ArticlePDF Available

Impact of chlorine dioxide disinfection of irrigation water on the epiphytic bacterial community of baby spinach and underlying soil

Authors:

Abstract and Figures

The contamination of pathogenic bacteria through irrigation water is a recognized risk factor for fresh produce. Irrigation water disinfection is an intervention strategy that could be applied to reduce the probability of microbiological contamination of crops. Disinfection treatments should be applied ensuring minimum effective doses, which are efficient in inhibiting the microbial contamination while avoiding formation and accumulation of chemical residues. Among disinfection technologies available for growers, chlorine dioxide (ClO2) represents, after sodium hypochlorite, an alternative disinfection treatment, which is commercially applied by growers in the USA and Spain. However, in most of the cases, the suitability of this treatment has been tested against pathogenic bacteria and low attention have been given to the impact of chemical residues on the bacterial community of the vegetable tissue. The aim of this study was to (i) to evaluate the continual application of chlorine dioxide (ClO2) as a water disinfection treatment of irrigation water during baby spinach growth in commercial production open fields, and (ii) to determine the subsequent impact of these treatments on the bacterial communities in water, soil, and baby spinach. To gain insight into the changes in the bacterial community elicited by ClO2, samples of treated and untreated irrigation water as well as the irrigated soil and baby spinach were analyzed using Miseq® Illumina sequencing platform. Next generation sequencing and multivariate statistical analysis revealed that ClO2 treatment of irrigation water did not affect the diversity of the bacterial community of water, soil and crop, but significant differences were observed in the relative abundance of specific bacterial genera. This demonstrates the different susceptibility of the bacteria genera to the ClO2 treatment. Based on the obtained results it can be concluded that the phyllosphere bacterial community of baby spinach was more influenced by the soil bacteria community rather than that of irrigation water. In the case of baby spinach, the use of low residual ClO2 concentrations (approx. 0.25 mg/L) to treat irrigation water decreased the relative abundance of Pseudomonaceae (2.28-fold) and Enterobacteriaceae (2.5-fold) when comparing treated versus untreated baby spinach. Members of these two bacterial families are responsible for food spoilage and foodborne illnesses. Therefore, a reduction of these bacterial families might be beneficial for the crop and for food safety. In general it can be concluded that the constant application of ClO2 as a disinfection treatment for irrigation water only caused changes in two bacterial families of the baby spinach and soil microbiota, without affecting the major phyla and classes. The significance of these changes in the bacterial community should be further evaluated.
Content may be subject to copyright.
RESEARCH ARTICLE
Impact of chlorine dioxide disinfection of
irrigation water on the epiphytic bacterial
community of baby spinach and underlying
soil
Pilar Truchado
1
, Marı
´a Isabel Gil
1
, Trevor Suslow
2
, Ana Allende
1
*
1Research Group on Quality, Safety and Bioactivity of Plant Foods, CEBAS-CSIC, Campus Universitario de
Espinardo, Murcia, Spain, 2Department of Plant Science, University of California, One Shields Avenue,
Mann Laboratory, Davis, CA, United States of America
*aallende@cebas.csic.es
Abstract
The contamination of pathogenic bacteria through irrigation water is a recognized risk factor
for fresh produce. Irrigation water disinfection is an intervention strategy that could be
applied to reduce the probability of microbiological contamination of crops. Disinfection
treatments should be applied ensuring minimum effective doses, which are efficient in inhib-
iting the microbial contamination while avoiding formation and accumulation of chemical res-
idues. Among disinfection technologies available for growers, chlorine dioxide (ClO
2
)
represents, after sodium hypochlorite, an alternative disinfection treatment, which is com-
mercially applied by growers in the USA and Spain. However, in most of the cases, the suit-
ability of this treatment has been tested against pathogenic bacteria and low attention have
been given to the impact of chemical residues on the bacterial community of the vegetable
tissue. The aim of this study was to (i) to evaluate the continual application of chlorine diox-
ide (ClO
2
) as a water disinfection treatment of irrigation water during baby spinach growth in
commercial production open fields, and (ii) to determine the subsequent impact of these
treatments on the bacterial communities in water, soil, and baby spinach. To gain insight
into the changes in the bacterial community elicited by ClO
2
, samples of treated and
untreated irrigation water as well as the irrigated soil and baby spinach were analyzed using
Miseq®Illumina sequencing platform. Next generation sequencing and multivariate statisti-
cal analysis revealed that ClO
2
treatment of irrigation water did not affect the diversity of the
bacterial community of water, soil and crop, but significant differences were observed in the
relative abundance of specific bacterial genera. This demonstrates the different susceptibil-
ity of the bacteria genera to the ClO
2
treatment. Based on the obtained results it can be con-
cluded that the phyllosphere bacterial community of baby spinach was more influenced by
the soil bacteria community rather than that of irrigation water. In the case of baby spinach,
the use of low residual ClO
2
concentrations (approx. 0.25 mg/L) to treat irrigation water
decreased the relative abundance of Pseudomonaceae (2.28-fold) and Enterobacteriaceae
(2.5-fold) when comparing treated versus untreated baby spinach. Members of these two
bacterial families are responsible for food spoilage and foodborne illnesses. Therefore, a
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 1 / 17
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Truchado P, Gil MI, Suslow T, Allende A
(2018) Impact of chlorine dioxide disinfection of
irrigation water on the epiphytic bacterial
community of baby spinach and underlying soil.
PLoS ONE 13(7): e0199291. https://doi.org/
10.1371/journal.pone.0199291
Editor: Leonard Simon van Overbeek, Wageningen
Universiteit en Researchcentrum, NETHERLANDS
Received: November 29, 2017
Accepted: June 5, 2018
Published: July 18, 2018
Copyright: ©2018 Truchado et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information
files.
Funding: Authors are thankful for the financial
support from the Center for Produce Safety Grant
Agreement (Projects 2015-374 and 2017-01 to A.
A.) and the MINECO (Projects AGL2013-48529-R
and AGL2016-75878-R to M.I.G.). P. Truchado is
holder of a Juan de la Cierva incorporation contract
from the MINECO (IJCI-2014-20932). Support
provided by the Fundacio
´n Se
´neca (19900/GERM/
reduction of these bacterial families might be beneficial for the crop and for food safety. In
general it can be concluded that the constant application of ClO
2
as a disinfection treatment
for irrigation water only caused changes in two bacterial families of the baby spinach and
soil microbiota, without affecting the major phyla and classes. The significance of these
changes in the bacterial community should be further evaluated.
Introduction
Fruit and vegetables harbor large and diverse types of cultivable and non-cultivable microbes
on their surface, which are in constant change during cultivation. Factors affecting changes
during cultivation have been associated to crop phenology, crop management, but also due to
environmental conditions [1,2]. Proteobacteria,Firmicutes,Bacteroidetes and Actinobacteria
are the most predominant phyla reported to comprise the bacterial community of the edible
part of above-soil harvested vegetables, particularly in leafy greens [36]. The composition
and the relative abundance of the bacterial taxa vary among plants, mostly due to plant species
and phenotypes, but also due to environmental conditions during growing, seasonality, the
physiological status of the plant and agricultural practices [79]. Previous studies have already
evaluated the impact that different agricultural practices have in the bacterial community of
different crops. For example, William et al., [8] observed significant differences in the bacterial
community of lettuce after irrigation using two different irrigation systems (sprinkler and drip
irrigation). On the other hand, the use of irrigation water with different microbial quality did
not significantly affect the bacterial community of tomato fruit [10,11]. Agricultural (ag) water
has been recognized as one of the major potential vectors of enteric human pathogens during
primary production [1215]. Several strategies have been proposed to reduce the risk of food-
borne pathogen contamination including, selection of irrigation water sources, application
practices and disinfection technologies such as chemical, physical and combined treatments
[1618]. Among these strategies, chlorine-derived compounds and UV-C water disinfection
are widely applied in primary production [18]. Sodium hypochlorite is the most commonly
used disinfection agent as it is easy to apply, efficient and cheap [17,18]. However, public
health concerns have been raised due to inappropriate hyperchlorination of water and the
potential health risks associated to the formation and accumulation of disinfection-by-prod-
ucts in the irrigation water which can be subsequently absorbed by the plant [17,14]. Thus, the
selection of more environmentally friendly technologies to reduce and efficiently control the
risk of microbial pathogen contamination in irrigation water has become a priority for grow-
ers. Another popular disinfectant agent to treat irrigation water is chlorine dioxide (ClO
2
),
which is being commercially applied by leafy greens growers in US and Spain [17,19]. One of
the reasons why ClO
2
has been suggested as an alternative to sodium hypochlorite is because it
does not forms trihalomethanes; however the accumulation of chlorate and chlorite may still
be of a concern [19].
The effectiveness of ClO
2
for irrigation water has been demonstrated for plant and human
pathogenic microorganisms [2022]. However, the impact of long-term application of this
water treatment on the bacterial community of different agricultural habitats such as water,
soil and crops has not been established. In order to develop recommendations and best prac-
tice protocols for growers, an evaluation of the potential impacts needs to be performed in
well-controlled studies.
Microbial community profiles from specific ecosystems and econiches can be determined
using various techniques. Traditionally, conventional culture-dependent microbiological
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 2 / 17
15) and Proyecto Intramural (201670E056 to M.I.
G.) is also appreciated. The funders had no role in
study design, data collection and analysis, decision
to publish, or preparation of the manuscript.
Competing interests: The authors have declared
that no competing interests exist.
techniques or 16S rRNA clone libraries and fingerprinting methodologies, including tempera-
ture/denaturing gradient gel electrophoresis (TGGE and DGGE), have been used to investigate
the microbial community composition [23,24]. More recently next-generation sequencing
(NGS) technologies have provided more comprehensive descriptions of bacterial communities
due to the increased number of sequence reads and improved bioinformatics pipelines [2527].
The recent advances in DNA sequencing can help researchers to understand the interactions
between plant and soil microbial communities and the qualitative and quantitative responses to
different agricultural practices and variable environmental and seasonal influences.
The goal of the present study was (i) to evaluate the continual application of chlorine diox-
ide (ClO
2
) as a water disinfection treatment of irrigation water during baby spinach growth in
commercial production open fields, and (ii) to determine the subsequent impact of these treat-
ments on the bacterial communities in water, soil, and baby spinach. For this purpose, the
comparative bacterial communities were profiled using Illumina high throughput NGS.
Results obtained in two commercial fields of baby spinach are presented.
