ArticlePDF Available

Extraction, identification and antioxidant property evaluation of limonin from pummelo seeds

Authors:

Abstract and Figures

Limonin, the main bioactive phytochemical constituent of limonoids with multi-functions, is enriched in citrus fruits and often found at a high concentration in citrus seeds. The present study was attempted to introduce a new and efficient extraction method to isolate limonoids from pummelo seeds, and to evaluate the antioxidant property of the main constituent limonin in HepG2 cells. Three key single factors were identified for the extraction of limonoids from pummelo seeds using the Box-Behnken experiment design of response surface methodology (RSM), and the optimized extraction parameters were treatment with 89.68 mL of anhydrous acetone for 4.62 h at 78.94 °C, while the yield of limonoids was 11.52 mg/g. The structure of isolated main constituent of the limonoids was further identified as limonin by Fourier transform infrared (FT-IR) spectrometer and nuclear magnetic resonance (NMR) spectrum. Moreover, the molecular data in HepG2 cells revealed that limonin exerted its anti-oxidant property mainly by the activation of nuclear factor (erythroid-2)-like 2 (Nrf2)/kelch-like ECH-associated protein 1 (Keap1)- antioxidant response element (ARE) pathway in the form of transcriptional regulation of Nrf2 mRNA and posttranscriptional regulation of Nrf2/Keap1 system. These results demonstrate that pummelo seeds are an ideal source of limonoids, and limonin is proved to exert its anti-oxidant property by the activation of Nrf2/Keap1 pathway. © 2018 Chinese Association of Animal Science and Veterinary Medicine
Content may be subject to copyright.
Original Research Article
Extraction, identication, and antioxidant property evaluation of
limonin from pummelo seeds
Si Qin
a
,
b
,
*
, Chenghao Lv
a
, Qingshan Wang
a
, Zhibing Zheng
a
,
b
, Xi Sun
a
, Minyi Tang
a
,
Fangming Deng
a
,
*
a
Key Laboratory for Food Science and Biotechnology of Hunan Province, College of Food Science and Technology, Hunan Agricultural University, Changsha
410128, China
b
Hunan Co-Innovation Center for Utilization of Botanical Functional Ingredients, Hunan Agricultural University, Changsha 410128, China
article info
Article history:
Received 31 March 2018
Received in revised form
28 April 2018
Accepted 16 May 2018
Available online 20 June 2018
Keywords:
Limonin
Extraction
Identication
Nrf2-ARE pathway
Antioxidant
abstract
Limonin, the main bioactive phytochemical constituent of limonoids with multi-functions, is enriched in
citrus fruits and often found at a high concentration in citrus seeds. The present study was attempted to
introduce a new and efcient extraction method to isolate limonoids from pummelo seeds, and to
evaluate the antioxidant property of the main constituent limonin in HepG2 cells. Three key single
factors were identied for the extraction of limonoids from pummelo seeds using the Box-Behnken
experiment design of response surface methodology (RSM), and the optimized extraction parameters
were treatment with 89.68 mL of anhydrous acetone for 4.62 h at 78.94
C, while the yield of limonoids
was 11.52 mg/g. The structure of isolated main constituent of the limonoids was further identied as
limonin by Fourier transform infrared (FT-IR) spectrometer and nuclear magnetic resonance (NMR)
spectrum. Moreover, the molecular data in HepG2 cells revealed that limonin exerted its anti-oxidant
property mainly by the activation of nuclear factor (erythroid-2)-like 2 (Nrf2)/kelch-like ECH-
associated protein 1 (Keap1)- antioxidant response element (ARE) pathway in the form of transcrip-
tional regulation of Nrf2 mRNA and posttranscriptional regulation of Nrf2/Keap1 system. These results
demonstrate that pummelo seeds are an ideal source of limonoids, and limonin is proved to exert its
anti-oxidant property by the activation of Nrf2/Keap1 pathway.
©2018, Chinese Association of Animal Science and Veterinary Medicine. Production and hosting
by Elsevier B.V. on behalf of KeAi Communications Co., Ltd. This is an open access article under the
CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction
Limonoids are a prominent group of secondary metabolites
found in the Rutaceae and Meliacea families and a group of highly
oxygenated triterpenoid compounds (Manners, 2007; Roy and
Saraf, 2006; Tian et al., 2001; Zhao et al., 2008). Many previous
studies had shown that limonoids exhibited a number of biological
and pharmacological activities, such as anti-cancer (Tian et al.,
2001; So et al., 1996), anti-obesity (Ono, 2011), anti-HIV
(Battinelli et al., 2003), anti-oxidant (Sun et al., 2005; Mandadi
et al., 2007), antiviral (Ribeiro et al., 2008), and cholesterol
lowering (Kurowska et al., 2000) properties. Extraction of limo-
noids by supercritical carbon dioxide (SC-CO
2
) was prevalent in the
limonoids extraction eld (Patil et al., 2006). Although organic
solvents was reduced, sophisticated devices and special expertise
were required. Meanwhile, the low yield of limonoids extracted by
the method restricted the development in the food industry.
Recently, ash extraction (Liu et al., 2012b) and hydrotropic
extraction (Dandekar et al., 2008) were reported for limonoids
extraction, but these methods are not mature enough to achieve
industrial requirements. Therefore, solvent extraction still remains
the main method of limonoids extraction at present (Jayaprakasha
et al., 2006; Liu et al., 2012; Mandadi et al., 2009; Melwita and Ju,
2010; Vikram et al., 2007). The pummelo is an important and
popular citrus species in terms of cultivation and consumption
*Corresponding authors.
E-mail addresses: qinsiman@hunau.edu.cn (S. Qin), 1059768225@qq.com
(F. Deng).
Peer review under responsibility of Chinese Association of Animal Science and
Veterinary Medicine.
Production and Hosting by Elsevier on behalf of KeAi
Contents lists available at ScienceDirect
Animal Nutrition
journal homepage: http://www.keaipublishing.com/en/journals/aninu/
https://doi.org/10.1016/j.aninu.2018.05.005
2405-6545/©2018, Chinese Association of Animal Science and Veterinary Medicine. Production and hosting by Elsevier B.V. on behalf of KeAi Communications Co., Ltd. This is
an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Animal Nutrition 4 (2018) 281e287
around the world. It belongs to the Rutaceae family and is a native
citrus species in Southern China. However, there is limited infor-
mation available in literature about the extraction of limonoids
from pummelo seeds. The development of new raw sources of
limonoids is a great help to satisfy the increasing demand for
limonoids, which is with potential health benets.
