Content uploaded by Luzia Sampaio
Author content
All content in this area was uploaded by Luzia Sampaio on Jul 01, 2018
Content may be subject to copyright.
Contents lists available at ScienceDirect
Biochemical Pharmacology
journal homepage: www.elsevier.com/locate/biochempharm
Experimental ischemia/reperfusion model impairs endocannabinoid
signaling and Na
+
/K
+
ATPase expression and activity in kidney proximal
tubule cells
Luzia S. Sampaio
a,b,d
, Fabio A. Iannotti
c
, Luciana Veneziani
a
, Rosa T. Borelli-Tôrres
a,b
,
Fabrizia De Maio
c
, Fabiana Piscitelli
c
, Ricardo A.M. Reis
a,b
, Vincenzo Di Marzo
c
,
Marcelo Einicker-Lamas
a,⁎
a
Instituto de Biofísica Carlos Chagas Filho, UFRJ, Rio de Janeiro, Brazil
b
Lab. Neuroquímica, Instituto Nacional de Ciência e Tecnologia em Neurociência Translacional, Brazil
c
Endocannabinoid Research Group, Istituto di Chimica Biomolecolare, CNR, Pozzuoli (Naples), Italy
d
CAPES Foundation, Ministry of Education of Brazil, Brasilia DF 70.040-020, Brazil
ARTICLE INFO
Chemical compounds studied in this article:
WIN 55,212-2 (PubChem CID 5311501)
AM251 (PubChem CID 2125)
Ouabain (PubMed CID 6364534)
Antimycin A (PubMed CID 16218979)
ATP (PubMed CID 124080954)
EDTA (PubMed CID 6049)
Hepes (PubMed CID 2724248)
Trypsin inhibitor (PubMed CID 123132003)
Keywords:
Endocannabinoid system
CB1
WIN55,212-2
Na
+
/K
+
ATPase
ABSTRACT
LLC-PK1 cells, an immortalized epithelial cell line derived from pig renal proximal tubules, express all the major
players of the endocannabinoid system (ECS) such as CB1, CB2 and TRPV1 receptors, as well as the main
enzymes involved in the biosynthesis and degradation of the major endocannabinoids named 2-arachido-
noylglycerol, 2-AG and anandamide, AEA. Here we investigated whether the damages caused by ischemic insults
either in vitro using LLC-PK1 cells exposed to antimycin A (an inductor of ATP-depletion) or in vivo using Wistar
rats in a classic renal ischemia and reperfusion (IR) protocol, lead to changes in AEA and 2-AG levels, as well as
altered expression of genes from the main enzymes involved in the regulation of the ECS. Our data show that the
mRNA levels of the CB1 receptor gene were downregulated, while the transcript levels of monoacylglycerol
lipase (MAGL), the main 2-AG degradative enzyme, were upregulated in LLC-PK1 cells after IR model.
Accordingly, IR was accompanied by a significant reduction in the levels of 2-AG and AEA, as well as of the two
endocannabinoid related molecules, oleoylethanolamide (OEA) and palmitoylethanolamide (PEA) in LLC-PK1
cells. In kidney cortex homogenates, only AEA levels were significantly decreased. In addition, we found that in
both the in vitro and in vivo model IR caused a reduction in the expression and activity of the Na
+
/K
+
ATPase.
These changes were reversed by the CB1/CB2 agonist WIN55,212, in a CB1-receptor dependent manner in the
LLC-PK1 IR model. In conclusion, the ECS and Na
+
/K
+
ATPase are down-regulated following IR in LLC-PK1 cells
and rat kidney. We suggest that CB1 agonists might represent a potential strategy to reverse the consequences of
IR injury in kidney tissues.
1. Introduction
The discovery of the endocannabinoid system (ECS) represented the
identification of a pro-homeostatic apparatus in organ (nervous, im-
mune, endocrine and cardiovascular) functioning or malfunctioning in
health or disease, with possible clinical applications in cancer, obesity,
metabolic syndrome, diabetes and its complications, neurodegenerative
diseases and many others [1,2]. However, ECS role in some diseases is
still not completely understood, one example being the injury that
usually follows ischemia and reperfusion (IR). Data in the literature
indicate that the ECS either may contribute to or protect from IR-in-
duced damage, depending on the organ involved and experimental
conditions [3].
IR damage is the most important cause of tissue injury evoked by
cerebral and/or myocardium stroke, tissue/organ transplants and
others. In all these cases, the damage initiates because of an abrupt
https://doi.org/10.1016/j.bcp.2018.06.005
Received 23 March 2018; Accepted 4 June 2018
⁎
Corresponding author at: Laboratório de Biomembranas, IBCCF, CCS, UFRJ –Ilha do Fundão, 21949-902 Rio de Janeiro, RJ, Brazil.
E-mail address: einicker@biof.ufrj.br (M. Einicker-Lamas).
Nomenclature and abbreviations: 2-AG, 2-arachidonoylglycerol; AEA, anandamide; AM251, N-(piperidin-1-yl)-1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl-1H-pyrazole-3-car-
boxamide; CB1, cannabinoid type-1 receptor; CB2, cannabinoid type-2 receptor; DGL, diacylglycerol lipase; ECS, endocannabinoid system; FAAH, fatty acid amide hydrolase; LLC-PK1
cells, immortalized epithelial cells derived from pig kidney proximal tubule; MAGL, monoacylglycerol lipase; NAPE-PLD, N-acylphosphatidylethanolamine-phospholipase D; TRPV1,
transient receptor potential vanilloid-1 channel; WIN, WIN55,212-2, (2,3-dihydro-5-methyl-3-((4-morpholinyl)methyl)pyrrolo-(1,2,3-de)-1,4-benzoxazin-6-yl)( 1-naphthalenyl)metha-
none monomethanesulfonate
Biochemical Pharmacology 154 (2018) 482–491
Available online 08 June 2018
0006-2952/ © 2018 Elsevier Inc. All rights reserved.
T
rupture of normal blood circulation (ischemia) followed by reperfusion
and, to date, not many therapeutic tools have been identified to treat it
efficiently [3]. In this direction, the ECS may act as a potential im-
portant player being able to regulate inflammatory cascades critical in
IR injury via the modulation of the G-protein coupled receptors CB1
and CB2, and also the enzymes responsible for the biosynthesis of en-
docannabinoids, such as the N-acylphosphatidylethanolamine-phos-
pholipase D (NAPE-PLD), which is responsible for the generation of
anandamide (AEA); or the enzymes involved in endocannabinoids de-
gradation, such as the Fatty Acid Amide Hydrolase (FAAH) and the
Monoacylglycerol Lipase (MAGL), which are responsible for AEA and 2-
arachidonoylglycerol (2-AG) hydrolysis, respectively [2,3].
During IR, a significant decrease in ATP production is observed as a
consequence of the lower availability of oxygen circulation. This may
particularly affect tissues and organs with high metabolic activity, in-
cluding the kidneys. The sequential steps of reperfusion, as well as the
ensuing inflammatory process, cause a high formation rate of reactive
oxygen and nitrogen species (ROS and RNS), cell death and tissue
dysfunction. These events compromise the overall function of renal
tissues, especially the cortex, which is the most perfused and presents a
considerable abundance of ATP-dependent proteins [4].
