Available via license: CC BY
Content may be subject to copyright.
RESEARCH ARTICLE
Impact of chlorine dioxide disinfection of
irrigation water on the epiphytic bacterial
community of baby spinach and underlying
soil
Pilar Truchado
1
, Marı
´a Isabel Gil
1
, Trevor Suslow
2
, Ana Allende
1
*
1Research Group on Quality, Safety and Bioactivity of Plant Foods, CEBAS-CSIC, Campus Universitario de
Espinardo, Murcia, Spain, 2Department of Plant Science, University of California, One Shields Avenue,
Mann Laboratory, Davis, CA, United States of America
*aallende@cebas.csic.es
Abstract
The contamination of pathogenic bacteria through irrigation water is a recognized risk factor
for fresh produce. Irrigation water disinfection is an intervention strategy that could be
applied to reduce the probability of microbiological contamination of crops. Disinfection
treatments should be applied ensuring minimum effective doses, which are efficient in inhib-
iting the microbial contamination while avoiding formation and accumulation of chemical res-
idues. Among disinfection technologies available for growers, chlorine dioxide (ClO
2
)
represents, after sodium hypochlorite, an alternative disinfection treatment, which is com-
mercially applied by growers in the USA and Spain. However, in most of the cases, the suit-
ability of this treatment has been tested against pathogenic bacteria and low attention have
been given to the impact of chemical residues on the bacterial community of the vegetable
tissue. The aim of this study was to (i) to evaluate the continual application of chlorine diox-
ide (ClO
2
) as a water disinfection treatment of irrigation water during baby spinach growth in
commercial production open fields, and (ii) to determine the subsequent impact of these
treatments on the bacterial communities in water, soil, and baby spinach. To gain insight
into the changes in the bacterial community elicited by ClO
2
, samples of treated and
untreated irrigation water as well as the irrigated soil and baby spinach were analyzed using
Miseq®Illumina sequencing platform. Next generation sequencing and multivariate statisti-
cal analysis revealed that ClO
2
treatment of irrigation water did not affect the diversity of the
bacterial community of water, soil and crop, but significant differences were observed in the
relative abundance of specific bacterial genera. This demonstrates the different susceptibil-
ity of the bacteria genera to the ClO
2
treatment. Based on the obtained results it can be con-
cluded that the phyllosphere bacterial community of baby spinach was more influenced by
the soil bacteria community rather than that of irrigation water. In the case of baby spinach,
the use of low residual ClO
2
concentrations (approx. 0.25 mg/L) to treat irrigation water
decreased the relative abundance of Pseudomonaceae (2.28-fold) and Enterobacteriaceae
(2.5-fold) when comparing treated versus untreated baby spinach. Members of these two
bacterial families are responsible for food spoilage and foodborne illnesses. Therefore, a
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 1 / 17
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Truchado P, Gil MI, Suslow T, Allende A
(2018) Impact of chlorine dioxide disinfection of
irrigation water on the epiphytic bacterial
community of baby spinach and underlying soil.
PLoS ONE 13(7): e0199291. https://doi.org/
10.1371/journal.pone.0199291
Editor: Leonard Simon van Overbeek, Wageningen
Universiteit en Researchcentrum, NETHERLANDS
Received: November 29, 2017
Accepted: June 5, 2018
Published: July 18, 2018
Copyright: ©2018 Truchado et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information
files.
Funding: Authors are thankful for the financial
support from the Center for Produce Safety Grant
Agreement (Projects 2015-374 and 2017-01 to A.
A.) and the MINECO (Projects AGL2013-48529-R
and AGL2016-75878-R to M.I.G.). P. Truchado is
holder of a Juan de la Cierva incorporation contract
from the MINECO (IJCI-2014-20932). Support
provided by the Fundacio
´n Se
´neca (19900/GERM/
reduction of these bacterial families might be beneficial for the crop and for food safety. In
general it can be concluded that the constant application of ClO
2
as a disinfection treatment
for irrigation water only caused changes in two bacterial families of the baby spinach and
soil microbiota, without affecting the major phyla and classes. The significance of these
changes in the bacterial community should be further evaluated.
Introduction
Fruit and vegetables harbor large and diverse types of cultivable and non-cultivable microbes
on their surface, which are in constant change during cultivation. Factors affecting changes
during cultivation have been associated to crop phenology, crop management, but also due to
environmental conditions [1,2]. Proteobacteria,Firmicutes,Bacteroidetes and Actinobacteria
are the most predominant phyla reported to comprise the bacterial community of the edible
part of above-soil harvested vegetables, particularly in leafy greens [3–6]. The composition
and the relative abundance of the bacterial taxa vary among plants, mostly due to plant species
and phenotypes, but also due to environmental conditions during growing, seasonality, the
physiological status of the plant and agricultural practices [7–9]. Previous studies have already
evaluated the impact that different agricultural practices have in the bacterial community of
different crops. For example, William et al., [8] observed significant differences in the bacterial
community of lettuce after irrigation using two different irrigation systems (sprinkler and drip
irrigation). On the other hand, the use of irrigation water with different microbial quality did
not significantly affect the bacterial community of tomato fruit [10,11]. Agricultural (ag) water
has been recognized as one of the major potential vectors of enteric human pathogens during
primary production [12–15]. Several strategies have been proposed to reduce the risk of food-
borne pathogen contamination including, selection of irrigation water sources, application
practices and disinfection technologies such as chemical, physical and combined treatments
[16–18]. Among these strategies, chlorine-derived compounds and UV-C water disinfection
are widely applied in primary production [18]. Sodium hypochlorite is the most commonly
used disinfection agent as it is easy to apply, efficient and cheap [17,18]. However, public
health concerns have been raised due to inappropriate hyperchlorination of water and the
potential health risks associated to the formation and accumulation of disinfection-by-prod-
ucts in the irrigation water which can be subsequently absorbed by the plant [17,14]. Thus, the
selection of more environmentally friendly technologies to reduce and efficiently control the
risk of microbial pathogen contamination in irrigation water has become a priority for grow-
ers. Another popular disinfectant agent to treat irrigation water is chlorine dioxide (ClO
2
),
which is being commercially applied by leafy greens growers in US and Spain [17,19]. One of
the reasons why ClO
2
has been suggested as an alternative to sodium hypochlorite is because it
does not forms trihalomethanes; however the accumulation of chlorate and chlorite may still
be of a concern [19].
The effectiveness of ClO
2
for irrigation water has been demonstrated for plant and human
pathogenic microorganisms [20–22]. However, the impact of long-term application of this
water treatment on the bacterial community of different agricultural habitats such as water,
soil and crops has not been established. In order to develop recommendations and best prac-
tice protocols for growers, an evaluation of the potential impacts needs to be performed in
well-controlled studies.
Microbial community profiles from specific ecosystems and econiches can be determined
using various techniques. Traditionally, conventional culture-dependent microbiological
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 2 / 17
15) and Proyecto Intramural (201670E056 to M.I.
G.) is also appreciated. The funders had no role in
study design, data collection and analysis, decision
to publish, or preparation of the manuscript.
Competing interests: The authors have declared
that no competing interests exist.
techniques or 16S rRNA clone libraries and fingerprinting methodologies, including tempera-
ture/denaturing gradient gel electrophoresis (TGGE and DGGE), have been used to investigate
the microbial community composition [23,24]. More recently next-generation sequencing
(NGS) technologies have provided more comprehensive descriptions of bacterial communities
due to the increased number of sequence reads and improved bioinformatics pipelines [25–27].
The recent advances in DNA sequencing can help researchers to understand the interactions
between plant and soil microbial communities and the qualitative and quantitative responses to
different agricultural practices and variable environmental and seasonal influences.