Material and methods
Experimental set-up
Baby spinach (Spinacea Oleracea L.) was grown in two commercial fields (0.5 and 0.8 ha)
located in Pozo de la Higuera (Almerı
´a, Spain) and across two consecutive trials (October-
December 2015 and February-March 2016). The size of the experimental plots was dictated by
the need to conduct comparisons on commercial management units. As contiguous fields
were not available, the selected two fields were separated by a distance of 500 m. The edapho-
climatic conditions of the two fields were very similar regarding the soil texture and topogra-
phy. Nevertheless, in order to minimize uncontrollable influences of the geospatial location
and field characteristics, one field was the treated field (irrigated with ClO
2
-treated surface
water) in one trial and the other was the untreated one (irrigated with untreated surface water)
and the treatment assignment was reversed in the second trial. Crop management of soil prep-
aration, seeding, irrigation, and fertilization were consistent with commercial production
practices of baby spinach in this area as described previously [28]. Briefly, surface water stored
in a lined water reservoir was used for stand establishment and irrigation. This water source
was the only one available in these commercial plots. Water reservoirs are commonly used to
guarantee water supply throughout the whole irrigation season in arid and semiarid areas.
Therefore, when water is available, the water reservoir is filled and the water used during the
whole growing season. The quality of the irrigated water has been previously characterized in
Lo
´pez-Ga
´lvez et al. [28] and it was catalogued as good based on its low microbial counts, mod-
erate conductivity and the reduced concentration of organic matter. A stable and highly con-
centrated aqueous solution of ClO
2
(6000 mg/L), commercially known as AGRI DIS1
(Servicios Te
´cnicos de Canarias, Las Palmas de Gran Canaria, Spain) was used to treat the irri-
gation water. The commercial solution was prepared following the manufacturer instructions.
The concentrated ClO
2
solution (6000 ppm) was diluted with irrigation water in a 1000 L
opaque plastic tank. The diluted ClO
2
solution (approx. 100 ppm) was pumped into the irriga-
tion water system using a programmable Venturi suction unit (INTA Crop Technology S.L.,
A
´guilas, Spain). Dosing of ClO
2
was carried out to fulfill the ClO
2
demand of the irrigation
water and to maintain a constant residual dose of about 0.25 ppm, within an interval of 0.2–
0.7, but always below 1 mg/L. Monitorization of the ClO
2
concentration in the irrigation water
was determined using the chronoamperometry analysis Chlordioxense (Palintest, Gateshead,
UK) with a limit of detection of 0.02 mg/L. Analyses were performed on a daily basis at the
sprinkler head during the irrigation event.
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 3 / 17
Sampling
Water samples were taken directly from the solid set sprinkler irrigation system. Soil and baby
spinach was sampled at the end of the growing season at the commercial maturity stage of the
plants (12–15 cm long measured from the petiole and 6 expanded leaves per plant). Plant sam-
ples (100 g) were hand harvested using scissors by excision from the base of petioles and stored
in sterile plastic bags which were maintained on ice during transportation to the laboratory
(aprox. 45 min.). Scissors were wiped with an ethanol (70%) saturated cloth between use on
the different fields (ClO
2
treated and untreated). Soil and baby spinach samples were taken
from five representative positions, homogeneously distributed within each field. Plants were
harvested at each designated site from an area of 0.5 and 0.8 ha which corresponded to the
ClO
2
treated and untreated fields, respectively. Soil samples (25 g) were taken at the soil surface
(no more than 3 cm deep) located around each sampled plant. Irrigation water samples (2.5 L
each) were taken from different sprinkler riser positions located at each growing field. About
400 mL of sodium thiosulfate (5 g/L; Sigma-Aldrich, Darmstadt, Germany) was added to
quench oxidizer residuals in samples of irrigation water treated with ClO
2
. All samples were
transported (approximately 90 km) under refrigerated conditions in polystyrene boxes to the
CEBAS-CSIC laboratory (Murcia, Spain), and stored refrigerated at 4˚C until further process-
ing. Processing of the samples was performed within the first 12 hours after sampling.
DNA extraction
Samples of baby spinach (60 g each) were sonicated in 240 mL of 0.2% sterile buffered peptone
water (BPW; Scharlau Chemie, Barcelona, Spain) supplemented with 1% of Tween-80 (Poly-
ethylene glycol sorbitan monooleate; Sigma Aldrich, St Louis, MO, USA). Soil samples (3 g
each) were stomached in 150 mL of BPW for 1 min. Sonicated baby spinach and stomached
soil were centrifuged at 3000 X gfor 10 min, the supernatant was decanted, and the pellet
obtained was stored at -20˚C for DNA extraction. For both sample types, extraction processing
used the FastDNA1SPIN Kit for soil and the FastPrep124-Instrument (MPBiomedicals,
Solon, OH, USA), according to the manufacturer’s recommendations. Irrigation water sam-
ples (500 mL each) were centrifuged at 3000 X gfor 20 min. As stated above, the resultant pel-
lets were kept at -20˚C until the DNA extraction was performed following the previously
described protocol [29]. Briefly, the resulting pellets were lysed by enzymatic treatment with
Proteinase K (50 μg/μL). For each sample, DNA was extracted from the lysed pellets using the
MasterPureComplete DNA and RNA purification kit (Epicenter, Madison, USA) according
to the manufacturer’s instructions. The quality and concentration of DNA extracts were deter-
mined by spectrophotometric measurement at 260/280 nm and 260/230nm using a Nano-
Drop1ND-1000 UV-Vis spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA,
USA). Limitations can be also related to the selection of the polymorphic hypervariable
regions. In the present study, the V3-V4 regions were selected as they have been defined as the
most reliable regions for representing the full-length 16S rRNA sequences in the phylogenetic
analysis of most bacterial phyla. However, other regions, such as V6, have been suggested by
the literature. In the present study, this region was not included due to technical limitations.
Illumina sequencing
The V3-V4 hypervariable region of the 16S rRNA gene was amplified using primers S-D-Bact-
0341-b-S-17/S-D-Bact-0785-a-A-21 [30] with Illumina overhang adapters on a MiSeq (Illu-
mina, Hayward, CA, USA) instrument. The libraries were generated using two limited-PCR
cycles. The first one included an initial denaturation step at 98˚C for 30 s; 20 cycles of a dena-
turation step at 98˚C for 30 s, an annealing step at 50˚C for 20 s, an extension step at 72˚C for
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 4 / 17
20 s; and a final extension at 72˚C for 2 min. Once completed, a PCR clean up step was per-
formed using AMPure XP beads (New England Biolabs, Ipswich, MA, USA) to purify the 16S
V3 and V4 amplicon, avoiding free primers and primer dimer species. Illumina sequencing
adapters and dual-index barcodes were added to the amplicon. To attach dual-index barcodes
(S-D-Bact-0341-b-S-17: ACACTGACGACATGGTTCTACA and S-D-Bact-0785-a-A-21: TAC
GGTAGCAGAGACTTGGTCT), a second PCR was performed using an Illumina sequencing
adapter from Nextera XT Index primers, developed by Illumina (Illumina, Hayward, CA,
USA). The second thermal cycling step included an initial denaturation step at 98˚C for 30 s;
12 cycles of a denaturation step at 98˚C for 30 s, an annealing step at 60˚C for 20 s, an exten-
sion step at 72˚C for 20 s; and a final extension at 72˚C for 2 min. The obtained PCR products
were cleaned with AMPure XP beads before library quantification was performed. The con-
centrations and qualities of library preparations were determined using the Quant-iT Pico-
Green double stranded DNA assay (Invitrogen, Carlsbad, CA, USA). Sequence data were
analyzed using the Quantitative Insights into Microbial Ecology (QIIME) program, version
1.9.1 [31]. The output file was processed for quality filtering by split_libraries_fastq.py. High
quality sequences were grouped into Operational Taxonomic Units (OTUs) with a sequence
identity threshold of 97%. Taxonomy was assigned by interrogating the high quality sequences
with the Greengenes database (13_5). Unclassified OTU sequences were manually annotated
against the NCBI database using the BLASTn function. Data were randomly subsampled to
the sequence count of the sample with the lowest sequence count using rarify_even_depth
implemented in the phyloseq package [32]. An average of 5624 reads per sample were obtained
and grouped into 803 phylotypes. Average read lengths from all samples were 240 bp.
Sequence depths from samples of irrigation water, soil, and baby spinach were determined by
the rarefaction curves and shown in the supplementary data (S1 Fig).
Statistical analysis
All statistical analyses were performed in R-studio program (3.3.2) and IBM SPSS Statistics 23
(SPSS, Chicago, IL). For each sample, total number of species, Fisher’s diversity, Shannon,
Simpson and inverse Simpson indices were calculated to assess the alpha diversity. Pielou’s
index was used as indicator of evenness in the community. Correlation among samples was
assessed using cluster analysis and the metric multidimensional scaling (MDS) ordination
method. Bray-Curtis and Jaccard distances were used to construct dissimilarity matrices of the
communities. Beta diversity of the community was determined and Nonmetric multidimen-
sional scaling (NMDS) was employed to visualize the differences among samples using the
vegan package in R [33]. Dissimilarity analyses of bacterial community structures in samples
from different treatments (ClO
2
treated and untreated) were calculated using the function
Adonis (PERMANOVA) and ANOSIM. Differences in alpha diversity, evenness measures and
relative abundances of bacteria genera between treated and untreated samples were compared
using Mann Whitney U and Kruskal–Wallis tests.
Results and discussion
Bacterial community composition of irrigation water, soil and baby
spinach
Based on the protocols utilized, the bacterial community of irrigation water was dominated by
Proteobacteria (41.53 ±1.42% average for control samples ±standard deviation) and Actino-
bacteria (16.71 ±5.41%) followed by less abundant phyla such as Bacteroidetes (11.13 ±3.09%),
Chloroflexi (7.99 ±4.33%), Firmicutes (7.47 ±1.33%) and Verrumicrobia (5.57 ±0.78%) (Fig
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 5 / 17
1A). Regarding classes, Actinobacteria (16.52 ±5.42%), Alpha (15.65 ±6.39%), Beta (11.49 ±
1.54%), and Gammaproteobacteria (3.51 ±1.39%) were the most predominant taxa (Fig 1B).
The members of the most predominant families in the irrigation water were Thermogemmatis-
poraceae (8.78 ±3.82%), Dethiosulfovibrionaceae (5.20 ±1.88%), Pseudonocardiaceae (4.83 ±
1.06%), Saprospiraceae (4.70 ±1.13%), Comamonadaceae (4.61 ±1.78%), Verrucomicrobiaceae
(4.15 ±0.82%) and Campylobacteraceae (4.07 ±0.66%) (S1 Table). These results are consistent
with those described for the bacterial community of surface water [3436].
