Molecular Study of SHV-11 and SHV-12 Genes among Klebsiella Pneumoniae Isolated from UTI Patients in Erbil City

Full text

ZANCO Journal of Pure and Applied Sciences
The official scientific journal of Salahaddin University-Erbil
ZJPAS (2016), 28 (4); 25-35
Molecular Study of SHV-11 and SHV-12 Genes among Klebsiella Pneumoniae
Isolated from UTI Patients in Erbil City
Fairuz H. Abdullah Tawgozy1 Bushra K. Amin2
1,2 Department of Biology College of Science, Salahaddin University, Erbil, Iraq
*Corresponding Author; E-mail:
1. INTRODUCTION
Klebsiella pneumoniae (K. pneumoniae), is a
Gram-negative bacterium belongs to the
Enterobacteriaceae family. It is an important
opportunistic pathogen and a frequent cause of
urinary tract infections (UTIs) and pneumonia
(Podschun and Ullmann, 1998). It is the second
Gram negative causative agent of UTI
(Schembri et al., 2005). UTIs represent one of
the most common diseases encountered in
medical practice. There is a growing concern
regarding antimicrobial resistance worldwide,
particularly in K. pneumoniae and other
causative agents of UTIs (Rashed et al., 2008).
The predominant mechanism for
resistance to β-lactam antibiotics in gram-
negative bacteria is the production of β-
lactamase. In addition, production of extended-
spectrum β-lactamases (ESBLs) is another
important mechanism which is responsible for
resistance to the third-generation
cephalosporins (Paterson et al., 2003).
ESBLs are plasmid mediated enzymes that are
able to hydrolyse a wide variety of penicillins
and cephalosporins (Turner, 2005). ESBLs are
more prevalent in K. pneumoniae than in any
other Enterobacterial species. K. pneumoniae
isolates usually carry a chromosomal β-
lactamase, most commonly SHV (Hæggman et
al., 2004) and the plasmid variants have
probably derived from the chromosomal SHV
genes (Chaves et al., 2001). Plasmid-mediated
SHV-type ESBLs are wide spread in clinical
isolates of K. pneumoniae (Ryoo et al., 2005).
A R T I C L E I N F O
A B S T R A C T
Article History:
Received: 28/12/2015
Accepted: 19/04/2016
Published:10/10/2016
Among 350 urine samples collected from urinary tract infection patients in Erbil city,
(50) isolates were identified as Klebsiella pneumoniae using cultural, morphological
and biochemical characteristics. Their identity confirmed by Vitek2 system.
Extended-spectrum β-lactamase (ESBL) production determined by phenotypic and
molecular methods. Phenotypic detection methods include an initial screening by
using (ATM30, CTX5 and CI30), by which (52%) were resistant. Phenotypic ESBL
production was confirmed by DDST and CDM. Eight per cent of the isolates were
ESBL producer by DDST and (42%) were ESBL producer by CDM. Fifty per cent of
the isolates were ESBL producer by both methods. Polymerase Chain Reaction
(PCR) amplification used for detection of SHV-11 (a non- ESBL) gene in the
genomic DNA and SHV-12 (an ESBL) gene in the plasmid DNA. SHV-11 found in
the genomic DNA of 96% of ESBL producer isolates, while 88% of phenotypic
ESBL negative isolates contained SHV-11 in their genomic DNA. Seventy two per
cent of the phenotypic ESBL producer isolates had SHV-12 in their plasmid DNA,
whereas 44% of the phenotypic ESBL negative isolates contained SHV-12 in their
plasmid DNA. Out of 25 phenotypic ESBL producer isolates, 72% carried SHV-11
and SHV-12, whilst only 44% of phenotypic ESBL negative isolates contained both
genes.
Keywords:
Extended-spectrum β-
lactamase;
PCR;
SHV-12;
SHV-11
*Corresponding Author:
Fairuz H. Abdullah Tawgozy1
fairuzbio@yahoo.com

