang et al.,
2017). Furthermore, the excessive production of ROS resulting
due to the HC intake would also accelerate mitochondrial
fission, which might, in turn, depress the transcriptions of these
genes (Qian et al., 2005;Zhuang et al., 2017). The upregulated
ATP-6 expression might be attributed to the increased energy
intake caused by HC diets, which could increase the oxidative
phosphorylation rate and ATP production in mitochondria,
then enhancing its transcriptional level (Jonathan et al., 2010).
Here, an increased UCP-2 expression was also found in the
HC group, suggesting that HC intake induced the uncoupling
reaction in the respiratory chain. This phenomenon seems to
be the opposite of ATP content, but it is not unique to our
system. Infact, previous studies have confirmed that high-sucrose
diet intake could also accelerate the phosphorylation of ADP
to produce ATP by stimulating the coupling reaction in liver
mitochondria despite the overexpression of UCP (Ruiz-Ramírez
et al., 2011). These results may suggest that the expression
of UCPs and mitochondrial respiration are not completely
interconnected (Herlein et al., 2009;Ruiz-Ramírez et al., 2011).
However, the underlying mechanisms involving these aspects
mentioned previously are still unknown. Meanwhile, dietary
supplementation of benfotiamine at 1.425 mg/kg resulted in a
remarkable increase of the transcriptions of CYT-b, COX-2, and
ATP-6. This result indicated an enhanced mitochondrial function
in the liver of blunt snout bream due to the administration of
benfotiamine at suitable dosages. This was further supported by
the fact that benfotiamine could scavenge excess free radicals
as well as inhibit superoxide anion production, thus alleviating
the functional damage of mitochondria caused by high glucose-
induced oxidative stress (Liu and Ames, 2005). The studies
afore-mentioned are mainly focused on mammals. The exact
mechanisms in fish still warrant further in-depth studies.
In summary, the findings of the present study indicated
that dietary supplementation of benfotiamine could improve the
growth performance and mitochondrial biogenesis and function
of M. amblycephala fed HC diets, through the activation of
the AMPK/PGC-1β/NRF-1 pathway, the upregulation of the
fusion-associated genes, and the enhancement of mitochondrial
enzyme complexes activities as well as their transcriptions. The
best value of growth performance and mitochondrial biogenesis
and function were all observed in fish offered 1.425 mg/kg
benfotiamine.
AUTHOR CONTRIBUTIONS
X-FL, CX, and W-BL conceived and designed the experiments.
CX and D-DZ analyzed the data. X-FL, CX, H-JS, and LZ
performed the experiments and contributed reagents, materials,
and analysis tools. CX and X-FL wrote the paper. All authors read
and approved the final version of the manuscript.
FUNDING
This research was funded by the National Technology System of
Conventional Freshwater Fish Industries of China (CARS-45-14)
and the Postgraduate Research and Practice Innovation Program
of Jiangsu Province (KYCX18_0697).
REFERENCES
Ali, M. Z., and Jauncey, K. (2004). Optimal dietary carbohydrate to lipid ratio
in African catfish Clarias gariepinus (Burchell 1822). Aquac. Int. 12, 169–180.
doi: 10.1023/B:AQUI.0000032065.28059.5b
Asadi, F., Hallajian, A., Asadian, P., Shahriari, A., and Pourkabir, M. (2009). Serum
lipid, free fatty acid, and proteins in juvenile sturgeons: Acipenser persicus and
Acipenser stellatus.Comp. Clin. Pathol. 18, 287–289. doi: 10.1007/s00580-008-
0797-0
Beltramo, E., Berrone, E., Tarallo, S., and Porta, M. (2008). Effects of thiamine
and benfotiamine on intracellular glucose metabolism and relevance in the
prevention of diabetic complications. Acta Diabetol. 45, 131–141. doi: 10.1007/
s00592-008-0042-y
Berrone, E., Beltramo, E., Carmela, S., Ape, A. U., and Porta, M. (2006). Regulation
of intracellular glucose and polyol pathway by thiamine and benfotiamine
in vascular cells cultured in high glucose. J. Biol. Chem. 281, 9307–9313.