In addition to the ongoing inflammatory process, another hallmark
of IR injury in local renal cells is the loss of function that occurs in
parallel to changes in renal epithelial cell morphology. Thus, rats ex-
perimentally subjected to IR injury exhibit dysfunctional renal cells
associated with a loss of the brush border, one of the main character-
istics of the healthy renal tubular epithelium [5]. In addition, ischemia
induces ATP depletion, changes in the cytoskeleton of the epithelial
cells, loss of complexes and adhesion molecules in lateral cell junctions
with subsequent changes in cell polarity [4]. Indeed, loss of polarity
generated by IR causes important disturbances of the ion transport
processes, one of the crucial functions of the renal epithelium. A key
feature during this process is the change in location and function of the
Na
+
/K
+
ATPase, the main enzyme responsible for Na
+
reabsorption
through the renal epithelium [5,6]. Under normal conditions, the Na
+
/
K
+
ATPase is localized in the basolateral membrane of kidney tubule
cells; in response to IR injury, it loses this location, and this misplace-
ment leads to further perturbation of Na
+
homeostasis [7]. In addition,
it was demonstrated that the Na
+
/K
+
ATPase can be detected in in-
tracellular compartments after IR [8].
Our group had recently reported that LLC-PK1 cells, which are
immortalized epithelial cells derived from pig kidney proximal tubules,
possess the main components of the ECS [8,9]. We also provided evi-
dence for the participation of the ECS in the regulation of the Na
+
/K
+
ATPase in these cells. In the present study, we also addressed the
question of whether these injured cells show significant physiological
changes after IR. In addition, we also used an animal model (Wistar
Rats) for in vivo ischemia/reperfusion to investigate the correlation
between the ECS and the IR lesion, in particular with regard to the
expression and activity of the Na
+
/K
+
ATPase. Since we previously
reported that this ion pump can be upregulated upon activation of
cannabinoid CB1 receptors with WIN55,212-2 (WIN), a synthetic can-
nabinoid agonist [9],wefinally asked if WIN treatment after IR could
rescue ATPase activity in LLC-PK1 cells and also in the animal model
used.
2. Material and methods
All materials used were of analytical grade. Reagents for qRT-PCR
were from BioRad (Milan, Italy), and primers were from Eurofins MWG
Operon (Table 1). Solvents used for the endocannabinoid analysis were
from Merck (Milan, Italy); the internal deuterated endocannabinoid
standards, WIN55,212-2, AM251 and the MAGL antibody were from
Cayman Chemical (Michigan, EUA). Antibodies for Na
+
/K
+
ATPase, β-
actin and CB2 receptor, and ouabain were from Sigma Aldrich (Mis-
souri, EUA). Antibodies for FAAH was from Santa Cruz (Texas, EUA)
and CB1 from Merck KGaA (Darmstadt, Germany). NAPE-PLD and
PTPN22 antibodies were from Abnova (Jhongli, Taiwan).
2.1. Kidney epithelial cell culture
LLC-PK1 cells (immortalized epithelial cells derived from pig kidney
proximal tubule; ATCC –LLC-PK1: ATCC®CL-101TM) were grown in
plastic plates (Techno Plastic Products, TPP, Trasadingen, Switzerland)
or 13 mm coverslips, with Dulbecco's Modified Eagle Medium (DMEM)
supplemented with 10% fetal bovine serum (FBS) for 48 h at 37 °C in an
air with 5% CO
2
atmosphere. Cultures used were 90% confluent as
described, and up to 50th passage [9].
2.2. ATP depletion protocol
We used the ATP depletion protocol induced by antimycin A in vitro,
because it mimics the main aspects of that from in vivo ischemia and
reperfusion injury (IR). Briefly, confluent LLC-PK1 cells were treated
with antimycin A (10
−6
M) for 30 min at 37 °C in a5% CO
2
atmosphere,
then cultures were washed 3 times with phosphate buffer saline, pH 7.4
(PBS) and reincubated in fresh medium (DMEM supplemented with
10% FBS) for 24 h at 37 °C in an air with 5% CO
2
atmosphere [10]. The
ATP depletion due this chemical inhibition is considered one of the
most efficient IR models in vitro [11].
2.3. Animals
The experiments involving animals were approved by and carried
out in accordance with the guidelines of the Institutional Animal Care
and Use Committee of the Federal University of Rio de Janeiro (CEUA
IBCCF 137/13). Animals were obtained from the animal facility of the
Federal University of Rio de Janeiro and kept in our own animal facility
for 20 days until the date of the experimental procedures.
For this work, we used a total of 9 male Wistar rats (3months with
300–350 g each animal), divided in 3 groups, control, sham and IR (3
animals each group). All animals were kept in individual cages with
free access to standard chow and water.
2.4. Ischemia and reperfusion injury
The animals of control group do not undergo any intervention,
while sham animals were submitted to simulation of surgical manip-
ulation (anesthesia and exposure of the renal arteries) and the IR group
was submitted to the IR model described by Beiral and coworkers [12].
Briefly, after anesthetized, the renal arteries (bilateral) of IR group
animals were exposed and clamped for 30 min (ischemia), then the
clamp was removed (reperfusion) and the animals were returned to
their boxes. After 24 h (reperfusion), the animals were euthanized and
the kidneys were removed and placed in an isotonic solution (0.25 M
sucrose, 0.01 M Hepes-Tris (pH 7.4), 0.002 M EDTA and 0.15 mg/ml
trypsin inhibitor type II-S) on ice.
2.5. LLC-PK1 and kidney cortex homogenates
To prepare the whole cell homogenates from LLC-PK1, the medium
was removed after the different treatments and the cells were washed
with PBS (3 times). Then, the cells were scraped offthe plates and the
homogenates were prepared in lysis buffer (10 mM EDTA, 50 mM
Hepes-Tris (pH 7.0), 1 M Sucrose (pH 7.4), 0.15 mg/ml trypsin in-
hibitor) using a glass homogenizer. Some samples were used fresh and
others were stored at −70 °C until use. Fidney cortex homogenates
were prepared after the dissection of the external cortical region of each
kidney (cortex corticcis), a kidney region where most of the nephron
proximal tubules are placed [13]. The tissue was homogenized using a
glass homogenizer and then centrifuged for 1000×g15 min at 4 °C. The
supernatant (kidney cortex homogenate) was collected and the samples
L.S. Sampaio et al. Biochemical Pharmacology 154 (2018) 482–491
483
stored at −70 °C until use.
The total protein concentration in LLC-PK1 and kidney cortex
homogenates was measured by Folin-phenol method [14].
2.6. Quantification of endocannabinoids (AEA, 2-AG) and related
mediators (PEA, OEA)
Endocannabinoids and related mediator levels were analyzed ac-
cording to the methodology described previously [15]. We evaluated
the N-acyletanolamines (including anandamide –AEA, palmitoyletha-
nolamine –PEA and oleylethanolamine –OEA) and 2-arachido-
noylglycerol (2-AG) levels.
LLC-PK1 cells, control and antimycin A treatment (IR), in 6-well
plates were harvested in 1 ml of DMEM and 1 ml of methanol (1:1) and
the samples were stored at −70 °C for 24 h. The total lipids were ex-
tracted by adding 2 ml of chloroform. We also performed the extraction
of total lipids from kidney cortex homogenates derived from each ex-
perimental group. Total lipids were extracted from 100 µl aliquots of
each kidney cortex homogenates by adding 400 µl chloroform: me-
thanol (2:1).
All the samples were sonicated at 4 °C (1 min) and the internal
deuterated standards ([
2
H]
8
AEA, 5 pmol; and [
2
H]
5
2-AG, [
2
H]
4
PEA
and [
2
H]
2
OEA, 50 pmol each) were added. Total lipids were extracted
with chloroform, followed by centrifugation at 2000gfor 3 min and the
organic phase was collected and evaporated, diluted in 3 ml of
chloroform and freeze-dried in vacuum speed. Final dry weight of the
sample was determined and kept stored at −20 °C for 48 h.
