ArticlePDF Available

Molecular identification of Physaloptera sp. from wild northern bobwhite (Colinus virginianus) in the Rolling Plains ecoregion of Texas

Authors:

Abstract and Figures

Physaloptera spp. are common nematodes found in the stomach and muscles of mammals, reptiles, amphibians, and birds. Physaloptera spp. have a complicated life cycle with multiple definitive hosts, arthropod intermediate hosts, aberrant infections, and possible second intermediate hosts or paratenic hosts. For example, Physaloptera sp. larvae have been found within the tissues of wild northern bobwhite quail (Colinus virginianus), and it is suspected that quail may serve as paratenic or secondary hosts of these parasites. However, because it is not known what role quail play in the life cycle of Physaloptera spp. and descriptions of Physaloptera spp. larvae are limited, molecular tools may be beneficial when identifying these helminths. In this study, we generated primers using universal nematode primers and obtained a partial mitochondrial cytochrome oxidase 1 (COX 1) sequence. Morphological identification of Physaloptera sp. in bobwhite was confirmed via polymerase chain reaction (PCR), and a phylogenetic tree was constructed using the maximum likelihood method. BLAST analysis revealed a strong identity to other Physaloptera spp. and the phylogenetic tree placed all Physaloptera spp. in the same cluster. We also documented a marked increase in Physaloptera infections in bobwhite from 2017 to 2018, and the similarity of these parasites to Onchocerca volvulus and Wuchereria bancrofti may give insight into the increased prevalence we observed. This study demonstrates the usefulness of molecular techniques to confirm the identity of species that may lack adequate descriptions and provides new insight for the diagnosis and potentially overlooked significance of Physaloptera sp. infections of bobwhite in the Rolling Plains ecoregion of Texas.
This content is subject to copyright. Terms and conditions apply.
ORIGINAL PAPER
Molecular identification of Physaloptera sp. from wild northern
bobwhite (Colinus virginianus) in the Rolling Plains ecoregion of Texas
Aravindan Kalyanasundaram
1
&Cassandra Henry
1
&Matthew Z. Brym
1
&Ronald J. Kendall
1
Received: 22 May 2018 /Accepted: 28 June 2018
#Springer-Verlag GmbH Germany, part of Springer Nature 2018
Abstract
Physaloptera spp. are common nematodes found in the stomach and muscles of mammals, reptiles, amphibians, and birds.
Physaloptera spp. have a complicated life cycle with multiple definitive hosts, arthropod intermediate hosts, aberrant infections,
and possible second intermediate hosts or paratenic hosts. For example, Physaloptera sp. larvae have been found within the
tissues of wild northern bobwhite quail (Colinus virginianus), and it is suspected that quail may serve as paratenic or secondary
hosts of these parasites. However, because it is not known what role quail play in the life cycle of Physaloptera spp. and
descriptions of Physaloptera spp. larvae are limited, molecular tools may be beneficial when identifying these helminths. In this
study, we generated primers using universal nematode primers and obtained a partial mitochondrial cytochrome oxidase 1 (COX
1) sequence. Morphological identification of Physaloptera sp. in bobwhite was confirmed via polymerase chain reaction (PCR),
and a phylogenetic tree was constructed using the maximum likelihood method. BLAST analysis revealed a strong identity to
other Physaloptera spp. and the phylogenetic tree placed all Physaloptera spp.in the samecluster. We alsodocumented a marked
increase in Physaloptera infections in bobwhite from 2017 to 2018, and the similarity of these parasites to Onchocerca volvulus
and Wuchereria bancrofti may give insight into the increased prevalence we observed. This study demonstrates the usefulness of
molecular techniques to confirm the identity of species that may lack adequate descriptions and provides new insight for the diagnosis
and potentially overlooked significance of Physaloptera sp. infections of bobwhite in the Rolling Plains ecoregion of Texas.
Keywords COX1 .Muscle worm .PCR .Physaloptera .Quail .Sequencing
Introduction
Physaloptera (Spirurida: Physalopteridae) are a genus of
widely distributed helminths that infect a multitude of hosts
including amphibians, birds, reptiles, and mammals (Schmidt
and Roberts 2009). In North America, these helminths are
most commonly found in the gastrointestinal tracts of felines,
mesocarnivores, and some species of lizards (Morgan 1941;
Tel ford 1970), which may become infected after eating food
harboring Physaloptera spp. larvae. Physalopterids are trans-
mitted via an indirect life cycle and utilize a variety of arthro-
pod intermediate hosts, including beetles, cockroaches,
crickets, earwigs, and grasshoppers (Petri and Ameel 1950;
Schell 1952; Goldberg and Bursey 1989). Upon entering the
definitive host, Physalopterids attach to the walls of the duo-
denum and stomach (Naem and Asadi 2013) and are known to
have pathological consequences such as catarrhal gastritis,
gastrointestinal upset, erosion of the mucosa, ulcers, and
vomiting (Soulsby 1965).
Additionally, amphibians, birds, reptiles, and rodents have
all been identified as potential paratenic hosts for
Physalopterids (Widmer 1970; Cawthorn and Anderson
1976; Velikanov and Sharpillo 2002). While the role of
paratenic hosts in the transmission of Physalopterids is not
fully understood (Cawthorn and Anderson 1976; Boggs et al.
1990), some researchers suspect that they may be an essential
means of transmission for these parasites (Naem et al. 2006;
Schmidt and Roberts 2009). For example, Physaloptera sp.
larvae have been found embedded in the tissues of northern
bobwhite quail (Colinus virginianus Linnaeus, 1758; hereafter
bobwhite) (Boggs et al. 1990;Cram1931) and are often con-
sumed by birds of prey that are common definitive hosts of
Physaloptera spp. (Anderson et al. 2009).
*Ronald J. Kendall
ron.kendall@ttu.edu
1
The Wildlife Toxicology Laboratory, The Institute of Environmental
and Human Health, Texas Tech University, Box 43290,
Lubbock, TX 79409-3290, USA
Parasitology Research
https://doi.org/10.1007/s00436-018-5993-5
Although it has not been determined whether bobwhite are
a true paratenic host to Physalopterids (Boggs et al. 1990),
surveys to determine parasite abundance have found
Physaloptera sp. in approximately 8% of bobwhite in the
Southeastern US and in the Rolling Plains ecoregion of
Texas and Oklahoma (Boggs et al. 1990; Bruno 2014;
Applegate et al. 2017). This is a concerning discovery because
Naem et al. (2006) suspected that paratenic hosts could facil-
itate human infection, and quail hunting is an economically
significant activity that draws a substantial number of partic-
ipants in this region (Johnson et al. 2012), potentially increas-
ing the likelihood of human exposure. Boggs et al. (1990)
further suspected that Physalopterid infections in quail may
be more common than previously believed and highlighted
the need for additional research into the life history and sys-
tematics of these parasites. Furthermore, while the pathologi-
cal consequences of Physaloptera sp. infection in their defin-
itive hosts have been studied, research regarding the potential
effects of Physaloptera sp. in paratenic hosts is lacking, and
this may be an important consideration given the economic
significance and oftentimes limited populations of bobwhite.
Consequently, further research into the systematics, life
cycle, and pathogenicity of Physalopterids may yield valuable
insight into the prevalence and significance of Physaloptera
sp. infection in potential paratenic hosts, such as bobwhite, as
well as transmission dynamics and the likelihood of zoonotic
events. However, descriptions of the larval stages in the family
Physalopteridae are incomplete (Boggs et al. 1990), and mor-
phological identification of the genus Physaloptera sp. can be
difficult due to the similarities in ascarids (Cleeland et al.