doi: 10.1074/jbc.M600418200
Booth, F. W., and Thomason, D. B. (1991). Molecular and cellular adaptation of
muscle in response to exercise: perspectives of various models. Physiol. Rev. 71,
541–585. doi: 10.1152/physrev.1991.71.2.541
Bradford, H. F., and Dodd, P. R. (1977). Convulsions and activation
of epileptic foci induced by monosodium glutamate and related
compounds. Biochem. Pharmacol. 26, 253–254. doi: 10.1016/0006-2952(77)
90312-4
Bremer, K., Kocha, K. M., Snider, T., and Moyes, C. D. (2016). Sensing and
responding to energetic stress: the role of the AMPK-PGC1α-NRF1 axis in
control of mitochondrial biogenesis in fish. Comp. Biochem. Phys. B Biochem.
Mol. Biol. 199, 4–12. doi: 10.1016/j.cbpb.2015.09.005
Bremer, K., and Moyes, C. D. (2011). Origins of variation in muscle cytochrome
c oxidase activity within and between fish species. J. Exp. Biol. 214, 1888–1895.
doi: 10.1242/jeb.053330
Caballero, M. J., Izquierdo, M. S., Kjørsvik, E., Fernández, A. J., and Rosenlund, G.
(2004). Histological alterations in the liver of sea bream, Sparus aurata L.,
caused by short- or long-term feeding with vegetable oils. Recovery of normal
morphology after feeding fish oil as the sole lipid source. J. Fish Dis. 27, 531–541.
doi: 10.1111/j.1365-2761.2004.00572.x
Cannon, B., and Nedergaard, J. A. N. (2004). Brown adipose tissue: function
and physiological significance. Physiol. Rev. 84, 277–359. doi: 10.1152/physrev.
00015.2003
Chung, K. M., Kang, W., Kim, D. G., Hong, H. J., Lee, Y., and Han, C. H.
(2014). Anti-diabetic effects of benfotiamine on an animal model of type
2 diabetes mellitus. Korean J. Vet. Res. 54, 21–26. doi: 10.14405/kjvr.2014.
54.1.21
Craig, P. M., Moyes, C. D., and LeMoine, C. M. R. (2017). Sensing and responding
to energetic stress: evolution of the AMPK network. Comp. Biochem. Phys. B
Biochem. Mol. Biol. 224, 156–169. doi: 10.1016/j.cbpb.2017.11.001
David, L., and John, M. (1984). Simple colorimetry of glycated serumprotein in a
centrifugal analyzer. Clin. Chem. 30, 1686–1688.
Depeint, F., Bruce, W. R., Shangari, N., Mehta, R., and O’Brien, P. J.
(2006). Mitochondrial function and toxicity: role of the B vitamin family
on mitochondrial energy metabolism. Chem. Biol. Interact. 163, 94–112.
doi: 10.1016/j.cbi.2006.04.014
Frontiers in Physiology | www.frontiersin.org 13 September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 14
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
Ducommun, S., Deak, M., Sumpton, D., Ford, R. J., Núñez Galindo, A.,
Kussmann, M., et al. (2015). Motif affinity and mass spectrometry proteomic
approach for the discovery of cellular AMPK targets: identification of
mitochondrial fission factor as a new AMPK substrate. Cell. Signal. 27, 978–988.
doi: 10.1016/j.cellsig.2015.02.008
Enes, P., Panserat, S., Kaushik, S., and Oliva-Teles, A. (2009). Nutritional regulation
of hepatic glucose metabolism in fish. Fish Physiol. Biochem. 35, 519–539.
doi: 10.1007/s10695-008- 9259-5
Eya, J. C., Ashame, M. F., and Pomeroy, C. F. (2011). Association of
mitochondrial function with feed efficiency in rainbow trout: diets and
family effects. Aquaculture 321, 71–84. doi: 10.1016/j.aquaculture.2011.
08.037
Eya, J. C., Ashame, M. F., Pomeroy, C. F., Manning, B. B., and Peterson, B. C.