Accumulating data have shown that nuclear factor (erythroid-
2)-like 2 (Nrf2) can modulate the antioxidant or electrophile
response element (ARE/EpRE) and specic nucleotide sequences to
promote series of antioxidant genes (Wasserman and Fahl, 1997;
Venugopal and Jaiswal, 1996; Hayes and McMahon, 2001). Nu-
clear factor (erythroid-2)-like 2 is a member of the Cap ncollar
(CNC) family of bZIP proteins and has extensively been shown to be
a crucial activator of antioxidant response element (ARE)-mediated
gene expression, such as sulredoxin 1 (SRXN1), thioredoxin
reductase 1 (TXNRD1), NAD(P)H dehydrogenase quinone 1 (NQO1),
and glutathione reductase (GSR)(Malhotra et al., 2011; Chorley
et al., 2012; Hirotsu et al., 2012). Limonin is the most prevalent
member of limonoids, which has been reported to exhibit an
antioxidant property and induce the expressions of glutathione S-
transferase and quinone reductase (Sun et al., 2005; Jun et al.,
2005). However, the effect of limonin on Nrf2/Keap1-ARE
signaling pathway and the underlying mechanism remained
unclear.
In the present study, a simple and easy solvent extraction
method was used to extract limonin from pummelo seeds, and the
extraction parameters were optimized by using Box-Behnken
experiment design of the response surface methodology (RSM).
Moreover, the structure of the extracted limonin crystals was
further identied by Fourier transform infrared (FT-IR) and nuclear
magnetic resonance (NMR) spectrum. Finally, a liver cell model was
used to study the antioxidant property of limonin, associated with
its effect on Nrf2/Keap1-ARE signaling pathway.
2. Materials and methods
2.1. Raw material, chemicals, and cell culture
The pummelo fruits were purchased from a local farmers mar-
ket (Changsha, Hunan, China). Seeds were separated manually,
dried, and nely powdered. The limonin standard was purchased
from SigmaeAldrich (St. Louis, MO, USA). Other chemical reagents
used were of analytical grade. The HepG2 cells were purchased
from ATCC (VA, USA) and were cultured in Dulbecco's modied
Eagle's medium (DMEM) with 10% fetal bovine serum (FBS) plus
100 units of penicillin and streptomycin. The antibodies of anti-
Nrf2, anti-NQO1, anti-HO-1, anti-GAPDH, and anti-Keap1 were
procured from Santa Cruz Biotechnology Inc. (CA, USA). The sec-
ondary antibodies were purchased from Cell Signaling Technology
(Beverly, MA, USA).
2.2. Isolation and quantication of limonin
The pummelo seeds were milled by a drug pulverizer after
drying. Fat in the seeds powder (10.0 g) was removed using a
Soxhlet apparatus (Tianbo Corp., Tianjing, China) with 40 mL of
petroleum ether at 25
C for 10 h. The crude limonoids were then
extracted from the defatted seeds powder (2.5 g) with acetone at a
different time, solvent dosage, temperature, and pH value in a
single factor experiment. Limonin was obtained from the crude
limonoids on a silica gel column (Changcheng Corp., Zhengzhou,
China) with dichloromethane (CH
2
Cl
2
) and isopropanol. Thin layer
chromatography and chemistry color response were used for
qualitative and quantitative analyses of limonin.
2.3. Experiment design
Various operation parameters were investigated to extract
limonoids. The extraction of limonoids from pummelo seeds was
optimized by varying operating parameters according to
BoxeBehnkendesign(3
3
factorial). BoxeBehnken design is an
independent quadratic design in which the treatment combina-
tions are multiples of the edge of the process space and the center.
It is known that the extraction efciency mainly depends on sol-
vent dosage, time, pH, and temperature variations (Toshinao and
Hideaki, 2003). Based on the single factor experiment, 3 vari-
ables, namely solvent dosage, time, and temperature of extraction
were selected for each set of experiments while keeping the pH of
extraction (pH ¼7) constant throughout the experiments (data
not shown). The following 3 variables were selected for the
extraction process output, viz. solvent dosage (60, 80, and
120 mL), temperature (70, 80, and 85
C) and time of extraction (3,
4, and 6 h).
2.4. Identication of limonin
The infrared spectrum of limonin in the range of 4,000 to 400
per cm was analyzed by FT-IR (510-P, Nicolet Corp., USA) using KBr
wafers. Puried limonin was identied by
1
H- and
13
C- NMR
spectrometer (AC-80, BRURER Corp, Switzerland) and compared
with the limonin standard.
2.5. Total RNA extraction and real-time PCR
HepG2 (1 10
6
) cells were pre-cultured in dishes for 24 h and
then treated with various concentrations of the puried limonin
(>98%, mass/volume) obtained above in 0.1% dimethyl sulfoxide
(DMSO), or with 0.1% DMSO alone as a control, for 9 h. Total RNA was
extracted with an Isogen RNA Kit (Nippon Gene Co., Toyama, Japan)
as described in manufacturer's manual. All primers (5
0
to 3
0
) were
designed with the software PRIMER3 and were synthesized as fol-
lows: Nrf2, forward (AGACAAACATTCAAGCCGCT) and reverse
(CCATCTCTTGTTTGCTGCAG); HO-1, forward (CCAGCGGGCCAGCAA-
CAAAGTGC) and reverse (AAGCCTTCAGTGCCCACGGTAAGG); NQO1,
forward (AGTGCAGTGGTGTGATCTCG) and reverse (GGTGGAGT-
CACGCCTGTAAT); Keap1, forward (CCTTCAGCTACACCCTGGAG) and
reverse (AACATGGCCTTGAAGACAGG). Reverse transcription and
real-time PCR was performed with a DyNAmo SYBR Green 2-Step
qRT-PCR kit (Finnzymes Oy., Espoo, Finland) according to the man-
ufacturer's manual. Briey, RNA (200 ng) was reverse-transcribed to
cDNA using Oligo dT and M-MuLV RNase at 37
C for 30 min, and the
reaction was then terminated at 85
C for 5 min. The sequences of
PCR primers and other reaction conditions used in the present study
were described by Qin et al (2013). The result was represented by the
relative expression level normalized with control cells.
2.6. Immunoblot analysis
The HepG2 (3 10
6
) cells were pre-cultured in 100 mm dishes
for 24 h and treated with various concentrations of limonin for the
indicated periods. After that, the cells were lysed with modied
radioimmunoprecipitation assay buffer (RIPA buffer), and protein
quantication was performed by a protein assay kit (Bio-Rad Lab-
oratories, CA, USA) as describe by Qin et al, (2013). After harvest, the
whole-cell lysates were collected and treated by a normal protocol,
and the sample was run by sodium dodecyl sulfate-polyacrylamide
gel electrophoresis (SDS-PAGE) and electrophoretically transferred
to polyvinylidene uoride (PVDF) membrane (Amersham Phar-
macia Biotech). After blotting and antibodies incubation, the
membrane was detected using an ECL western blotting system (GE
S. Qin et al. / Animal Nutrition 4 (2018) 281e287282
ImageQuant LAS4000mini model, Fujilm, Tokyo, Japan) and the
relative amounts of specic proteins were quantied using Lumi
Vision Image software (TAITEC Co., Saitama, Japan).
2.7. Data analysis
The collected data were analyzed using RSM procedure by SAS
9.0 System for Windows. Data were expressed as means ±SD of at
least 3 independent experiments. Student's t-tests and Tukey's test
were performed to compare the means of 2 groups or selected data
sets, and P<0.05 was considered as signicant.