2013). Thus, combining morphological descriptions with mo-
lecular methods, such as polymerase chain reaction (PCR),
can help confirm the genera of interest.
Materials and methods
Quail sampling
Bobwhite were collected in the same manner as described by
Dunham et al. (2017) from March to October in 2017 and in
March of 2018 in Mitchell (n= 65) and Garza (n= 4) Counties
in Texas. We also received hunter-donated bobwhite in
January and December 2017 and January and February 2018
from Garza (n= 5), Mitchell (n=22),andStonewall (n=58)
Counties in Texas. Additionally, six bobwhite were given to
the lab between March and October 2017 from Stonewall
County after being found dead or in such a weakened state
that the bobwhite could be picked up. All bobwhite were
trapped and handled according to Texas Parks and Wildlife
permit SPR-0715-095 and Texas Tech University Animal
Care and Use Committee under protocol 16071-08.
Parasite collection and morphological identification
During dissections, parasites were seen in the breast muscle of
some bobwhite. Using a scalpel, we excised ~25 g portions of
tissue containing encapsulated larvae from quail breast mus-
cles. Fat and fascia surrounding the cysts were removed with
surgical scissors and the remaining material was digested at
40 °C for 2 h in 1 liter of digestive solution consisting of 6 g
of pepsin and 6 ml of HCl (37%) in distilled water. After the
larvae were recovered, they were examined microscopically
and were identified as Physaloptera sp. based on morphology
described by Cram (1931), Dixon and Roberson (1967), Boggs
et al. (1990), Taton-Allen and Cheney (2001), González and
Hamann (2012), and Mohamadain and Ammar (2012). Some
specimens were stained with lactophenol blue to make
distinguishing characteristics more visible when photographed;
these were not used for sequencing as the phenol is known to
inhibit PCR (Schrader et al. 2012). The remaining
Physaloptera spp. recovered from breast muscle of bobwhite
collected in October 2017 and January 2018 were used for
sequencing. Collected specimens were washed carefully with
1× PBS buffer solution and stored at 80 °C for DNA extrac-
tion after confirmation of morphological identification.
DNA extraction
Genomic DNA of male and female Physaloptera sp. was extract-
ed using Qiagen DNeasy Blood and Tissue Kit (Qiagen,
Germany) according to the manufacturers instruction with a
slight modification. For the final step, 100 μl sterile water was
used instead of 200 μl of AE buffer. Male and female muscle
worms were homogenized separately in 180 μlofATLbuffer
with a micropestle (Sigma, USA) followed by an addition of
20 μl proteinase K. Samples were incubated at 56 °C for
20 min. Extracted DNA was stored at 40 °C until further use.
Primer design
Physaloptera genomic DNA was subjected to PCR using
nematode-specific primers as described by (Prosser et al.
2013). Physaloptera species specific forward and reverse
primers were designed (Table 1) using sequencing results of
primary amplification based on methods described in
Kalyanasundaram et al. (2017).
Amplification of COX1
Physaloptera spp. primers were optimized using an annealing
temperature gradient from 55 to 60 °C. PCR reactions
contained 5 μl of 2× Red Dye Master Mix (Bioline,
England), 0.5 μlof10μM forward and reverse COX1 primers,
3.0 μl of molecular grade water, and 1 μl of template DNA for a
total reaction volume of 10 μl. PCR reactions were run under
Parasitol Res
the following parameters: 95 °C for 3 min, 95 °C for 30 s, and
57 °C for 30 s for both COX1. Elongation temperature was kept
at7Cfor1minwith29cycles.Finalelongationat7Cfor
5 min was used to check extended chain. Amplification of the
COX1 products was visualized on 1.5% agarose gels.
Sequencing
Purified PCR products of COX1 were sequenced in both di-
rections using its respective forward and reverse primers. Raw
sequences were trimmed using DNA chromatogram explorer
(www.dnabaser.com). Final sequences used for analysis
totaled at 557 bp, and the GC content of the amplified
partial COX1 region was 36%. Sequence similarity was
performed using BLAST analysis.
Phylogenetic analysis
MEGA 7 software was used to generate phylogeny of partial
COX1 gene regions. Physaloptera spp. sequence was aligned
with sequences of other similar parasites retrieved from the
GenBank, NCBI. Initially, we did multiple alignment with
nearly 20 sequences of COX1 retrieved from GenBank using
CLUSTAL W program and simple trees were constructed by
maximum likelihood method (Larkin et al. 2007). We used
taxa from order Spirurida for constructing the COX1 phylo-
genetic tree. Based on the alignment results, identical and
unfit/short sequences were removed until enough congregate
sequences were found. We used Ascaridida (Tox asc ar is
leonina [KC902750]) as an out group in this tree. The boot-
strap value was set at 1000 in order to represent strong evolu-
tionary relationships between Physaloptera sp. and other par-
asites of the Nematoda phylum.
Results and discussion
Physaloptera sp. larvae were found encapsulated and coiled
near the surface of the breast muscle which is similar to the
descriptions by Cram (1931) and Dixon and Roberson
(1967). Boggs et al. (1990) further described Physaloptera sp.
larvae as Brice grain^lesions at the surface of breast muscle of
bobwhite. However, the specimens described by Boggs et al.
(1990) were not encapsulated, but it was suspected that the
infection was too recent for the capsule to form. Macroscopic
rice grain-like lesions were observed in our samples as well and
were approximately 46mminlength(Fig.1). When uncoiled,
larvae were 35 mm in length and matched descriptions of
Physaloptera sp. larvae from Boggs et al. (1990)and
Mohamadain and Ammar (2012). Recovered Physaloptera
sp. larvae also possessed cephalic collars and two spines at
the anterior end (Fig. 2), which are characteristic morphological
features of Physaloptera sp. described by Taton-Allen and
Cheney (2001) and González and Hamann (2012).
Interestingly, the anterior spines described by Taton-Allen and
Cheney (2001) were documented in adult Physaloptera spp.
Thus, it is possible that these features may have been present
in our samples due to their advanced development, potentially
supporting speculations by Cram (1931)thatPhysaloptera sp.
may continue development in bobwhite. If development is in-
deed continuing, bobwhite may be a second intermediate host
and not a paratenic host and further research is needed to deter-
mine the role of bobwhite in the life cycle of Physaloptera sp.
Because birds of prey are common definitive hosts for
Physaloptera sp. (Anderson et al. 2009) and predators of bob-
white, bobwhite might facilitate transmission to birds of prey.
Blast analysis showed that the 557-bp COX1 gene of
Physaloptera sp. has 87% identity to Physaloptera retusa
Rudolphi, 1819 (KT894803) and 86% to Physaloptera
turgida Rudolphi, 1819 isolates (KT894808), confirming that
our sequence corresponds with previously submitted
Physalopetra spp. sequences. Additionally, a phylogenetic
tree was constructed and all Physaloptera spp. were placed
in the same cluster with strong support by ML bootstrap anal-
ysis (Fig. 3), further confirming the identification of
Physaloptera sp. in bobwhite. Muscle worm Physaloptera
sp. COX1 nucleotide (557 bp) sequence was submitted as
Physaloptera sp. WTL (Acc No. LC381943) in DDBJ.