(2012). Genetic variation in feed consumption, growth, nutrient utilization
efficiency and mitochondrial function within a farmed population of channel
catfish (Ictalurus punctatus). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 163,
211–220. doi: 10.1016/j.cbpb.2012.05.019
Eya, J. C., Yossa, R., Perera, D., Okubajo, O., and Gannam, A. (2017).
Combined effects of diets and temperature on mitochondrial function, growth
and nutrient efficiency in rainbow trout (Oncorhynchus mykiss). Comp.
Biochem. Physiol. B Biochem. Mol. Biol. 212, 1–11. doi: 10.1016/j.cbpb.2017.
06.010
Folch, J., Lees, M., and Sloane-Stanley, G. H. (1957). A simple method for the
isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226,
497–509.
Fraser, D. A., Hessvik, N. P., Nikolic’, N., Aas, V., Hanssen, K. F., Bøhn, S. K., et al.
(2012). Benfotiamine increases glucose oxidation and downregulates NADPH
oxidase 4 expression in cultured human myotubes exposed to both normal and
high glucose concentrations. Genes Nutr. 7, 459–469. doi: 10.1007/s12263-011-
0252-8
Gao, G., and Moyes, C. D. (2016). Evaluating the role of NRF-1 in the regulation
of the goldfish COX4-1 gene in response to temperature. J. Exp. Biol. 219,
3019–3027. doi: 10.1242/jeb.141184
Gao, Z. X., Luo, W., Liu, H., Zeng, C., Liu, X. L., Yi, S. K., et al. (2012).
Transcriptome analysis and SSR/SNP markers information of the blunt snout
bream (Megalobrama amblycephala). PLoS One 7:e42637. doi: 10.1371/journal.
pone.0042637
Gutierrez, J., Carrillo, M., Zanuy, S., and Planas, J. (1984). Daily rhythms of insulin
and glucose plasma levels in sea bass Dicentrarchus labrax after experimental
feeding. Gen. Comp. Endocrinol. 55, 393–397. doi: 10.1016/0016-6480(84)
90009-1
Hammes, H. P., Du, X., Edelstein, D., Taguchi, T., Matsumura, T., Ju, Q.,
et al. (2003). Benfotiamine blocks three major pathways of hyperglycemic
damage and prevents experimental diabetic retinopathy. Nat. Med. 9, 294–299.
doi: 10.1038/nm834
Hardie, D. G., Scott, J. W., Pan, D. A., and Hudson, E. R. (2003). Management
of cellular energy by the AMP-activated protein kinase system. FEBS Lett. 546,
113–120. doi: 10.1016/S0014-5793(03)00560- X
Hatefi, Y. (1985). The mitochondrial electron transport and oxidative
phosphorylation system. Annu. Rev. Biochem. 54, 1015–1054.
doi: 10.1146/annurev.bi.54.070185.005055
Hemre, G. I., Mommsen, T. P., and Krogdahl, A. (2002). Carbohydrates in fish
nutrition: effects on growth, glucose metabolism and hepatic enzymes. Aquac.
Nutr. 8, 175–194. doi: 10.1046/j.1365-2095.2002.00200.x
Herlein, J. A., Fink, B. D., O’Malley, Y., and Sivitz, W. I. (2009). Superoxide
and respiratory coupling in mitochondria of insulin-deficient diabetic rats.
Endocrinology 150, 46–55. doi: 10.1210/en.2008-0404
Hertz, Y., Madar, Z., Hepher, B., and Gertler, A. (1989). Glucose metabolism in
the common carp (Cyprinus carpio L.): the effects of cobalt and chromium.
Aquaculture 76, 255–267. doi: 10.1016/0044-8486(89)90079- 3
Hilton, J. W., and Hodson, P. V. (1983). Effect of increased dietary carbohydrate on
selenium metabolism and toxicity in rainbow trout (Salmo gairdneri). J. Nutr.