3. Results and discussion
3.1. Effect of the single factor on extraction yield
The pH value played a signicant role on limonoids yield. The
experiments were carried out in following conditions: 100 mL
acetone, 80
C, 4 h, and the pH of 4.0, 5.5, 7.0, 8.5, 10.0, and 12.0,
respectively (Fig. 1A). The extraction yield signicantly increased
with the pH value from 4.0 to 7.0. It reached the maximal 11.23 mg/g
at pH 7.0 and signicantly decreased beyond pH 7.0. It was only
0.69 mg/g at pH 12.0. The possible reason was that acidic and
alkaline conditions can lead to the decomposition of limonoids and
ringeopening reaction (Jitpukdeebodintra et al., 2005). Therefore,
the neutral condition (pH z7) was optimum for the extraction and
kept constant for all the subsequent experiments.
The solvent concentration was also an important variable. Seven
acetone concentrations (acetone:H
2
O; vol/vol; 80:0, 75:5, 70:10,
65:15, 60:20, 55:25) were chosen to test the effect of extraction
solvent concentration on limonoids yield (Fig. 1B). The total solvent
volume is 80 mL, and the experiments were conducted at 80
C, 4 h,
pH 7.0. The limonoids yield signicantly decreased with increasing
water content. The highest limonoids yield (10.90 mg/g) was ob-
tained with the use of anhydrous acetone. Therefore, anhydrous
acetone was chosen as the optimum extraction solvent.
3.2. Optimization of extraction parameters
After the initial study, the effects of the 3 key factors, which
were solvent dosage, extraction time and temperature, were opti-
mized using Box-Behnken experiment design of the RSM. The
conventional multifactor experiment is time-consuming and
ignores the combined interactions among physicochemical pa-
rameters, while the RSM can be employed as a useful approach to
implement optimal process conditions by performing a minimum
number of experiments. Box-Behnken experiment design is an
efcient and creative three-level composite design for tting
second-order response surfaces. A total of 15 experiments were
conducted to optimize the extraction conditions. Table 1 shows the
experimental design and corresponding yield data. The maximal
yield of 11.38 mg/g was produced at 80
C, 4 h and 80 mL. Response
surface methodology of the data shown in Table 1 demonstrates
that the relationship between limonin yield and extraction pa-
rameters was quadratic with very good regression coefcient
(R
2
¼0.989). The following equation shows the relationship:
Y¼125.1910 þ2.6958X
1
þ0.2930X
2
þ7.4845X
3
0.0164 X
12
0.000069X
1
X
2
0.00158X
22
0.02353X
1
X
3
0.00084X
2
X
3
0.6025X
32
, in which Yis the extraction yield, X
1
is the extraction
temperature, X
2
is the solvent dosage, and X
3
is the extraction time.
This equation demonstrated that limonoid yield depended more on
extraction time followed by extraction temperature, while solvent
dosage was the least effect on the extraction yield.
According to Table 1, the prediction model between the
extraction yield and the 3 key factors were produced and illustrated
in Fig. 2, which shows the relationship between the RSM generated
Table 1
Extraction of limonoids from pummelo seeds.
1
Run Temperature,
C Acetone, mL Time, h Yield, mg/g
1 70 60 4 8.48
2 70 120 4 8.59
3 85 60 4 9.29
4 85 120 4 9.50
5 80 60 3 8.74
6 80 60 6 9.07
7 80 120 3 8.51
8 80 120 6 8.81
9 70 80 3 8.18
10 85 80 3 9.54
11 70 80 6 9.24
12 85 80 6 9.50
13 80 80 4 11.00
14 80 80 4 11.38
15 80 80 4 11.23
1
Extraction solvent is anhydrous acetone; extraction pH is 7.0.
Fig. 1. Effect of extraction pH and solvent on the yield of limonoids.
S. Qin et al. / Animal Nutrition 4 (2018) 281e287 283
extraction yield, time, and acetone dosage. The extraction yield
increased with the extraction time and acetone dosage. Fig. 2B
demonstrates that the extraction yield of limonin sharply improved
with increasing extraction time and temperature. In Fig. 2C, it can
be seen that the extraction yield increased at rst and then
decreased with the increase of both temperature and acetone
dosage beyond the optimized extraction parameters. These be-
haviors can be explained by the fact that limonin can easily
decompose with the increase of extraction temperature, time and
solvent dosage beyond the optimized extraction parameters. By the
experimental data and RSM, the predicted maximum yield of
limonin was 11.58 mg/g, and the extraction parameters were
optimized at 78.94
C, 89.68 mL anhydrous acetone, and 4.62 h of
extraction time. In order to verify the credibility of the optimized
extraction parameters, we carried out another experiment using
the optimized extraction parameters, and we obtained the extrac-
tion yield of 11.52 mg/g, which is close to 11.58 mg/g mentioned
above. The results indicated that the optimized extraction param-
eters are credible. Comparing with the methods and results from
other previous studies, the limonoid concentration range in
pummelo seeds was only from 2.3 to 4.7 mg/g, by using solvent
extraction method and a novel process consisting of water extrac-
tion, ammonium sulfate precipitation and resin adsorption (Wang
et al., 2016; Yang et al, 2017). Therefore, the concentration of
limonin obtained from this study was much higher than those from
those studies.
3.3. Determination of limonin
Limonoids, including limonin, nomilin ichangin, and obacu-
none, are a group of highly oxygenated, tetracyclic triterpene sec-
ondary metabolites derivatives (Roy and Saraf, 2006). Limonin is
the most important bioactive limonoid. The purication of limonin
from limonoids is a universal and signicant process. The detailed
purication process is described in the materials and methods.
Fig. 3 shows the infrared (IR) spectra of the limonin sample and the
chemical structure of limonin. The IR spectra with potassium bro-
mide pressed-disk technique are exhibited (Fig. 3A). The charac-
teristic absorption peaks were:
b
-furan ring (2,966, 1,065 and
875 per cm),
d
-lactone (1,759 per cm), cyclic ether (1,285 per cm),
ketone (1,708 per cm), and methyl groups (1,365 and 1,165 per cm).
The results of the IR analysis were consistent with the chemical
structure of limonin.
To further determine the crystal,
1
H -NMR of the crystal was
performed. Fig. 4 shows
1
H NMR of the crystal sample and the
limonin standard. Table 2 lists the
1
H -NMR data. The main
Fig. 3. Infrared (IR) spectra data of the limonin sample (A) and the chemical structure of limonin (B).
Fig. 2. BoxeBehnke experiment result of optimal parameters for the extraction of
limonoid.
S. Qin et al. / Animal Nutrition 4 (2018) 281e287284
characteristic peaks list as follows: H-1 (
d
4.10), H-2a (
d
2.69), H-2b
(
d
2.97), H-15 (
d
4.04), H-17 (
d
5.47), H-19a (
d
4.78), H-19b (
d
4.45 to
4.47), H-21 (
d
7.27), H-22 (
d
6.34), H-23 (
d
7.40 to 7.42). Compared
with the limonin standard,
1
H -NMR spectrum (Fig. 4A) and data
(chemical shift
d
) of the crystal are in excellent agreement with the
standard ones (Fig. 4B). Meanwhile, the
1
H -NMR data are consis-
tent with the reference of (Breksa et al., 2008).