Of the bobwhite collected in 2017 (n= 125) and 2018
(n= 35), 4.8% were infected with Physaloptera sp.in 2017
and 14.3% in 2018. This rise in prevalence is concerning
because Physaloptera sp. infections were not seen in 2017
until May, and infection rates for Physaloptera sp. in bob-
white are typically around 7% (Boggs et al. 1990; Bruno
2014). However, a similar instance of increased
Physaloptera sp. infections was documented in the early
1960s in which 14.8% of bobwhite were infected (Jackson
1969), and this preceded a drop in bobwhite abundance
(Peterson 2007). The increase in Physaloptera sp. we ob-
served also occurred amidst decreasing bobwhite abun-
dance which coincided with reports of elevated burdens
of eyeworms (Oxyspirura petrowi Skrjabin, 1929) and
Table 1 Cytochrome oxidase 1
gene specific primers used in the
study
Primer Sequence Length GC Annealing Tm (°C)
Phy F GGGCAGGATTAGGAGGTTCTG 21 57.1 57
Phy R AAGCCCCAGCCAAAACTGGAA 21 52.4
Parasitol Res
cecal worms (Aulonocephalus pennula Canavan, 1929)
(Henry et al. 2017;Brymetal.2018), and Physaloptera
rara Hall & Wigdor, 1918 infection in coyotes is known to
have a positive association with other parasites (Pence and
Meinzer 1979). Thus, it is possible that Physaloptera sp.
may have a comparable association with eyeworms and
cecal worms.
Similar trends have been noted for Onchocerca volvulus
Leuckart, 1893 (AP017695) and Wuchereria bancrofti
Cobbold, 1877 (JQ316200), which share a 79% and 78% iden-
tity with Physaloptera sp., respectively. For example, O. volvulus
is known to have positive associations with Trichuris trichiura
Linnaeus 1771, Mansonella perstans Manson, 1891, and hook-
worm infection (Rietveld et al. 1987; Wanji et al. 2003;Faulkner
et al. 2005). W. bancrofti is also associated with increased density
of Plasmodium falciparum Welch, 1897 in schoolchildren
(Mboera et al. 2011) and is known to coinfect with the fungus
Pichia guilliermondii (Mukherjee et al. 2014). Additionally, W.
bancrofti infection is more prevalent when individuals are also
infected with O. volvulus (Engelbrecht et al. 2003) and is known
to increase susceptibility to other infections (Fernando et al.
2001). Therefore, the high infection levels of eyeworms and
cecal worms that have been seen in bobwhite (Henry et al.
2017;Brymetal.2018) may have triggered parasite-induced
immunosuppression that facilitated establishment of infection
by Physaloptera sp. (Cox 2001).
The idea that an agent can cause an organism to be immuno-
compromised and increase susceptibility to additional pathogens
is not new (Armstrong 1993); however, studies that evaluate the
effects of multiple parasites are lacking (Cox 2001;Telferetal.
2010). Multiple infections have also been linked to negative
effects on host metabolism and condition. For instance, the basal
metabolic rate of mammals increases and longevity decreases as
parasite species richness increases in infected mammals (Morand
and Harvey 2000). In rabbits, multiple parasites negatively im-
pact body condition and affected their ability to escape predators
(Lello et al. 2005; Alzaga et al. 2008). This is concerning as
bobwhite have many predators, and hunters reported increased
occurrences of feather piles likely due to predation during the
winter of 20172018 (personal communication, Kendall 2018)
which may have been facilitated by coinfection of A. pennula,O.
petrowi,andPhysaloptera sp.
Because these parasites utilize Orthopterans as intermediate
hosts (Goldberg and Bursey 1989; Almas et al. 2018; Henry et al.
2018), it is possible that Physaloptera sp. may share a common
intermediate host with A. pennula and O. petrowi. This may have
contributed to the increased prevalence of Physaloptera sp. as A.
pennula and O. petrowi burdens were elevated as well.
Additionally, climate change has already been speculated to in-
crease the intensity and distribution of A. pennula due to changes
in Orthoptera intermediate host availability and distribution
(Henry et al. 2018), and this may further explain the increased
Fig. 1 Macroscopically visible
Physaloptera sp. in the breast
tissues of northern bobwhite quail
(Colinus virginianus)collectedin
Mitchell County, Texas. (a)
Physaloptera sp. are present
throughout the breast and appear
as 46-mm-long Brice grain^
lesions within the tissue (in red
circles). (b) Coiled Physaloptera
sp. is clearly visible upon closer
inspection of a lesion (in red
circle)
Fig. 2 (A) Cephalic collar and (B) two spines are visible at the anterior
end of a Physaloptera sp. recovered from the pectoral muscle of a north-
ern bobwhite quail (Colinus virginianus) collected in Stonewall County,
Tex as
Parasitol Res
prevalence we documented here. Furthermore, accidental human
infection of Dirofilaria repens Railliet & Henry, 1911
(KX265049), a parasite that shares an 80% identity with
Physaloptera sp., has increased in occurrence in Ukraine and
Italy and has been associated with climate change and increased
mosquito populations (Poppert et al. 2009; Genchi et al. 2011;
Sałamatin et al. 2013).
As changing climate may lead to increases in intermediate
host availability and subsequent Physaloptera sp. prevalence,
the potential of humans to become infected with physalopterids
after consuming an intermediate or paratenic host should be
considered. For example, an infant was diagnosed with infarc-
tion of the bowel from ingesting a Physaloptera sp. larvae
(Nicolaides et al. 1977). While cases of Physaloptera sp. in-
fection in humans are rare, the increased prevalence of
Physaloptera sp. we observed may be increasing the chance
of transmission to humans who consume infected bobwhite if
bobwhite are indeed an intermediate or paratenic host.
Consequently, further research into the life cycles of para-
sites such as A. pennula,O. petrowi,andPhysaloptera sp. is
warranted as the transmission dynamics, prevalence, and in-
tensities of these infections may be interdependent and driven
by common variables. Unfortunately, because many studies
focus on single host-parasite systems, despite the fact that
single infections are rare in wild populations (Bordes and
Morand 2011), the interaction and compounding potential of
these infections are not well understood. This lack of knowl-
edge is further exacerbated by incomplete descriptions of the
larval stages of some parasites, as well as difficulty detecting
these within intermediate and paratenic hosts (Kozak and
Wędrychowicz 2010). As such, molecular techniques can be
used to confirm the identity of poorly described larval stages,
which would allow for more accurate determination of inter-
mediate and paratenic hosts. This study highlights the poten-
tial of molecular techniques to identify parasites and better
understand their life cycles. Further research into the life cycle
of Physaloptera sp. and the role of bobwhite as a host will be
an important step in understanding how bobwhite may be
impacted by this parasite. Furthermore, the interactions be-
tween parasites infecting bobwhite should be investigated as
this understanding may allow for better prediction and control
of infections.
Acknowledgements We extend our gratitude to the owners and em-
ployees at our study ranch for their continued hospitality and for granting
us ranch access. We also thank all the Wildlife Toxicology Laboratory
(WTL) personnel for their laboratory and field assistance. Finally, we
appreciate the dedication and help of the hunters that donate bobwhite
to the WTL; their continued involvement is instrumental in advancing
this research.
Funding information This research received funding and support from
Park Cities Quail and the Rolling Plains Quail Research Foundation.
Compliance with ethical standards
All bobwhite were handled according to Texas Parks and Wildlife
Research Permit No. SPR-0715-095 and Texas Tech Animal Care and
Use Committee protocol 16071-08.