The goal of the present study was (i) to evaluate the continual application of chlorine diox-
ide (ClO
2
) as a water disinfection treatment of irrigation water during baby spinach growth in
commercial production open fields, and (ii) to determine the subsequent impact of these treat-
ments on the bacterial communities in water, soil, and baby spinach. For this purpose, the
comparative bacterial communities were profiled using Illumina high throughput NGS.
Results obtained in two commercial fields of baby spinach are presented.
Material and methods
Experimental set-up
Baby spinach (Spinacea Oleracea L.) was grown in two commercial fields (0.5 and 0.8 ha)
located in Pozo de la Higuera (Almerı
´a, Spain) and across two consecutive trials (October-
December 2015 and February-March 2016). The size of the experimental plots was dictated by
the need to conduct comparisons on commercial management units. As contiguous fields
were not available, the selected two fields were separated by a distance of 500 m. The edapho-
climatic conditions of the two fields were very similar regarding the soil texture and topogra-
phy. Nevertheless, in order to minimize uncontrollable influences of the geospatial location
and field characteristics, one field was the treated field (irrigated with ClO
2
-treated surface
water) in one trial and the other was the untreated one (irrigated with untreated surface water)
and the treatment assignment was reversed in the second trial. Crop management of soil prep-
aration, seeding, irrigation, and fertilization were consistent with commercial production
practices of baby spinach in this area as described previously [28]. Briefly, surface water stored
in a lined water reservoir was used for stand establishment and irrigation. This water source
was the only one available in these commercial plots. Water reservoirs are commonly used to
guarantee water supply throughout the whole irrigation season in arid and semiarid areas.
Therefore, when water is available, the water reservoir is filled and the water used during the
whole growing season. The quality of the irrigated water has been previously characterized in
Lo
´pez-Ga
´lvez et al. [28] and it was catalogued as good based on its low microbial counts, mod-
erate conductivity and the reduced concentration of organic matter. A stable and highly con-
centrated aqueous solution of ClO
2
(6000 mg/L), commercially known as AGRI DIS1
(Servicios Te
´cnicos de Canarias, Las Palmas de Gran Canaria, Spain) was used to treat the irri-
gation water. The commercial solution was prepared following the manufacturer instructions.
The concentrated ClO
2
solution (6000 ppm) was diluted with irrigation water in a 1000 L
opaque plastic tank. The diluted ClO
2
solution (approx. 100 ppm) was pumped into the irriga-
tion water system using a programmable Venturi suction unit (INTA Crop Technology S.L.,
A
´guilas, Spain). Dosing of ClO
2
was carried out to fulfill the ClO
2
demand of the irrigation
water and to maintain a constant residual dose of about 0.25 ppm, within an interval of 0.2–
0.7, but always below 1 mg/L. Monitorization of the ClO
2
concentration in the irrigation water
was determined using the chronoamperometry analysis Chlordioxense (Palintest, Gateshead,
UK) with a limit of detection of 0.02 mg/L. Analyses were performed on a daily basis at the
sprinkler head during the irrigation event.
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 3 / 17
Sampling
Water samples were taken directly from the solid set sprinkler irrigation system. Soil and baby
spinach was sampled at the end of the growing season at the commercial maturity stage of the
plants (12–15 cm long measured from the petiole and 6 expanded leaves per plant). Plant sam-
ples (100 g) were hand harvested using scissors by excision from the base of petioles and stored
in sterile plastic bags which were maintained on ice during transportation to the laboratory
(aprox. 45 min.). Scissors were wiped with an ethanol (70%) saturated cloth between use on
the different fields (ClO
2
treated and untreated). Soil and baby spinach samples were taken
from five representative positions, homogeneously distributed within each field. Plants were
harvested at each designated site from an area of 0.5 and 0.8 ha which corresponded to the
ClO
2
treated and untreated fields, respectively. Soil samples (25 g) were taken at the soil surface
(no more than 3 cm deep) located around each sampled plant. Irrigation water samples (2.5 L
each) were taken from different sprinkler riser positions located at each growing field. About
400 mL of sodium thiosulfate (5 g/L; Sigma-Aldrich, Darmstadt, Germany) was added to
quench oxidizer residuals in samples of irrigation water treated with ClO
2
. All samples were
transported (approximately 90 km) under refrigerated conditions in polystyrene boxes to the
CEBAS-CSIC laboratory (Murcia, Spain), and stored refrigerated at 4˚C until further process-
ing. Processing of the samples was performed within the first 12 hours after sampling.
DNA extraction
Samples of baby spinach (60 g each) were sonicated in 240 mL of 0.2% sterile buffered peptone
water (BPW; Scharlau Chemie, Barcelona, Spain) supplemented with 1% of Tween-80 (Poly-
ethylene glycol sorbitan monooleate; Sigma Aldrich, St Louis, MO, USA). Soil samples (3 g
each) were stomached in 150 mL of BPW for 1 min. Sonicated baby spinach and stomached
soil were centrifuged at 3000 X gfor 10 min, the supernatant was decanted, and the pellet
obtained was stored at -20˚C for DNA extraction. For both sample types, extraction processing
used the FastDNA1SPIN Kit for soil and the FastPrep124-Instrument (MPBiomedicals,
Solon, OH, USA), according to the manufacturer’s recommendations. Irrigation water sam-
ples (500 mL each) were centrifuged at 3000 X gfor 20 min. As stated above, the resultant pel-
lets were kept at -20˚C until the DNA extraction was performed following the previously
described protocol [29]. Briefly, the resulting pellets were lysed by enzymatic treatment with
Proteinase K (50 μg/μL). For each sample, DNA was extracted from the lysed pellets using the
MasterPure™Complete DNA and RNA purification kit (Epicenter, Madison, USA) according
to the manufacturer’s instructions. The quality and concentration of DNA extracts were deter-
mined by spectrophotometric measurement at 260/280 nm and 260/230nm using a Nano-
Drop1ND-1000 UV-Vis spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA,
USA). Limitations can be also related to the selection of the polymorphic hypervariable
regions. In the present study, the V3-V4 regions were selected as they have been defined as the
most reliable regions for representing the full-length 16S rRNA sequences in the phylogenetic
analysis of most bacterial phyla. However, other regions, such as V6, have been suggested by
the literature. In the present study, this region was not included due to technical limitations.
Illumina sequencing
The V3-V4 hypervariable region of the 16S rRNA gene was amplified using primers S-D-Bact-
0341-b-S-17/S-D-Bact-0785-a-A-21 [30] with Illumina overhang adapters on a MiSeq (Illu-
mina, Hayward, CA, USA) instrument. The libraries were generated using two limited-PCR
cycles. The first one included an initial denaturation step at 98˚C for 30 s; 20 cycles of a dena-
turation step at 98˚C for 30 s, an annealing step at 50˚C for 20 s, an extension step at 72˚C for
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 4 / 17
20 s; and a final extension at 72˚C for 2 min. Once completed, a PCR clean up step was per-
formed using AMPure XP beads (New England Biolabs, Ipswich, MA, USA) to purify the 16S
V3 and V4 amplicon, avoiding free primers and primer dimer species. Illumina sequencing
adapters and dual-index barcodes were added to the amplicon. To attach dual-index barcodes
(S-D-Bact-0341-b-S-17: ACACTGACGACATGGTTCTACA and S-D-Bact-0785-a-A-21: TAC
GGTAGCAGAGACTTGGTCT), a second PCR was performed using an Illumina sequencing
adapter from Nextera XT Index primers, developed by Illumina (Illumina, Hayward, CA,
USA). The second thermal cycling step included an initial denaturation step at 98˚C for 30 s;
12 cycles of a denaturation step at 98˚C for 30 s, an annealing step at 60˚C for 20 s, an exten-
sion step at 72˚C for 20 s; and a final extension at 72˚C for 2 min. The obtained PCR products
were cleaned with AMPure XP beads before library quantification was performed. The con-
centrations and qualities of library preparations were determined using the Quant-iT Pico-
Green double stranded DNA assay (Invitrogen, Carlsbad, CA, USA). Sequence data were
analyzed using the Quantitative Insights into Microbial Ecology (QIIME) program, version
1.9.1 [31]. The output file was processed for quality filtering by split_libraries_fastq.py. High
quality sequences were grouped into Operational Taxonomic Units (OTUs) with a sequence
identity threshold of 97%. Taxonomy was assigned by interrogating the high quality sequences
with the Greengenes database (13_5). Unclassified OTU sequences were manually annotated
against the NCBI database using the BLASTn function. Data were randomly subsampled to
the sequence count of the sample with the lowest sequence count using rarify_even_depth
implemented in the phyloseq package [32]. An average of 5624 reads per sample were obtained
and grouped into 803 phylotypes. Average read lengths from all samples were 240 bp.