AEA, 2-AG, PEA and OEA quantification was performed using liquid
chromatography–atmospheric pressure chemical ionization–mass
spectrometry using a Shimadzu high-performance liquid chromato-
graphy apparatus (LC-10ADVP) coupled to a Shimadzu (LCMS-2020)
quadrupole mass spectrometry via a Shimadzu atmospheric pressure
chemical ionization interface as previously described [16].
2.7. Quantitative real time qRT-PCR
Total RNA from control and IR LLC-PK1 cells (cultured in 6-well
plates), was isolated by Trizol-Reagent (Sigma-Aldrich) following the
manufacturer’s instruction, reacted with DNase-I (1 U/ml; Sigma-
Aldrich) for 15 min at room temperature, and followed by spectro-
photometric quantification. The purified mRNA was reverse-tran-
scribed by use of iScript reverse transcriptase enzyme (Biorad).
Quantitative real-time PCR was carried out in CFX384 real-time PCR
detection system (Bio-Rad) with specific primers (see Table 1) by the
use of Universal SYBR Green Supermix (Bio-Rad). Samples were am-
plified simultaneously in quadruplicate in one-assay run with a non-
template control blank for each primer pair to control for contamina-
tion or primer-dimers formation, and the ct (cycle threshold) value for
each experimental group was determined. The housekeeping genes (the
ribosomal protein S16) have been used as an internal control to nor-
malize the ct values, using the 2
−ΔΔct
formula [17].
2.8. Na
+
/K
+
ATPase activity
Na
+
/K
+
ATPase activity was measured colorimetrically by quan-
tifying the difference of inorganic phosphate (Pi) released from ATP
hydrolysis [18] in the absence and presence of ouabain (2 mM), a
specific inhibitor of Na
+
/K
+
ATPase.
All the determinations using LLC-PK1 cell homogenates were per-
formed just after each treatment when the fresh cell homogenates were
prepared (as described in Section 2.5). The different treatments in-
cluded; antimycin A model (IR), 10
−7
M Win 55,212-2 (WIN), an
agonist for cannabinoid receptors for 30 min at 37 °C and 10
−7
M
AM251, a selective antagonist for CB1 for 15 min at 37 °C. The WIN and
AM251 treatments were as recently reported by our group [9].
For the kidney cortex, the homogenates of different groups were
thawed and treated with WIN at 37 °C before the Na
+
/K
+
ATPase ac-
tivity assay.
The Na
+
/K
+
ATPase activity assay was performed in triplicate as
described [13]. Briefly after the different treatments, the homogenates
(0.05 mg total protein/ml) were pre-incubated in reaction medium:
50 mM Bis-Tris-propane (pH 7.4), 0.2 mM EDTA, 5 mM MgCl
2
, 120 mM
NaCl and 2 mM ouabain for 10 min at 37°C and the reaction was started
by addition of 24 mM KCl plus ATP 5 mM. The incubation time was
10 min and the reaction were stopped with active charcoal in 0.1 M
HCL. The samples were centrifuged, and the supernatant collected to
the colorimetrically determination of the released Pi using spectro-
photometer.
2.9. Western blotting
Proteins (50 µg/lane) from LLC-PK1 cells and kidney cortex homo-
genates were separated by polyacrylamide gel electrophoresis (10%
SDS-PAGE) and transferred to nitrocellulose membranes [19]. After 2 h
in blocking buffer (low fat dried milk 5% in Tris-buffered saline –TBS),
the immunodetection was done with a specific primary antibody (anti-
β-actin (Sigma A1978 1:5000), anti-Na
+
/K
+
ATPase, (Sigma A275
1:500), anti-CB1 (Merck 209550 1:500), anti-CB2 (Sigma
WH001269M1 1:500), anti-FAAH (Santa Cruz sc-26427 1:200) and
anti-MAGL (Cayman 10035 1:500), anti-NAPE-PLD (Abnova PAB12126
1:500) and anti-PTPN22 (Abnova H00026191-M01) by overnight in-
cubation at 4 °C. The incubation with the secondary horseradish per-
oxidase (HRP)-conjugated antibody was for 2 h. The proteins of interest
were finally detected using the Luminata™Forte (Merck Millipore) and
ChemiDoc MP system (Bio-Rad). Western blotting analyzes were per-
formed by measuring the densitometry of each specific
Table 1
Primers used for qRT-PCR.
Forward Primer Reverse Primer
NAPE-PLD 5′ACCGGCCTCTGAGAAAATGG3′5′AGGGTTAACTGGGGAGACCT3′
DAGL-α5′GAAACCAAACACGCCTCCAC3′5′CAACCCAGCAGCAAAGGAAC3′
DAGL-β5′TTTGTAATCCCGGACCACGG3′5′ATTCTCGTTTCCCACACGCT3′
FAAH 5′TGCCACCGTGCAAGAAAATG3′5′CCACTGCCCTAACAACGACT3′
MAGL 5′CACTTCTCCGGCATGGTTCT3′5′CGTGAAACGGCGTTGAGC3′
ABDH4 5′CGATTCCGACCGGACTTCAA3′5′ACCTCAGAGGACACAGGTCT3′
PTPN22 5′TCCTGGATGAGGCCCAAAAC3′5′CTGGCGTTGATGTAGCTGGA3′
GDE-1 5′CTCATGGGCCCGTTCTCTTT3′5′TACCGTGTTGTCGTGCATCA3′
ABDH6 5′TTCTCTGCGCACAAGGACAT3′5′CGATGGGTAGTAAGCGGCAT3′
ABDH12 5′GAAGTGGCGACAACCCTGTA3′5′ATTCCACTGCTGGTGATGGG3′
CB1 5′CGCCAATGACATTCAGGGAAG3′5′CGGGAATGGAGGATAACGCA3′
CB2 5′TTTATAGCCTGGCCTCCCCT3′5′TTTTCCCGTCTGCCTCTGTC3′
TRPV1 5′TAAGACCAGCTCCAGCCAAG3′5′AACTCGCTGTCCACCAGATG3′
S16 5′TCATCAAAGTGAACGGGCGA3′5′GACGAGGATCAGCTACCAGC3′
L.S. Sampaio et al. Biochemical Pharmacology 154 (2018) 482–491
484
immunodetection using the scion image software. Actin was used as
load control in each immunodetection.
2.10. Immunofluorescence analysis
After the treatments the LLC-PK1 cells were washed with PBS and
fixed for 15 min in solution of 4% paraformaldehyde in phosphate
buffer 0.1 M, pH 7.4 (PFA 4%). Cover slips were washed three times
with PBS and incubated for 15 min with 0.25% Triton X-100 in PBS (v/
v) and incubated for 2 h at room temperature with a blocking buffer
(3% donkey serum in PBS) followed by the incubation with a primary
antibody.
When using the kidney cortex, the kidneys were removed, washed
with PBS and fixed for 24 h in PFA 4%; after these procedures, the
kidneys were washed in PBS three times and were cryoprotected in
sucrose 15% and 30%, embedded in O.C.T. compound, frozen and then
cut on a cryostat. The slices (12 μm) were incubated for 1 h with 0.25%
Triton X-100 and 3% FCS in PBS followed by the primary antibody.
Primary antibody against the Na
+
/K
+
ATPase (1:100) was in-
cubated overnight at 4 °C. Them, the cover slips and kidney slices were
washed with PBS and fluorochrome-conjugated secondary antibody
(Alexa 594, 1:1000) added for 3 h at room temperature in the dark.