113, 1241–1248. doi: 10.1093/jn/113.6.1241
Huang, H. H., Feng, L., Liu, Y., Jiang, J., Jiang, W. D., and Hu, K. (2011). Effects
of dietary thiamin supplement on growth, body composition and intestinal
enzyme activities of juvenile Jian carp (Cyprinus carpio var. Jian). Aquac. Nutr.
17, e233–e240. doi: 10.1111/j.1365-2095.2010.00756.x
Jaworek, D., Gruber, W., and Bergmeyer, H. U. (1974). “Adenosine- 5’-
diphosphate and adenosine-5’-monophosphate,” in Methods of Enzymatic
Analysis, ed. H. U. Bergmeyer (New York, NY: Academic Press), 2127–2131.
Jeejeebhoy, K. N. (2002). Nutritional assessment by measuring mitochondrial
complex activity. United States Patent No. 6455243. Ontario, CA: US. Patent
and Trademark Office.
Jonathan, C. E., Martha, F. A., and Charles, F. P. (2010). Influence of diet on
mitochondrial complex activity in channel catfish. N. Am. J. Aquacul. 72,
225–236. doi: 10.1577/A09-058.1
Kamalam, B. S., Medale, F., and Panserat, S. (2017). Utilisation of dietary
carbohydrates in farmed fishes: new insights on influencing factors, biological
limitations and future strategies. Aquaculture 467, 3–27. doi: 10.1016/j.
aquaculture.2016.02.007
Kelley, D. E., He, J., Menshikova, E. V., and Ritov, V. B. (2002). Dysfunction of
mitochondria in human skeletal muscle in type 2 diabetes. Diabetes Metab. Res.
Rev 51, 2944–2950. doi: 10.2337/diabetes.51.10.2944
Keppler, D., Decker, K., and Bergmeyer, H. U. (1974). “Glycogen determination
with amyloglucosidase,” in Methods of Enzymatic Analysis, ed. H. U. Bergmeyer
(New York, NY: Academic Press), 1127–1131.
Kirby, D. M., Thorburn, D. R., Turnbull, D. M., and Taylor, R. W. (2007).
“Biochemical assays of respiratory chain complex activity,” in Methods in Cell
Biology: Mitochondria, Vol. 80, 2nd Edn, eds L. A. Pon and E. A. Schon
(San Diego, CA: Academic Press), 93–119.
LeMoine, C. M., Genge, C. E., and Moyes, C. D. (2008). Role of the PGC-1 family in
the metabolic adaptation of goldfish to diet and temperature. J. Exp. Biol. 211,
1448–1455. doi: 10.1242/jeb.014951
Li, M., Absher, P. M., Liang, P., Russell, J. C., Sobel, B. E., and Fukagawa, N. K.
(2001). High glucose concentrations induce oxidative damage to mitochondrial
DNA in explanted vascular smooth muscle cells. Exp. Biol. Med. 226, 450–457.
doi: 10.1177/153537020122600510
Li, X. F., Lu, K. L., Liu, W. B., Jiang, G. Z., and Xu, W. N. (2014). Effects of dietary
lipid and carbohydrate and their interaction on growth performance and body
composition of juvenile blunt snout bream, Megalobrama amblycephala.Isr. J.
Aquacult. Bamidgeh 66:931.
Liao, K., Yan, J., Mai, K. S., and Ai, Q. H. (2016). Dietary lipid concentration
affects liver mitochondrial DNA copy number, gene expression and DNA
methylation in large yellow croaker (Larimichthys crocea). Comp. Biochem.
Physiol. B Biochem. Mol. Biol. 193, 25–32. doi: 10.1016/j.cbpb.2015.11.012
Lin, Z., Xue, Y. M., Sha, J. P., Mao, R. R., Long, K., and Sang, D. (2009). High glucose
impairs mitochondrial respiratory chain function in pancreatic beta cells. J. S.
Med. Univ. 29, 1251–1253.