Sequence depths from samples of irrigation water, soil, and baby spinach were determined by
the rarefaction curves and shown in the supplementary data (S1 Fig).
Statistical analysis
All statistical analyses were performed in R-studio program (3.3.2) and IBM SPSS Statistics 23
(SPSS, Chicago, IL). For each sample, total number of species, Fisher’s diversity, Shannon,
Simpson and inverse Simpson indices were calculated to assess the alpha diversity. Pielou’s
index was used as indicator of evenness in the community. Correlation among samples was
assessed using cluster analysis and the metric multidimensional scaling (MDS) ordination
method. Bray-Curtis and Jaccard distances were used to construct dissimilarity matrices of the
communities. Beta diversity of the community was determined and Nonmetric multidimen-
sional scaling (NMDS) was employed to visualize the differences among samples using the
vegan package in R [33]. Dissimilarity analyses of bacterial community structures in samples
from different treatments (ClO
2
treated and untreated) were calculated using the function
Adonis (PERMANOVA) and ANOSIM. Differences in alpha diversity, evenness measures and
relative abundances of bacteria genera between treated and untreated samples were compared
using Mann Whitney U and Kruskal–Wallis tests.
Results and discussion
Bacterial community composition of irrigation water, soil and baby
spinach
Based on the protocols utilized, the bacterial community of irrigation water was dominated by
Proteobacteria (41.53 ±1.42% average for control samples ±standard deviation) and Actino-
bacteria (16.71 ±5.41%) followed by less abundant phyla such as Bacteroidetes (11.13 ±3.09%),
Chloroflexi (7.99 ±4.33%), Firmicutes (7.47 ±1.33%) and Verrumicrobia (5.57 ±0.78%) (Fig
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 5 / 17
1A). Regarding classes, Actinobacteria (16.52 ±5.42%), Alpha (15.65 ±6.39%), Beta (11.49 ±
1.54%), and Gammaproteobacteria (3.51 ±1.39%) were the most predominant taxa (Fig 1B).
The members of the most predominant families in the irrigation water were Thermogemmatis-
poraceae (8.78 ±3.82%), Dethiosulfovibrionaceae (5.20 ±1.88%), Pseudonocardiaceae (4.83 ±
1.06%), Saprospiraceae (4.70 ±1.13%), Comamonadaceae (4.61 ±1.78%), Verrucomicrobiaceae
(4.15 ±0.82%) and Campylobacteraceae (4.07 ±0.66%) (S1 Table). These results are consistent
with those described for the bacterial community of surface water [34–36].
Among soil samples, the dominant phyla were Actinobacteria (43.19 ±2.90%), followed by
Proteobacteria (28.28 ±2.19%), Firmicutes (21.84 ±1.50%)and Bacteroidetes (2.77±0.35%)
(Fig 1A). These identified phyla, as well as the Acidobacteria phyla have been associated previ-
ously with the bacterial community of soil in arid and semiarid Mediterranean regions [37–
39]. However, the Acidobacteria phylum was not detected in the current study. The difference
observed in the identified phyla could be due to environmental factors but also due to some
Fig 1. Composition of bacterial phyla and classes of untreated and ClO
2
treated samples. Percentage of relative
abundance of bacterial phyla (A) and classes (B) of untreated and ClO
2
treated samples of irrigation water (IW), soil (Soil)
and baby spinach (Crop). Bacterial community is the average of 5 individual samples. Data shown are phyla that
comprised at least 1% of the sequences in at least one sample of a given agronomic habitat.
https://doi.org/10.1371/journal.pone.0199291.g001
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 6 / 17
intrinsic characteristics of the plant material (e.g. genotype and leaf maturity) [40–42]. Among
the identified classes, the predominant ones were Actinobacteria (41.31 ±2.88%), Bacilli
(16.74 ±1.72%), Alphaproteobacteria (13.45 ±1.23%), and Gammaproteobacteria (6.03 ±
0.49%) (Fig 1B). Further analyses carried out in soil samples revealed the presence of a total of
23 major families (abundance >1% in at least one sample) and 58 genera (abundance >0.5%
in at least one sample). Among them, the most abundant families represented were Bacillaceae
(13.49 ±1.45%), Nocardioidaceae (10.38 ±0.61%), Micrococcaceae (9.72 ±1.35%), and Strepto-
mycetaceae (7.21 ±1.44%), which included members of the genera Bacillus (10.30 ±11.10%),
Nocardioides (5.92 ±0.52%), Arthrobacter (6.11 ±0.93%) and Streptomyces (6.68 ±1.37%) (S1
Table).
Schlatter et al. [43] suggested that the bacterial community of plants could be influenced by
the soil bacterial community. Supporting this general expectation, Mowlick et al. [44] observed
similar bacterial diversity in soil and spinach samples collected from the same production
field. Splash dispersal and deposition of soil during irrigation events would be a reasonable
mechanism, for a low growing crop like baby spinach, to result in these outcomes. However,
generalizations are difficult to make from such a limited sample size, where only one commer-
cial field has been monitored. Additionally, it should be taken into account the complexity of
soil microbial community and the myriad of ways in which different climate drivers such as
temperature and precipitation might affect soil microorganisms [45].
In baby spinach, the most dominant phyla were Proteobacteria (44.64 ±8.54%), Firmicutes
(28.29 ±11.23%), and Actinobacteria (18.73 ±3.95%), accounting for more than 92% of the
total sequences (Fig 1A). Additionally, the bacterial classes with the highest relative abundance
were Bacilli (20.33 ±6.12%), Gammaproteobacteria (16.58 ±6.0%), Actinobacteria (16.55 ±
4.39%), Alphaproteobacteria, (13.76 ±4.21%) and Betaproteobacteria (5.08 ±2.93%) (Fig 1B).