Among soil samples, the dominant phyla were Actinobacteria (43.19 ±2.90%), followed by
Proteobacteria (28.28 ±2.19%), Firmicutes (21.84 ±1.50%)and Bacteroidetes (2.77±0.35%)
(Fig 1A). These identified phyla, as well as the Acidobacteria phyla have been associated previ-
ously with the bacterial community of soil in arid and semiarid Mediterranean regions [37
39]. However, the Acidobacteria phylum was not detected in the current study. The difference
observed in the identified phyla could be due to environmental factors but also due to some
Fig 1. Composition of bacterial phyla and classes of untreated and ClO
2
treated samples. Percentage of relative
abundance of bacterial phyla (A) and classes (B) of untreated and ClO
2
treated samples of irrigation water (IW), soil (Soil)
and baby spinach (Crop). Bacterial community is the average of 5 individual samples. Data shown are phyla that
comprised at least 1% of the sequences in at least one sample of a given agronomic habitat.
https://doi.org/10.1371/journal.pone.0199291.g001
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 6 / 17
intrinsic characteristics of the plant material (e.g. genotype and leaf maturity) [4042]. Among
the identified classes, the predominant ones were Actinobacteria (41.31 ±2.88%), Bacilli
(16.74 ±1.72%), Alphaproteobacteria (13.45 ±1.23%), and Gammaproteobacteria (6.03 ±
0.49%) (Fig 1B). Further analyses carried out in soil samples revealed the presence of a total of
23 major families (abundance >1% in at least one sample) and 58 genera (abundance >0.5%
in at least one sample). Among them, the most abundant families represented were Bacillaceae
(13.49 ±1.45%), Nocardioidaceae (10.38 ±0.61%), Micrococcaceae (9.72 ±1.35%), and Strepto-
mycetaceae (7.21 ±1.44%), which included members of the genera Bacillus (10.30 ±11.10%),
Nocardioides (5.92 ±0.52%), Arthrobacter (6.11 ±0.93%) and Streptomyces (6.68 ±1.37%) (S1
Table).
Schlatter et al. [43] suggested that the bacterial community of plants could be influenced by
the soil bacterial community. Supporting this general expectation, Mowlick et al. [44] observed
similar bacterial diversity in soil and spinach samples collected from the same production
field. Splash dispersal and deposition of soil during irrigation events would be a reasonable
mechanism, for a low growing crop like baby spinach, to result in these outcomes. However,
generalizations are difficult to make from such a limited sample size, where only one commer-
cial field has been monitored. Additionally, it should be taken into account the complexity of
soil microbial community and the myriad of ways in which different climate drivers such as
temperature and precipitation might affect soil microorganisms [45].
In baby spinach, the most dominant phyla were Proteobacteria (44.64 ±8.54%), Firmicutes
(28.29 ±11.23%), and Actinobacteria (18.73 ±3.95%), accounting for more than 92% of the
total sequences (Fig 1A). Additionally, the bacterial classes with the highest relative abundance
were Bacilli (20.33 ±6.12%), Gammaproteobacteria (16.58 ±6.0%), Actinobacteria (16.55 ±
4.39%), Alphaproteobacteria, (13.76 ±4.21%) and Betaproteobacteria (5.08 ±2.93%) (Fig 1B).
These results agree with previous studies that reported these phyla and classes as the predomi-
nant ones in the phyllopshere of baby spinach [46,47]. At the family level, Bacillae (12.79 ±
3.76%), Pseudomonaceae (7.96 ±4.59%) and Sphingomonadaceae (4.51 ±1.12%) were the pre-
dominant families in baby spinach when both irrigated with treated and untreated water (S1
Table). This study is not the first one identifying members of the Sphingomonadaceae family in
baby spinach phyllosphere. A previous study published by Lopez-Velasco et al., [48] isolated
Sphingomonas, of the Sphingomonadaceae family from spinach leaf surface. However, other
families such as Enterobacteriaceae, previously described in the phyllosphere of spinach [5,46],
were found at low abundance in the present study. This low abundance of the Enterobacteria-
ceae family could be attributed not only to environmental differences but also to some intrinsic
characteristics of the plant material such as differences in the genotype and leaf maturity [40
42]. At the genus level, the most prevalent ones in the phyllosphere of baby spinach were Bacil-
lus (10.32 ±3.00%) and Pseudomonas (7.96 ±4.58%). In agreement with other studies on bac-
terial community of spinach, Pseudomonas were the dominant genera detected on surface
leaves (4–29% of the population), although Bacillus was found at lower concentrations (2.2–
0.8% of the population) [5,6]. Additionally, other less prevalent genera (e.g., Massilia and Pan-
toea) previously identified as part of the core phyllosphere community of leafy greens
[3,4,25,46] were also found in ClO
2
treated and untreated baby spinach.
Bacterial community structure of irrigation water, soil and baby spinach
due to the ClO
2
treatment
In order to determine the impact of ClO
2
disinfection treatment of irrigation water on the bac-
terial diversity of different agronomic factors (irrigation water, soil and leaves), the species
richness, the alpha-diversity index and evenness were calculated for untreated and ClO
2
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 7 / 17
treated samples. The selected indexes did not show significant differences (Mann Whitney test
P<0.01) between treated and untreated samples. These results were based on the similar
range of alpha-diversity between samples (Table 1). Nonmetric multidimensional scaling
(NMDS) plots using Bray-Curtis distance, based on the OTUs matrix, were performed to
evaluate the structure of bacterial community from the different agronomic factors. It was
observed that NMDS plots for treated and untreated irrigation water and soil samples irrigated
with treated and untreated water associated in distinct clusters (Fig 2A and 2B). In contrast,
bacterial community of baby spinach irrigated with treated and untreated water clustered
together (Fig 2C). The dissimilarity analysis of bacterial community structures of irrigation
water, soil and baby spinach revealed that significant differences on the OTUs abundance were
only observed between treated and untreated irrigation water samples (Table 2). These results
showed that the use of ClO
2
as a water disinfection treatment had a low impact on the soil and
plant bacterial communities.
Bacterial community composition of irrigation water, soil and baby
spinach due to the ClO
2
treatment
In the case of irrigation water, no significant differences were found in the relative abundance
of the predominant taxonomic groups of bacteria between treated and untreated samples.
However, when compared to the untreated water, ClO
2
treated water showed a reduction of
the relative abundance of Verrucomicrobiae and Synergistia classes of about 1.17 (P<0.000)
and 2.53 (P<0.005), respectively (Fig 2). Previous studies in drinking water and wastewater
reported that the abundance of the phylum Proteobacteria decreased upon chlorine disinfec-
tion [49,50]. The differences observed with the present study could be due to the low concen-
tration of ClO
2
applied for the irrigation water disinfection, which might have affected the
relative abundance of less predominant families, without affecting the most predominant
ones. A second hypothesis could be associated with the fact that DNA-high throughput
sequencing could not distinguish between viable and dead cells. In an attempt to alleviate this
limitation, DNA intercalating dyes such as Propidium monoazide (PMA) could have been an
efficient methodology to include during sample processing [29,51]. Recently, [52] demon-
strated that the use of (NGS) combined with PMA was an efficient technique to determine the
Table 1. Species richness (total species), diversity (Shannon, Fisher’s alpha, Simpson and Inverse Simpson indices), and evenness (Pielou’s index) of untreated and
ClO
2
treated samples of irrigation water (IW), soil (Soil) and baby spinach (Crop).
Index IW Soil Crop
Total species Untreated 523 (514 ±557) 613 (609 ±633) 556 (490 ±607)
ClO
2
Treated 558 (534 ±572) 599 (587 ±613) 576 (470 ±6.21)
Shannon Untreated 4.11 (3.97 ±4.19) 4.67 (4.61 ±4.78) 3.05 (1.05 ±4.46)
ClO
2
Treated 4.18 (4.05 ±4.39) 4.73 (4.56 ±4.78) 2.86 (1.50 ±0.43)
Fisher Untreated 7.75 (7.50 ±8.17) 8.70 (8.57 ±8.76) 8.26 (6.80 ±9.16)
ClO
2
Treated 8.02 (7.77 ±8.54) 8.85 (8.70 ±9.01) 8.14 (6.74 ±9.05)
Simpson Untreated 0.95 (0.94 ±0.90) 0.97 (0.97 ±0.95) 0.75 (0.42 ±0.94)
ClO
2
Treated 0.96 (0.95 ±0.97) 0.97 (0.96 ±0.98) 0.69 (0.42 0.93)
Inverse Simpson Untreated 21.25 (18.03 ±27.56) 34.01 (33.25 ±41.32) 6.52 (1.74 ±19.53)
ClO
2
Treated 25.01 (21.27 ±26.81) 39.48 (32.32 ±42.47) 13.03 (2.11±16.15)
Pielou Untreated 0.65 (0.64 ±0.69) 0.73 (0.72 ±0.75) 0.48 (0.24 ±0.70)
ClO
2
Treated 0.66 (0.64 ±0.69) 0.73 (0.71 ±0.74) 0.45 (0.24 ±067)
Values are the mean ±SEM of n = 20 for irrigation water, n = 10 for soil and n = 20 for baby spinach.
https://doi.org/10.1371/journal.pone.0199291.t001
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 8 / 17
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 9 / 17
changes in the bacterial community composition of drinking water when comparing treated
and untreated water disinfection samples.
At genus level, 73 major genera (abundance >0.5% in at least one sample) were identified
in the irrigation water samples, showing 17 of them having significant differences between
ClO
2
treated and untreated irrigation water. Among them, ClO
2
treatment significantly
reduced the relative abundance of phylotypes belonging to genera such as Acidimicrobium,
Kribbella,Mycobacterium,Rhodococcus,Saccharopolyspora,Euzebya,Kaistobacter,Novosphin-
gobium,Rhodobacter,Sphingobium,Sphingomonas,Polynucleobacter,Legionella,Luteibacter,
Dethiosulfovibrio,Candidatus and Xiphinematobacter (Table 3). In consequence, the relative
abundance of some others increased such as Demequina,Chitinophaga,Flavobacterium,Fluvii-
cola,Bacillus,Clostridium,Candidatus Scalindua,Acidiphilium,Polaromonas,Campylobacter
and Mycoplasm (Table 3). Nevertheless, members belonging to families associated with patho-
genic bacteria such as Legionella and Mycobacterium species were detected, although the abun-
dance of these pathogenic bacteria decreased in irrigation water treated with ClO
2
(Table 3).
These results are in agreement with others that showed the decrease in Legionella and Myco-
bacterium when using different disinfection water treatments such as, ozone, chlorine, and
ClO
2
[5355].
In soil, at phylum and class levels, no significant differences in the bacterial community
were observed between crop areas irrigated with untreated and ClO
2
treated water, except for
the Betaproteobacteria class, which showed a reduction of 1.6 folds of their relative abundance.