26 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
The SHV-β-lactamases comprise one of
the most clinically significant classes of β-
lactamase family. PCR and hybridisation
studies revealed that blaSHV genes are native to
K. pneumoniae chromosome (Ford and Avison,
2004). It has also been found on plasmids of K.
pneumoniae and some other members of
Enterobacteriaceae family such as E. coli, K.
oxytoca and Proteus mirabilis (Hirakata et al.,
2005). SHV-1 is encoded both chromosomally
and on plasmids in K. pneumoniae. SHV-β-
lactamases belong to group 2be β-lactamases.
Since SHV-β-lactamase gene is a normal part
of the K. pneumoniae chromosome, evidences
have shown that plasmid-borne blaSHV genes
are originated from chromosomal blaSHV genes
as a result of translocation via transposons and
insertion sequences such as insertion sequence
26 (IS26). The plasmid borne blaSHV carries
IS26 insertions (820 bp IS) either upstream of
the promotor or in it, which in turn reinforces
the promotor strength.
The aim of the present study was PCR
amplification of SHV-11 gene genomic DNA
and SHV-12 gene in plasmid DNA in of the
phenotypic ESBL producer and phenotypic
non-ESBL producer isolates of K. pneumoniae
in order to know whether presence of these
genes related to antibiotic resistance or not.
2.MATERIALS AND METHODS
2.1 BACTERIAL SAMPLES
Three-hundred and fifty urine samples were
collected during the period of 2nd of June to
5th of October 2012 from patients with urinary
tract infection admitted to Hawler Teaching,
Rizgary, Raparin and West Emergency
hospitals in Erbil city.
Urine samples were cultured on
MacConKey agar by streaking method and
incubated at 37˚C for 18-24 hours. The
suspected colonies were sub-cultured on
nutrient agar for obtaining pure culture.
The morphological characteristics of the
colonies were studied. The K. pneumoniae
isolates grow well on ordinary media at 37˚C
for 18-24 hours. On MacConkey agar the
colonies typically appear large, pink and
mucoid (Arora and Arora, 2008). The
biochemical tests performed for suspected
bacterial isolates include catalase, oxidase, urea
hydrolysis, citrate utilization, sugar
fermentation and motility tests (Atlas et al.,
1995). Moreover, VITEK 2 was used for
confirming the identity of the isolates.
2.2 DETECTION METHODS FOR ESBLS
2.2.1 PHENOTYPIC DETECTION
METHODS
With rising in number of ESBL
producing clinical isolates of bacteria there is
also requirement for their detection in the
laboratory (Al-Jasser, 2006). According to the
Clinical and Laboratory Standards Institute
(CLSI, 2011) guidelines for detection of
ESBL-production, an initial screening method
and phenotypic confirmatory tests based on
synergy between an indicator cephalosporin
and clavulanic acid was used.
Although these three antibiotic discs
(CTX, CI and ATM) were used as indicator of
ESBL production as the antibiotic sensitivity
testing was done, phenotypic confirmatory tests
was done for all of the isolates.
According to the CLSI, (2011)
recommendations, a disc of ceftazidime (30μg)
alone and in combination with clavulanic acid
(30/10μg) discs were used. The discs were
placed on a plate streaked with the isolate to be
tested within fifteen minutes. An increase of 5
mm or more in the zone diameter of
ceftazidime tested in combination with
clavulanic acid versus its zone when tested
alone, confirm the presence of ESBL
phenotype.
2.2.1.1 DOUBLE DISC SYNERGY TEST
(DDST)
In the same way as the antibiotic
sensitivity testing was done, a disc of
amoxicillin/clavulanic acid (20/10μg) placed