These results agree with previous studies that reported these phyla and classes as the predomi-
nant ones in the phyllopshere of baby spinach [46,47]. At the family level, Bacillae (12.79 ±
3.76%), Pseudomonaceae (7.96 ±4.59%) and Sphingomonadaceae (4.51 ±1.12%) were the pre-
dominant families in baby spinach when both irrigated with treated and untreated water (S1
Table). This study is not the first one identifying members of the Sphingomonadaceae family in
baby spinach phyllosphere. A previous study published by Lopez-Velasco et al., [48] isolated
Sphingomonas, of the Sphingomonadaceae family from spinach leaf surface. However, other
families such as Enterobacteriaceae, previously described in the phyllosphere of spinach [5,46],
were found at low abundance in the present study. This low abundance of the Enterobacteria-
ceae family could be attributed not only to environmental differences but also to some intrinsic
characteristics of the plant material such as differences in the genotype and leaf maturity [40–
42]. At the genus level, the most prevalent ones in the phyllosphere of baby spinach were Bacil-
lus (10.32 ±3.00%) and Pseudomonas (7.96 ±4.58%). In agreement with other studies on bac-
terial community of spinach, Pseudomonas were the dominant genera detected on surface
leaves (4–29% of the population), although Bacillus was found at lower concentrations (2.2–
0.8% of the population) [5,6]. Additionally, other less prevalent genera (e.g., Massilia and Pan-
toea) previously identified as part of the core phyllosphere community of leafy greens
[3,4,25,46] were also found in ClO
2
treated and untreated baby spinach.
Bacterial community structure of irrigation water, soil and baby spinach
due to the ClO
2
treatment
In order to determine the impact of ClO
2
disinfection treatment of irrigation water on the bac-
terial diversity of different agronomic factors (irrigation water, soil and leaves), the species
richness, the alpha-diversity index and evenness were calculated for untreated and ClO
2
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 7 / 17
treated samples. The selected indexes did not show significant differences (Mann Whitney test
P<0.01) between treated and untreated samples. These results were based on the similar
range of alpha-diversity between samples (Table 1). Nonmetric multidimensional scaling
(NMDS) plots using Bray-Curtis distance, based on the OTUs matrix, were performed to
evaluate the structure of bacterial community from the different agronomic factors. It was
observed that NMDS plots for treated and untreated irrigation water and soil samples irrigated
with treated and untreated water associated in distinct clusters (Fig 2A and 2B). In contrast,
bacterial community of baby spinach irrigated with treated and untreated water clustered
together (Fig 2C). The dissimilarity analysis of bacterial community structures of irrigation
water, soil and baby spinach revealed that significant differences on the OTUs abundance were
only observed between treated and untreated irrigation water samples (Table 2). These results
showed that the use of ClO
2
as a water disinfection treatment had a low impact on the soil and
plant bacterial communities.
Bacterial community composition of irrigation water, soil and baby
spinach due to the ClO
2
treatment
In the case of irrigation water, no significant differences were found in the relative abundance
of the predominant taxonomic groups of bacteria between treated and untreated samples.
However, when compared to the untreated water, ClO
2
treated water showed a reduction of
the relative abundance of Verrucomicrobiae and Synergistia classes of about 1.17 (P<0.000)
and 2.53 (P<0.005), respectively (Fig 2). Previous studies in drinking water and wastewater
reported that the abundance of the phylum Proteobacteria decreased upon chlorine disinfec-
tion [49,50]. The differences observed with the present study could be due to the low concen-
tration of ClO
2
applied for the irrigation water disinfection, which might have affected the
relative abundance of less predominant families, without affecting the most predominant
ones. A second hypothesis could be associated with the fact that DNA-high throughput
sequencing could not distinguish between viable and dead cells. In an attempt to alleviate this
limitation, DNA intercalating dyes such as Propidium monoazide (PMA) could have been an
efficient methodology to include during sample processing [29,51]. Recently, [52] demon-
strated that the use of (NGS) combined with PMA was an efficient technique to determine the
Table 1. Species richness (total species), diversity (Shannon, Fisher’s alpha, Simpson and Inverse Simpson indices), and evenness (Pielou’s index) of untreated and
ClO
2
treated samples of irrigation water (IW), soil (Soil) and baby spinach (Crop).
Index IW Soil Crop
Total species Untreated 523 (514 ±557) 613 (609 ±633) 556 (490 ±607)
ClO
2
Treated 558 (534 ±572) 599 (587 ±613) 576 (470 ±6.21)
Shannon Untreated 4.11 (3.97 ±4.19) 4.67 (4.61 ±4.78) 3.05 (1.05 ±4.46)
ClO
2
Treated 4.18 (4.05 ±4.39) 4.73 (4.56 ±4.78) 2.86 (1.50 ±0.43)
Fisher Untreated 7.75 (7.50 ±8.17) 8.70 (8.57 ±8.76) 8.26 (6.80 ±9.16)
ClO
2
Treated 8.02 (7.77 ±8.54) 8.85 (8.70 ±9.01) 8.14 (6.74 ±9.05)
Simpson Untreated 0.95 (0.94 ±0.90) 0.97 (0.97 ±0.95) 0.75 (0.42 ±0.94)
ClO
2
Treated 0.96 (0.95 ±0.97) 0.97 (0.96 ±0.98) 0.69 (0.42 0.93)
Inverse Simpson Untreated 21.25 (18.03 ±27.56) 34.01 (33.25 ±41.32) 6.52 (1.74 ±19.53)
ClO
2
Treated 25.01 (21.27 ±26.81) 39.48 (32.32 ±42.47) 13.03 (2.11±16.15)
Pielou Untreated 0.65 (0.64 ±0.69) 0.73 (0.72 ±0.75) 0.48 (0.24 ±0.70)
ClO
2
Treated 0.66 (0.64 ±0.69) 0.73 (0.71 ±0.74) 0.45 (0.24 ±067)
Values are the mean ±SEM of n = 20 for irrigation water, n = 10 for soil and n = 20 for baby spinach.
https://doi.org/10.1371/journal.pone.0199291.t001
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 8 / 17
changes in the bacterial community composition of drinking water when comparing treated
and untreated water disinfection samples.
At genus level, 73 major genera (abundance >0.5% in at least one sample) were identified
in the irrigation water samples, showing 17 of them having significant differences between
ClO
2
treated and untreated irrigation water. Among them, ClO
2
treatment significantly
reduced the relative abundance of phylotypes belonging to genera such as Acidimicrobium,
Kribbella,Mycobacterium,Rhodococcus,Saccharopolyspora,Euzebya,Kaistobacter,Novosphin-
gobium,Rhodobacter,Sphingobium,Sphingomonas,Polynucleobacter,Legionella,Luteibacter,
Dethiosulfovibrio,Candidatus and Xiphinematobacter (Table 3). In consequence, the relative
abundance of some others increased such as Demequina,Chitinophaga,Flavobacterium,Fluvii-
cola,Bacillus,Clostridium,Candidatus Scalindua,Acidiphilium,Polaromonas,Campylobacter
and Mycoplasm (Table 3). Nevertheless, members belonging to families associated with patho-
genic bacteria such as Legionella and Mycobacterium species were detected, although the abun-
dance of these pathogenic bacteria decreased in irrigation water treated with ClO
2
(Table 3).
These results are in agreement with others that showed the decrease in Legionella and Myco-
bacterium when using different disinfection water treatments such as, ozone, chlorine, and
ClO
2
[53–55].
In soil, at phylum and class levels, no significant differences in the bacterial community
were observed between crop areas irrigated with untreated and ClO
2
treated water, except for
the Betaproteobacteria class, which showed a reduction of 1.6 folds of their relative abundance.