3.4. Antioxidant property assay in in vitro level
Indirect antioxidant property of phytochemical seems more
attractive than its direct reactive oxygen species (ROS) scavenging
ability, which was why we performed in vitro test by detecting the
expressions of mRNA and protein of typical biomarkers related to
Nrf2-ARE pathway in HepG2 cells. As shown in Fig. 5, limonin (5 to
10
m
mol/L) enhanced the transcription of Nrf2 and its downstream
genes HO-1 and NQO1, in a dose-dependent manner. Similarly,
limonin also stimulated the expressions of Nrf2,HO-1, and NQO1,
but had no effect on Keap1 expression. These results are in accor-
dance with the study of Chen et al (2017), in which limonin 7-
deacetylgedunin (7-DGD) was also reported to induce the expres-
sions of Nrf2 and HO-1, at a dose of 25
m
mol/L in RAW264.7 cells.
Thus, the results obtained here indicated that limonin could
Table 2
Proton nuclear magnetic resonance (
1
H NMR) data for the puried crystal, limonin
standard, and the reference.
1
Position Sample Standard Reference
1 4.03 4.03 4.03
2a 2.69 2.67 2.67
2b 2.97 2.97 2.98
6a 2.48 2.48 2.46
6b 2.86 2.85 2.85
9 2.54 2.54 2.55
11 1.802 1.77 to 1.89 1.72 to 1.95
12 1.68 1.50 to 1.53 1.46 to 1.58
15 4.04 4.04 4.05
17 5.47 5.47 5.47
18 1.18 1.18 1.18
19a 4.78 4.77 4.76
19b 4.45 to 4.47 4.45 to 4.48 4.46
21 7.27 7.26 7.4
22 6.34 6.34 6.34
23 7.40 to 7.42 7.40 to 7.41 7.41
24 1.07 1.07 1.08
25a 1.30 1.30 1.29
25b 1.17 1.18 1.18
1
Source: Breksa, Dragull and Wong (2008).
Fig. 4. Proton nuclear magnetic resonance (
1
H NMR) spectrum data (A) of the crystal obtained versus that of its corresponding standard (B).
S. Qin et al. / Animal Nutrition 4 (2018) 281e287 285
activate Nrf2-ARE pathway in both transcriptional and post-
transcriptional levels.
4. Conclusions
In conclusion, the present study demonstrated that pummelo
seeds are a potent source of limonoids. The extraction of limonoids
was optimized by using Box-Behnken experiment design of the
RSM. The highest yield of limonoids was 11.52 mg/g at 78.94
Cof
extraction temperature, 89.68 mL anhydrous acetone, and 4.62 h of
extraction time. The isolated limonin crystals were identied by the
FT-IR and
1
H -NMR spectrum. These results opened a new way to
improve the development of deep processing industry of pummelo
seeds. Moreover, the in vitro data obtained in HepG2 cells by
treatment of limonin revealed that pummelo seeds could be
deemed as a potential candidate for dietary source with potent
antioxidant property.
Conicts of interest
We declare that we have no nancial and personal relationships
with other people or organizations that can inappropriately inu-
ence our work; there is no professional or other personal interest of
any nature or kind in any product, service and company that could
be construed as inuencing the content of this paper.
Acknowledgment
This work was partially supported by Natural Science Founda-
tion of China (31101268) and Core Research Program 1515 of Hunan
Agricultural University of China to Si Qin.
References
Battinelli L, Mengoni F, Lichtner M, Mazzanti G, Saija A, Mastroianni CM, Vullo V.
Effect of limonin and nomilin on HIV-1 replication on infected human mono-
nuclear cells. Planta Med 2003;69(10):910e3.
Breksa AP, Dragull K, Wong RY. Isolation and identication of the rst C-17 limonin
epimer, epilimonin. J Agric Food Chem 2008;56(14):5595e8.
Chen JY, Zhu GY, Su XH, Wang R, Liu J, Liao K, et al. 7-deacetylgedunin suppresses
inammatory responses through activation of Keap1/Nrf2/HO-1 signaling.
Oncotarget 2017;8(33):55051e63.
Chorley BN, Campbell MR, Wang X, Karaca M, Sambandan D, Bangura F, et al.
Identication of novel NRF2-regulated genes by ChIP-Seq: inuence on retinoid
X receptor alpha. Nucleic Acids Res 2012;40(15):7416e29.
Dandekar DV, Jayaprakasha GK, Patil BS. Hydrotropic extraction of bioactive
limonin from sour orange (Citrus aurantium L. ) seeds. Food Chem
2008;109(3):515e20.
Hayes JD, McMahon M. Molecular basi s for the contr ibution of t he antioxidant
responsive element to cancer chemoprevention. Cancer Lett 2001;174:
103e13 .
Hirotsu Y, Katsuoka F, Funayama R, Nagashima T, Nishida Y, Nakayama K, et al. Nrf2-
MafG heterodimers contribute globally to antioxidant and metabolic networks.
Nucleic Acids Res 2012;40:10228e39.
Jayaprakasha GK, Brodbelt JS, Bhat NG, Patil BS. Methods for the separation of
limonoids from citrus. In: Patil BS, Turner ND, Miller EG, editors. Potential
health benets of citrusvol. 936; 2006. p. 34e51.
Jitpukdeebodintra S, Chantachum S, Ratanaphan A, Chantapromma K. Stability of
limonin from lime seeds. J Food Agric Environ 2005;3(2):99e10 0.
Jun Y, Limin W, Rosemary LW, Edward GM, Leonard MP, Bhimanagouda SP. Anti-
oxidant activity of citrus limonoids, avonoids, and coumarins. J Agric Food
Chem 2005;53:2009e14.
Kurowska EM, Manthey JA, Hasegawa S. Regulatory effects of tangeretin, a avonoid
from tangerines, and limonin, a limonoid from citrus,on apo B metabolism in
HepG2 cells. Faseb J 2000;14(4). A298eA298.
Liu C, Liu J, Rong YH, Liang NY, Rong L. Aqueous extraction of limonin from Citrus
reticulate Blanco. Czech J Food Sci 2012;30(4):364e8.
Liu J, Liu C, Rong YH, Huang GL, Rong L. Extraction of limonin from orange (citrus
reticulata blanco) seeds by the ash extraction method. Solvent Extr Res Dev
Jpn 2012;19:137e45.
Malhotra D, Thimmulappa RK, Mercado N, Ito K, Kombairaju P, Kumar S, et al.
Denitrosylation of HDAC2 by targeting Nrf2 restores glucocorticosteroid
sensitivity in macrophages from COPD patients. J Clin Invest 2011;121:
4289e302.
Fig. 5. Effect of limonin on the transcriptional (A, gene expressions) and posttranscriptional of Nrf2-ARE pathway (B, protein synthesis). Signicance is marked by star bars. * stands
for P<0.05, ** stands for P<0.01.