Cover slips and kidney slices were treated with DAPI 0.04 μg/ml and
examined with a fluorescence microscope (ApoTome 2®–Zeiss). The
orientation of the slices as well as the identification of macro structures
of the renal parenchyma are easily identified in Differential Interference
Contrast (DIC) images performed in axiovert 35 microscope (Zeiss).
2.11. Statistical analysis
Results are shown as means ± SEM. Graph pad Prism5®software
was used to analyze the results by nonparametric variance (ANOVA),
followed by Tukey post-test, or Student t-test (nonparametric test
Mann-Whitney test, two-tailed). For all the results, p < 0.05 was taken
as the significance level, and the number of experiments is described in
each figure legend.
3. Results
3.1. IR decreases endocannabinoids levels in LLC-PK1 cells and in kidney
cortex homogenates
In a recent study from our group, we reported that LLC-PK1 cells
express key enzymes and receptors of the ECS and this system is in-
volved in the modulation of Na
+
/K
+
ATPase with further repercussion
on the amount of Na
+
reabsorbed by the kidney [9], and due to this
important role in LLC-PK1 cells, we presently investigated whether ECS
expression and activity would be altered or, correlated to the IR injury.
To test this hypothesis, LLC-PK1 cells were pre-treated with antimycin
A for ATP-depletion, an experimental model that mimics in vivo IR, as
described in Methods. To determine endocannabinoids levels, the
samples were prepared as described, and then subjected to total lipid
extraction, purification and quantification of N-acyletanolamines (in-
cluding anandamide –AEA, N-palmitoylethanolamine –PEA, and
oleylethanolamine –OEA) and 2-arachidonoylglycerol (2-AG). As
shown in Fig. 1 we observed that IR induced by antimycin A treatment
leads to a significant reduction in the levels of 2-AG and AEA, as well as
those of OEA and PEA in LLC-PK1 cells.
Despite some possible differences between the in vitro and in vivo
models, we evaluated endocannabinoid levels also in kidney cortex
homogenates from sham and IR groups (Fig. 1). As described in the
Introduction, several studies reported a significant increase in the
production of endocannabinoids in different IR injury models, which
seems to be correlated with the degree of tissue injury and inflamma-
tion [1,3]. Interestingly, in agreement with our in vitro data, we found a
significant reduced level of AEA in kidney cortex homogenates from the
IR group when compared to the sham group (Fig. 1A), but the same was
not found for 2-AG, PEA or OEA (Fig. 1B, C and D, respectively). These
changes were not accompanied by any significant alteration in total
lipid levels (Fig. 1E). Notably, AEA, OEA and PEA can be biosynthesized
and degraded through the same routes, whereas the synthesis and de-
gradation of 2-AG follow distinct pathways from those controlling N-
acylethanolamine levels [2,20].
3.2. IR induced changes in key proteins expression from the ECS
After incubation with antimycin A, LLC-PK1 cells were harvested
and analyzed for the mRNA encoding the main enzymes involved in the
biosynthesis and degradation of endocannabinoids, as well as the
mRNA for CB1, CB2 and TRPV1 receptors. Our results show that the
mRNA levels of CB1 and one of the enzymes involved in AEA and other
N-acylethanolamine biosynthesis, tyrosine-protein phosphatase non-
receptor type 22 (PTPN22), were down regulated. On the other hand,
the mRNA levels of the main 2-AG hydrolytic enzyme, mono-
acylglycerol lipase (MAGL), were upregulated in LLC-PK1 cells after
treatment with antimycin A (Fig. 2A and C). No statistically significant
changes were observed for the mRNA levels of the other investigated
receptors (i.e. CB2 and TRPV1) or biosynthetic and hydrolytic enzymes
in LLC-PK1 cells (Fig. 2D and B).
Western blot analysis were also performed to evaluate the protein
expression levels of CB1 and CB2 receptors, the enzyme PTPN22 and
that of the main enzymes catalyzing endocannabinoid degradation:
fatty acid amide hydrolase (FAAH), for AEA, and MAGL, for 2-AG in
LLC-PK1. Our results confirmed the down regulation of CB1 and up
regulation of MAGL after IR injury in vitro but not for PTPN22 (Fig. 3A
and B). Since the results of endocannabinoid levels in renal cortex
homogenate only showed the reduction in AEA levels, we performed a
western blot analysis for the main enzyme of AEA synthesis, the N-acyl
phosphatidylethanolamine-specific phospholipase D (NAPE-PLD) and
also for the enzyme FAAH. Notably, our western blot in vivo model
revealed that protein expression levels of NAPE-PLD, FAAH and CB1
were reduced in IR kidney when compared to control, which likely
indicates and explain the observed reduced AEA’s tone. On the other
hand, MAGL expression was not changed (Fig. 3C and D).
3.3. WIN restore the Na
+
/K
+
ATPase activity through CB1 receptor after
IR
Na
+
/K
+
ATPase is an important player for the maintenance of
cellular homeostasis, especially in the cells of the proximal renal tubule.
Alterations of its activity and/or expression either in kidney cells or in
other tissues have been reported in cellular damage caused by IR [21].
Here we show that the IR model induced by antimycin A treatment
causes a reduction of Na
+
/K
+
ATPase activity in LLC-PK1 cells
(Fig. 4A). Our group recently showed that 30 min incubation with WIN,
a cannabinoid receptor agonist, on LLC-PK1 cells promotes a significant
increase in Na
+
/K
+
ATPase activity by a CB1-dependent pathway [9].
In the present work we showed that addition of WIN (10
−7
M), restored
Na
+
/K
+
ATPase activity after 30 min incubation in LLC-PK1 cells that
were previously submitted to ATP-depletion (Fig. 4A). The WIN posi-
tive effect was completely abolished when the cells were pretreated for
15 min with AM251 (10
−7
M), a selective CB1 antagonist (Fig. 4A).
We also analyzed kidney cortex homogenates from control rats.
Animals were treated with different concentrations of WIN
(10
−5
M–10
−8
M) for 30 min and we showed that 10
−7
and 10
−8
M
were able to increase Na
+
/K
+
ATPase activity (Fig. 4B). Using the in
vivo model, we showed that IR injury promotes a reduction in Na
+
/K
+
ATPase activity, and treatment with WIN 10
−7
M recovered the Na
+
/
K
+
ATPase activity in kidney cortex homogenates under IR conditions
(Fig. 4C).
As mentioned, in vitro or in vivo IR injury not only alters Na
+
/K
+
ATPase activity, but also its expression and cellular localization.
L.S. Sampaio et al. Biochemical Pharmacology 154 (2018) 482–491
485
Therefore, we evaluated the expression of Na
+
/K
+
ATPase in our ex-
perimental models. LLC-PK1 cultures were subjected to total protein
extraction and analysis by electrophoresis or prepared for im-
munocytochemistry after antimycin A protocol (IR) and treatments.
Our data show that after IR, Na
+
/K
+
ATPase expression was reduced in
LLC-PK1 cells (Fig. 5A and B). Addition of 10
−7
M WIN restored the
expression levels of the Na
+
/K
+
ATPase to those observed in control
cells, while CB1 blockage by AM251 10
−7
M abolished this recovery
(Fig. 5A and B). In the kidney cortex we evaluated the Na
+
/K
+
ATPase
in Sham and IR groups, and in agreement with previously published
studies [7,8], we found that after the IR injury there was a decrease in
Na
+
/K
+
ATPase expression (Fig. 5C). We also showed that the cellular
expression of Na
+
/K
+
ATPase was altered by IR in proximal tubule
(Fig. 5D), where the enzyme is present solely in the basolateral mem-
brane in Sham kidney, whereas after IR the Na
+
/K
+
ATPase is also
localized in the apical membrane (Fig. 5D). We performed the same
analysis using control rats, which were not submitted to the surgical
procedures and the level of Na
+
/K
+
ATPase expression and also its
distribution is very similar to that from kidneys of the Sham group (data
not shown).