At lower taxonomic levels, the relative abundance of the Limnobacter and Pontibacter genera
significantly decreased in the soil irrigated with ClO
2
treated water (Table 3). These changes
suggest a potentially greater susceptibility to ClO
2
treatment. Gu et al. [56] reported that the
bacterial community in baby spinach shifted significantly after chlorine washing. They
observed that Proteobacteria species, such as Stenotrophomonas spp. and Erwinia spp., were
relatively tolerant of chlorine treatment, while species of Flavobacterium and Pedobacter (phy-
lum bacteroidetes) grew rapidly during storage, especially at abusive temperatures. The results
obtained suggest that the continuous application of ClO
2
as a water disinfection treatment to
improve the microbiological quality of irrigation water did not cause significant changes in the
bacterial community composition of the soil. These results support the use of a low residual
concentration of ClO
2
in the irrigation water, as a corrective measure for water sources of con-
cern, to be applied during the growing cycle without a detrimental impact on the bacterial
diversity of soil. Long-term application with subtle but cumulative effects should be consid-
ered. Also, previous studies reported that soil irrigated with ClO
2
treated wastewater did not
alter the bacterial community based on a terminal restriction fragment analysis [57]. However,
further in-depth studies are still needed to determine the impact of the water disinfection
Fig 2. Comparison of bacterial community of untreated and ClO
2
treated (ClO
2
) samples of irrigation water
(IW), soil (Soil) and baby spinach (Crop). Nonmetric multidimensional scaling (NMDS) based on Bray–Curtis
distance from OTUs abundance.
https://doi.org/10.1371/journal.pone.0199291.g002
Table 2. Dissimilarity analysis of bacterial community structured in irrigation water (IW), soil (Soil) and baby
spinach (Crop).
Adonis Anosim
F P R P
IW 5.881 0.01 0.476 0.01
Soil 1.866 0.07 0.196 0.08
Crop 0.934 0.31 0.008 0.29
https://doi.org/10.1371/journal.pone.0199291.t002
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 10 / 17
treatments in the bacterial composition across variable water constituent content qualities,
duration of treatment and environmental conditions.
For baby spinach samples, no significant differences at the phyla and class levels were found
between samples irrigated with ClO
2
treated and untreated water. However, when the major
families and genera (those with average abundance >0.5% in at least one sample) were com-
pared, significant differences were observed between irrigated baby spinach with treated and
untreated water. The use of ClO
2
treated water to irrigate baby spinach during the complete
growing cycle significantly reduced the relative abundance of two families and four genera
including Pseudomonas as well as some less abundant genera such as Erwinia,Enterobacter and
Tolumonas (Table 3). In general, these genera were not among the most predominant ones in
Table 3. Bacteria genera that showed significant differences (P <0.05) in their relative abundances between untreated and ClO
2
treated samples of irrigation water
(IW), soil (Soil) and baby spinach (Crop).
Taxonomy
Phylum Class Order Family Genera PUntreated ClO
2
Treated
IW Actinobacteria Acidimicrobiia Acidimicrobiales Acidimicrobiaceae Acidimicrobium 0.043 0.30±0.13 0.18±0.10
Actinobacteria Actinobacteria Actinomycetales Cellulomonadaceae Demequina 0.029 2.50±1.50 4.03±0.55
Actinobacteria Actinobacteria Actinomycetales Nocardioidaceae Kribbella 0.007 0.94±0.35 0.58±0.14
Actinobacteria Actinobacteria Actinomycetales Mycobacteriaceae Mycobacterium 0.000 1.33±0.59 0.33±0.19
Actinobacteria Actinobacteria Actinomycetales Nocardiaceae Rhodococcus 0.002 0.33±0.13 0.17±0.04
Actinobacteria Actinobacteria Actinomycetales Pseudonocardiaceae Saccharopolyspora 0.000 4.40±1.04 1.57±0.57
Actinobacteria Nitriliruptoria Euzebyales Euzebyaceae Euzebya 0.000 0.51±0.14 0.25±0.04
Bacteroidetes Sphingobacteriia Sphingobacteriales Chitinophagaceae Chitinophaga 0.000 0.27±0.13 0.62±0.21
Bacteroidetes Flavobacteriia Flavobacteriales Flavobacteriaceae Flavobacterium 0.009 1.44±0.35 1.89±0.33
Bacteroidetes Flavobacteriia Flavobacteriales Cryomorphaceae Fluviicola 0.000 0.37±0.22 0.95±0.25
Firmicutes Clostridia Clostridiales Clostridiaceae Clostridium 0.004 0.28±0.05 0.41±0.10
Planctomycetes Brocadiae Brocadiales Brocadiaceae Candidatus Scalindua 0.007 1.01±0.68 1.93±0.55
Proteobacteria Alphaproteobacteria Rhodospirillales Acetobacteraceae Acidiphilium 0.000 1.14±0.51 2.80±0.64
Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Kaistobacter 0.004 0.15±0.30 0.05±0.07
Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Novosphingobium 0.000 0.85±0.29 0.38±0.09
Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae Rhodobacter 0.003 1.40±0.25 0.91±0.30
Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingobium 0.002 0.45±0.63 0.10±0.02
Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas 0.000 1.61±0.14 0.56±0.03
Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Polaromonas 0.002 0.21±0.15 0.48±0.16
Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae Polynucleobacter 0.043 0.31±0.11 0.44±0.01
Proteobacteria Epsilonproteobacteria Campylobacterales Campylobacteraceae Campylobacter 0.000 3.97±0.81 13.34±5.96
Proteobacteria Gammaproteobacteria Legionellales Legionellaceae Legionella 0.000 0.39±0.10 0.24±0.04
Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Luteibacter 0.002 3.17±0.97 2.00±0.37
Synergistetes Synergistia Synergistales Dethiosulfovibrionaceae Dethiosulfovibrio 0.002 5.20±1.99 2.58±0.88
Tenericutes Mollicutes Mycoplasmatales Mycoplasmataceae Mycoplasma 0.001 0.90±0.18 1.67±0.41
Verrucomicrobia Spartobacteria Chthoniobacterales Candidatus Xiphinematobacter 0.002 1.42±0.27 0.95±0.20
Soil Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Limnobacter 0.009 0.64±0.17 0.20±0.11
Bacteroidetes Sphingobacteriia Sphingobacteriales Flexibacteraceae Pontibacter 0.016 0.78±0.12 0.45±0.15
Crop Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas 0.019 7.76±4.58 2.92±2.24
Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Erwinia 0.004 0.36±0.33 0.09±0.06
Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Enterobacter 0.023 0.37±0.51 0.11±0.10
Proteobacteria Gammaproteobacteria Aeromonadales Aeromonadaceae Tolumonas 0.043 0.30±0.32 0.09±0.07
Only genera greater and equal to 0.5% differed with a p-value <0.05 (Mann Whitney) are shown.
https://doi.org/10.1371/journal.pone.0199291.t003
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 11 / 17
the bacterial community of baby spinach, except for Pseudomonas. This is a notable finding
because approximately 30% of the postharvest losses per year in fresh produce have been attrib-
uted to the colonization by Pseudomonas,Erwinia and Enterobacter [58–59]. Some species from
the Pseudomonas and Erwinia genera were listed among the top ten plant pathogenic bacteria
[60], although Pseudomonas and Erwinia genera also contain many plant-beneficial groups.
Impact sources of the bacterial community of baby spinach and their
interactions with agronomic habitats
Cluster analysis and metric multidimensional scaling (MDS) were performed to evaluate the
similarity of the different agronomic habitats (irrigation water, soil and leaves) (Fig 3). The
OTU enumeration data were used to construct dissimilarity matrices with Bray-Cutis distance
with the aim to determine whether the bacterial community from irrigation water and soil
interrelated with the composition of the natural microbiota of baby spinach. The cluster analy-
sis differentiated two clusters; a first one composed by all the irrigation water samples and a
second one including two sub-clusters, one for soil samples and another for baby spinach (Fig
3A). The MDS plot displayed similar patterns among samples, in which the bacterial commu-
nity from baby spinach and soil clustered in close display proximity and differed from those of
water samples (Fig 3B). These results suggested that the composition of bacterial community
associated with the crop was influenced more by the soil bacterial community than by the irri-
gation water microbiota. These findings are consistent with previous studies, which suggested
that soil can be a source of bacteria associated with leafy greens [25,61]. In agreement with our
results, it was observed that the bacterial community of spinach was more similar to soil
microbiota than that of irrigation water [6,62]. This was attributed to the structure of the leaves
(open canopy) and very limited vertical separation from the soil seedbed, thereby facilitating
dispersal of soil bacteria to the crop. Regarding irrigation water, our results are consistent with
previous studies, which demonstrated that the irrigation water bacterial community did not
contribute to the variation of the phyllosphere microbial diversity of the crop [11,10].