Conflict of interest The authors declare that they have no conflict of
interest.
References
Almas S, Gibson AG, Presley SM (2018) Molecular detection of
Oxyspirura larvae in arthropod intermediate hosts. Parasitol Res
117:819823
Alzaga V, Vicente J, Villanua D, Acevedo P, Casas F, Gortazar C (2008)
Body condition and parasite intensity correlates with escape capac-
ity in Iberian hares (Lepus granatensis). Behav Ecol Sociobiol 62:
769775
Fig. 3 The evolutionary history
was inferred by MEGA 7 using
the maximum likelihood method.
The analysis involved 15
nucleotide sequences. All
positions containing gaps and
missing data were eliminated.
There were a total of 334
positions in the final dataset
Parasitol Res
Anderson RC, Chabaud AG, Willmott S (2009) Keys to the nematode
parasites of vertebrates: archival volume. CAB International,
Wallingford
Applegate R, Gerhold RW Jr, Fenton H, Fischer JR (2017) Free-ranging,
northern bobwhite submissions to the southeastern cooperative
wildlife disease study (19822015). Proc Natl Quail Symp 8:85
Armstrong D (1993) History of opportunistic infection in the immuno-
compromised host. Clin Infect Dis 17:318321
Boggs JF, Peoples AD, Lochmiller RL (1990) Occurence and pathology
of Physalopterid larvae infections in bobwhite quail from western
Oklahoma. Proc Okla Acad Sci 70:2931
Bordes F, Morand S (2011) The impact of multiple infections on wild
animal hosts: a review. Infect Ecol Epidemiol 1:7346. https://doi.
org/10.3402/iee.v1i0.7346
Bruno A (2014) Survey for Trichomonas gallinae and assessment of
helminth parasites in northern bobwhites from the Rolling Plains
ecoregion. Thesis, Texas A&M University-Kingsville
Brym MZ, Henry C, Kendall RJ (2018) Elevated parasite burdens as a
potential mechanism affecting northern bobwhite (Colinus
virginianus) population dynamics in the Rolling Plains of West
Texas. Parasitol Res 16
Cawthorn RJ, Anderson RC (1976) Development of Physaloptera
maxillaris (Nematoda: Physalopteroidea) in skunk (Mephitis
mephitis) and the role of paratenic and other hosts in its life cycle.
Can J Zool 54:313323
Cleeland LM, Reichard MV, Tito RY, Reinhard KJ, Lewis CM Jr (2013)
Clarifying prehistoric parasitism from a complementary morpholog-
ical and molecular approach. J Archaeol Sci 40:30603066
Cox FEG (2001) Concomitant infections, parasites and immune re-
sponses. Parasitol 122:2338
Cram EB (1931) Recent findings in connection with parasites of game
birds. Trans Am Game Conf 18:243247
Dixon JM, Roberson JH (1967) Case report: aberrant larvae of
Physaloptera sp. in a quail (Colinus virginianus). Avian Dis 11:
4144
Dunham NR, Peper ST, Downing C, Brake E, Rollins D, Kendall RJ
(2017) Infection levels of the eyeworm Oxyspirura petrowi and
caecal worm Aulonocephalus pennula in the northern bobwhite
and scaled quail from the Rolling Plains of Texas. J Helminthol
91:569577
Engelbrecht F, Oettl T, Herter U, Link C, Philipp D, Edeghere H, Kaliraj
P, Enwezor F (2003) Analysis of Wuchereria bancrofti infections in
a village community in northern Nigeria: increased prevalence in
individuals infected with Onchocerca volvulus. Parasitol Int 52:
1320
Faulkner H, Turner J, Behnke J, Kamgno J, Rowlinson MC, Bradley JE,
Boussinesq M (2005) Associations between filarial and gastrointes-
tinal nematodes. Trans R Soc Trop Med Hyg 99:301312
Fernando RJ, Fernando SSE, Leong ASY (2001) Tropical infectious
diseases: epidemiology, investigation, diagnosis and management.
Cambridge University Press
Genchi C, Kramer LH, Rivasi F (2011) Dirofilarial infections in Europe.
Vector-Borne Zoonotic Dis 11:13071317. https://doi.org/10.1089/
vbz.2010.0247
Goldberg SR, Bursey CR (1989) Physaloptera retusa (Nematoda,
Physalopteridae) in naturally infected sagebrush lizards,
Sceloporus graciosus (Iguanidae). J Wildl Dis 25:425429
González CE, Hamann MI (2012) First report of nematode parasites of
Physalaemus albonotatus (Steindachner, 1864) (Anura: Leiuperidae)
from Corrientes, Argentina. Neotrop Helminthol 6:923
Henry C, Brym MZ, Kendall RJ (2017) Oxyspirura petrowi and
Aulonocephalus pennula infection in wild northern bobwhite quail
in the Rolling Plains Ecoregion, Texas: possible evidence of a die-
off. Arch Parasitol 1:2
Henry C, Brym MZ, Kalyanasundaram A, Kendall RJ (2018) Molecular
identification of potential intermediate hosts of Aulonocephalus
pennula from the order Orthoptera. J Helminthol:16
Jackson AS (1969) Quail management handbook for West Texas Rolling
Plains. Bulletin Number 48. Texas Parks and Wildlife Department,
Austin
Johnson JL, Rollins D, Reyna KS (2012) Whats a quail worth? A lon-
gitudinal assessment of quail hunter demographics, attitudes, and
spending habits in Texas. Proc Natl Quail Symp 7:294299
Kalyanasundaram A, Blanchard KR, Kendall RJ (2017) Molecular iden-
tification and characterization of partial COX1 gene from caecal
worm (Aulonocephalus pennula) in northern bobwhite (Colinus
virginianus) from the Rolling Plains Ecoregion of Texas. Int J
Parasitol Parasites Wildl 6:195201
Kozak M, Wędrychowicz H (2010) The performance of a PCR assay for
field studies on the prevalence of Fasciola hepatica infection in
Galba truncatula intermediate host snails. Vet Parasitol 168:2530
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,
McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R,
Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and
Clustal X version 2.0. Bioinformatics 23:29472948
Lello J, Boag B, Hudson PJ (2005) The effect of single and concomitant
pathogen infections on condition and fecundity of the wild rabbit
(Oryctolagus cuniculus). Int J Parasitol 35:15091515
Mboera LE, Senkoro KP, Rumisha SF, Mayala BK, Shayo EH, Mlozi
MR (2011) Plasmodium falciparum and helminth coinfections
among schoolchildren in relation to agro-ecosystems in Mvomero
District, Tanzania. Acta Trop 120:95102
Mohamadain HS, Ammar KN (2012) Redescription of Physaloptera
praeputialis von Linstow, 1889 (Nematoda: Spirurida) infecting
stray cats (Felis catus Linnaeus, 1758) inQena, Egypt andoverview
of the genus taxonomy. J Egypt Soc Parasitol 42:675690
Morand S, Harvey PH (2000) Mammalian metabolism, longevity and
parasite species richness. Proc R Soc Lond B Biol Sci 267:
19992003
Morgan BB (1941) A summary of the Physalopterinae (Nematoda) of
North America. Proc Helminthol Soc Wash 8:2830
Mukherjee S, Mukherjee N, Saini P, Gayen P, Roy P, Babu SPS (2014)
Molecular evidence on the occurrence of co-infection with Pichia
guilliermondii and Wuchereria bancrofti in two filarial endemic dis-
tricts of India. Infect Dis Poverty 3:13
Naem S, Asadi R (2013) Ultrastructural characterization of male and
female Physaloptera rara (Spirurida: Physalopteridae): feline stom-
ach worms. Parasitol Res 112:19831990
Naem S, Abbass Farshid A, Tanhai Marand V (2006) Pathological find-
ings on natural infection with Physaloptera praeputialis in cats.