At lower taxonomic levels, the relative abundance of the Limnobacter and Pontibacter genera
significantly decreased in the soil irrigated with ClO
2
treated water (Table 3). These changes
suggest a potentially greater susceptibility to ClO
2
treatment. Gu et al. [56] reported that the
bacterial community in baby spinach shifted significantly after chlorine washing. They
observed that Proteobacteria species, such as Stenotrophomonas spp. and Erwinia spp., were
relatively tolerant of chlorine treatment, while species of Flavobacterium and Pedobacter (phy-
lum bacteroidetes) grew rapidly during storage, especially at abusive temperatures. The results
obtained suggest that the continuous application of ClO
2
as a water disinfection treatment to
improve the microbiological quality of irrigation water did not cause significant changes in the
bacterial community composition of the soil. These results support the use of a low residual
concentration of ClO
2
in the irrigation water, as a corrective measure for water sources of con-
cern, to be applied during the growing cycle without a detrimental impact on the bacterial
diversity of soil. Long-term application with subtle but cumulative effects should be consid-
ered. Also, previous studies reported that soil irrigated with ClO
2
treated wastewater did not
alter the bacterial community based on a terminal restriction fragment analysis [57]. However,
further in-depth studies are still needed to determine the impact of the water disinfection
Fig 2. Comparison of bacterial community of untreated and ClO
2
treated (ClO
2
) samples of irrigation water
(IW), soil (Soil) and baby spinach (Crop). Nonmetric multidimensional scaling (NMDS) based on Bray–Curtis
distance from OTUs abundance.
https://doi.org/10.1371/journal.pone.0199291.g002
Table 2. Dissimilarity analysis of bacterial community structured in irrigation water (IW), soil (Soil) and baby
spinach (Crop).
Adonis Anosim
F P R P
IW 5.881 0.01 0.476 0.01
Soil 1.866 0.07 0.196 0.08
Crop 0.934 0.31 0.008 0.29
https://doi.org/10.1371/journal.pone.0199291.t002
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 10 / 17
treatments in the bacterial composition across variable water constituent content qualities,
duration of treatment and environmental conditions.
For baby spinach samples, no significant differences at the phyla and class levels were found
between samples irrigated with ClO
2
treated and untreated water. However, when the major
families and genera (those with average abundance >0.5% in at least one sample) were com-
pared, significant differences were observed between irrigated baby spinach with treated and
untreated water. The use of ClO
2
treated water to irrigate baby spinach during the complete
growing cycle significantly reduced the relative abundance of two families and four genera
including Pseudomonas as well as some less abundant genera such as Erwinia,Enterobacter and
Tolumonas (Table 3). In general, these genera were not among the most predominant ones in
Table 3. Bacteria genera that showed significant differences (P <0.05) in their relative abundances between untreated and ClO
2
treated samples of irrigation water
(IW), soil (Soil) and baby spinach (Crop).
Taxonomy
Phylum Class Order Family Genera PUntreated ClO
2
Treated
IW Actinobacteria Acidimicrobiia Acidimicrobiales Acidimicrobiaceae Acidimicrobium 0.043 0.30±0.13 0.18±0.10
Actinobacteria Actinobacteria Actinomycetales Cellulomonadaceae Demequina 0.029 2.50±1.50 4.03±0.55
Actinobacteria Actinobacteria Actinomycetales Nocardioidaceae Kribbella 0.007 0.94±0.35 0.58±0.14
Actinobacteria Actinobacteria Actinomycetales Mycobacteriaceae Mycobacterium 0.000 1.33±0.59 0.33±0.19
Actinobacteria Actinobacteria Actinomycetales Nocardiaceae Rhodococcus 0.002 0.33±0.13 0.17±0.04
Actinobacteria Actinobacteria Actinomycetales Pseudonocardiaceae Saccharopolyspora 0.000 4.40±1.04 1.57±0.57
Actinobacteria Nitriliruptoria Euzebyales Euzebyaceae Euzebya 0.000 0.51±0.14 0.25±0.04
Bacteroidetes Sphingobacteriia Sphingobacteriales Chitinophagaceae Chitinophaga 0.000 0.27±0.13 0.62±0.21
Bacteroidetes Flavobacteriia Flavobacteriales Flavobacteriaceae Flavobacterium 0.009 1.44±0.35 1.89±0.33
Bacteroidetes Flavobacteriia Flavobacteriales Cryomorphaceae Fluviicola 0.000 0.37±0.22 0.95±0.25
Firmicutes Clostridia Clostridiales Clostridiaceae Clostridium 0.004 0.28±0.05 0.41±0.10
Planctomycetes Brocadiae Brocadiales Brocadiaceae Candidatus Scalindua 0.007 1.01±0.68 1.93±0.55
Proteobacteria Alphaproteobacteria Rhodospirillales Acetobacteraceae Acidiphilium 0.000 1.14±0.51 2.80±0.64
Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Kaistobacter 0.004 0.15±0.30 0.05±0.07
Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Novosphingobium 0.000 0.85±0.29 0.38±0.09
Proteobacteria Alphaproteobacteria Rhodobacterales Rhodobacteraceae Rhodobacter 0.003 1.40±0.25 0.91±0.30
Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingobium 0.002 0.45±0.63 0.10±0.02
Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas 0.000 1.61±0.14 0.56±0.03
Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Polaromonas 0.002 0.21±0.15 0.48±0.16
Proteobacteria Betaproteobacteria Burkholderiales Oxalobacteraceae Polynucleobacter 0.043 0.31±0.11 0.44±0.01
Proteobacteria Epsilonproteobacteria Campylobacterales Campylobacteraceae Campylobacter 0.000 3.97±0.81 13.34±5.96
Proteobacteria Gammaproteobacteria Legionellales Legionellaceae Legionella 0.000 0.39±0.10 0.24±0.04
Proteobacteria Gammaproteobacteria Xanthomonadales Xanthomonadaceae Luteibacter 0.002 3.17±0.97 2.00±0.37
Synergistetes Synergistia Synergistales Dethiosulfovibrionaceae Dethiosulfovibrio 0.002 5.20±1.99 2.58±0.88
Tenericutes Mollicutes Mycoplasmatales Mycoplasmataceae Mycoplasma 0.001 0.90±0.18 1.67±0.41
Verrucomicrobia Spartobacteria Chthoniobacterales Candidatus Xiphinematobacter 0.002 1.42±0.27 0.95±0.20
Soil Proteobacteria Betaproteobacteria Burkholderiales Comamonadaceae Limnobacter 0.009 0.64±0.17 0.20±0.11
Bacteroidetes Sphingobacteriia Sphingobacteriales Flexibacteraceae Pontibacter 0.016 0.78±0.12 0.45±0.15
Crop Proteobacteria Gammaproteobacteria Pseudomonadales Pseudomonadaceae Pseudomonas 0.019 7.76±4.58 2.92±2.24
Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Erwinia 0.004 0.36±0.33 0.09±0.06
Proteobacteria Gammaproteobacteria Enterobacteriales Enterobacteriaceae Enterobacter 0.023 0.37±0.51 0.11±0.10
Proteobacteria Gammaproteobacteria Aeromonadales Aeromonadaceae Tolumonas 0.043 0.30±0.32 0.09±0.07
Only genera greater and equal to 0.5% differed with a p-value <0.05 (Mann Whitney) are shown.
https://doi.org/10.1371/journal.pone.0199291.t003
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 11 / 17
the bacterial community of baby spinach, except for Pseudomonas. This is a notable finding
because approximately 30% of the postharvest losses per year in fresh produce have been attrib-
uted to the colonization by Pseudomonas,Erwinia and Enterobacter [5859]. Some species from
the Pseudomonas and Erwinia genera were listed among the top ten plant pathogenic bacteria
[60], although Pseudomonas and Erwinia genera also contain many plant-beneficial groups.
Impact sources of the bacterial community of baby spinach and their
interactions with agronomic habitats
Cluster analysis and metric multidimensional scaling (MDS) were performed to evaluate the
similarity of the different agronomic habitats (irrigation water, soil and leaves) (Fig 3). The
OTU enumeration data were used to construct dissimilarity matrices with Bray-Cutis distance
with the aim to determine whether the bacterial community from irrigation water and soil
interrelated with the composition of the natural microbiota of baby spinach. The cluster analy-
sis differentiated two clusters; a first one composed by all the irrigation water samples and a
second one including two sub-clusters, one for soil samples and another for baby spinach (Fig
3A). The MDS plot displayed similar patterns among samples, in which the bacterial commu-
nity from baby spinach and soil clustered in close display proximity and differed from those of
water samples (Fig 3B). These results suggested that the composition of bacterial community
associated with the crop was influenced more by the soil bacterial community than by the irri-
gation water microbiota. These findings are consistent with previous studies, which suggested
that soil can be a source of bacteria associated with leafy greens [25,61]. In agreement with our
results, it was observed that the bacterial community of spinach was more similar to soil
microbiota than that of irrigation water [6,62]. This was attributed to the structure of the leaves
(open canopy) and very limited vertical separation from the soil seedbed, thereby facilitating
dispersal of soil bacteria to the crop. Regarding irrigation water, our results are consistent with
previous studies, which demonstrated that the irrigation water bacterial community did not
contribute to the variation of the phyllosphere microbial diversity of the crop [11,10].
This study has a few limitations. The enrolled producer was among the largest baby spinach
producers in the study area. This was important to assure that the results of this study are rele-
vant to a large segment of the produced baby spinach in this area of Spain. However, because
producers of different sizes may have different management practices caution is needed in
extrapolating the results to all producers in the study area. Notably, this study evaluated two
growing cycles, where the control and treatment plots were reversed after the first assay to
eliminate any factor associated to the specific plots. However, variation in field soil composi-
tion may exist thus explaining variations between experiments. However, reversing the control
and treatments plots was performed to eliminate any factor associated to the specific plots but
this might have caused some effects on the soil bacterial community.
Conclusions
The results obtained regarding the bacterial community composition and diversity showed
that ClO
2
disinfection treatment positively affected the microbiota of irrigation water reduc-
ing–the relative abundance genera associated with spoilage and foodborne illnesses. However,
the bacterial community of soil and baby spinach irrigated with ClO
2
treated water was not
demonstrably affected. Small changes were only detected at lower taxonomic levels, particu-
larly for Pseudomonadaceae and Enterobacteriaceae with a decrease in the abundance of these
genera in baby spinach irrigated with ClO
2
treated water. Based on the results obtained, stabi-
lized ClO
2
could be considered an eco-compatible disinfection technology as it has a neutral
effect on soil and crop microbial diversity.