This study has a few limitations. The enrolled producer was among the largest baby spinach
producers in the study area. This was important to assure that the results of this study are rele-
vant to a large segment of the produced baby spinach in this area of Spain. However, because
producers of different sizes may have different management practices caution is needed in
extrapolating the results to all producers in the study area. Notably, this study evaluated two
growing cycles, where the control and treatment plots were reversed after the first assay to
eliminate any factor associated to the specific plots. However, variation in field soil composi-
tion may exist thus explaining variations between experiments. However, reversing the control
and treatments plots was performed to eliminate any factor associated to the specific plots but
this might have caused some effects on the soil bacterial community.
Conclusions
The results obtained regarding the bacterial community composition and diversity showed
that ClO
2
disinfection treatment positively affected the microbiota of irrigation water reduc-
ing–the relative abundance genera associated with spoilage and foodborne illnesses. However,
the bacterial community of soil and baby spinach irrigated with ClO
2
treated water was not
demonstrably affected. Small changes were only detected at lower taxonomic levels, particu-
larly for Pseudomonadaceae and Enterobacteriaceae with a decrease in the abundance of these
genera in baby spinach irrigated with ClO
2
treated water. Based on the results obtained, stabi-
lized ClO
2
could be considered an eco-compatible disinfection technology as it has a neutral
effect on soil and crop microbial diversity.
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 12 / 17
Supporting information
S1 Fig. Rarefaction curves of sequencing samples. (A) irrigation water samples (IW), (B)
soil samples (soil), (C) baby spinach samples (crop). CT is the control treatments (without
Fig 3. Dendrogram generated by UPGMA clustering (A) and metric multidimensional scaling (MDS) (B) based on the Bray-
curtis distance from the OTUs abundance matrix of irrigation water (IW), soil (Soil) and baby spinach (Crop). Colors denote
the cluster from samples.
https://doi.org/10.1371/journal.pone.0199291.g003
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 13 / 17
chlorine dioxide) and ClO2 represents chlorine dioxide treatments. (1, IW-CT; 2, IW-CT;
3, IW-CT; 4, IW-CT; 5, IW-CT; 6, IW-CT; 7, IW-CT; 8, IW-CT; 9, IW-CT; 10, IW-CT; 11,
IW-ClO
2
; 12, IW-ClO
2
; 13, IW-ClO
2
; 14, IW-ClO
2
; 15, IW-ClO
2
; 16, IW-ClO
2
; 17, IW-ClO
2
;
18, IW-ClO
2
; 19, IW-ClO
2
; 20, IW-ClO
2
. (B) soil samples (1, Soil-CT; 2, Soil-CT; 3, Soil-CT; 4,
Soil-CT; 5, Soil-CT; 6, Soil-ClO
2
; 7, Soil-ClO
2
; 8, Soil-ClO
2
; 9, Soil-ClO
2
; 10, Soil-ClO
2
). (C)
Baby spinach samples (1, Crop-CT; 2, Crop-CT; 3, Crop-CT; 4, Crop-CT; 5, Crop-CT; 6,
Crop-CT; 7, Crop-CT; 8, Crop-CT; 9, Crop-CT; 10, Crop-CT; 11, Crop-ClO
2
; 12, Crop-ClO
2
;
13, Crop-ClO
2
; 14, Crop-ClO
2
; 15, Crop-ClO
2
; 16, Crop-ClO
2
; 17, Crop-ClO
2
; 18, Crop-ClO
2
;
19, Crop-ClO
2
; 20, Crop-ClO
2
).
(TIF)
S1 Table. Composition of bacterial families of untreated and ClO
2
treated samples of irri-
gation water (IW), soil (Soil) and baby spinach (Crop). Bacterial community is the average
of 5 individual samples. Data shown are families that comprised at least 1% of the sequences in
at least one sample of a given agronomic habitat.
(PDF)
Acknowledgments
Authors are thankful for the financial support from the Center for Produce Safety Grant
Agreement (Projects 2015-374 and 2017-01) and the MINECO (ProjectsAGL2013-48529-R
and AGL2016-75878-R). P. Truchado is holder of a Juan de la Cierva incorporation contract
from the MINECO (IJCI-2014-20932). Support provided by the Fundacio
´n Se
´neca (19900/
GERM/15) and Proyecto Intramural 201670E056 is also appreciated.
Author Contributions
Conceptualization: Pilar Truchado, Marı
´a Isabel Gil, Ana Allende.
Data curation: Pilar Truchado.
Formal analysis: Pilar Truchado.
Funding acquisition: Ana Allende.
Methodology: Pilar Truchado, Trevor Suslow.
Project administration: Ana Allende.
Supervision: Ana Allende.
Writing – original draft: Pilar Truchado.
Writing – review & editing: Marı
´a Isabel Gil, Trevor Suslow, Ana Allende.
References
1. Vorholt JA. Microbial life in the phyllosphere. Nat. Rev. Microbiol. 2012; 10: 828–840. https://doi.org/10.
1038/nrmicro2910 PMID: 23154261
2. Deng W, Gibson KE. Interaction of microorganisms within leafy green phyllospheres: where do human
norovirus fit in? Int J Food Microbiol 2017; 258: 28–37. https://doi.org/10.1016/j.ijfoodmicro.2017.07.
010 PMID: 28755583
3. Rastogi G, Sbodio A, Tech JJ, Suslow TV, Coaker GL, Leveau JHJ. Leaf microbiota in an agroecosys-
tem: spatiotemporal variation in bacterial community composition on field-grown lettuce. ISME J. 2012;
10:1812–1822.
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 14 / 17
4. Bulgarelli D, Schlaeppi K, Spaepen S, Loren V, van Themaat E. Schulze-Lefert P. Structure and func-
tions of the bacterial microbiota of plants. Annu Rev Plant Biol. 2013; 64: 807–838. https://doi.org/10.
1146/annurev-arplant-050312-120106 PMID: 23373698
5. Leff JW, Fierer N. Bacterial Communities associated with the surfaces of fresh fruits and vegetables.
PLoS ONE. 2013; 8: e59310. https://doi.org/10.1371/journal.pone.0059310 PMID: 23544058
6. Burch AY, Do PT, Sbodio A, Suslow TV, Lindow SE. High-level culturability of epiphytic bacteria and fre-
quency of biosurfactant producers on leaves. Appl Environ Microb. 2016; 82: 5997–6009.
7. Jensen B, Knudsen IMB, Andersen B, Nielsen KF, Thranes U, Jensen DF, et al. Characterization of
microbial communities and fungal metabolites on field grown strawberries from organic and conven-
tional production. Int J Food Microbiol. 2013; 160: 313–322 https://doi.org/10.1016/j.ijfoodmicro.2012.
11.005 PMID: 23290240
8. Williams TR, Moyne AL., Harris LJ, Marco ML. Season, irrigation, leaf age, and Escherichia coli inocula-
tion influence the bacterial diversity in the lettuce phyllosphere. PLoS ONE, 2013; 8:e68642. https://doi.
org/10.1371/journal.pone.0068642 PMID: 23844230
9. Wei F, Hu X, Xu X. Dispersal of Bacillus subtilis and its effect on strawberry phyllosphere microbiota
under open field and protection conditions. Scientific Reports. 2016: 6; 22611. https://doi.org/10.1038/
srep22611 PMID: 26936109
10. Telias A, White JR, Pahl DM, Ottesen AR, Walsh CS. Bacterial community diversity and variation in
spray water sources and the tomato fruit surface. BMC Microbiol. 2011; 11–81.