Liu, J., and Ames, B. N. (2005). Reducing mitochondrial decay with mitochondrial
nutrients to delay and treat cognitive dysfunction, Alzheimer’s disease, and
Parkinson’s disease. Nutr. Neurosci. 8, 67–89. doi: 10.1080/10284150500047161
Lund, P., Cornell, N. W., and Krebs, H. A. (1975). Effect of adenosine on the
adenine nucleotide content and metabolism of hepatocytes. Biochem. J. 152,
593–599. doi: 10.1042/bj1520593
Makarchikov, A. F. (2009). Vitamin B1: metabolism and functions. Biochem. Suppl.
Series B Biomed. Chem. 3, 116–128. doi: 10.1134/S1990750809020024
Miao, L. H., Lin, Y., Pan, W. J., Huang, X., Ge, X. P., Ren, M. C., et al.
(2017). Identification of differentially expressed microRNAs associate with
glucose metabolism in different organs of blunt snout bream (Megalobrama
amblycephala). Int. J. Mol. Sci. 18, 1161–1176. doi: 10.3390/ijms18061161
Monnier, V. M., Vishwanath, V., Frank, K. E., Elmets, C. A., Dauchot, P., and
Kohn, R. R. (1986). Relation between complications of type I diabetes mellitus
and collagen-linked fluorescence. N. Engl. J. Med. 314, 403–408. doi: 10.1056/
NEJM198602133140702
Moon, T. W. (2001). Glucose intolerance in teleost fish: fact or fiction? Comp.
Biochem. Physiol. B Biochem. Mol. Biol. 129, 243–249. doi: 10.1016/S1096-
4959(01)00316-5
Panserat, S., Médale, F., Brèque, J., Plagnes-Juan, E., and Kaushik, S. (2000). Lack
of significant long-term effect of dietary carbohydrates on hepatic glucose-
6-phosphatase expression in rainbow trout (Oncorhynchus mykiss). J. Nutr.
Biochem. 11, 22–29. doi: 10.1016/S0955-2863(99)00067-4
Petersen, K. F., Befroy, D., Dufour, S., Dziura, J., Ariyan, C., Rothman, D. L.,
et al. (2003). Mitochondrial dysfunction in the elderly: possible role in insulin
resistance. Science 300, 1140–1142. doi: 10.1126/science.1082889
Frontiers in Physiology | www.frontiersin.org 14 September 2018 | Volume 9 | Article 1079
fphys-09-01079 August 30, 2018 Time: 17:3 # 15
Xu et al. Effect of Benfotiamine on Liver Mitochondria of Fish
Polakof, S., Moon, T. W., Aguirre, P., Skiba-Cassy, S., and Panserat, S. (2011a).
Glucose homeostasis in rainbow trout fed a high-carbohydrate diet: metformin
and insulin interact in a tissue-dependent manner. Am. J. Physiol. Regul. Integr.
Comp. Physiol. 300, R166–R174. doi: 10.1152/ajpregu.00619.2010
Polakof, S., Panserat, S., Craig, P. M., Martyres, D. J., Plagnes-Juan, E.,
Savari, S., et al. (2011b). The metabolic consequences of hepatic AMP-kinase
phosphorylation in rainbow trout. PLoS One 6:e20228. doi: 10.1371/journal.
pone.0020228
Polakof, S., Panserat, S., Soengas, J. L., and Moon, T. W. (2012). Glucose
metabolism in fish: a review. J. Comp. Physiol. B 182, 1015–1045. doi: 10.1007/
s00360-012-0658-7
Prathomya, P., Prisingkorn, W., Jakovli´
c, I., Deng, F. Y., Zhao, Y. H., and Wang,
W. M. (2017). 1H NMR-based metabolomics approach reveals metabolic
alterations in response to dietary imbalances in Megalobrama amblycephala.
Metabolomics 13:17. doi: 10.1007/s11306-016-1158- 7
Prisingkorn, W., Prathomya, P., Jakovliæ, I., Liu, H., Zhao, Y. H., and Wang,
W. M. (2017). Transcriptomics, metabolomics and histology indicate that high-
carbohydrate diet negatively affects the liver health of blunt snout bream
(Megalobrama amblycephala). BMC Genomics 18:856. doi: 10.1186/s12864-
017-4246-9
Qian, W., Nishikawa, M., Haque, A. M., Hirose, M., Mashimo, M., Sato, E., et al.