4. Discussion
The ECS is an important pro-homeostatic system associated to dif-
ferent types of cellular injuries, both in vitro and in vivo. Its role either in
protecting or promoting injury in different tissues, via different mole-
cular mechanisms and in different pathological conditions, is also
known. This is true for the injury arising from ischemia and reperfusion
(IR), where this dualistic role of the ECS has been already pointed out
[1,3,22,23]. In the kidney, some studies have sought to assess this ECS
paradox in IR conditions. It was shown that administration of CB1/CB2
receptor agonists could be able to provide protection to the kidney,
thereby decreasing the impact of the injury caused by blood flow
changes [24]. However, it was not clear which receptors were involved
in this action, since administration of either selective CB1 or CB2
agonists was able to generate protection to the renal tissue. Further-
more, the agonists were administered 30 min before in vivo IR, and it is
not known if their protective action would have been observed also
following IR.
Here we used LLC-PK1 epithelial cells, derived from pig kidney
proximal tubules, and cortex homogenates from Wistar rat kidneys, to:
1) evaluate the effect of an in vitro model of IR (ATP depletion induced
Fig. 1. In vitro and in vivo IR causes reduction of the levels of endocannabinoids and related N-acylethanolamines. After IR induction performed as described in
Section 2, total lipids were extracted and analyzed for their N-acyletanolamine (including anandamide –AEA, N-palmitoylethanolamine –PEA and N-oleyletha-
nolamine –OEA) and 2-arachidonoylglycerol (2-AG) content. White bars represent controls and black bars IR groups. Analysis showed a reduction in the levels of the
two endocannabinoids, AEA (A) and 2-AG (B) and also of PEA (C) and OEA (D), in the in vitro model (LLC-PK1 cells) and a specific AEA decrease (A) in the in vivo
model (rat kidney cortex homogenate), whereas the levels of total lipids were not significantly altered (E) in the two models. Number of experiments ≥3 (in
duplicate), statistical analysis by ANOVA (nonparametric) with Tukey post-test, P < 0.05.
L.S. Sampaio et al. Biochemical Pharmacology 154 (2018) 482–491
486
Fig. 2. Changes in the expression of endocannabinoid metabolic enzymes and cannabinoid receptors in LLC-PK1 cells following in vitro IR. In vitro ischemia was
mimicked by the addition of 10
−6
M antimycin A for 30 min and reperfusion for 24 h (IR). White bars represent control and black bars IR groups. A, Reduction in the
expression of PTNP-22 expression levels in the IR group compared to control and other key enzymes of N-acyletanolamine biosynthesis. B, No change was observed in
the levels of enzymes that synthesize 2-AG. C, Increased expression of MAGL mRNA levels compared to control and other endocannabinoid degrading enzymes under
IR conditions. D, Reduction in the expression of CB1, but not of CB2 or TRPV1, receptors following IR. Number of experiments = 3 (performed in quadruplicate),
statistical analysis by the Student’st-test, P < 0.05.
Fig. 3. In vitro and in vivo IR injuries cause CB1 downregulation. In vitro and in vivo IR were performed as described in Section 2. For western blot analysis, we used an
aliquot of 50 μg of total proteins for each lane. A, In vitro representative images of the proteins of interest (FAAH, MAGL, PTPN22, CB1 and CB2) and β-actin as
loading control. B, Quantification for each analyzed protein, where the white bars represent the control condition and the black bars the LLC-PK1 IR groups
(antimycin A treatment). C, In vivo, representative images of the proteins of interest (FAAH, MAGL, NAPE-PLD, CB1 and CB2) and β-actin as loading control. D,
Quantification for each analyzed protein, white bars represent the sham group while black bars the IR groups of renal cortex homogenates. Number of experi-
ments ≥4, statistical analysis by the Student’st-test, P ≤0.05.
L.S. Sampaio et al. Biochemical Pharmacology 154 (2018) 482–491
487
by the antimycin A treatment) on the ECS, and hence investigate the
role of the latter system on any putative alteration induced by IR on the
Na
+
/K
+
ATPase; and 2) bring new evidence and additional experi-
mental data to suggest that ECS targeting can minimize such patholo-
gical alterations. The in vitro IR lesion was mimicked by using anti-
mycin A, a drug able to block mitochondrial respiration, leading to a
decrease in the intracellular concentration of ATP. Reperfusion was
achieved through drug withdrawal and reestablishment of normal cell
culture conditions, being this model an in vitro protocol able to promote
important changes in epithelial kidney cells [10,11]. Further, we also
performed IR in vivo in Wistar rats, through the bilateral obstruction of
the renal arteries, for 30 min following 24 h of reperfusion, and this
model promotes all the characteristic changes in the physiological renal
tissue [12].
Using the in vitro model of IR, we observed the upregulation of
MAGL, and downregulation of CB1, mRNA and protein levels in LLC-
PK1 cells. The changes in MAGL expression may explain why IR was
also accompanied by a decrease in 2-AG levels. On the other hand, in
the in vivo model we observed a specific decrease in AEA levels followed
by NAPE-PLD and FAAH downregulation.
Both AEA and 2-AG are CB1 and CB2 partial agonists but the former
compound displays lower intrinsic activity for CB2 than CB1 [25].
Several groups have shown the presence of ECS in the renal tissue,
acting in different functions, especially through AEA signaling. This is
shown for relaxation on the renal endothelium [26] or dilation of the
afferent and efferent arterioles and decreased glomerular filtration
[27], even if expression of this system is low compared to other tissues,
such as the central nervous system. In addition, studies have shown that
AEA administration in rat renal medulla promotes a decrease in blood
pressure through interaction with CB1, and increased urine volume due
to interaction with TRPV1 receptors [28].
Concomitantly, IR also caused a reduction in CB1 mRNA and in
protein expression in our in vitro and in vivo models. It is known that
WIN modulates Na
+
/K
+
ATPase activity through a CB1-PKC signaling
pathway in LLC-PK1 cells [9]. However, it is unknown how these me-
chanisms operate in vivo. Rat kidneys have been evaluated in patho-
physiological cases where ECS receptors have been shown to modify
renal output. CB1 activation is associated with lesion progression, while
CB1 inhibition together with CB2 activation show an important pro-
tective role in diabetic nephropathy [29,30], but details of how CB1
and CB2 operate are not fully understood. One marker in diabetic ne-
phropathy is the increase in Na
+
/K
+
ATPase activity and expression
[31], but it is unknown if CB1 activation is directly involved.
The IR injury is able to change the basal activity and expression of
the main ion transporter for kidney physiology: the Na
+
/K
+
ATPase.
Since we previously reported that stimulation of CB1 receptors in LLC-
PK1 cells enhances Na
+
/K
+
ATPase activity [9], it is tempting to
speculate that the observed decrease in the activity of this ion pump
following IR could be due to IR-induced impairment of CB1 signaling.
Accordingly, the CB1/CB2 agonist WIN was shown here to reverse the
IR-induced decrease in Na
+
/K
+
ATPase activity and expression, in a
CB1-dependent manner, as its effect was fully reversed by pretreatment
of the cells with the CB1 receptor antagonist, AM251. The ability of
WIN to increase Na
+
/K
+
ATPase activity after IR was confirmed in rat
kidney cortex homogenates in vivo model.