11. Ottesen A, Telias A, White JR, Newell MJ, Pahl D, Brown EW, et al. Bacteria of tomatoes managed with
well water and pond water: Impact of agricultural water sources on carposphere microbiota. Int J Envi-
ron Agric Res. 2016; 2: 2454–1850.
12. Park S, Navratil S, Gregory A, Bauer A, Srinath I, Jun M, et al. Generic Escherichia coli contamination
of spinach at the pre-harvest level: The role of farm management and environmental factors. Appl Envi-
ron Microbiol. 2013; 79:4347–4358. https://doi.org/10.1128/AEM.00474-13 PMID: 23666336
13. Pachepsky Y, Shelton DR, McLain JET, Patel J, Mandrell RE, Irrigation waters as a source of patho-
genic microorganisms in produce: a review. Adv Agron. 2011: 113; 73–138.
14. Allende A., Monaghan JM. Irrigation water quality for leafy crops: a perspective of risks and potential
solutions. Int J Environ Health Res. 2015; 12: 7457–7477.
15. Monaghan JM., Augustin JC., Bassett J., Betts R., Pourkomailian B., Zwietering MH. Risk assessment
or assessment of Risk? Developing an evidence-eased approach for primary producers of leafy vegeta-
bles to assess and manage microbial risks. J Food Prot. 2017; 80: 725–733.
16. EFSA (European Food Safety Authority). 2013. Scientific Opinion of the Panel on Biological Hazards
(BIOHAZ) on VTEC-seropathotype and scientific criteria regarding pathogenicity assessment. EFSA J.
11:3138; 1–106. Available from: http://www.10.2903/j.efsa.2013.3138.EFSA, 2013.
17. Suslow, TV. Standards for irrigation and foliar contact water. An initiative of the pew charitable trusts at
Georgetown University. Peer-Reviewed Issue. 2010. Available from: http://www.producesafetyproject.
org/admin/assets/files/Water-Suslow-1.pdf
18. Gil MI, Selma MV, Suslow T, Jacxsens L, Uyttendaele M, Allende A. Pre- and postharvest preventive
measures and intervention strategies to control microbial food safety hazards of fresh leafy vegetables.
Crit. Rev. Food Sci. 2015; 55: 453–468.
19. Lo
´pez-Ga
´lvez F, Sampers I, Gil MI, Allende A. Modelling of E.coli inactivation by chlorine dioxide in irri-
gation water. Agric Water Manment. 2017; 192: 98–102.
20. Yao KS, Hsieh YH, Chang YJ, Chang CY, Cheng TC, Liao HL. 2010. Inactivation effect of chlorine diox-
ide on phytopathogenic bacteria in irrigation water. Environ. Eng. Manag. J. 2010; 3: 157–160.
21. Scarlett K, Collins D, Tesoriero L, Jewell L van Ogtrop F, Daniel R. Efficacy of chlorine, chlorine dioxide
and ultraviolet radiation as disinfectants against plant pathogens in irrigation water. Eur J Plant Pathol.
2017; 145: 27–38.
22. Reitz SR, Roncarati RA, Shock CC, Kreeft H, Klauzer J, Chlorine dioxide injection through drip irrigation
reduces Escherichia coli. ASABE/IA Irrigation Symposium: Emerging Technologies for Sustainable Irri-
gation. Proceedings of the 10–12 November 2015 Symposium, Long Beach, California USA. Published
by ASABE St. Joseph, Michigan, USA. 2015: November 10, 2015.
23. Ibekwe AM, Grieve CM. Changes in developing plant microbial community structure as affected by con-
taminated water. FEMS Microbiol Ecol. 2004; 48: 239–248. https://doi.org/10.1016/j.femsec.2004.01.
012 PMID: 19712407
24. Zwielehner J, Handschur M, Michaelsen A, Irez S, Demel M, Denner EB, et al. DGGE and real-time
PCR analysis of lactic acid bacteria in bacterial communities of the phyllosphere of lettuce. Mol Nutr
Food Res. 2008; 52: 614–23. https://doi.org/10.1002/mnfr.200700158 PMID: 18398868
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 15 / 17
25. Dees MW, Lysøe E, Nordskog B, Brurberg MB. Bacterial communities associated with surfaces of leafy
greens: shift in composition and decrease in richness over time. App Environ Microbiol. 2015; 81:
1530–1539.
26. Qin Y, Hou J, Deng M, Liu Q, Wu C, Ji Y, et al. Bacterial abundance and diversity in pond water supplied
with different feeds. Sci Rep. 2016; 6: 35232. https://doi.org/10.1038/srep35232 PMID: 27759010
27. Ishaq SL., Johnson SP., Miller Z.J., Lehnhoff EA, Olivo S, Yeoman CJ., et al. Impact of cropping sys-
tems, soil inoculum, and plant species identity on soil bacterial community structure. 2017. Microbial
Ecol. 2017; 73: 417–434.
28. Lo
´pez-Ga
´lvez F, Gil MI, Truchado P, Allende A. Demonstration tests of irrigation water disinfection with
chlorine dioxide in open field cultivation of baby spinach. J Sci Food Agric. 2018, https://doi.org/10.
1002/jsfa.8794 PMID: 29171860
29. Truchado P, Gil MI, Kostic T, Allende A, Optimization and validation ofa PMA qPCR methodfor Escher-
ichia coli quantification in primary production. Food Control. 2016; 62: 150–156.
30. Herlemann DPR, Labrenz M, Juergens K, Bertilsson S, Waniek JJ, Anderrson AF. Transition in bacte-
rial communities along the 2000 km salinity gradient of the Baltic Sea. ISME J. 2011; 5: 1571–1579.
https://doi.org/10.1038/ismej.2011.41 PMID: 21472016
31. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME allows
analysis of high-throughput community sequencing data. Nat Methods. 2010; 7: 335–6. https://doi.org/
10.1038/nmeth.f.303 PMID: 20383131
32. McMurdie PJ, Holmes S. Phyloseq: an R package for reproducible interactive analysis and graphics of
microbiome census data. PLoS One. 2013; 8(4): e61217. https://doi.org/10.1371/journal.pone.0061217
PMID: 23630581
33. Oksanen J, Blanchet FG, Kindt R, Legendre P, Minchin PR, O’Hara RB, et al. Vegan: community ecol-
ogy package. R package vegan, vers. 2.2–1. 2015. Available from: http://www.cran.r-project.org/
package=vegan
34. Vaz-Moreira I, Egas C, Nunes OC. Manaia CM. Bacterial diversity from the source to the tap: a compar-
ative study based on 16S rRNA gene-DGGE and culture-dependent methods. FEMS Microbiol. Ecol.
2013; 83: 361–374. https://doi.org/10.1111/1574-6941.12002 PMID: 22938591
35. Wei YM, Wang JQ, Liu TT, Kong WW, Chen N, He XQ, et al. Bacterial communities of Beijing surface
waters as revealed by 454 pyrosequencing of the 16S rRNA gene. Environ Sci Pollut Res. 2015: 22;
12605.
36. Becerra-Castro C, Macedo G, Silva AMT, Manaia CM, Nunes OC,. Proteobacteria become predomi-
nant during regrowth after water disinfection. Sci Total Environ. 2016; 573: 313–323. https://doi.org/10.