Veterinarski Arhiv 76:315321
Nicolaides NJ, Musgrave J, McGuckin D, Moorhouse DE (1977)
Nematode larvae (Spirurida: Physalopteridae) causing infarction of
the bowel in an infant. Pathology 9:129135
Pence DB, Meinzer WP (1979) Helminth parasitism in the coyote, Canis
latrans, from the Rolling Plains of Texas. Int J Parasitol 9:339344
Peterson MJ (2007) Diseases and parasites of Texas quails. In: Brennan
LA (ed) Texas quails: ecology and management. Texas A&M
University Press, College Station, pp 89114
Petri LH, Ameel DJ (1950) Studies on the life cycle of Physaloptera rara
Hall and Wigdor, 1918, and Physaloptera praeputialis Linstow,
1889. J Parasitol 36:40
Poppert S, Hodapp M, Krueger A, Hegasy G, Niesen WD, Kern WV,
Tannich E (2009) Dirofilaria repens infection and concomitant me-
ningoencephalitis. Emerg Infect Dis 15:18441846
Prosser SW, Velarde-Aguilar MG, Leon-Regagnon V, Hebert PD (2013)
Advancing nematode barcoding: a primer cocktail for the cyto-
chrome c oxidase subunit I gene from vertebrate parasitic nema-
todes. Mol Ecol Resour 13:11081115
Parasitol Res
Rietveld E, Vetter JCM, Stilma JS (1987) Concurrent parasitic infections
among patients with onchocerciasis and controls in Sierra Leone,
West Africa. Doc Ophthalmol 67:2532
Sałamatin R, Pavlikovska T, Sagach O, Nikolayenko S, Kornyushin V,
Kharchenko V, Masny A, Cielecka D, Konieczna-Sałamatin J, Conn
D, Golab E (2013) Human dirofilariasis due to Dirofilaria repens in
Ukraine, an emergent zoonosis: epidemiological report of 1465
cases. Acta Parasitol 58:592598
Schell S (1952) Studies on the life cycle of Physaloptera hispida Schell
(Nematoda: Spiruroidea) a parasite of the cotton rat (Sigmodon
hispidus littoralis Chapman). J Parasitol 38:462447
Schmidt GD, Roberts LS (2009) Foundations of parasitology, 8th edn.
McGraw Hill, New York
Schrader C, Schielke A, Ellerbroek L, Johne R (2012) PCR inhibi-
torsoccurrence, properties and removal. J Appl Microbiol 113:
10141026
Soulsby EJL (1965) Textbook of veterinary clinical parasitology, volume
1: helminths. Blackwell, Oxford
Taton-Allen G, Cheney J (2001) Gastrointestinal parasites. In: Lappin
MR (ed) Feline internal medicine secrets. Hanley & Belfus, Inc,
Philadelphia, pp 8595
Telfer S, Lambin X, Birtles R, Beldomenico P, Burthe S, Paterson S,
Begon M (2010) Species interactions in a parasite community drive
infection risk in a wildlife population. Sci 330:243246
Telford SR Jr (1970) A comparative studyof endoparasitism amongsome
southern California lizard populations. Am Midl Nat 83:516554
Velikanov VP, Sharpillo VP (2002) Experimental indentification of
Physaloptera praeputialis, p 2529
Wanji S, Tendongfor N, Esum M, Ndindeng S, Enyong P (2003)
Epidemiology of concomitant infections due to Loa loa,
Mansonella perstans,andOnchocerca volvulus in rain forest vil-
lages of Cameroon. Med Microbiol Immunol 192:1521
Widmer EA (1970) Development of third-stage Physaloptera larvae
from Crotalus viridis rafinesque, 1818 in cats with notes on
pathology of the larvae in the reptile. (Nematoda, Spiruroidea).
J Wildl Dis 6:8993
Parasitol Res
... The felines get infected by ingesting food harbouring Physaloptera larvae. Their life cycle involves a variety of arthropod intermediate hosts, including beetles, cockroaches, grasshoppers and crickets, as intermediate hosts (Hobmaier 1941;Petri and Ameel 1950;Goldberg and Bursey 2002) with reptiles, rodents, amphibians and birds as paratenic hosts (Widmer 1970;Cawthorn and Anderson 1976;Velikanov and Sharpillo 2002;Kalyanasundaram et al. 2018). In the definitive host, the adult worms get firmly attached to the stomach wall and cause catarrhal gastritis, gastrointestinal disorders, erosion of the mucosa and vomition (Soulsby 1982;Naem and Asadi 2013;Panti-May et al. 2015). ...
... Subsequently, Physaloptera species-specific forward and reverse primers (Phy F/R) ( Table 1) were used for amplification of partial COX1 as per the protocol described by Kalyanasundaram et al. (2018) with minor modifications. In brief, PCR cycle was performed at 94°C (initial denaturation) for 3 min, followed by 32 cycles of three steps of 1 min at 94°C (denaturation), 1 min at 47°C (annealing) and 45 s at 72°C (extension), with a final elongation of 7 min at 72°C. ...
... were positioned in the same cluster supported by moderate to strong bootstrap value, further confirming the identification of P. praeputialis in stray cats. Our results corroborate with the findings of earlier workers in relation to phylogenetic position of physalopterids among other related nematodes (Kalyanasundaram et al. 2018;Maldonado Jr. et al. 2019). ...
Article
Full-text available
Nematodes of the genus Physaloptera are globally distributed and infect a multitude of hosts. Their life cycle involves orthopterans and coleopterans as intermediate hosts. The morphological characters alone are inadequate to detect and differentiate Physaloptera spp. from its congeners. Moreover, molecular studies are limited to compare them precisely. The present communication reports the first molecular phylogenetic characterization of feline Physaloptera spp. from India based on mitochondrial cytochrome c oxidase subunit 1 (COX1) and small subunit ribosomal DNA (18S rDNA). The nematodes were first isolated from the stomach of adult stray cats during necropsy examination. Based on the gross and microscopic characters, the worms were identified as P. praeputialis. Morphological identification was further confirmed through PCR targeting the barcode region of the mitochondrial cytochrome c oxidase subunit I (MT-COI) gene, using nematode-specific primers cocktail followed by species specific primers targeting partial COX1 and 18S rRNA genes. Generated sequences were submitted in NCBI GenBank (MW517846, MW410927, MW411349), and phylogenetic trees were constructed using the maximum likelihood method. When compared with other sequences of Physaloptera species across the globe, the present isolates showed 85.6–97.7% and 97.3–99% nucleotide homology based on COX1 and 18S rRNA gene, respectively. BLASTn analysis revealed a strong identity to other Physaloptera spp., and the phylogenetic tree placed all Physaloptera spp. in the same cluster. This study again indicates the usefulness of molecular techniques to substantiate the identity of species that may lack adequate descriptions and impart new insight for the potentially overlooked significance of P. praeputialis infections in felines.