(2005). Mitochondrial density determines the cellular sensitivity to cisplatin-
induced cell death. Am. J. Physiol. Cell Physiol. 289, C1466–C1475. doi: 10.1152/
ajpcell.00265.2005
Rathanaswami, P., and Pourany, A. (1991). Effects of thiamine deficiency on the
secretion of insulin and the metabolism of glucose in isolated rat pancreatic
islets. Biochem. Int. 25, 577–583.
Reznick, R. M., and Shulman, G. I. (2006). The Role of AMP-activated protein
kinase in mitochondrial biogenesis. J. Physiol. 574, 33–39. doi: 10.1113/jphysiol.
2006.109512
Rossignol, R., and Karbowski, M. (2009). Editorial of the directed issue on
mitochondrial dynamics in biology and medicine. Int. J. Biochem. Cell Biol. 41,
1748–1749. doi: 10.1016/j.biocel.2009.05.019
Ruiz-Ramírez, A., Chávez-Salgado, M., Peñeda-Flores, J. A., Zapata, E., Masso, F.,
and El-Hafidi, M. (2011). High-sucrose diet increases ROS generation, FFA
accumulation, UCP2 level, and proton leak in liver mitochondria. Am. J.
Physiol. Endocrinol. Metab. 301, E1198–E1207. doi: 10.1152/ajpendo.00631.
2010
Rutter, G. A., and Leclerc, I. (2009). The AMP-regulated kinase family: enigmatic
targets for diabetes therapy. Mol. Cell. Endocrinol. 297, 41–49. doi: 10.1016/j.
mce.2008.05.020
Sathanoori, R., Rosi, F., Gu, B. J., Wiley, J. S., Müller, C. E., Olde, B., et al. (2015).
Shear stress modulates endothelial KLF2 through activation of P2X4. Purinergic
Signal. 11, 139–153. doi: 10.1007/s11302-014-9442-3
Scheffler, I. E. (2008). Mitochondria, 2nd Edn. Hoboken, NJ: Wiley, 1–484.
Selvaraj, N., Bobby, Z., and Sridhar, M. G. (2008). Increased glycation of
hemoglobin in chronic renal failure: corrected. Potential role of oxidative stress.
Arch. Med. Res. 39, 277–284. doi: 10.1016/j.arcmed.2008.01.001
Su, B., Wang, X., Zheng, L., Perry, G., Smith, M. A., and Zhu, X. (2009). Abnormal
mitochondrial dynamics and neurodegenerative diseases. Biochim. Biophys.
Acta 1802, 135–142. doi: 10.1016/j.bbadis.2009.09.013
Tang, X., Luo, Y. X., Chen, H. Z., and Liu, D. P. (2014). Mitochondria, endothelial
cell function, and vascular diseases. Front. Physiol. 5:175. doi: 10.3389/fphys.
2014.00175
Vedel, F., Lalanne, É, Sabar, M., Chétrit, P., and Paepe, R. D. (1999). The
mitochondrial respiratory chain and ATP synthase complexes: composition,
structure and mutational studies. Plant Physiol. Biochem. 37, 629–643.
doi: 10.1016/S0981-9428(00)80093- 5
Wang, Z. F., Shi, X. J., Sun, L. X., Bai, Y. Z., Zhang, D. Z., and Tang, B. P.