S. Qin et al. / Animal Nutrition 4 (2018) 281e287286
Mandadi KK, Jayaprakasha GK, Bhat NG, Patil BS. Red Mexican grapefruit: a novel
source for bioactive limonoids and their antioxidant activity. Zeitschrift Fur
Naturforschung C J Biosci 2007;62(3e4):179e88.
Mandadi K, Ramirez M, Jayaprakasha GK, Faraji B, Lihono M, Deyhim F, et al. Citrus
bioactive compounds improve bone quality and plasma antioxidant activity in
orchidectomized rats. Phytomedicine 2009;16(6e7):513e20.
Manners GD. Citrus limonoids: analysis, bioactivity, and biomedical prospects.
J Agric Food Chem 2007;55(21):8285e94.
Melwita E, Ju YH. Separation of azadirachtin and other limonoids from crude neem
oil via solvent precipitation. Separ Purif Technol 2010;74(2):219e24.
Ono E, Inoue J, Hashidume T, Shimizu M, Sato R. Anti-obesity and anti-hypergly-
cemic effects of the dietary citrus limonoid nomilin in mice fed a high-fat diet.
Biochem Biophys Res Commun 2011;410(3):677e81.
Patil BS, Vu J, Dandekar DV, Toledo RT, Singh RK, Pike LM. Citrus bioactive limonoids
and avonoids extraction by supercritical uids. In: Patil BS, Turner ND,
Miller EG, editors. Potential health benets of citrusvol. 936; 2006. p. 18e33.
Qin S, Chen J, Tanigawa S, Hou DX. Microarray and pathway analysis highlight Nrf2/
ARE-mediated expression proling by polyphenolic myricetin. Mol Nutr Food
Res 2013;57:435e46.
Ribeiro IA, Rocha J, Sepodes B, Mota-Filipe H, Ribeiro MH. Effect of naringin enzy-
matic hydrolysis towards naringenin on the anti-inammatory activity of both
compounds. J Mol Catal B Enzym 2008;52e3:13e8.
Roy A, Saraf S. Limonoids, Overview of signicant bioactive triterpenes distributed
in plants kingdom. Biol Pharm Bull 2006;29(2):191e201.
So FV, Guthrie N, Chambers AF, Moussa M, Carroll KK. Inhibition of human breast
cancer cell proliferation and delay of mammary tumorigenesis by avonoids
and citrus juices. Nutr Cancer Int J 1996;26(2):167e81.
Sun CD, Chen KS, Chen Y, Chen QJ. Contents and antioxidant capacity of limonin and
nomilin in different tissues of citrus fruit of four cultivars during fruit growth
and maturation. Food Chem 2005;93(4):599e605.
Tian QG, Miller EG, Ahmad H, Tang LL, Patil BS. Differential inhibition of human
cancer cell proliferation bycitrus limonoids. Nutr Cancer Int J 2001;40(2):180e4.
Toshinao I, Hideaki O. Yoichi, limonoids in seeds of iyo tangor (citrus iyo hort. Ex
tanaka). Food Sci Technol Res 2003;2:62e164.
Venugopal R, Jaiswal AK. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively
regulate the human antioxidant response element-mediated expression of
NAD(P)H:quinone oxidoreductase1 gene. Proc Natl Acad Sci U S A 1996;93:
14960e5.
Vikram A, Jayaprakasha GK, Patil BS. Simultaneous determination of citrus limonoid
aglycones and glucosides by high performance liquid chromatography. Anal
Chim Acta 2007;590(2):180e6.
Wang F, Yu X, Liu X, Shen W, Zhu S, Zhao X. Temporal and spatial variations on
accumulation of nomilin and limonin in the pummelos. Plant Physiol Biochem
2016;9(106):23e9.
Wasserman WW, Fahl WE. Functional antioxidant responsive elements. Proc Natl
Acad Sci U S A 1997;94:5361e6.
Yang YF, Zhang LZ, Du XP, Zhang SF, Li LJ, Jiang ZD, et al. Recovery and purication of
limonin from pummelo [Citrus grandis] peel using water extraction, ammo-
nium sulfate precipitation and resin adsorption. J Chromatogr B Analyt Technol
Biomed Life Sci. 2017;15(1060):150e7.
Zhao PH, Sun LM, Liu XJ, Cao MA, Yuan CS. Limonoids from the root of Dictamnus
radicis cortex. Chem Pharmaceut Bull 2008;56(1):102e4.
S. Qin et al. / Animal Nutrition 4 (2018) 281e287 287
... It is a secondary metabolite that is widely found in citrus fruits [7]. Numerous studies have shown that limonin exhibits a wide spectrum of biological and pharmacological activities, including anti-cancer [8][9][10], anti-inflammatory [10,11], anti-oxidative [12], anti-viral [13], and liver-protective properties [14,15]. Hesperidin, or vitamin P, is a flavanone glycoside found in all types of citrus fruits. ...
... Instead, less toxic solvents, i.e., ethanol and water, were chosen for extraction in this study. In comparison with previous studies [12,27], the extraction yields of limonin and hesperidin in this work are relatively lower. The yield ranges for limonin and hesperidin in previous studies were 2.3-11.38 and 0.0-3.6 mg/g, respectively. ...
... Considering the interaction between several factors affecting extraction efficiency, our response surface methodology data is consistent with previous studies. Qin et al. showed that extraction temperature had a profound effect on the limonin concentration in the extract of pummelo seeds [12]. Another study, which extracted hesperidin from three types of citrus peels (orange, lemon, and clementine), found that ethanol concentration significantly affected hesperidin concentration in every sample, while the extraction temperature had a significant effect on some samples [40]. ...
Full-text available
Article
Green extraction is aimed at reducing energy consumption by using renewable plant sources and environmentally friendly bio-solvents. Lime (Citrus aurantifolia) is a rich source of flavonoids (e.g., hesperidin) and limonoids (e.g., limonin). Manufacturing of lime products (e.g., lime juice) yields a considerable amount of lime peel as food waste that should be comprehensively exploited. The aim of this study was to develop a green and simple extraction method to acquire the highest yield of both limonin and hesperidin from the lime peel. The study method included ethanolic-aqueous extraction and variable factors, i.e., ethanol concentrations, pH values of solvent, and extraction temperature. The response surface methodology was used to optimize extraction conditions. The concentrations of limonin and hesperidin were determined by using UHPLC-MS/MS. Results showed that the yields of limonin and hesperidin significantly depended on ethanol concentrations and extraction temperature, while pH value had the least effect. The optimal extraction condition with the highest amounts of limonin and hesperidin was 80% ethanol at pH 7, 50 °C, which yields 2.072 and 3.353 mg/g of limonin and hesperidin, respectively. This study illustrates a green extraction process using food waste, e.g., lime peel, as an energy-saving source and ethanol as a bio-solvent to achieve the highest amount of double bioactive compounds.