1016/j.scitotenv.2016.08.054 PMID: 27570199
37. Lauber CL, Hamady M, Knight R, Fierer N. Pyrosequencing-based assessment of soil pH as a predictor
of soil bacterial community structure at the continental scale. Appl Environ Microbiol. 2009; 75: 5111–
5120. https://doi.org/10.1128/AEM.00335-09 PMID: 19502440
38. Saul-Tcherkas V, Steinberger Y. Soil microbial diversity in the vicinity of a Negev Desert shrub–Reau-
muria negevensis. Microb Ecol. 2011; 61: 64–81. https://doi.org/10.1007/s00248-010-9763-x PMID:
21052657
39. Frenk S, Hadar Y, Minz D. Resilience of soil bacterial community to irrigation with water of different qual-
ities under Mediterranean climate. Environ Microbiol. 2014; 16: 559–69. https://doi.org/10.1111/1462-
2920.12183 PMID: 23826671
40. Hunter PJ. Hand P. Pink D. Whipps JM. Bending GD. Both leaf properties and microbe-microbe interac-
tions influence within-species variation in bacterial population diversity and structure in the lettuce (Lac-
tuca species) phyllosphere. Appl Environ Microbiol. 2010; 76: 8817–8125.
41. Jackson CR, Randolph KC, Osborn SL, Tyler HL. Culture dependent and independent analysis of bac-
terial communities associated with commercial salad leaf vegetables. BMC Microbiol. 2013; 13: 274.
https://doi.org/10.1186/1471-2180-13-274 PMID: 24289725
42. Izhaki I, Fridman S, Gerchman Y, Halpern M. Variability of bacterial community composition on leaves
between and within plant species. Curr Microbiol. 2013; 66: 227–235. https://doi.org/10.1007/s00284-
012-0261-x PMID: 23143286
43. Schlatter DC, Bakker MG, Bradeen JM, Kinkel LL. Plant community richness and microbial interactions
structure bacterial communities in soil. Ecology. 2015; 96: 134–42. PMID: 26236898
44. Mowlick S, Inoue T, Takehara T., Kaku N, Ueki K, Ueki A. Changes and recovery of soil bacterial com-
munities influenced by biological soil disinfestation as compared with chloropicrin-treatment. AMB
Express. 2013; 3: 1–12.
45. Bardgett RD, Freeman C, Ostle N,. Microbial contributions to climate change through carbon cycles
feedbacks. ISME J. 2008; 2: 805–814. https://doi.org/10.1038/ismej.2008.58 PMID: 18615117
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 16 / 17
46. Lopez-Velasco G, Carder PA, Welbaum GE, Ponder MA. Diversity of the spinach (Spinacia oleracea)
spermosphere and phyllosphere bacterial communities. FEMS Microbiol. Lett. 2013; 346: 146–154.
https://doi.org/10.1111/1574-6968.12216 PMID: 23859062
47. Hausdorf L, Mundt K, Winzer M, Cordes C, Fro
¨hling A, Schlu¨ter O, et al Characterization of the cultiva-
ble microbial community in a spinach-processing plant using MALDI-TOF MS. Food Microbiol. 2013;
34: 406–41. https://doi.org/10.1016/j.fm.2012.10.008 PMID: 23541209
48. Lopez-Velasco G, Tydings HA, Boyer RR, Falkinham JO, Ponder MA. Characterization of interactions
between Escherichia coli O157:H7 with epiphytic bacteria in vitro and on spinach leaf surfaces. J Food
Microbiol. 2012; 153: 351–357.
49. Williams MM, Domingo JWS, Meckes MC, Kelty CA, Rochon HS. Phylogenetic diversity of drinking
water bacteria in a distribution system simulator. J Appl Microbiol. 2004; 96: 954–964 https://doi.org/10.
1111/j.1365-2672.2004.02229.x PMID: 15078511
50. Pang YC, Xi JY, Xu Y, Huo ZY, Hu HY. Shifts of live bacterial community in secondary effluent by chlo-
rine disinfection revealed by Miseq high-throughput sequencing combined with propidium monoazide
treatment. Appl Microbiol Biotechnol. 2016; 100: 6435–46. https://doi.org/10.1007/s00253-016-7452-5
PMID: 27005415
51. Nocker A, Camper A. Novel approaches toward preferential detection of viable cells using nucleic acid
amplification techniques. FEMS Microbiol. Lett. 2009; 291: 137–142. https://doi.org/10.1111/j.1574-
6968.2008.01429.x PMID: 19054073
52. Chiao TH, Clancy TM, Pinto A, Xi C, Raskin L. Differential resistance of drinking water bacterial popula-
tions to monochloramine disinfection. Environ Sci Technol. 2016; 48: 4038–4047.
53. Taylor RH, Falkinham JO, Norton CD, LeChevallier MW. Chlorine, chloramine, chlorine dioxide, and
ozone susceptibility of Mycobacterium avium. Appl Environ Microbiol. 2000; 66: 1702–1705. PMID:
10742264
54. Keina
¨nen-Toivola MM, Revetta RP, Santo Domingo JW. Identification of active bacterial communities
in a model drinking water biofilm system using 16S rRNA-based clone libraries. FEMS Microbiol Lett.
2006; 257: 182–188. https://doi.org/10.1111/j.1574-6968.2006.00167.x PMID: 16553851
55. Go
´mez-Alvarez V, Pfaller S, Pressman JG, Wahman DG, Revetta RP. Resilience of microbial commu-
nities in a simulated drinking water distribution system subjected to disturbances: role of conditionally
rare taxa and potential implications for antibiotic resistant bacteria. Environ Sci: Water Res Technol.
2016; 2: 645–657.
56. Gu G, Ottesen A, Bolten S., Ramachandran P, Reed E., Rideout S., et al. Shifts in spinach microbial
communities after chlorine washing and storage at compliant and abusive temperatures. Food Micro-
biol. 2018; 73: 73–84. https://doi.org/10.1016/j.fm.2018.01.002 PMID: 29526229
57. Sklarz MY, Zhou M, Ferrando Chavez DL, Yakirevich A, Gillor O, Gross A, et al. Effect of treated
domestic wastewater on soil physicochemical and microbiological properties. J. Environ. Qual. 2013;
42: 1226–1235. https://doi.org/10.2134/jeq2012.0416 PMID: 24216374
58. Tournas VH. Spoilage of vegetable crops by bacteria and fungi and related health hazards. Crit Rev
Microbiol. 2005; 31: 33–44. https://doi.org/10.1080/10408410590886024 PMID: 15839403
59. Lee DH, Kim JB, Kim M, Roh E, Jung K, Choi M, et al. Microbiota on spoiled vegetables and their char-
acterization. J Food Prot. 2013; 76: 1350–8. https://doi.org/10.4315/0362-028X.JFP-12-439 PMID:
23905790
60. Mansfield J, Genin S, Magori S, Citovsky V, Sriariyanum M, Ronald P, et al. Top 10 plant pathogenic
bacteria in molecular plant pathology. Mol Plant Pathol. 2012; 13: 614–29. https://doi.org/10.1111/j.
1364-3703.2012.00804.x PMID: 22672649
61. Williams TR, Marco ML. Phyllosphere microbiota composition and microbial community transplantation
on lettuce plants grown indoors. mBio, 2014; 5: e01564–14. https://doi.org/10.1128/mBio.01564-14
PMID: 25118240
62. Ottesen AR, Pena AG, White JR, Pettengill JB, Li C, Allard S, et al., Baseline survey of the anatomical
microbial ecology of an important food plant: Solanum lycopersicum (tomato). BMC Microbiol. 2013; 13:
114. https://doi.org/10.1186/1471-2180-13-114 PMID: 23705801
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 17 / 17