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 12 / 17
Supporting information
S1 Fig. Rarefaction curves of sequencing samples. (A) irrigation water samples (IW), (B)
soil samples (soil), (C) baby spinach samples (crop). CT is the control treatments (without
Fig 3. Dendrogram generated by UPGMA clustering (A) and metric multidimensional scaling (MDS) (B) based on the Bray-
curtis distance from the OTUs abundance matrix of irrigation water (IW), soil (Soil) and baby spinach (Crop). Colors denote
the cluster from samples.
https://doi.org/10.1371/journal.pone.0199291.g003
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 13 / 17
chlorine dioxide) and ClO2 represents chlorine dioxide treatments. (1, IW-CT; 2, IW-CT;
3, IW-CT; 4, IW-CT; 5, IW-CT; 6, IW-CT; 7, IW-CT; 8, IW-CT; 9, IW-CT; 10, IW-CT; 11,
IW-ClO
2
; 12, IW-ClO
2
; 13, IW-ClO
2
; 14, IW-ClO
2
; 15, IW-ClO
2
; 16, IW-ClO
2
; 17, IW-ClO
2
;
18, IW-ClO
2
; 19, IW-ClO
2
; 20, IW-ClO
2
. (B) soil samples (1, Soil-CT; 2, Soil-CT; 3, Soil-CT; 4,
Soil-CT; 5, Soil-CT; 6, Soil-ClO
2
; 7, Soil-ClO
2
; 8, Soil-ClO
2
; 9, Soil-ClO
2
; 10, Soil-ClO
2
). (C)
Baby spinach samples (1, Crop-CT; 2, Crop-CT; 3, Crop-CT; 4, Crop-CT; 5, Crop-CT; 6,
Crop-CT; 7, Crop-CT; 8, Crop-CT; 9, Crop-CT; 10, Crop-CT; 11, Crop-ClO
2
; 12, Crop-ClO
2
;
13, Crop-ClO
2
; 14, Crop-ClO
2
; 15, Crop-ClO
2
; 16, Crop-ClO
2
; 17, Crop-ClO
2
; 18, Crop-ClO
2
;
19, Crop-ClO
2
; 20, Crop-ClO
2
).
(TIF)
S1 Table. Composition of bacterial families of untreated and ClO
2
treated samples of irri-
gation water (IW), soil (Soil) and baby spinach (Crop). Bacterial community is the average
of 5 individual samples. Data shown are families that comprised at least 1% of the sequences in
at least one sample of a given agronomic habitat.
(PDF)
Acknowledgments
Authors are thankful for the financial support from the Center for Produce Safety Grant
Agreement (Projects 2015-374 and 2017-01) and the MINECO (ProjectsAGL2013-48529-R
and AGL2016-75878-R). P. Truchado is holder of a Juan de la Cierva incorporation contract
from the MINECO (IJCI-2014-20932). Support provided by the Fundacio
´n Se
´neca (19900/
GERM/15) and Proyecto Intramural 201670E056 is also appreciated.
Author Contributions
Conceptualization: Pilar Truchado, Marı
´a Isabel Gil, Ana Allende.
Data curation: Pilar Truchado.
Formal analysis: Pilar Truchado.
Funding acquisition: Ana Allende.
Methodology: Pilar Truchado, Trevor Suslow.
Project administration: Ana Allende.
Supervision: Ana Allende.
Writing – original draft: Pilar Truchado.
Writing – review & editing: Marı
´a Isabel Gil, Trevor Suslow, Ana Allende.
References
1. Vorholt JA. Microbial life in the phyllosphere. Nat. Rev. Microbiol. 2012; 10: 828–840. https://doi.org/10.
1038/nrmicro2910 PMID: 23154261
2. Deng W, Gibson KE. Interaction of microorganisms within leafy green phyllospheres: where do human
norovirus fit in? Int J Food Microbiol 2017; 258: 28–37. https://doi.org/10.1016/j.ijfoodmicro.2017.07.
010 PMID: 28755583
3. Rastogi G, Sbodio A, Tech JJ, Suslow TV, Coaker GL, Leveau JHJ. Leaf microbiota in an agroecosys-
tem: spatiotemporal variation in bacterial community composition on field-grown lettuce. ISME J. 2012;
10:1812–1822.
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 14 / 17
4. Bulgarelli D, Schlaeppi K, Spaepen S, Loren V, van Themaat E. Schulze-Lefert P. Structure and func-
tions of the bacterial microbiota of plants. Annu Rev Plant Biol. 2013; 64: 807–838. https://doi.org/10.
1146/annurev-arplant-050312-120106 PMID: 23373698
5. Leff JW, Fierer N. Bacterial Communities associated with the surfaces of fresh fruits and vegetables.
PLoS ONE. 2013; 8: e59310. https://doi.org/10.1371/journal.pone.0059310 PMID: 23544058
6. Burch AY, Do PT, Sbodio A, Suslow TV, Lindow SE. High-level culturability of epiphytic bacteria and fre-
quency of biosurfactant producers on leaves. Appl Environ Microb. 2016; 82: 5997–6009.
7. Jensen B, Knudsen IMB, Andersen B, Nielsen KF, Thranes U, Jensen DF, et al. Characterization of
microbial communities and fungal metabolites on field grown strawberries from organic and conven-
tional production. Int J Food Microbiol. 2013; 160: 313–322 https://doi.org/10.1016/j.ijfoodmicro.2012.
11.005 PMID: 23290240
8. Williams TR, Moyne AL., Harris LJ, Marco ML. Season, irrigation, leaf age, and Escherichia coli inocula-
tion influence the bacterial diversity in the lettuce phyllosphere. PLoS ONE, 2013; 8:e68642. https://doi.
org/10.1371/journal.pone.0068642 PMID: 23844230
9. Wei F, Hu X, Xu X. Dispersal of Bacillus subtilis and its effect on strawberry phyllosphere microbiota
under open field and protection conditions. Scientific Reports. 2016: 6; 22611. https://doi.org/10.1038/
srep22611 PMID: 26936109
10. Telias A, White JR, Pahl DM, Ottesen AR, Walsh CS. Bacterial community diversity and variation in
spray water sources and the tomato fruit surface. BMC Microbiol. 2011; 11–81.
11. Ottesen A, Telias A, White JR, Newell MJ, Pahl D, Brown EW, et al. Bacteria of tomatoes managed with
well water and pond water: Impact of agricultural water sources on carposphere microbiota. Int J Envi-
ron Agric Res. 2016; 2: 2454–1850.
12. Park S, Navratil S, Gregory A, Bauer A, Srinath I, Jun M, et al. Generic Escherichia coli contamination
of spinach at the pre-harvest level: The role of farm management and environmental factors. Appl Envi-
ron Microbiol. 2013; 79:4347–4358. https://doi.org/10.1128/AEM.00474-13 PMID: 23666336
13. Pachepsky Y, Shelton DR, McLain JET, Patel J, Mandrell RE, Irrigation waters as a source of patho-
genic microorganisms in produce: a review. Adv Agron. 2011: 113; 73–138.
14. Allende A., Monaghan JM. Irrigation water quality for leafy crops: a perspective of risks and potential
solutions. Int J Environ Health Res. 2015; 12: 7457–7477.
15. Monaghan JM., Augustin JC., Bassett J., Betts R., Pourkomailian B., Zwietering MH. Risk assessment
or assessment of Risk? Developing an evidence-eased approach for primary producers of leafy vegeta-
bles to assess and manage microbial risks. J Food Prot. 2017; 80: 725–733.
16. EFSA (European Food Safety Authority). 2013. Scientific Opinion of the Panel on Biological Hazards
(BIOHAZ) on VTEC-seropathotype and scientific criteria regarding pathogenicity assessment. EFSA J.
11:3138; 1–106. Available from: http://www.10.2903/j.efsa.2013.3138.EFSA, 2013.
17. Suslow, TV. Standards for irrigation and foliar contact water. An initiative of the pew charitable trusts at
Georgetown University. Peer-Reviewed Issue. 2010. Available from: http://www.producesafetyproject.
org/admin/assets/files/Water-Suslow-1.pdf
18. Gil MI, Selma MV, Suslow T, Jacxsens L, Uyttendaele M, Allende A. Pre- and postharvest preventive
measures and intervention strategies to control microbial food safety hazards of fresh leafy vegetables.
Crit. Rev. Food Sci. 2015; 55: 453–468.
19. Lo
´pez-Ga
´lvez F, Sampers I, Gil MI, Allende A. Modelling of E.coli inactivation by chlorine dioxide in irri-
gation water. Agric Water Manment. 2017; 192: 98–102.
20. Yao KS, Hsieh YH, Chang YJ, Chang CY, Cheng TC, Liao HL. 2010. Inactivation effect of chlorine diox-
ide on phytopathogenic bacteria in irrigation water. Environ. Eng. Manag. J. 2010; 3: 157–160.
21. Scarlett K, Collins D, Tesoriero L, Jewell L van Ogtrop F, Daniel R. Efficacy of chlorine, chlorine dioxide
and ultraviolet radiation as disinfectants against plant pathogens in irrigation water. Eur J Plant Pathol.
2017; 145: 27–38.
22. Reitz SR, Roncarati RA, Shock CC, Kreeft H, Klauzer J, Chlorine dioxide injection through drip irrigation
reduces Escherichia coli. ASABE/IA Irrigation Symposium: Emerging Technologies for Sustainable Irri-
gation. Proceedings of the 10–12 November 2015 Symposium, Long Beach, California USA. Published
by ASABE St. Joseph, Michigan, USA. 2015: November 10, 2015.
23. Ibekwe AM, Grieve CM. Changes in developing plant microbial community structure as affected by con-
taminated water. FEMS Microbiol Ecol. 2004; 48: 239–248. https://doi.org/10.1016/j.femsec.2004.01.
012 PMID: 19712407
24. Zwielehner J, Handschur M, Michaelsen A, Irez S, Demel M, Denner EB, et al. DGGE and real-time
PCR analysis of lactic acid bacteria in bacterial communities of the phyllosphere of lettuce. Mol Nutr
Food Res. 2008; 52: 614–23. https://doi.org/10.1002/mnfr.200700158 PMID: 18398868
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 15 / 17
25. Dees MW, Lysøe E, Nordskog B, Brurberg MB. Bacterial communities associated with surfaces of leafy
greens: shift in composition and decrease in richness over time. App Environ Microbiol. 2015; 81:
1530–1539.
26. Qin Y, Hou J, Deng M, Liu Q, Wu C, Ji Y, et al. Bacterial abundance and diversity in pond water supplied
with different feeds. Sci Rep. 2016; 6: 35232. https://doi.org/10.1038/srep35232 PMID: 27759010
27. Ishaq SL., Johnson SP., Miller Z.J., Lehnhoff EA, Olivo S, Yeoman CJ., et al. Impact of cropping sys-
tems, soil inoculum, and plant species identity on soil bacterial community structure. 2017. Microbial
Ecol. 2017; 73: 417–434.
28. Lo
´pez-Ga
´lvez F, Gil MI, Truchado P, Allende A. Demonstration tests of irrigation water disinfection with
chlorine dioxide in open field cultivation of baby spinach. J Sci Food Agric. 2018, https://doi.org/10.
1002/jsfa.8794 PMID: 29171860
29. Truchado P, Gil MI, Kostic T, Allende A, Optimization and validation ofa PMA qPCR methodfor Escher-
ichia coli quantification in primary production. Food Control. 2016; 62: 150–156.