(2017). Evolution of mitochondrial energy metabolism genes associated with
hydrothermal vent adaption of Alvinocaridid shrimps. Genes Genomics 39,
1367–1376. doi: 10.1007/s13258-017- 0600-1
Wikstrom, J. D., Israeli, T., Bachar-Wikstrom, E., Swisa, A., Ariav, Y., Waiss, M.,
et al. (2013). AMPK regulates ER morphology and function in stressed
pancreatic β-cells via phosphorylation of DRP1. Mol. Endocrinol. 27,
1706–1723. doi: 10.1210/me.2013-1109
Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V.,
et al. (1999). Mechanisms controlling mitochondrial biogenesis and respiration
through the thermogenic coactivator PGC-1. Cell 98, 115–124. doi: 10.1016/
S0092-8674(00)80611-X
Xu, C., Li, X. F., Tian, H. Y., Jiang, G. Z., and Liu, W. B. (2016). Feeding rates
affect growth, intestinal digestive and absorptive capabilities and endocrine
functions of juvenile blunt snout bream Megalobrama amblycephala.Fish
Physiol. Biochem. 42, 689–700. doi: 10.1007/s10695-015-0169- z
Xu, C., Liu, W. B., Dai, Y. J., Jiang, G. Z., Wang, B. K., and Li, X. F. (2017a).
Long-term administration of benfotiamine benefits the glucose homeostasis
of juvenile blunt snout bream Megalobrama amblycephala, fed a high-
carbohydrate diet. Aquaculture 40, 74–83. doi: 10.1016/j.aquaculture.2016.
12.025
Xu, C., Liu, W. B., Zhang, D. D., Wang, K. Z., Xia, S. L., and Li, X. F.
(2017b). Molecular characterization of AMP-activated protein kinase α2 from
herbivorous fish Megalobrama amblycephala and responsiveness to glucose
loading and dietary carbohydrate levels. Comp. Biochem. Physiol. A Mol. Integr.
Physiol. 208, 24–34. doi: 10.1016/j.cbpa.2017.03.008
Xu, C., Liu, W. B., Zhang, D. D., Cao, X. F., Shi, H. J., and Li, X. F. (2018).
Interactions between dietary carbohydrate and metformin: implications on
energy sensing, insulin signaling pathway, glycolipid metabolism and glucose
tolerance in blunt snout bream Megalobrama amblycephala.Aquaculture 483,
183–195. doi: 10.1016/j.aquaculture.2017.10.022
Yang, Y. X., Han, T., Xiao, J., Li, X. Y., and Wang, J. T. (2018). Transcriptome
analysis reveals carbohydrate-mediated liver immune responses in Epinephelus
akaara.Sci. Rep. 8:639. doi: 10.1038/s41598-017-18990- 8
Yoshida, H., Bao, L., Kefaloyianni, E., Taskin,E., Okorie, U., Hong, M., et al. (2012).
AMP-activated protein kinase connects cellular energy metabolism to KATP
channel function. J. Mol. Cell. Cardiol. 52, 410–418. doi: 10.1016/j.yjmcc.2011.
08.013
Yu, L., and Yang, S. J. (2010). AMP-activated protein kinase mediates activity-
dependent regulation of peroxisome proliferator-activated receptor gamma
coactivator-1alpha and nuclear respiratory factor 1 expression in rat visual
cortical neurons. Neuroscience 169, 23–38. doi: 10.1016/j.neuroscience.2010.
04.063
Zhao, X., Terkeltaub, R., Lotz, M., and Liu-Bryan, R. (2013). AMPK-SIRT1-PGC-
1αsignaling regulates mitochondrial function in human articular chondrocytes.
Osteoarthr. Cartil. 21(Suppl.), S128–S128. doi: 10.1016/j.joca.2013.02.269
Zhuang, X. Y., Maimaitijiang, A., Li, Y., Shi, H. M., and Jiang, X. F. (2017).
Salidroside inhibits high-glucose-induced proliferation of vascular smooth
muscle cells via inhibiting mitochondrial fission and oxidative stress. Exp. Ther.
Med. 14, 515–524. doi: 10.3892/etm.2017.4541
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
Copyright © 2018 Xu, Liu, Zhang, Shi, Zhang and Li. This is an open-access article
distributed under the terms of the Creative Commons Attribution License (CC BY).
The use, distribution or reproduction in other forums is permitted, provided the
original author(s) and the copyright owner(s) are credited and that the original
publication in this journal is cited, in accordance with accepted academic practice.
No use, distribution or reproduction is permitted which does not comply with these
terms.
Frontiers in Physiology | www.frontiersin.org 15 September 2018 | Volume 9 | Article 1079