In addition to AEA and 2-AG levels, we also analyzed the levels of
two other N-acylethanolamines, OEA and PEA, in agreement with the
fact that these compounds are also biosynthesized and degraded by the
same enzymes as AEA. However, OEA and PEA are not considered
endocannabinoids, since they do not directly activate CB1 or CB2 re-
ceptors [32]. In fact, there are studies showing a significant participa-
tion of other N-acylethanolamines in IR injury models, such as PEA, an
agonist of peroxisome proliferator-activated receptor alpha (PPAR-α)
with potent anti-inflammatory effects, which can reduce the damage
caused by both intestinal and renal IR [33,34].
Our data also confirms that the type of endocannabinoid whose
Fig. 4. WIN promotes the recovery of Na
+
/K
+
ATPase activity after IR in-
duction in both an in vitro and in vivo model. In LLC-PK1 cells WIN effect was
antagonized by a CB1 antagonist. A, Under basal conditions (control), treat-
ment of LLC-PK1 cells with 10
−7
M WIN, a cannabinoid receptor agonist, for
30 min enhanced the activity of the Na
+
/K
+
ATPase, whereas pre-treatment
with 10
−7
M AM251, a selective CB1 antagonist, for 15 min, prevented the WIN
effect. Basal activity of the Na
+
/K
+
ATPase is reduced after antimycin A
treatment in LLC-PK1 cells (black bar) and addition of WIN recovered Na
+
/K
+
ATPase activity to control levels (white bars), whilst CB1 blockage counteracted
this effect. Number of experiments = 6 (in triplicate) analysis by ANOVA with
Tukey post-test, P < 0.05. B, Kidney cortex homogenates were treated with
different concentration of WIN for 30 min. WIN 10
−7
M and 10
−8
M treatment
increased the Na
+
/K
+
ATPase activity in kidney cortex homogenates from
control rats (CONT). Number of experiments = 5 (in triplicate) analysis by
ANOVA with Tukey post-test, *P < 0.05, **P < 0.001. C, In CONT (white
bar) and SHAM (grey bar) groups the treatment with WIN 10
−7
M for 30 min
increases the Na
+
/K
+
ATPase activity in kidney cortex homogenates. In vivo IR
model (black bar) shows a decrease in Na
+
/K
+
ATPase activity when compared
to CONT and SHAM and treatment for 30 min with WIN 10
−7
M was enough to
recover the Na
+
/K
+
ATPase activity in the IR kidney cortex homogenates.
Number of experiments = 4 (in triplicate) analysis by ANOVA with Tukey post-
test, P < 0.05.
L.S. Sampaio et al. Biochemical Pharmacology 154 (2018) 482–491
488
levels are affected by IR, and the direction of the alteration, might differ
among models, cell types and species. In fact, it was shown that after IR-
induced liver injury the levels of 2-AG were enhanced and could be
used as an oxidative stress marker of this pathological condition [35].
On the other hand, it was demonstrated that after an IR process in brain
striatum, AEA levels are increased [36]. In these studies, the IR meth-
odology consisted of an acute procedure with 90 or 120 min of ischemia
following 120 or 60 min of reperfusion, respectively. Another study
investigating high intraocular pressure (IOP)-induced ischemia in the
mouse retina showed an increase in FAAH activity and in protein ex-
pression, and a possibly subsequent decrease in AEA levels upon 45 min
of ischemia followed by 12 h of reperfusion [37].
One may wonder about the physiological relevance of our present
findings, obtained mainly in immortalized proximal tubule-derived
LLC-PK1 epithelial cells. However, deep alterations in renal tubule
structure have been reported following IR [5,6,8]. Furthermore, both
CB1 and CB2 receptors have been identified in human and animal
kidneys in addition to primary and kidney cell lines, reviewed in Ref.
[38]. Although CB1 expression in all renal cells, including epithelial
tubular cells, is well established, evidence for the presence of CB2 in
healthy kidney is still controversial [39]. Modulation of both CB1 and
CB2 has a wide range of anti-inflammatory and neuroprotective re-
sponses, turning these receptors into promising therapeutic targets in
tissues affected by IR [1,3]. Several studies reported the involvement of
CB2 receptors in the protection and recovery from IR of peripheral
tissues besides kidneys, for example the liver [40] and heart [41,42].
On the other hand, CB1 downregulation, as well as its decreased acti-
vation upon IR, have been related to cytoprotection [37]. However, it
was shown recently that activation of CB1 can also restore cell viability,
reduce cell apoptosis, increase ROS and induce structural and func-
tional impairments in mitochondria both in vitro and in vivo models of
cerebral IR [43]. Our present data add one more option, i.e. the reversal
of IR-induced impairment of Na
+
/K
+
ATPase, to the wide range of
possible cytoprotective mechanisms associated with CB1 activation.
Indeed, Na
+
/K
+
ATPase activity and expression are significantly re-
duced in cerebral IR (from 6 h to 7 days) [44,45].
Fig. 5. WIN treatment restores Na
+
/K
+
ATPase expression and cellular localization after induction of IR in LLC-PK1 cells. A, In vitro IR in LLC-PK1 cells causes a
significant reduction in the levels of Na
+
/K
+
ATPase expression, measured by western blotting of whole protein extracts from LLC-PK1 cell homogenates (black bar).
After IR, treatment with 10
−7
M WIN for 30 min restores Na
+
/K
+
ATPase expression, this effect being abolished when cells are pre-treated with 10
−7
M AM251 for
15 min. In vitro IR was performed as described in Section 2. Data show a representative image for the immunodetection of Na
+
/K
+
ATPase and β-actin and the
immunodetection quantification. Number of experiments =8, analysis by ANOVA (non parametric) with Tukey post-test, P < 0.05. B, The immunofluorescence of
Na
+
/K
+
ATPase (red) in LLC-PK1 cells shows a reduction in Na
+
/K
+
ATPase expression after the IR protocol. IR LLC-PK1 cell incubation with WIN shows a normal
Na
+
/K
+
ATPase expression, but this effect is inhibited by AM251 pre-treatment. In blue the nucleus of the cells. Number of experiments = 8, scale bar: 20 µm, all
images were obtained with 40× magnification using a fluorescence microscope ApoTome (Zeiss). C, In vivo IR in kidneys promotes a decrease in Na
+
/K
+
ATPase
expression in cortex homogenates when compared to SHAM, observed in western blots of total protein extracts. The data show a representative image for the
immunodetection of Na
+
/K
+
ATPase and β-actin, number of experiments = 3. D, Kidney immunofluorescence shows the Na
+
/K
+
ATPase (red) located only in the
basolateral membrane (white arrow) of the proximal tubules (cortex corticcis) in the SHAM group, but in the IR group it is possible to see the Na
+
/K
+
ATPase (red)
also in the apical membrane (yellow arrow) of the cells. In blue the nucleus of the cells. Number of experiments = 3; scale bar = 20 µm, images on the top panel were
obtained with 20×, while the images from bottom panel with 40× magnification in a fluorescence microscope ApoTome (Zeiss). To confirm the preservation of renal
structures, differential interference contrast (DIC) images of the kidneys of both groups were performed. Red Asterisks indicate the glomeruli and white ones indicate
renal tubules. Scale bar = 20 µm, images were obtained with 5× magnification with a Axiovert 35 microscope (Zeiss). (For interpretation of the references to colour
in this figure legend, the reader is referred to the web version of this article.)