... Usually, two major classes of limonoids are present in citrus fruits viz, limonoid aglycones and limonoid glucosides (Manners, & Breksa III, 2004). A scientific research study analyzed the Citrus maxima (pummelo) seeds for limonoid content and reported the yield of 11.52mg/g on treatment with acetone (89.68ml) at 78.94°C temperature for 4.62 hours (Qin et al., 2018). ...
... (Zhang et al., 2020) 1 Source of essential oil Limonoids  Limonoid extracted from pummelo ( Citrus maxima ) seeds exhibited high limonoid yield of 11.52mg/g. (Qin et al., 2018) Poly Unsaturated Fatty Acids (PUFAs) ...
Article
Citrus fruits fall in the category of those commercially grown fruits that constitute an excellent repository of phytochemicals and biologically active compounds, with health-promoting properties. Processing of fruit results in generation of large amounts of waste, which are fed to animals or disposed of, increasing the burden on the environment. However, due to its richness in valuable compounds, citrus fruit waste viz. peels (flavedo and albedo), seeds, and pomace are considered potent bio-resource materials for various uses in the food and non-food sectors. The inherent bioactive compounds present in citrus waste can be used as food additive, encapsulant, nanoparticle, prebiotic, pectin source, essential oil, polyphenol, carotenoid, or dietary fiber. It can also be used as a natural ingredient for cosmetics, medicines, packaging materials, and synthetic fuels. Use as bio-absorbents, biofertilizers, biodiesel, biogas, and bioethanol are some other non-food applications of citrus waste. Irrespective, citrus waste is considered as an ecological risk, alongside other types of waste. Considering this risk, some strategies have recently been developed to reduce its adverse effects. This review on the same lines covers all possible effective and economical ways of valorization of citrus waste in the food and non-food sectors.
... Limonin has been reported to suppress the NF-κB pathway in RAW 264.7 macrophages stimulated by LPS [23]. Meanwhile, it has also been shown that limonin may activate Nrf2 in HepG2 cells [24]. Although studies have described the regulatory effects of limonin on the NF-κB pathway and Nrf2, the effect of limonin in OA is still unknown. ...
... Even though earlier a research report has revealed that limonin activates the Nrf2/HO-1 cascade [24], its role in chondrocytes is not yet known. The western blot assay results showed that limonin enhanced the transportation of Nrf2 3.6. ...
Full-text available
Article
Osteoarthritis (OA), a degenerative disorder, is considered to be one of the most common forms of arthritis. Limonin (Lim) is extracted from lemons and other citrus fruits. Limonin has been reported to have anti-inflammatory effects, while inflammation is a major cause of OA; thus, we propose that limonin may have a therapeutic effect on OA. In this study, the therapeutic effect of limonin on OA was assessed in chondrocytes in vitro in IL-1β induced OA and in the destabilization of the medial meniscus (DMM) mice in vivo. The Nrf2/HO-1/NF-κB signaling pathway was evaluated to illustrate the working mechanism of limonin on OA in chondrocytes. In this study, it was found that limonin can reduce the level of IL-1β induced proinflammatory cytokines such as INOS, COX-2, PGE2, NO, TNF-α, and IL-6. Limonin can also diminish the biosynthesis of IL-1β-stimulated chondrogenic catabolic enzymes such as MMP13 and ADAMTS5 in chondrocytes. The research on the mechanism study demonstrated that limonin exerts its protective effect on OA through the Nrf2/HO-1/NF-κB signaling pathway. Taken together, the present study shows that limonin may activate the Nrf2/HO-1/NF-κB pathway to alleviate OA, making it a candidate therapeutic agent for OA.
... This was due to an affinity between the polarity of the solvent and the compound of interest [28]. The high extraction efficiency of ethanol was due to the high solubility of the limonoid group in alcohol [29]. It was consistent with previous reports that ethanol is a good solvent system for the extraction of polyphenolic compounds from Ocimum basilicum [30]. ...
... The microwave power and thermal effect for the extraction process were interrelated, as a high microwave power increased the temperature in the system [33]. However, high temperature might lead to its degradation due to the thermally labile property of nimbolide in limonoid group [29]. Therefore, 210-490 W was chosen for subsequent experimental design by the Box-Behnken design (BBD). ...
Full-text available
Article
Nimbolide, a limonoid present in leaves of the neem tree (Azadirachta indica), is an anticancer compound against a panel of human cancer cell lines. The rapid process of extraction and purification of the nimbolide from the leaves of neem tree through microwave-assisted extraction (MAE) coupled with a chromatographic technique was accomplished. The crude with a maximum content of nimbolide could be recovered from neem leaves through MAE. By using three-factors, three-level Box–Behnken design of response surface methodology (RSM), the optimal conditions for nimbolide extraction (R2 = 0.9019) were solid/liquid ratio 1:16 g/mL, microwave power 280 W, and extraction time 22 min. The enriched extract was further purified by a preparative thin-layer chromatography (PTLC), where nimbolide was obtained as 0.0336 g (0.67% yield, purity over 98%) with ethyl acetate/hexane = 4:6 in 3.0 h. Structural elucidation was performed through spectroscopic techniques, including FT-IR, 1H, and 13C-NMR. This method was simple and had a good potential for the purification of bioactive compounds from a natural product.
... The limonoid aglycones, which are present predominantly in citrus seed or peels, are insoluble in water and induce the bitter flavour of citrus fruits and juices. Limonoid glucosyltransferase transforms limonoids into tasteless limonoids during maturation, which decreases the bitterness of citrus fruits (Qin et al., 2018). ...
Article
Food production and processing in developing countries produce a huge amount of fruit waste by‐products, which is costly and pose detrimental effects on the environment. Proteins, lipids, starch, micronutrients, bioactive compounds and dietary fibres are found in many of these fruit wastes. Among fruit wastes, citrus fruits play an important role in generating a wide range of health benefits. Citrus L. of the Rutaceae family are common fruits cultivated and consumed globally both as fresh fruits and as a juice. Citrus peel wastes (CPW) are considered the main by‐products, with an average of 60% of processed fruits; hence, CPW have a promising role in the food production industry. CPW contain high concentrations of polyphenol and essential oils, which have nutritional importance and pharmaceutical usage. There is a concern on the increasing prevalence and incidence of different fish infections and a growing interest in shifting from synthetic to natural antimicrobial agents, leading to the use of citrus peel wastes for identification of novel compounds for use as fish feed additives. Although the antimicrobial properties of EOs have been reviewed extensively, the antimicrobial properties of citrus peels oil have not been extensively discussed. In fish farming, feeding strategies that employ phytochemicals as modulators of immunological and physiological responses such as growth, antioxidant activity and gene expression have received attention. In the past years, several studies have reported positive results of using citrus peel extracts as a nutritional additive in aquafeeds. Recently, these dietary functional feed additives have been evaluated and reported to increase disease resistance and improve fish growth, animal welfare and feed utilization. This review elucidates the global production, bioactive compounds, natural sources, chemical structures, physical properties, practical applications of citrus peel wastes and extracts as a desirable and sustainable route in fish nutrition.