30. Herlemann DPR, Labrenz M, Juergens K, Bertilsson S, Waniek JJ, Anderrson AF. Transition in bacte-
rial communities along the 2000 km salinity gradient of the Baltic Sea. ISME J. 2011; 5: 1571–1579.
https://doi.org/10.1038/ismej.2011.41 PMID: 21472016
31. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME allows
analysis of high-throughput community sequencing data. Nat Methods. 2010; 7: 335–6. https://doi.org/
10.1038/nmeth.f.303 PMID: 20383131
32. McMurdie PJ, Holmes S. Phyloseq: an R package for reproducible interactive analysis and graphics of
microbiome census data. PLoS One. 2013; 8(4): e61217. https://doi.org/10.1371/journal.pone.0061217
PMID: 23630581
33. Oksanen J, Blanchet FG, Kindt R, Legendre P, Minchin PR, O’Hara RB, et al. Vegan: community ecol-
ogy package. R package vegan, vers. 2.2–1. 2015. Available from: http://www.cran.r-project.org/
package=vegan
34. Vaz-Moreira I, Egas C, Nunes OC. Manaia CM. Bacterial diversity from the source to the tap: a compar-
ative study based on 16S rRNA gene-DGGE and culture-dependent methods. FEMS Microbiol. Ecol.
2013; 83: 361–374. https://doi.org/10.1111/1574-6941.12002 PMID: 22938591
35. Wei YM, Wang JQ, Liu TT, Kong WW, Chen N, He XQ, et al. Bacterial communities of Beijing surface
waters as revealed by 454 pyrosequencing of the 16S rRNA gene. Environ Sci Pollut Res. 2015: 22;
12605.
36. Becerra-Castro C, Macedo G, Silva AMT, Manaia CM, Nunes OC,. Proteobacteria become predomi-
nant during regrowth after water disinfection. Sci Total Environ. 2016; 573: 313–323. https://doi.org/10.
1016/j.scitotenv.2016.08.054 PMID: 27570199
37. Lauber CL, Hamady M, Knight R, Fierer N. Pyrosequencing-based assessment of soil pH as a predictor
of soil bacterial community structure at the continental scale. Appl Environ Microbiol. 2009; 75: 5111–
5120. https://doi.org/10.1128/AEM.00335-09 PMID: 19502440
38. Saul-Tcherkas V, Steinberger Y. Soil microbial diversity in the vicinity of a Negev Desert shrub–Reau-
muria negevensis. Microb Ecol. 2011; 61: 64–81. https://doi.org/10.1007/s00248-010-9763-x PMID:
21052657
39. Frenk S, Hadar Y, Minz D. Resilience of soil bacterial community to irrigation with water of different qual-
ities under Mediterranean climate. Environ Microbiol. 2014; 16: 559–69. https://doi.org/10.1111/1462-
2920.12183 PMID: 23826671
40. Hunter PJ. Hand P. Pink D. Whipps JM. Bending GD. Both leaf properties and microbe-microbe interac-
tions influence within-species variation in bacterial population diversity and structure in the lettuce (Lac-
tuca species) phyllosphere. Appl Environ Microbiol. 2010; 76: 8817–8125.
41. Jackson CR, Randolph KC, Osborn SL, Tyler HL. Culture dependent and independent analysis of bac-
terial communities associated with commercial salad leaf vegetables. BMC Microbiol. 2013; 13: 274.
https://doi.org/10.1186/1471-2180-13-274 PMID: 24289725
42. Izhaki I, Fridman S, Gerchman Y, Halpern M. Variability of bacterial community composition on leaves
between and within plant species. Curr Microbiol. 2013; 66: 227–235. https://doi.org/10.1007/s00284-
012-0261-x PMID: 23143286
43. Schlatter DC, Bakker MG, Bradeen JM, Kinkel LL. Plant community richness and microbial interactions
structure bacterial communities in soil. Ecology. 2015; 96: 134–42. PMID: 26236898
44. Mowlick S, Inoue T, Takehara T., Kaku N, Ueki K, Ueki A. Changes and recovery of soil bacterial com-
munities influenced by biological soil disinfestation as compared with chloropicrin-treatment. AMB
Express. 2013; 3: 1–12.
45. Bardgett RD, Freeman C, Ostle N,. Microbial contributions to climate change through carbon cycles
feedbacks. ISME J. 2008; 2: 805–814. https://doi.org/10.1038/ismej.2008.58 PMID: 18615117
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 16 / 17
46. Lopez-Velasco G, Carder PA, Welbaum GE, Ponder MA. Diversity of the spinach (Spinacia oleracea)
spermosphere and phyllosphere bacterial communities. FEMS Microbiol. Lett. 2013; 346: 146–154.
https://doi.org/10.1111/1574-6968.12216 PMID: 23859062
47. Hausdorf L, Mundt K, Winzer M, Cordes C, Fro
¨hling A, Schlu¨ter O, et al Characterization of the cultiva-
ble microbial community in a spinach-processing plant using MALDI-TOF MS. Food Microbiol. 2013;
34: 406–41. https://doi.org/10.1016/j.fm.2012.10.008 PMID: 23541209
48. Lopez-Velasco G, Tydings HA, Boyer RR, Falkinham JO, Ponder MA. Characterization of interactions
between Escherichia coli O157:H7 with epiphytic bacteria in vitro and on spinach leaf surfaces. J Food
Microbiol. 2012; 153: 351–357.
49. Williams MM, Domingo JWS, Meckes MC, Kelty CA, Rochon HS. Phylogenetic diversity of drinking
water bacteria in a distribution system simulator. J Appl Microbiol. 2004; 96: 954–964 https://doi.org/10.
1111/j.1365-2672.2004.02229.x PMID: 15078511
50. Pang YC, Xi JY, Xu Y, Huo ZY, Hu HY. Shifts of live bacterial community in secondary effluent by chlo-
rine disinfection revealed by Miseq high-throughput sequencing combined with propidium monoazide
treatment. Appl Microbiol Biotechnol. 2016; 100: 6435–46. https://doi.org/10.1007/s00253-016-7452-5
PMID: 27005415
51. Nocker A, Camper A. Novel approaches toward preferential detection of viable cells using nucleic acid
amplification techniques. FEMS Microbiol. Lett. 2009; 291: 137–142. https://doi.org/10.1111/j.1574-
6968.2008.01429.x PMID: 19054073
52. Chiao TH, Clancy TM, Pinto A, Xi C, Raskin L. Differential resistance of drinking water bacterial popula-
tions to monochloramine disinfection. Environ Sci Technol. 2016; 48: 4038–4047.
53. Taylor RH, Falkinham JO, Norton CD, LeChevallier MW. Chlorine, chloramine, chlorine dioxide, and
ozone susceptibility of Mycobacterium avium. Appl Environ Microbiol. 2000; 66: 1702–1705. PMID:
10742264
54. Keina
¨nen-Toivola MM, Revetta RP, Santo Domingo JW. Identification of active bacterial communities
in a model drinking water biofilm system using 16S rRNA-based clone libraries. FEMS Microbiol Lett.
2006; 257: 182–188. https://doi.org/10.1111/j.1574-6968.2006.00167.x PMID: 16553851
55. Go
´mez-Alvarez V, Pfaller S, Pressman JG, Wahman DG, Revetta RP. Resilience of microbial commu-
nities in a simulated drinking water distribution system subjected to disturbances: role of conditionally
rare taxa and potential implications for antibiotic resistant bacteria. Environ Sci: Water Res Technol.
2016; 2: 645–657.
56. Gu G, Ottesen A, Bolten S., Ramachandran P, Reed E., Rideout S., et al. Shifts in spinach microbial
communities after chlorine washing and storage at compliant and abusive temperatures. Food Micro-
biol. 2018; 73: 73–84. https://doi.org/10.1016/j.fm.2018.01.002 PMID: 29526229
57. Sklarz MY, Zhou M, Ferrando Chavez DL, Yakirevich A, Gillor O, Gross A, et al. Effect of treated
domestic wastewater on soil physicochemical and microbiological properties. J. Environ. Qual. 2013;
42: 1226–1235. https://doi.org/10.2134/jeq2012.0416 PMID: 24216374
58. Tournas VH. Spoilage of vegetable crops by bacteria and fungi and related health hazards. Crit Rev
Microbiol. 2005; 31: 33–44. https://doi.org/10.1080/10408410590886024 PMID: 15839403
59. Lee DH, Kim JB, Kim M, Roh E, Jung K, Choi M, et al. Microbiota on spoiled vegetables and their char-
acterization. J Food Prot. 2013; 76: 1350–8. https://doi.org/10.4315/0362-028X.JFP-12-439 PMID:
23905790
60. Mansfield J, Genin S, Magori S, Citovsky V, Sriariyanum M, Ronald P, et al. Top 10 plant pathogenic
bacteria in molecular plant pathology. Mol Plant Pathol. 2012; 13: 614–29. https://doi.org/10.1111/j.
1364-3703.2012.00804.x PMID: 22672649
61. Williams TR, Marco ML. Phyllosphere microbiota composition and microbial community transplantation
on lettuce plants grown indoors. mBio, 2014; 5: e01564–14. https://doi.org/10.1128/mBio.01564-14
PMID: 25118240
62. Ottesen AR, Pena AG, White JR, Pettengill JB, Li C, Allard S, et al., Baseline survey of the anatomical
microbial ecology of an important food plant: Solanum lycopersicum (tomato). BMC Microbiol. 2013; 13:
114. https://doi.org/10.1186/1471-2180-13-114 PMID: 23705801
Changes in epiphytic bacterial community due to agricultural practices
PLOS ONE | https://doi.org/10.1371/journal.pone.0199291 July 18, 2018 17 / 17

Supplementary resources (2)

... Similarly, the ClO 2 treatment of irrigation water did not affect the diversity of water, soil, or crop bacterial communities. However, significant differences were observed in the relative abundance of specific bacteria belong to Enterobacteriaceae and Pseudomonas (Truchado et al., 2018). However, until now, the impact of chlorine disinfectants on soil microbial community has been mainly concentrated at the level of community composition, and the change of functions often cannot be determined accurately and comprehensively. ...
... Metagenomic analysis helped us better understand the impact of chlorine treatment on the soil microbial community. According to the results of pre-experiments, we selected two representative concentrations (0.05 and 1 mg L -1 ) of irrigation water with chlorine to treat wheat, based on the actual amount of residual chlorine in the soil and the concentration of disinfectant in contact with the soil, which were within reasonable residual chlorine range (Truchado et al., 2018;Subpiramaniyam, 2021). In this study, after continuous chlorine treatment for 14 d, the composition of the rhizosphere microbial community significantly differed from control group, while the bulk soil microbial community did not, which was consistent with the results of soil enzyme activity mentioned above. ...