L.S. Sampaio et al. Biochemical Pharmacology 154 (2018) 482–491
489
In conclusion, in vitro and in vivo IR reduced both endocannabinoid
signaling and Na
+
/K
+
ATPase expression and activity in LLC-PK1 cells
and rat kidney cortex. Addition of a CB1/CB2 agonist restored Na
+
/K
+
ATPase function in a CB1-dependent manner in LLCP-K1 cells.
Collectively, our results point to CB1 receptors as a new pro-homeo-
static mechanism for the re-establishment of correct Na
+
/K
+
ATPase
function after IR injury in proximal tubule renal cells. CB1 receptor
agonists and/or inhibitors of endocannabinoid inactivating enzymes
might represent a new approach for the treatment of IR-induced kidney
disease.
Acknowledgements
The authors would like to thank Mr. Celso Pereira for helpful
technician help. Supported by grants from CAPES, CNPq, CABBIO and
FAPERJ.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in the
online version, at https://doi.org/10.1016/j.bcp.2018.06.005.
References
[1] P. Pacher, G. Kunos, Modulating the endocannabinoid system in human health and
disease–successes and failures, FEBS J. 280 (9) (2013) 1918–1943.
[2] F.A. Iannotti, V. Di Marzo, S. Petrosino, Endocannabinoids and endocannabinoid-
related mediators: targets, metabolism and role in neurological disorders, Prog.
Lipid Res. 62 (2016) 107–128.
[3] P. Pacher, G. Hasko, Endocannabinoids and cannabinoid receptors in ischaemia-
reperfusion injury and preconditioning, Br. J. Pharmacol. 153 (2) (2008) 252–262.
[4] J.V. Bonventre, A. Zuk, Ischemic acute renal failure: an inflammatory disease?
Kidney Int. 66 (2) (2004) 480–485.
[5] G. Coux, L. Trumper, M.M. Elias, Cortical Na+, K+-ATPase activity, abundance
and distribution after in vivo renal ischemia without reperfusion in rats, Nephron
89 (1) (2001) 82–89.
[6] E. Feraille, A. Doucet, Sodium-potassium-adenosinetriphosphatase-dependent so-
dium transport in the kidney: hormonal control, Physiol. Rev. 81 (1) (2001)
345–418.
[7] B.A. Molitoris, R. Dahl, A. Geerdes, Cytoskeleton disruption and apical redistribu-
tion of proximal tubule Na(+)-K(+)-ATPase during ischemia, Am. J. Physiol. 263
(3 Pt 2) (1992) F488–F495.
[8] F.A. Wald, Y. Figueroa, A.S. Oriolo, P.J. Salas, Membrane repolarization is delayed
in proximal tubules after ischemia-reperfusion: possible role of microtubule-orga-
nizing centers, Am. J. Physiol. Renal Physiol. 285 (2) (2003) F230–F240.
[9] L.S. Sampaio, R. Taveira Da Silva, D. Lima, C.L. Sampaio, F.A. Iannotti,
E. Mazzarella, V. Di Marzo, A. Vieyra, R.A. Reis, M. Einicker-Lamas, The en-
docannabinoid system in renal cells: regulation of Na(+) transport by CB1 re-
ceptors through distinct cell signalling pathways, Br. J. Pharmacol. 172 (19) (2015)
4615–4625.
[10] R.S. Lindoso, D.S. Araujo, J. Adao-Novaes, R.M. Mariante, K.S. Verdoorn, L. Fragel-
Madeira, C. Caruso-Neves, R. Linden, A. Vieyra, M. Einicker-Lamas, Paracrine in-
teraction between bone marrow-derived stem cells and renal epithelial cells, Cell.
Physiol. Biochem. 28 (2) (2011) 267–278.
[11] G.A. Kurian, B. Pemaih, Standardization of in vitro cell-based model for renal
ischemia and reperfusion injury, Indian J. Pharm. Sci. 76 (4) (2014) 348–353.
[12] H.J. Beiral, C. Rodrigues-Ferreira, A.M. Fernandes, S.R. Gonsalez, N.C. Mortari,
C.M. Takiya, M.M. Sorenson, C. Figueiredo-Freitas, A. Galina, A. Vieyra, The impact
of stem cells on electron fluxes, proton translocation, and ATP synthesis in kidney
mitochondria after ischemia/reperfusion, Cell Transplant. 23 (2) (2014) 207–220.
[13] P.A. Silva, G. Monnerat-Cahli, A. Pereira-Acacio, R. Luzardo, L.S. Sampaio,
M.A. Luna-Leite, L.S. Lara, M. Einicker-Lamas, R. Panizzutti, C. Madeira,
L.D. Vieira-Filho, C. Castro-Chaves, V.S. Ribeiro, A.D. Paixao, E. Medei, A. Vieyra,
Mechanisms involving Ang II and MAPK/ERK1/2 signaling pathways underlie
cardiac and renal alterations during chronic undernutrition, PLoS One 9 (7) (2014)
e100410.
[14] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, Protein measurement with the
Folin phenol reagent, J. Biol. Chem. 193 (1) (1951) 265–275.
[15] V. Di Marzo, S.K. Goparaju, L. Wang, J. Liu, S. Batkai, Z. Jarai, F. Fezza, G.I. Miura,
R.D. Palmiter, T. Sugiura, G. Kunos, Leptin-regulated endocannabinoids are in-
volved in maintaining food intake, Nature 410 (6830) (2001) 822–825.
[16] L.M. Krott, F. Piscitelli, M. Heine, S. Borrino, L. Scheja, C. Silvestri, J. Heeren, V. Di
Marzo, Endocannabinoid regulation in white and brown adipose tissue following
thermogenic activation, J. Lipid Res. 57 (3) (2016) 464–473.
[17] F.A. Iannotti, F. Piscitelli, A. Martella, E. Mazzarella, M. Allara, V. Palmieri,
C. Parrella, R. Capasso, V. Di Marzo, Analysis of the “endocannabinoidome”in
peripheral tissues of obese Zucker rats, Prostaglandins Leukot. Essent. Fatty Acids
89 (2–3) (2013) 127–135.
[18] H.H. Taussky, E. Shorr, A microcolorimetric method for the determination of in-
organic phosphorus, J. Biol. Chem. 202 (2) (1953) 675–685.
[19] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of
bacteriophage T4, Nature 227 (5259) (1970) 680–685.
[20] N. Ueda, K. Tsuboi, T. Uyama, Metabolism of endocannabinoids and related N-
acylethanolamines: canonical and alternative pathways, FEBS J 280 (9) (2013)
1874–1894.
[21] T. Matsuzaki, H. Watanabe, K. Yoshitome, T. Morisaki, A. Hamada, H. Nonoguchi,
Y. Kohda, K. Tomita, K. Inui, H. Saito, Downregulation of organic anion transporters
in rat kidney under ischemia/reperfusion-induced acute [corrected] renal failure,
Kidney Int. 71 (6) (2007) 539–547.
[22] C.J. Hillard, Role of cannabinoids and endocannabinoids in cerebral ischemia, Curr.
Pharm. Des. 14 (23) (2008) 2347–2361.
[23] R.F. Tuma, S. Steffens, Targeting the endocannabinod system to limit myocardial
and cerebral ischemic and reperfusion injury, Curr. Pharm. Biotechnol. 13 (1)
(2012) 46–58.
[24] A. Feizi, M.R. Jafari, F. Hamedivafa, P. Tabrizian, B. Djahanguiri, The preventive
effect of cannabinoids on reperfusion-induced ischemia of mouse kidney, Exp.