... It has been noted that some flavonoids are linked to carbohydrates and that the spectral region between 1200 and 950 cm −1 contains functional groups mainly from carbohydrates [26]. The second spectral window can still be referred to the polyphenol content; moreover, in this range, the characteristic peaks of limonin, neodiosmin, and obacunone fingerprints are also detectable [29][30][31]. The LAMP sample had predominant bands in both windows, which may explain the highest relative antioxidant and antiproliferative activities. ...
Full-text available
Article
Citrus fruits are one of the principal fruits used to produce juices. Over the years, these fruits have been recognized as new health-promoting agents. In this work, food wastes derived from autochthonous citrus fruits of Southern Italy, named Limone di Rocca Imperiale, Arancia Rossa Moro, and Arancia Bionda Tardivo from Trebisacce, were analyzed. After fresh-squeezing juice, peel and pomace were employed to obtain six different extracts using an ultrasound-assisted method in a hydroalcoholic solvent. The extracts were analyzed in terms of qualitative composition, antioxidant properties, and antiproliferative activity on MCF-7, MDA-MB-231, and BJ-hTERT cell lines. GC-MS and LC-ESI-MS analyses showed different compounds: of note, limonin-hexoside, neodiosmin, obacunone glucoside, and diacetyl nomilinic acid glucoside have been identified as limonoid structures present in all the samples, in addition to different polyphenols including naringenin-glucoside, hesperetin-O-hexoside-O-rhamnoside-O-glucoside, diferuloyl-glucaric acid ester, chlorogenic acid, and the presence of fatty acids such as palmitic, myristic, and linoleic acids. These extracts were able to exert antioxidant activity as demonstrated by DPPH and ABTS assays and, although at higher doses, to reduce the cell viability of different solid tumor cell lines, as shown in MTT assays.
... Besides, Russo et al. (2016) analyzed the limonoid content of Citrus bergamia Risso (Bergamot) fruit and reported high limonoid aglycone content in the seeds and peel. Furthermore, Qin et al. (2018) extracted limonoids from Citrus maxima (pummelo) seeds and reported the limonoids yield of 11.52 mg/g on treatment with acetone (89.68 mL) at temperature (78.94°C), and time (4.62 h). ...
Article
Citrus fruits are well known for their medicinal and therapeutic potential due to the presence of immense bioactive components. With the enormous consumption of citrus juice, citrus processing industries are focused on the production of juice but at the same time, a large amount of waste is produced mainly in the form of peel, seeds, pomace, and wastewater. This waste left after processing leads to environmental pollution and health-related hazards. However, it could be exploited for the recovery of essential oils, pectin, nutraceuticals, macro and micronutrients, ethanol, and biofuel generation. In view of the importance and health benefits of bioactive compounds found in citrus waste, the present review summarizes the recent work done on the citrus fruit waste valorization for recovery of value-added compounds leading to zero wastage. Therefore, instead of calling it waste, these could be a good resource of significant valuable components, in this way encouraging the zero-waste theory.
... The activity of extracts containing kaempferol involves the inhibition of VEGF expression and angiogenesis (Luo et al., 2012). Limonin present in fruits of citrus family is a multifunctional bioactive compound which posses antiobesity (Ono et al., 2011); anticancerous (Tian et al., 2001); and many more activities of pharmacological importance (Mandadi et al., 2007;Qin et al., 2018;Ribeiro et al., 2008). ...
Article
Kinnow is a fruit crop which is famous among consumers due to its tasty and delicious juice. It is a multipurpose crop which could be utilized as an important source of nutrients for humans as well as animals. Depending on the environmental conditions and age of kinnow fruit the amount of juice may vary from 45 to 60%. Total soluble solids present in juice reside in range from 9.5 to 16%. Kinnow fruit is a rich source of bioactive constituents, along with specific minerals (sodium 0.01–0.03 mg/g; potassium 1.6–2.5 mg/g; calcium 0.14–0.47 mg/g, and copper 6–8 mg/100 ml), vitamins and volatile compounds. Kinnow fruit could be used for a variety of purposes ranging from fresh juice to candy, jellies and wine. The remaining waste of kinnow fruit after juice extraction could also be useful as animal feed. Addition of kinnow in diet chart could provide many health benefits. The present review paper focused on detail description of nutritional profile of kinnow fruits, pre- and postharvest factors affecting the bioactive profile, volatile compounds, and usefulness of specific compounds present in kinnow for health benefiting properties. Mandarins are of great interest because of their agroindustrial value, high nutrients, and bioactive constituents.
Article
Liver fibrosis is a pathological process as a result of intrahepatic deposition of excessive extracellular matrix. Epithelial-mesenchymal transition (EMT) of hepatocytes and activation of hepatic stellate cells (HSCs) both play important roles in the etiology of liver fibrosis. Here, we found that limonin repressed transforming growth factor-β1 (TGF-β)-induced EMT in AML-12 hepatocytes and activation of LX-2 HSCs. In both kinds of cells, limonin suppressed TGF-β-provoked Smad2/3 C-terminal phosphorylation and subsequent nuclear translocation. Transcription of Smad2/3-downstream genes was in turn reduced. However, limonin exerted few effects on Smad2/3 phosphorylation at linker region. Mechanistically, limonin increased Smad7 at mRNA level in both AML-12 and LX-2 cells. Knockdown of Smad7 abrogated inhibitory effects of limonin on TGF-β-induced EMT in AML-12 cells and activation of LX-2 cells. Further studies revealed that limonin alleviated mouse liver fibrosis induced by CCl4. In livers of model mice, limonin upregulated Smad7 and declined C-terminal phosphorylation and nuclear translocation of Smad2/3. Transcription of Smad2/3-responsive genes was also attenuated. Our findings indicated that limonin inhibits TGF-β-induced EMT of hepatocytes and activation of HSCs in vitro and CCl4-induced liver fibrosis in mice. Upregulated Smad7 which suppresses Smad2/3-dependent gene transcription is implicated in the hepatoprotective activity of limonin.
Article
A potential bioactive compound limonin is found in citrus fruits, especially tremendous extent in seeds. In this study, an attempt has been made to develop a novel and proficient extraction method by using the hydrotrope solution to recover limonin from lemon (Citrus limon L.) seeds. Initially, the extraction time (4 h) was screened by varying the time from 3 to 6 h by fixing the concentration of hydrotrope (sodium salicylate), raw material loading and temperature of the extraction. To enhance the yield of hydrotrope extraction, Box–Behnken experimental design (BBD) was proposed. The maximum yield of limonin recovered was 6.41 mg g⁻¹ at optimized process conditions such as the hydrotrope concentration of 1.65 M, raw material loading of 8.08%, and temperature of 44°C. The obtained limonin yield in this study was higher compared to the other studies using different citrus seeds. The recovered limonin was identified by using Fourier Transform-Infrared Spectroscopy (FTIR) and high-performance liquid chromatography (HPLC). Furthermore, the scavenging ability was evaluated for the extracted limonin, and it is proved to be a potent antioxidant. Therefore, the results revealed that the extraction of bioactive compounds using hydrotrope is efficient, eco-friendly and can also lower the usage of organic chemicals.