Article
Full-text available
Chlorine-containing disinfectants have been widely used around the world for the prevention and control of the COVID-19 pandemic. However, at present, little is known about the impact of residual chlorine on the soil micro-ecological environment. Herein, we treated an experimental soil-plant-microbiome microcosm system by continuous irrigation with a low concentration of chlorine-containing water, and then analyzed the influence on the soil microbial community using metagenomics. After 14-d continuous chlorine treatment, there were no significant lasting effect on soil microbial community diversity and composition either in the rhizosphere or in bulk soil. Although metabolic functions of the rhizosphere microbial community were affected slightly by continuous chlorine treatment, it recovered to the original status. The abundance of several resistance genes changed by 7 d and recovered by 14 d. According to our results, the chlorine residue resulting from daily disinfection may present a slight long-term effect on plant growth (shoot length and fresh weight) and soil micro-ecology. In general, our study assisted with environmental risk assessments relating to the application ofchlorine-containing disinfectants and minimization of risks to the environment during disease control, such as COVID-19.
... Disinfection treatments can be applied to improve the microbiological quality of irrigation water, but its impact on the soil, plant and water microbiome is poorly understood. Truchado et al. [59]. evaluated the impact of chlorine dioxide (ClO 2 ), as a water treatment for irrigation of baby spinach, and observed changes in the water microbiome but no significant differences in soil and plant microbiomes. ...
... DRB colonized in water distribution systems could form a biofilm, which is a shelter providing durable high-level tolerance against disinfectants for pathogens and other unfavorable bacteria (Flemming, 2020;Garner et al., 2018;Zhu et al., 2014). DRB within irrigation water could migrate onto the surface of crops, posing a threat to food safety Truchado et al., 2018). ...
... DRB colonized in water distribution systems could form a biofilm, which is a shelter providing durable high-level tolerance against disinfectants for pathogens and other unfavorable bacteria (Flemming, 2020;Garner et al., 2018;Zhu et al., 2014). DRB within irrigation water could migrate onto the surface of crops, posing a threat to food safety Truchado et al., 2018). ...
Article
The epidemic of COVID-19 has aroused people's particular attention to biosafety. A growing number of disinfection products have been consumed during this period. However, the flaw of disinfection has not received enough attention, especially in water treatment processes. While cutting down the quantity of microorganisms, disinfection processes exert a considerable selection effect on bacteria and thus reshape the microbial community structure to a great extent, causing the problem of disinfection-residual-bacteria (DRB). These systematic and profound changes could lead to the shift in regrowth potential, biofouling potential, as well as antibiotic resistance level and might cause a series of potential risks. In this review, we collected and summarized the data from the literature in recent 10 years about the microbial community structure shifting of natural water or wastewater in full-scale treatment plants caused by disinfection. Based on these data, typical DRB with the most reporting frequency after disinfection by chlorine-containing disinfectants, ozone disinfection, and ultraviolet disinfection were identified and summarized, which were the bacteria with a relative abundance of over 5% in the residual bacteria community and the bacteria with an increasing rate of relative abundance over 100% after disinfection. Furthermore, the phylogenic relationship and potential risks of these typical DRB were also analyzed. Twelve out of fifteen typical DRB genera contain pathogenic strains, and many were reported of great secretion ability. Pseudomonas and Acinetobacter possess multiple disinfection resistance and could be considered as model bacteria in future studies of disinfection. We also discussed the growth, secretion, and antibiotic resistance characteristics of DRB, as well as possible control strategies. The DRB phenomenon is not limited to water treatment but also exists in the air and solid disinfection processes, which need more attention and more profound research, especially in the period of COVID-19.
... Our results showed that L. johnsonni 3121, L. rhamnosus 86, and P. pentosaceus KID7 could alter several gut microbial communities at the phylum and genus levels. Firmicutes and Bacteroidetes are the most common bacterial phyla in the gut and are used as determinants of human health and disease [59]. As compared with the ND, the HFD and probiotics significantly increased the relative abundance of Firmicutes and Firmicutes/Bacteroidetes ratio, but the relative abundance of Bacteroidetes was not significantly affected. ...
Article
Full-text available
Obesity is one of the major causes of the development of metabolic diseases, particularly cardiovascular diseases and type-2 diabetes mellitus. Increased lipid accumulation and abnormal adipocyte growth, which is an increase in cell numbers and differentiation, have been documented as major pathological characteristics of obesity. Thus, the inhibition of adipogenic differentiation prevents and suppresses obesity. Recently, specific probiotic strains have been known to regulate lipid metabolism in vitro and/or in vivo. Previously, we demonstrated that Lactobacillus johnsonni 3121 and Lactobacillus rhamnosus 86 could act as novel probiotic strains and reduce cholesterol levels. Moreover, both strains significantly reduced lipid accumulation and inhibited adipocyte differentiation by downregulating the adipogenic transcription factor in 3T3-L1 adipocytes. Therefore, L. johnsonni 3121 and L. rhamnosus 86 were selected for in vivo evaluation of their anti-obesity effects using a high-fat diet-induced obese mouse model. Daily oral administration of L. johnsonni 3121 and L. rhamnosus 86 for 12 weeks significantly improved serum lipid profile and downregulated the expression of genes related to adipogenesis and lipogenesis in epididymal white adipose tissue of high-fat diet fed obese mice (p < 0.05). Fecal analysis also suggested that the two probiotic strains could normalize the altered obesity–related gut microbiota in high-fat diet–fed obese mice. These results collectively demonstrate that oral administration of L. johnsonni 3121 and L. rhamnosus 86 could prevent obesity, thereby improving metabolic health.
Chapter
Full-text available
The chapter describes about various sources of antibiotics, and antibiotic resistant bacteria in the environment.
Article
Farmyard manure and slurry (FYM&S) and anaerobic digestate are potentially valuable soil conditioners providing important nutrients for plant development and growth. However, these organic fertilisers may pose a microbial health risk to humans. A quantitative microbial risk assessment (QMRA) model was developed to investigate the potential human exposure to pathogens following the application of FYM&S and digestate to agricultural land. The farm-to-fork probabilistic model investigated the fate of microbial indicators (total coliforms and enterococci) and foodborne pathogens in the soil with potential contamination of ready-to-eat salads (RTEs) at the point of human consumption. The processes examined included pathogen inactivation during mesophilic anaerobic digestion (M-AD), post-AD pasteurisation, storage, dilution while spreading, decay in soil, post-harvest washing processes, and finally, the potential growth of the pathogen during refrigeration/storage at the retail level in the Irish context. The QMRA highlighted a very low annual probability of risk (Pannual) due to Clostridium perfringens, norovirus, and Salmonella Newport across all scenarios. Mycobacterium avium may result in a very high mean Pannual for the application of raw FYM&S, while Cryptosporidium parvum and pathogenic E. coli showed high Pannual, and Listeria monocytogenes displayed moderate Pannual for raw FYM&S application. The use of AD reduces this risk; however, pasteurisation reduces the Pannual to an even greater extent posing a very low risk. An overall sensitivity analysis revealed that mesophilic-AD's inactivation effect is the most sensitive parameter of the QMRA, followed by storage and the decay on the field (all negatively correlated to risk estimate). The information generated from this model can help to inform guidelines for policymakers on the maximum permissible indicator or pathogen contamination levels in the digestate. The QMRA can also provide the AD industry with a safety assessment of pathogenic organisms resulting from the digestion of FYM&S.
Article
Chlorine disinfection is a key global public health strategy for the prevention and control of diseases, such as COVID-19. However, little is known about effects of low levels of residual chlorine on freshwater microbial communities and antibiotic resistomes. Here, we treated freshwater microcosms with continuous low concentrations of chlorine and quantified the effects on aquatic and zebrafish intestinal microbial communities and antibiotic resistomes, using shotgun metagenome and 16 S rRNA gene sequencing. Although chlorine rapidly degraded, it altered the aquatic microbial community composition over time and disrupted interactions among microbes, leading to decreases in community complexity and stability. However, community diversity was unaffected. The majority of ecological functions, particularly metabolic capacities, recovered after treatment with chlorine for 14 d, due to microbial community redundancy. There were also increased levels of antibiotic-resistance gene dissemination by horizontal and vertical gene transfer under chlorine treatment. Although the zebrafish intestinal microbial community recovered from temporary dysbiosis, growth and behavior of zebrafish adults were negatively affected by chlorine. Overall, our findings demonstrate the negative effects of residual chlorine on freshwater ecosystems and highlight a possible long-term risk to public health.
Article
Full-text available
Improving the environmental sustainability of the food supply chain will help to achieve the United Nations Sustainable Development Goals (SDGs). This environmental sustainability is related to different SDGs, but mainly to SDG 2 (Zero Hunger), SDG 12 (Responsible Production and Consumption), SDG 13 (Climate Action), and SDG 15 (Life on Land). The strategies and measures used to improve this aspect of the food supply chain must remain in balance with other sustainability aspects (economic and social). In this framework, the interactions and possible conflicts between food supply chain safety and sustainability need to be assessed. Although priority must be given to safety aspects, food safety policies should be calibrated in order to avoid unnecessary deleterious effects on the environment. In the present review, a number of potential tensions and/or disagreements between the microbial safety and environmental sustainability of the fresh produce supply chain are identified and discussed. The addressed issues are spread throughout the food supply chain, from primary production to the end-of-life of the products, and also include the handling and processing industry, retailers, and consumers. Interactions of fresh produce microbial safety with topics such as food waste, supply chain structure, climate change, and use of resources have been covered. Finally, approaches and strategies that will prove useful to solve or mitigate the potential contradictions between fresh produce safety and sustainability are described and discussed. Upon analyzing the interplay between microbial safety and the environmental sustainability of the fresh produce supply chain, it becomes clear that decisions that are taken to ensure fresh produce safety must consider the possible effects on environmental, economic, and social sustainability aspects. To manage these interactions, a global approach considering the interconnections between human activities, animals, and the environment will be required.
Article
The importance of leaf integrity, i.e. the effects of bruising (mechanical damage), and sanitisation with peroxyacetic acid (PAA) on bacterial communities of ready-to-eat baby spinach remains unclear. Two shelf-life studies were conducted at 4°C to investigate the effect of bruising and sanitisation on the growth of spoilage microorganisms. In the first experiment, both bruising treatments (100% and 40% of leaves) halved shelf life to 12 d, whereas intact leaves had a shelf-life of 23 d. Bruising had no influence on bacterial diversity during shelf-life, though some differences in the relative abundance of minor genera were observed. Pseudomonas and Pantoea were the most dominant bacterial genera, regardless of bruising treatment. High throughput amplicon sequencing also identified other spoilage bacteria including Chryseobacterium, Stenotrophomonas, Bacillus, Sphingobacterium, Erwinia and Flavobacterium. In the second experiment, washing of intact baby spinach with a sanitiser (80mg/L: PAA) reduced microbial load as determined by aerobic plate count but did not immediately affect the presence/relative abundance of most of the genera of spoilage bacteria observed. During shelf-life, the bacterial diversity of sanitised leaves was significantly lower than on water-washed leaves. Although sanitisation resulted in a higher initial log reduction in microbial load compared to control (portable tap water), sanitisation did not extend the shelf life of baby spinach (23 d). Sanitised spinach had reduced bacterial diversity however, by the end of shelf life, both sanitised and water-washed spinach was dominated by Pseudomonas and Pantoea spoilage bacteria. This study demonstrated for the first time that the shorter shelf life of bruised leaves was related to faster microbial growth rather than changes in bacterial diversity or community composition.