Toxicol. Pathol. 60 (4–5) (2008) 405–410.
[25] R.G. Pertwee, A.C. Howlett, M.E. Abood, S.P. Alexander, V. Di Marzo, M.R. Elphick,
P.J. Greasley, H.S. Hansen, G. Kunos, K. Mackie, R. Mechoulam, R.A. Ross,
International Union of Basic and Clinical Pharmacology. LXXIX. Cannabinoid re-
ceptors and their ligands: beyond CB(1) and CB(2), Pharmacol. Rev. 62 (4) (2010)
588–631.
[26] D.G. Deutsch, M.S. Goligorsky, P.C. Schmid, R.J. Krebsbach, H.H. Schmid, S.K. Das,
S.K. Dey, G. Arreaza, C. Thorup, G. Stefano, L.C. Moore, Production and physio-
logical actions of anandamide in the vasculature of the rat kidney, J. Clin. Invest.
100 (6) (1997) 1538–1546.
[27] Y. Koura, A. Ichihara, Y. Tada, Y. Kaneshiro, H. Okada, C.J. Temm, M. Hayashi,
T. Saruta, Anandamide decreases glomerular filtration rate through predominant
vasodilation of efferent arterioles in rat kidneys, J. Am. Soc. Nephrol. 15 (6) (2004)
1488–1494.
[28] J. Li, D.H. Wang, Differential mechanisms mediating depressor and diuretic effects
of anandamide, J. Hypertens. 24 (11) (2006) 2271–2276.
[29] F. Barutta, A. Corbelli, R. Mastrocola, R. Gambino, V. Di Marzo, S. Pinach,
M.P. Rastaldi, P.C. Perin, G. Gruden, Cannabinoid receptor 1 blockade ameliorates
albuminuria in experimental diabetic nephropathy, Diabetes 59 (4) (2010)
1046–1054.
[30] F. Barutta, F. Piscitelli, S. Pinach, G. Bruno, R. Gambino, M.P. Rastaldi, G. Salvidio,
V. Di Marzo, P. Cavallo Perin, G. Gruden, Protective role of cannabinoid receptor
type 2 in a mouse model of diabetic nephropathy, Diabetes 60 (9) (2011)
2386–2396.
[31] A. Fekete, K. Rosta, L. Wagner, A. Prokai, P. Degrell, E. Ruzicska, E. Vegh, M. Toth,
K. Ronai, K. Rusai, A. Somogyi, T. Tulassay, A.J. Szabo, A. Ver, Na+, K+-ATPase is
modulated by angiotensin II in diabetic rat kidney–another reason for diabetic
nephropathy? J. Physiol. 586 (22) (2008) 5337–5348.
[32] Y. Okamoto, J. Wang, J. Morishita, N. Ueda, Biosynthetic pathways of the en-
docannabinoid anandamide, Chem. Biodivers. 4 (8) (2007) 1842–1857.
[33] R. Di Paola, D. Impellizzeri, A. Torre, E. Mazzon, A. Cappellani, C. Faggio,
E. Esposito, F. Trischitta, S. Cuzzocrea, Effects of palmitoylethanolamide on in-
testinal injury and inflammation caused by ischemia-reperfusion in mice, J. Leukoc.
Biol. 91 (6) (2012) 911–920.
[34] R. Di Paola, D. Impellizzeri, P. Mondello, E. Velardi, C. Aloisi, A. Cappellani,
E. Esposito, S. Cuzzocrea, Palmitoylethanolamide reduces early renal dysfunction
and injury caused by experimental ischemia and reperfusion in mice, Shock 38 (4)
(2012) 356–366.
[35] Y. Ishii, T. Sakamoto, R. Ito, K. Yanaga, F2-isoprostanes and 2-arachidonylglycerol
as biomarkers of lipid peroxidation in pigs with hepatic ischemia/reperfusion in-
jury, J. Surg. Res. 161 (1) (2010) 139–145.
[36] D. Amantea, P. Spagnuolo, M. Bari, F. Fezza, C. Mazzei, C. Tassorelli, L.A. Morrone,
M.T. Corasaniti, M. Maccarrone, G. Bagetta, Modulation of the endocannabinoid
system by focal brain ischemia in the rat is involved in neuroprotection afforded by
17beta-estradiol, FEBS J 274 (17) (2007) 4464–4775.
[37] C. Nucci, V. Gasperi, R. Tartaglione, A. Cerulli, A. Terrinoni, M. Bari, C. De Simone,
A.F. Agro, L.A. Morrone, M.T. Corasaniti, G. Bagetta, M. Maccarrone, Involvement
of the endocannabinoid system in retinal damage after high intraocular pressure-
induced ischemia in rats, Invest. Ophthalmol. Vis. Sci. 48 (7) (2007) 2997–3004.
[38] D.H. Hryciw, A.J. McAinch, Cannabinoid receptors in the kidney, Curr. Opin.
Nephrol. Hypertens. 25 (5) (2016) 459–464.
[39] J. Tam, The emerging role of the endocannabinoid system in the pathogenesis and
treatment of kidney diseases, J. Basic Clin. Physiol. Pharmacol. 27 (3) (2016)
267–276.
[40] S. Batkai, D. Osei-Hyiaman, H. Pan, O. El-Assal, M. Rajesh, P. Mukhopadhyay,
F. Hong, J. Harvey-White, A. Jafri, G. Hasko, J.W. Huffman, B. Gao, G. Kunos,
P. Pacher, Cannabinoid-2 receptor mediates protection against hepatic ischemia/
reperfusion injury, FASEB J. 21 (8) (2007) 1788–1800.
[41] G.D. Duerr, J.C. Heinemann, G. Suchan, E. Kolobara, D. Wenzel, C. Geisen,
M. Matthey, K. Passe-Tietjen, W. Mahmud, A. Ghanem, K. Tiemann, J. Alferink,
S. Burgdorf, R. Buchalla, A. Zimmer, B. Lutz, A. Welz, B.K. Fleischmann, O. Dewald,
The endocannabinoid-CB2 receptor axis protects the ischemic heart at the early
stage of cardiomyopathy, Basic Res. Cardiol. 109 (4) (2014) 425.
[42] P.F. Wang, L.S. Jiang, J. Bu, X.J. Huang, W. Song, Y.P. Du, B. He, Cannabinoid-2
receptor activation protects against infarct and ischemia-reperfusion heart injury, J.
Cardiovasc. Pharmacol. 59 (4) (2012) 301–307.
[43] L. Ma, J. Jia, W. Niu, T. Jiang, Q. Zhai, L. Yang, F. Bai, Q. Wang, L. Xiong,
Mitochondrial CB1 receptor is involved in ACEA-induced protective effects on
L.S. Sampaio et al. Biochemical Pharmacology 154 (2018) 482–491
490
neurons and mitochondrial functions, Sci. Rep. 5 (2015) 12440.
[44] H. Huang, Y.M. Chen, F. Zhu, S.T. Tang, J.D. Xiao, L.L. Li, X.J. Lin, Down-regulated
Na(+)/K(+)-ATPase activity in ischemic penumbra after focal cerebral ischemia/
reperfusion in rats, Int. J. Clin. Exp. Pathol. 8 (10) (2015) 12708–12717.
[45] Y.W. Jung, I.J. Choi, T.H. Kwon, Altered expression of sodium transporters in is-
chemic penumbra after focal cerebral ischemia in rats, Neurosci. Res. 59 (2) (2007)
152–159.
L.S. Sampaio et al. Biochemical Pharmacology 154 (2018) 482–491
491