Full-text available
Article
Macrophages play a critical role in a variety of inflammatory diseases. Activation of Keap1/Nrf2/HO-1 signaling results in inactivation of macrophages and amelioration of inflammatory and autoimmune conditions. Hence, discovery for the activators of Keap1/Nrf2/HO-1 signaling has become a promising strategy for treatment inflammatory diseases. In the current study, the anti-inflammatory potential of 7-deacetylgedunin (7-DGD), a limonin chemical isolated from the fruits of Toona sinensis (A. Juss.) Roem, was intensively examined in vivo and in vitro for the first time. Results showed that 7-DGD alleviated mice mortality induced by LPS. Mechanistic study showed that 7-DGD suppressed macrophage proliferation via induction of cell arrest at the G0/G1 phase. Furthermore, 7-DGD inhibited iNOS expression, which is correlated with the increases of NQO1, HO-1 and UGT1A1 mRNA expression as well as HO-1 protein expression level in the cells. More importantly, 7-DGD markedly decreased Keap1 expression, promoted p62 expression, and facilitated Nrf2 translocation and localization in the nucleus of macrophages, and in turn up-regulates these anti-oxidant enzymes expression, eventually mediated anti-inflammatory effect. Collectively, 7-DGD suppresses inflammation in vivo and in vitro, indicating that the compound is valuable for further investigation as an anti-inflammatory agent in future.
Full-text available
Article
Limonoids are the important secondary metabolites in the citrus. In this study, the accumulation of limonoids at different fruit developmental stages and distribution among different genotypes, tissues and developmental stages were investigated in 12 pummelo varieties. The large variations on limonoids concentration were found among different varieties, which ranged from 233.78 mg/kg FW to 4090.41 mg/kg FW in the seeds at full color stage of the fruit. Classification of pummelos based on the limonoids content divided 12 varieties into three groups. It was matched well with the geographic origination of the pummelo varieties, suggesting that the accumulation of limonoids was mainly determined by the genotype of the pummelo. Accumulation of the limonoids in different tissues was highly variable, and in a tissue specific fashion. The trend of the change on the levels of nomilin and limonin in the seeds and segment membrane were corresponded to the physiological development of the fruit. The rapid accumulation of nomilin and limonoids was observed from the physiological ripening of the seeds. It suggested that physiological maturation of the seeds is a key point that the seeds accelerate the accumulation of nomilin and limonin. In most of pummelo varieties, 10% color break of the fruit was a phenotypic landmark associated with the maximum level of nomilin accumulated in the seeds.
Full-text available
Article
Iyo tangor (Citrus iyo hort ex Tanaka) seeds contained limonin, nomilin, obacunone and deacetylnomilin, in order of decreasing concentration. They also contained the 17-β-D-glucopyranosides of nomilin, obacunone, limonin, deacetynomilin and nomilinic acid. Total limonoid aglycone concentration in the seeds was 873 mg per 100 g on a dry weight basis and total limonoid glucoside concentration was 446 mg. The composition and relative concentration of each limonoid aglycone and glucoside in Iyo tangor seeds were very similar to those of other citrus species distributed widely in western Japan such as Valencia orange (C. sinensis Osbeck), Sanbokan (C. sulcata hort, ex Tanaka) and Hyuganatsu (C. tamurana hort, ex Tanaka). These data reveal that Iyo tangor taxonomically belongs to the same group as those citrus species.
Article
Limonin is a bioactive compound that is traditionally extracted from citrus seeds using organic solvents or alkaline/metal ion solutions. In the present study, pummelo [Citrus grandis] peel was investigated for limonin preparation using a novel process consisting of water extraction, ammonium sulfate precipitation and resin adsorption. The pummelo peel was determined to have 4.7 mg/g limonin, which could be extracted by water and further recovered by ammonium sulfate precipitation with a yield of 2.4 mg/g, which was similar to that of traditional process using ethanol extraction and vacuumed evaporation. The precipitated limonin was purified by resin adsorption and crystallization with a purity of 96.4%. In addition, the limonin was identified via the analyses of retention time, infrared spectrum and nuclear magnetic resonance. This study indicates a novel and eco-friendly process for recovering limonin, providing a new candidate for limonin preparation.
Article
The replacement of organic solutions in the extraction of limonin from citrus seeds with an alkaline solution was investigated. This method was based on the reversible conversion of limonin to limonoate A-ring lactone via ringopening of D-ring lactone at different pH values. The extraction conditions, optimised using Taguchi experimental design, were as follows: pH 11, temperature 70°C, alkaline solution/seeds ratio 20:1 (v/w), ultrasonic power 800 W for 30 minutes. A yield of 7.5 mg/g (limonin/citrus seeds) of 98% pure limonin was obtained.
Chapter
Limonoids are naturally occurring triterpenes found in Rutaceae and Meliaceae family plants. Many citrus limonoids have proved to be particularly difficult to purify using conventional methods. This chapter provides an overview of the methods used to extract and purify limonoid aglycones and limonoid glucosides from citrus, including solid liquid extraction, column chromatography, preparative HPLC and flash chromatography. Furthermore, recent literature on analytical methods such as HPLC and LC-MS for the separation and identification of limonoids have been discussed.
Chapter
The increasing use of organic solvents for extraction of bioactive compounds is a significant environmental concern. In the present report, limonoids and flavonoids were extracted from grapefruit (Citrus paradisi Macf.) seeds by an environmentally-friendly supercritical CO2 extraction (SC-CO2) technique. Optimum conditions for extraction of limonoid aglycones, such as pressure, temperature, extraction time, CO2 flow rate and the feeding modes of CO2, were determined. The highest yield of limonin was 6.3 mg/g seeds at 48.3 MPa, 50°C and 60 min with CO2 flow rate of approximately 5.0 l/min being fed from the top of the column. The highest extraction yield of limonin glycoside was 0.62 mg/g defatted seeds which was obtained at 48.3 MPa, 50°C and 30% ethanol in 40 min with flow rate of SC-CO2 of 5.0 l/min and fed from the top of the column. Furthermore, the maximum extraction of naringin (0.2 mg/g defatted seeds) was obtained under the conditions of 41.4 MPa, 50°C, 20% ethanol, 40 min with CO2 flow rate of approx. 5.0 l/min. The results demonstrated practical commercial application of SC-CO2 extraction of limonoids and flavonoids from grapefruit seeds.
Article
A flash extraction method was investigated for mass production of limonin from orange (Citrus reticulata Blanco) seeds. The limonin was extracted by using flash extraction for 2 min. The extraction conditions optimized by response surface methodology were as follows: ethanol concentration, 72% (v/v); solvent/solid ratio, 29:1 mL/g; rotational speed, 4000 r/min. The limonin was crystallized from the mixed solution of dichloromethane and isopropanol (1:3) at 4 oC for 1 h. The limonin crystals were identified by high performance liquid chromatography (HPLC) and from their infrared spectrum (IR). The purity of limonin was 95%, the yield of limonin was 6.8 mg/g and the recovery yield of limonin was 97.1%. Thus, flash extraction is an efficient method for the mass production of limonin.