... Physaloptera is a genus of nematodes found in the stomachs and occasionally in the duodenum of cats and dogs, as well as a wide range of other mammals, birds and reptiles worldwide [5][6][7]. In North America, these parasites have been described in dogs, coyotes, raccoons, wolves, foxes, cats, bobcats, and, recently, in a bobwhite quail [5,6]. ...
... Physaloptera is a genus of nematodes found in the stomachs and occasionally in the duodenum of cats and dogs, as well as a wide range of other mammals, birds and reptiles worldwide [5][6][7]. In North America, these parasites have been described in dogs, coyotes, raccoons, wolves, foxes, cats, bobcats, and, recently, in a bobwhite quail [5,6]. These gastrointestinal parasites are transmitted via an indirect life cycle and utilize a variety of arthropod intermediate hosts, including flour beetles, cockroaches, and crickets [1,6]. ...
... Cats may become infected after feeding on intermediate hosts infected by Physaloptera spp. larvae or by predation of paratenic hosts, such as mice, that have previously fed on an intermediate host [1,5]. Adult worms measure 1-6 cm depending on species, and the prepatent period is 8-10 weeks [8]. ...
Article
Full-text available
Here we describe an unusual and severe mixed parasitic infection in a cat that died during routine surgery. Gastric Physaloptera sp., cardiac Dirofilaria immitis, and intestinal Toxocara cati, Dipylidium caninum, Ancylostoma sp. and Taenia taeniaeformis were observed. Histologic lesions included chronic proliferative pulmonary endarteritis, mild increase of mucosal intestinal white cells, and terminal aspiration of gastric content. The severe dirofilariasis may have contributed to this patient death during anesthesia.
... In addition, the extremely lower prevalence of the Acanthocephalan Oncicola canis in stray cats in the present investigation has also been reported by Magda (1995) and Adams (2003). It is worth mentioning that none of the (Kalyanasundaram et al., 2018). ...
Article
Full-text available
The present investigation was conducted to determine the incidence of internal parasites and their related pathological and haematological changes in stray cats in Khartoum North area, Sudan. A total of 50 cats of different sex and age were captured from the back yards of restaurants, hotels, hospitals and streets of residential areas in different parts of the town. They were all examined for the presence of internal parasites by faecal examination and by direct recovery of worms from the gastrointestinal tract at necropsy. The results revealed the presence of two species of cestode parasites namely Joyeuxiella spp and Diplopylidium spp with a prevalence rate of 60% and. 30% respectively. In addition, there was one nematode species Physaloptera praeputialis (34%;), one Acanthocephala Onicola canis (4%) and three species of protozoan parasites including Toxoplasma gondii/ Hammondia hommondi (56.3%), Cryptosporidium spp (3.1%) and Cystoisospora rivolta and Cystoisospora felis (34.4% and 6.3%, respectively). No significant macroscopic lesions were associated with the presence of these parasites in the gastrointestinal tract of stray cats. However, microscopic evidence of subacute or chronic gastritis, focal erosions and deep ulcerations of the gastric mucosa were observed in stray cats infected with the nematode parasite Physaloptera praeputialis. In addition, American Journal of Research Communication www.usa-journals.com Mohamed, et al., 2021: Vol 9(5) 14 subacute and chronic catarrhal enteritis were further observed with the presence of Diplopylidium spp, Joyeuxiella spp and Oncicola canis. Fragments of cestode parasites were detected in the lumen of the small intestine. No significant changes in haematological parameters including haemoglobin (Hb) concentration, packed cell volume (PCV) and total white cell count (WBCs) in stray cats harbouring the above mentioned parasites.
... Two helminths, eyeworm Oxyspirura petrowi and caecal worm Aulonocephalus pennula, have been demonstrated to have high prevalence of 66% and 91%, respectively, in wild bobwhite in the Rolling Plains ecoregion of Texas [12]. A number of studies have been published in relation to prevalence and diagnostic techniques of these parasitic infections in wild bobwhite [13][14][15][16][17]. However, the available knowledge on host parasite interaction in this species is limited due to very few studies having utilized histological or proteomic approaches to assess the host response to these parasites [12,18]. ...
Article
Full-text available
Many recent studies have been focused on prevalence and impact of two helminth parasites, eyeworm Oxyspirura petrowi and caecal worm Aulonocephalus pennula, in the northern bobwhite quail (Colinus virginianus). However, few studies have attempted to examine the effect of these parasites on the bobwhite immune system. This is likely due to the lack of proper reference genes for relative gene expression studies. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme that is often utilized as a reference gene, and in this preliminary study, we evaluated the similarity of bobwhite GAPDH to GAPDH in other avian species to evaluate its potential as a reference gene in bobwhite. GAPDH was identified in the bobwhite full genome sequence and multiple sets of PCR primers were designed to generate overlapping PCR products. These products were then sequenced and then aligned to generate the sequence for the full-length open reading frame (ORF) of bobwhite GAPDH. Utilizing this sequence, phylogenetic analyses and comparative analysis of the exon–intron pattern were conducted that revealed high similarity of GAPDH encoding sequences among bobwhite and other Galliformes. Additionally, This ORF sequence was also used to predict the encoded protein and its three-dimensional structure which like the phylogenetic analyses reveal that bobwhite GAPDH is similar to GAPDH in other Galliformes. Finally, GAPDH qPCR primers were designed, standardized, and tested with bobwhite both uninfected and infected with O. petrowi, and this preliminary test showed no statistical difference in expression of GAPDH between the two groups. These analyses are the first to investigate GAPDH in bobwhite. These efforts in phylogeny, sequence analysis, and protein structure suggest that there is > 97% conservation of GADPH among Galliformes. Furthermore, the results of these in silico tests and the preliminary qPCR indicate that GAPDH is a prospective candidate for use in gene expression analyses in bobwhite.
... Towards the end of the hunting season, hunters began reporting fewer coveys and more feather piles indicating predation that coincided with consistently elevated parasites burdens . Moreover, Kalyanasundaram et al. (2018b) documented an increase in Physaloptera sp. In bobwhite infected with A. pennula and O. petrowi, leading them to postulate that bobwhite with high levels of these parasites may be more susceptible to co-infection with other helminths. ...
Article
Full-text available
The potential of parasites to affect host abundance has been a topic of heated contention within the scientific community for some time, with many maintaining that issues such as habitat loss are more important in regulating wildlife populations than diseases. This is in part due to the difficulty in detecting and quantifying the consequences of disease, such as parasitic infection, within wild systems. An example of this is found in the Northern bobwhite quail (Colinus virginanus), an iconic game bird that is one of the most extensively studied vertebrates on the planet. Yet, despite countless volumes dedicated to the study and management of this bird, bobwhite continue to disappear from fields, forest margins, and grasslands across the United States in what some have referred to as “our greatest wildlife tragedy”. Here, we will discuss the history of disease and wildlife conservation, some of the challenges wildlife disease studies face in the ever-changing world, and how a “weight of evidence” approach has been invaluable to evaluating the impact of parasites on bobwhite in the Rolling Plains of Texas. Through this, we highlight the potential of using “weight of the evidence” to better understand the complex effects of diseases on wildlife and urge a greater consideration of the importance of disease in wildlife conservation.
... The description of new species from the genus Physaloptera as well as the recording of new hosts has quickly evolved over the last decade [30][31][32][33][34][35][36][37]. However, there is a lack of additional data on the epidemiology, life cycle, clinical signs, and description of larval stages in intermediate hosts, which impedes progress in the understanding of these parasites. ...