Article
Full-text available
Fresh produce, like spinach, harbors diverse bacterial populations, including spoilage and potentially pathogenic bacteria. This study examined the effects of produce washing in chlorinated water and subsequent storage on the microbiota of spinach. Baby spinach leaves from a commercial fresh-cut produce processor were assessed before and after washing in chlorinated water, and then after one week's storage at 4, 10, and 15 °C. Microbial communities on spinach were analyzed by non-selective plating, qPCR, and 16S rDNA amplicon sequencing. Bacterial populations on spinach, averaging 6.12 ± 0.61 log CFU/g, were reduced by 1.33 ± 0.57 log after washing. However, populations increased by 1.77–3.24 log after storage, with larger increases occurring at higher temperature (15 > 10 > 4 °C). The predominant phylum identified on unwashed spinach leaves was Proteobacteria; dominant genera were Pseudomonas and Sphingomonas. Bacterial communities shifted significantly after chlorine washing and storage. Several Proteobacteria species, such as Stenotrophomonas sp. and Erwinia sp., were relatively tolerant of chlorine treatment, while species of Flavobacterium and Pedobacter (phylum Bacteroidetes) grew rapidly during storage, especially at abusive temperatures. Cupriavidus sp. and Ralstonia sp. showed significant increases after washing. After storage, microbial communities on spinach appeared to shift back toward the pre-washing distributions.
Article
Full-text available
Over the last 10 years, some high-profile foodborne illness outbreaks have been linked to the consumption of leafy greens. Growers are required to complete microbiological risk assessments (RAs) for the production of leafy crops supplied either to retail or for further processing. These RAs are based primarily on qualitative judgements of hazard and risks at various stages in the production process but lack many of the steps defined for quantitative microbiological RAs by the Codex Alimentarius Commission. This article is based on the discussions of an industry expert group and proposes a grower RA approach based on a structured qualitative assessment, which requires all decisions to be based on evidence and a framework for describing the decision process that can be challenged and defended within the supply chain. In addition, this article highlights the need for evidence to be more easily available and accessible to primary producers and identifies the need to develop hygiene criteria to aid validation of proposed interventions.
Article
Full-text available
The abundance and diversity of bacteria in two types of ponds were investigated by quantitative PCR and Illumina MiSeq sequencing. The results revealed that the abundance of bacterial 16S rRNA genes in D ponds (with grass carp fed sudan grass) was significantly lower than that in E ponds (with grass carp fed commercial feed). The microbial communities were dominated by Proteobacteria, Cyanobacteria, Bacteroidetes, and Actinobacteria in both E and D ponds, while the abundance of some genera was significantly different between the two types of ponds. Specifically, some potential pathogens such as Acinetobacter and Aeromonas were found to be significantly decreased, while some probiotics such as Comamonadaceae unclassified and Bacillales unclassified were significantly increased in D ponds. In addition, water quality of D ponds was better than that of E ponds. Temperature, dissolved oxygen and nutrients had significant influence on bacterial communities. The differences in bacterial community compositions between the two types of ponds could be partially explained by the different water conditions.
Article
Full-text available
Farming practices affect the soil microbial community, which in turn impacts crop growth and crop-weed interactions. This study assessed the modification of soil bacterial community structure by organic or conventional cropping systems, weed species identity [Amaranthusretroflexus L. (redroot pigweed) or Avena fatua L. (wild oat)], and living or sterilized inoculum. Soil from eight paired USDA-certified organic and conventional farms in north-central Montana was used as living or autoclave-sterilized inoculant into steam-pasteurized potting soil, planted with Am. retroflexus or Av. fatua and grown for two consecutive 8-week periods to condition soil nutrients and biota. Subsequently, the V3-V4 regions of the microbial 16S rRNA gene were sequenced by Illumina MiSeq. Treatments clustered significantly, with living or sterilized inoculum being the strongest delineating factor, followed by organic or conventional cropping system, then individual farm. Living inoculum-treated soil had greater species richness and was more diverse than sterile inoculum-treated soil (observed OTUs, Chao, inverse Simpson, Shannon, P?<?0.001) and had more discriminant taxa delineating groups (linear discriminant analysis). Living inoculum soil contained more Chloroflexi and Acidobacteria, while the sterile inoculum soil had more Bacteroidetes, Firmicutes, Gemmatimonadetes, and Verrucomicrobia. Organically farmed inoculum-treated soil had greater species richness, more diversity (observed OTUs, Chao, Shannon, P?<?0.05), and more discriminant taxa than conventionally farmed inoculum-treated soil. Cyanobacteria were higher in pots growing Am. retroflexus, regardless of inoculum type, for three of the four organic farms. Results highlight the potential of cropping systems and species identity to modify soil bacterial communities, subsequently modifying plant growth and crop-weed competition.
Article
Background: Treatments for the disinfection of irrigation water have to be evaluated by demonstration tests carried out under commercial settings taking into account not only their antimicrobial activity but also the potential phytotoxic effects on the crop. The consequences of the treatment of irrigation water with chlorine dioxide (ClO2 ) used for sprinkler irrigation of baby spinach in two commercial agricultural fields was assessed. Results: Residual ClO2 levels at the sprinklers in the treated field were always below 1 mg/L. ClO2 treatment provoked limited but statistically significant reductions in culturable Escherichia coli counts (0.2-0.3 log reductions), but not in the viable E. coli counts in water, suggesting the presence of viable but non-culturable cells (VBNC). Although disinfected irrigation water did not have an impact on the microbial loads of Enterobacteriaceae nor on the quality characteristics of baby spinach, it caused the accumulation of chlorates (up to 0.99 mg/kg in plants) and the reduction of the photosynthetic efficiency of baby spinach. Conclusion: Low concentrations of ClO2 are effective in reducing the culturable E. coli present in irrigation water but it might induce the VBNC state. Presence of disinfection by-products and their accumulation in the crop must be considered to adjust doses in order to avoid crop damage and chemical safety risks.
Article
Human noroviruses (hNoV) are one of the major causes of foodborne disease outbreaks linked to leafy greens. However, the interactions—including attachment and persistence—of hNoV with leafy greens are not well characterized. In the present review, three mechanisms are hypothesized for the interaction of hNoV with leafy green phyllospheres: 1) specific binding to histo-blood group antigen (HBGA)-like carbohydrates exposed on leaf surfaces and present on bacterial microbiota; 2) non-specific binding through electrostatic forces; and 3) internalization of hNoV through contaminated water (e.g. hydroponic feed water). To add more complexity, there is a rich diversity of microbial communities (i.e., bacteria, fungi, protozoa) residing in leafy green phyllospheres, and the attachment and persistence of hNoV could be largely impacted by these microorganisms through direct and indirect interactions. For instance, enzymes produced by bacteria and fungi could potentially compromise the structure of HBGA-like carbohydrate binding sites on leaves, leading to a reduction in hNoV binding. On the other hand, some bacteria also possess HBGA-like binding sites on their cell surface, which may provide extra binding locations for hNoV. There are also numerous metabolic compounds that can be produced by leafy greens and its microbial inhabitants and be subsequently distributed within leafy green phyllospheres. These compounds could theoretically play roles in enhancement or reduction in the attachment of hNoV. Overall, increasing the understanding of the various types of hNoV attachment and interactions with leafy green phyllospheres will be crucial for elucidating hNoV transmission via leafy greens as well as for the development of effective control measures.
Article
Irrigation water has been highlighted as a potential contamination source of fresh produce with foodborne pathogens. Water disinfection treatments can be used to improve its microbiological safety. Growers should ascertain the minimum effective disinfectant doses able to achieve the desired microbiological goals. Furthermore, potential unwanted effects both on crop health and on chemical risks associated with the accumulation of disinfection by-products (DBPs) on the crop must be taken into account. The minimum effective doses vary depending on intrinsic factors (e.g. physicochemical characteristics of the irrigation water, concentration of the target microorganism) and also extrinsic factors (e.g. geographical and weather conditions). In the present study, different types of surface irrigation water were treated with various doses of a stable solution of chlorine dioxide (ClO2) (0.1–2.5 mg/L) at 21 ± 2 °C for a contact time of 1 min. Escherichia coli concentration (before and after treatment) and the residual ClO2 (after treatment) were analyzed. Several water physicochemical parameters were measured (chemical oxygen demand (COD), turbidity, pH, oxidation-reduction potential (ORP), conductivity and absorbance of filtered water samples at 254 nm (UV254)). Data obtained was used to develop a model for ClO2 decay and a model for E. coli inactivation by linear regression. The ClO2 decay model (adjusted R² = 0.93) included the initial ClO2 concentration and the UV254 as explanatory variables. The E. coli inactivation model (adjusted R² = 0.77) included the initial ClO2 concentration, the initial E. coli concentration, and the UV254 as explanatory variables. The development of these models would help growers in making decisions regarding the minimum effective doses they might use to treat their irrigation water when using a stable solution of ClO2 to reduce microbial risk of fresh produce.
Article
Disinfection processes aim at reducing the number of viable cells through the generation of damages in different cellular structures and molecules. Since disinfection involves unspecific mechanisms, some microbial populations may be selected due to resilience to treatment and/or to high post-treatment fitness. In this study, the bacterial community composition of secondarily treated urban wastewater and of surface water collected in the intake area of a drinking water treatment plant was compared before and 3-days after disinfection with ultraviolet radiation, ozonation or photocatalytic ozonation. The aim was to assess the dynamics of the bacterial communities during regrowth after disinfection. In all the freshly collected samples, Proteobacteria and Bacteroidetes were the predominant phyla (40-50% and 20-30% of the reads, respectively). Surface water differed from wastewater mainly in the relative abundance of Actinobacteria (17% and <5% of the reads, respectively). After 3-days storage at light and room temperature, disinfected samples presented a shift of Gammaproteobacteria (from 8 to 10% to 33-65% of the reads) and Betaproteobacteria (from 14 to 20% to 31-37% of the reads), irrespective of the type of water and disinfection process used. Genera such as Pseudomonas, Acinetobacter or Rheinheimera presented a selective advantage after water disinfection. These variations were not observed in the non-disinfected controls. Given the ubiquity and genome plasticity of these bacteria, the results obtained suggest that disinfection processes may have implications on the microbiological quality of the disinfected water.