Article
Full-text available
Abbreviata caucasica (syn. Physaloptera mordens) has been reported in human and various non-human primates including great apes. The identification of this nematode is seldom performed and relies on egg characterization at the coproscopy, in the absence of any molecular tool. Following the recovery of two adult females of A. caucasica from the feces of wild Senegalese chimpanzees, morphometric characteristics were reported and new data on the width of the esophagus (0.268-0.287 mm) and on the cuticle structure (0.70-0.122 mm) were provided. The molecular characterization of a set of mitochondrial (cox1, 16S rRNA, 12S rRNA) and nuclear (18S rRNA and ITS2) partial genes was performed. Our phylogenetic analysis indicates for the first time that A. caucasica is monophyletic with Physaloptera species. A novel molecular tool was developed for the routine diagnosis of A. caucasica and the surveillance of Nematoda infestations. An A. caucasica-specific qPCR targeting the 12S gene was assessed. The assay was able to detect up to 1.13 × 10 −3 eggs/g of fecal matter irrespective of its consistency, with an efficiency of 101.8% and a perfect adjustment (R 2 = 0.99). The infection rate by A. caucasica in the chimpanzee fecal samples was 52.08%. Only 6.19% of the environmental samples were positive for nematode DNA and any for A. caucasica. Our findings indicate the need for further studies to clarify the epidemiology, circulation, life cycle, and possible pathological effects of this infestation using the molecular tool herein developed.
Thesis
Full-text available
Fighting against vector-borne diseases (VBD) relies essentially on the control of three main links: (i) the pathogen itself, (ii) the hosts (vectors and definitive hosts) and (iii) their interactions within their ecosystem. The present thesis inductively studies, on the one hand, the paradigm controls of VBD (mainly helminthiasis) of animals and on the other hand the role of sentinel animals in the transmission of VBD. We have studied the bacteria of the genus Wolbachia, an arthropod and filarial associated-endosymbiotic, often used for the control of VBD. The cell coculture system using Drosophila S2 cells allowed us to characterise the genome of Wolbachia massiliensis sp. nov. (wChem), a type strain of a new supergroup T. The bacteria were isolated from Cimex hemipterus collected in Senegal. The taxo-genomic study made it possible to distinguish clearly this new species from all other Wolbachia, as well as the need to review the taxonomy of this bacterial genus. Analysis of the W. massiliensis genome and its metabolic pathways show a profile close to that of the mutualistic Wolbachia of the human lymphatic filaria (Brugia malayi), which offers a new insight for deepening our knowledge of this symbiotic relationship. On the other hand, the involvement of Wolbachia as a molecular target for the diagnosis of canine filariasis has improved the detection of the occult form of these infections. However, we have proposed new molecular diagnosis approach based primarily on TaqMan® technology, combining multiple detection by qPCR, both of filaria as well as their Wolbachia. The main target species are those found in the Mediterranean basin, namely Dirofilaria immitis, D. repens, Acanthocheilonema reconditum, Cercopithifilaria grassii, C. bainae and Cercopithifilaria sp. II. In the second part of the present work, we characterized molecularly and/or morphologically nematodes of non-human primates (PNHs) from both the New and the Old World. Our results show that at least eleven species of gastrointestinal nematodes, often with zoonotic concern, have been characterized from faeces of African PNHs. Among them, Abbreviata caucasica, a parasite for which we have provided morphological data and a new specific molecular tool for its diagnosis and epidemiological surveillance. We also provided preliminary data on previously unidentified filarial parasites in neotropics monkeys (howler monkeys) of French Guiana, where at least three genotypes were identified. One of them belongs to the genus Brugia, a potential zoonosis. In addition, we have proposed a molecular detection system (qPCR) specific to this genus, in order to better diagnose, monitor and understand the life cycle of this parasite. In terms of protection against canine vector-borne diseases (CVBD), we evaluated in the field, the effectiveness of the multimodal monthly prophylactic strategy, based on the use of two products (Vectra® 3D associated with Milbactor®) against dirofilarioses, leishmaniasis (LCan) and ehrlichiosis. We therefore assessed the efficacy of artesunate in the treatment of LCan using a non-inferiority trial. In the context of biological pest control, an amine produced by the bacterial strain Serratia marcescens P400 has been partially characterized, which has been proven an insecticidal effect higher than that of ivermectin in keeling Aedes albopictus larvae. A natural infection of ticks with by parasite entomophagus wasps has also been detected. These data may offer an excellent alternative for biological control of these vectors. Finally, we demonstrated the role played by sentinel animals in the transmission and spread of VBD. Thus, the canine host, particularly dogs in Guyana, in metropolitan France, in Algeria and in Côte d'Ivoire, have a sentinel role for the maintenance and spread of BVD (dirofilariosis, leishmaniosis and trypanosomiasis). We also demonstrated the sentinel role in Italy for Rickettsiales played by reptiles. Moreover gorillas, in the Republic of Congo, have a sentinel role for gastrointestinal zoonoses (Giardia lamblia, Necator americanus, Ascaris lumbricoides, Strongyloides stercoralis and several unidentified nematodes). Finally, my thesis shows it is useful to develop and adapt new strategies for the control and surveillance of vector-borne diseases. I modestly contribute to make up for the lack of implementation of efficient techniques and knowledge in the perspective of a complete paradigm for the study of VBD in their ecosystem.
Article
Full-text available
Northern bobwhite quail (Colinus virginianus) are a highly sought-after game bird in the Rolling Plains of West Texas. Unfortunately, bobwhite populations in this area are subject to dramatic fluctuations and have been steadily decreasing over the past several decades. While many factors have been investigated as potential mechanisms of cyclic and declining bobwhite numbers, the effect of parasites on bobwhite populations has historically been undervalued. Between December 2017 and February 2018, we received 21 hunter-shot bobwhite from Garza and Mitchell counties in Texas and found peak caecal worm (Aulonocephalus pennula) and eyeworm (Oxyspirura petrowi) burdens averaging 599 and 44, respectively. These represent the highest average parasite loads we have documented in bobwhite from the Rolling Plains thus far and are coincident with widespread reports of declining bobwhite abundance. These elevated infections also followed a high point in bobwhite populations in the Rolling Plains, and our observations of infection dynamics during this time reflect other instances of potential parasite-induced host mortality. While the sample discussed in this communication is small, our findings highlight the need for additional research into how parasites may affect bobwhite population fluctuations in this region.
Article
Full-text available
Aulonocephalus pennula is a heteroxenous nematode that commonly infects a declining game bird, the northern bobwhite quail ( Colinus virginianus ). There is a lack of information on the life cycle of A. pennula and the potential effects of infection on bobwhites. In order to better understand the life cycle of this parasite, various species from the order Orthoptera were collected from a field site in Mitchell County, Texas. Using polymerase chain reaction (PCR), nine potential intermediate hosts were identified from the 35 orthopteran species collected. Later, ten live specimens were collected to identify larvae within the potential intermediate hosts. Larvae were present in three of these and were sent for sequencing. Similarly, the presence of larvae was confirmed from extra tissues of samples identified as positive with PCR. This was the first study to document potential intermediate hosts, but future studies are needed to confirm that these species are capable of transmitting infection to bobwhite. However, this study demonstrates that PCR has increased sensitivity and may be a valuable tool when determining intermediate hosts.
Article
Full-text available
To determine potential intermediate hosts of Oxyspirura petrowi, a common nematode eyeworm of wild gallinaceous birds, various arthropod species including red harvester ants, beetles, wood cockroaches, crickets, grasshoppers, katydids, and desert termites were screened for the presence of O. petrowi using specific polymerase chain reaction (PCR) primers targeting the internal transcribed spacer 2 region (ITS2) of the eyeworm ribosomal deoxyribonucleic acid (rDNA). This is the first study to investigate the intermediate hosts of O. petrowi utilizing molecular techniques. We determined 38% (13/34) of the cockroaches, 27% (3/11) of the crickets, and 23% (68/289) of the grasshoppers which were positive for O. petrowi. Identifying potential intermediate hosts of O. petrowi is essential to better understanding the epizoology of the eyeworm's transmission mechanics and to controlling infections in wild gallinaceous birds.
Article
Full-text available
There are concerns regarding population declines of northern bobwhite (Colinus virginianus) over the past 4 decades (Palmer et al. 2011). Infectious and noninfectious diseases are among the limiting factors that potentially influence bobwhite demographics (Applegate 2014). The last update of diseases of bobwhite was presented at the Second National Quail Symposium in 1982 (Davidson et al. 1982). Since that report, scientists at the Southeastern Cooperative Wildlife Disease Study (SCWDS) have examined 133 wild bobwhites from 13 states. The SCWDS is a cooperative between states and the University of Georgia and obtains cases from the cooperating states. In this update, we focus on the diagnostic testing results from wild birds and exclude other cases that were examined during this period. We searched the SCWDS database for all bobwhite cases 1985-2016 and examined the individual case reports for 133 wild bobwhite quail. During this period, the majority of cases originated from Florida, Georgia, and Kansas, where research was being conducted on bobwhite populations. A diagnosis could not be clearly identified in all cases and some otherwise healthy bobwhites were submitted for screening; therefore, we have narrowed the focus of this report to a subset of 78 bobwhites. Wild bobwhites that were submitted by SCWDS state cooperators had an approximately even distribution between male and female birds (26 F: 19 M; 2 unknown sex). Adults (20 F, 10 M) predominated over juvenile birds (6 F, 7 M, 2 unknown sex). Trauma (physical injury) was the diagnosis in 17 female and 38 male bobwhites submitted during this period. Three each of male and female birds were considered to have no health problems. Some of the most frequent findings in diagnosed bobwhites were possible Physaloptera sp. infection (n ¼ 9, 17.0%), avian pox (n ¼ 7, 14.9%), intoxication (lead and carbamate; n ¼ 5, 10.6%), corneal opacity (n ¼ 4, 8.5%), Sarcocystis sp. infection (n ¼ 3, 6.4%), and fungal pneumonia (n ¼ 2, 4.25%). Some parasitic infections (e.g., coccidiosis) were thought to be associated with mortality based on necropsy and laboratory findings while a number of the parasites were determined to be incidental findings (e.g., Sarcocystis and Physaloptera) based on necropsy and laboratory findings. Corneal opacity was found in 4 birds, but the cause was not determined. The most striking findings were that trauma (e.g., physical injury) or avian pox were among the most common causes of mortality in free-ranging quail. Iatrogenic (researcher) causes of mortality (n ¼ 5, 10.6%) associated with complications from radiotransmitters and small mammal trapping also occurred. This latter urges careful consideration among bobwhite researchers. The cause of population declines in bobwhites are likely multifactorial. We hope that morbidity and mortality investigations can provide some insight into potential limiting factors for bobwhites and assist wildlife managers with population management decisions.
Article
Full-text available
We have been monitoring wild Northern bobwhite quail (Colinus virginianus) on a research transect in Mitchell County, Texas. We captured a total of 51 bobwhites in March-May of 2016 and 2017 and examined them for eyeworm (Oxyspirura petrowi) and caecal worm (Aulonocephalus pennula) infections. In March 2017, bobwhites averaged 15 ± 10 eyeworms and 269 ± 90 caecal worms, and by mid-April averages had increased to 18 ± 13 eyeworms and 372 ± 144 caecal worms. These averages were much higher than those observed in March 2016 (11 ± 13 eyeworms and 160 ± 57 caecal worms) and April 2016 (12 ± 12 and 216 ± 56, respectively). We observed a precipitous decline in quail numbers by late April 2017, and average infection had dropped to 7 ± 2 eyeworms and 252 ± 109 caecal worms. The number of trapping sessions needed to capture one bobwhite also increased from 14.26 in 2016 to 36.46 in 2017. These observations warrant further investigation into the effects these helminth parasites may have on bobwhites and their populations within the Rolling Plains.
Article
Full-text available
Aulonocephalus pennula is a nematode living in the caeca of the wild Northern bobwhite quail (Colinus virginianus) present throughout the Rolling Plains Ecoregion of Texas. The cytochrome oxidase 1 (COX 1) gene of the mitochondrial genome was used to screen A. pennula in wild quail. Through BLAST analysis, similarity of A. pennula to other nematode parasites was compared at the nucleotide level. Phylogenetic analysis of A. pennula COX1 indicated relationships to Subuluridae, Ascarididae, and Anisakidae. This study on molecular characterization of A. pennula provides new insight for the diagnosis of caecal worm infections of quail in the Rolling plains Ecoregion of Texas.
Article
Full-text available
Northern bobwhite (Colinus virginianus) and scaled quail (Callipepla squamata) have experienced chronic declines within the Rolling Plains ecoregion of Texas. Parasitic infection, which has long been dismissed as a problem in quail, has not been studied thoroughly until recently. A total of 219 northern bobwhite and 101 scaled quail from Mitchell County, Texas were captured and donated from 2014-2015, and examined for eyeworm (Oxyspirura petrowi) and caecal worm (Aulonocephalus pennula) infections. In 2014, bobwhites averaged 19.6±1.8 eyeworms and 98.6±8.2 caecal worms and 23.5±2.1 eyeworms and 129.9±10.7 caecal worms in 2015. Scaled quail averaged 4.8±1.0 eyeworms and 50±6.8 caecal worms in 2014 and 5.7±1.3 eyeworms and 38.1±7.1 caecal worms in 2015. This study expands the knowledge of parasitic infection in quail inhabiting the Rolling Plains of Texas. A significant difference was documented in O. petrowi infection between species but there was no significant difference in A. pennula between quail species. No significant difference was detected in parasite infection between the sexes of both northern bobwhite and scaled quail. This study also documented the highest reported O. petrowi infection in both species of quail. Additional research is needed on the life history and infection dynamics of O. petrowi and A. pennula infections to determine if there are individual and/or population level implications due to parasitic infection. .
Article
Concomitant infections are common in nature and often involve parasites. A number of examples of the interactions between protozoa and viruses, protozoa and bacteria, protozoa and other protozoa, protozoa and helminths, helminths and viruses, helminths and bacteria, and helminths and other helminths are described. In mixed infections the burden of one or both the infectious agents may be increased, one or both may be suppressed or one may be increased and the other suppressed. It is now possible to explain many of these interactions in terms of the effects parasites have on the immune system, particularly parasite-induced immunodepression, and the effects of cytokines controlling polarization to the Th1 or Th2 arms of the immune response. In addition, parasites may be affected, directly or indirectly, by cytokines and other immune effector molecules and parasites may themselves produce factors that affect the cells of the immune system. Parasites are, therefore, affected when they themselves, or other organisms, interact with the immune response and, in particular, the cytokine network. The importance of such interactions is discussed in relation to clinical disease and the development and use of vaccines.