27 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
16 mm apart (centre to centre) from a disc
containing a third generation cephalosporin
(cefotaxime, ceftriaxone and aztreonam) on a
plate of Muller-Hinton inoculated and streaked
with the tested bacterium. Extension of the
edge of one of the cephalosporins or aztreonam
zone on the side exposed to the disc containing
clavulanic acid indicate the presence of ESBL
and the isolate should be considered as ESBL
producer (Freitas et al., 2003).
2.2.1.2. COMBINATION DISC METHOD
(CDM)
According to the CLSI, (2011)
recommendations, a disc of ceftazidime (30μg)
alone and in combination with clavulanic acid
(30/10μg) discs were used. The discs were
placed on a plate streaked with the isolate to be
tested within fifteen minutes. An increase of 5
mm or more in the zone diameter of
ceftazidime tested in combination with
clavulanic acid versus its zone when tested
alone, confirm the presence of ESBL
phenotype.
2.2.2 MOLECULAR DETECTION
METHOD
Since the phenotypic ESBL detection
methods do not provide an accurate
identification of an ESBL producer, detection
of the β-lactamase gene is a more precise
approach. In this study, specific primers were
designed for amplification of SHV-11 which is
a non-ESBL β-lactamase gene and SHV-12
which is an ESBL β-lactamase gene. PCR was
done for genomic DNA extracts of all fifty
isolates by using SHV-11 primers and plasmid
DNA extracts by using SHV-12 primers.
2.3 GENOMIC DNA EXTRACTION
The G-spin ™ genomic DNA extraction
kit was used for purification of genomic DNA
of the isolates. It is designed for rapid isolation
of genomic DNA from a variety of sample
sources.
2.4. Plasmid DNA extraction
Plasmid DNA was extracted from 5
millilitre (ml) of an overnight culture of the
isolates of K. pneumoniae grown in LB broth
medium containing an appropriate antibiotic by
using plasmid DNA purification kit (DNA-spin
Plasmid DNA Purification Kit/ iNtRON/
Korea). The extracted plasmid DNA was stored
at -20oC until using.
2.5 PCR AMPLIFICATION OF BLASHV-11
AND BLASHV-12 GENES
Specific oligonucleotide primers were
designed for SHV-11 and SHV-12 genes
according to blaSHV-11 and blaSHV-12 nucleotide
sequences by using Genius software.
Table (1): SHV-11 and SHV-12 primer sequences
Primer
Sequence
Amplicon
size (bp)
SHV-11 F
CCGGCGATTTGCTGATTTCG
463
SHV-11 R
CCGCCATTACCATGAGCGAT
SHV-12 F
GGATCTGGTGGACTACTCGC
461
SHV-12 R
TGTTATTCGGGCCAAGCAGG
PCR amplification was done for genomic DNA
extracts using SHV-11 primers and PCR
program was 94°C for 2 min. (initial
denaturation), 94°C for 1min. (denaturation),
64°C for 1min. (annealing), 72°C for 1min.
(extension) and 72°C for 10 min. (post
extension) and 35 cycles. The reaction mixture
is shown in the table (2).
Table (2): The reaction mixture of (25µl) reaction
volume for PCR used in the present study
PCR amplification was done for SHV-12
gene by using plasmid DNA extracts of all
isolates as template and SHV-12 primers. The
PCR program was 94°C for 2 min. (initial

28 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
denaturation), 94°C for 1min. (denaturation),
54°C for 1min. (annealing), 72°C for 1min.
(extension) and 72°C for 10min. (post
extension) and 35 cycles. The PCR reaction
tube components were the same as for SHV-11.
For running PCR products of both SHV-
11 and SHV-12, 1.2 gm agarose powder was
weighed and added to 100 ml of TBE buffer
and bring to boil. After cooling, the gel casted
and after solidification, the PCR products were
loaded into the wells in the gel, 5µl/well. Five
µl of 1500bpDNA ladder (Gene Direx) loaded
into one of the wells in the gel to determine the
size of the amplified products. The gels were
run at 45V/15 min., then at 135V/30-45min.
The gel stained with ethidium bromide,
visualised by UV-trans illuminator and
photographed.
The method described by Sambrook and
Russell, (2001) was used for gel
electrophoresis. The extracted plasmids were
electrophoresed in 0.7% agarose gel with Tris-
Borate Ethylene-Diamine Tetra-Acetic acid
(TBE), stained with ethidium bromide and
visualized under UV-light.
3.RESULTS AND DISCUSSION
Among 350 urine samples collected from
patients admitted to Hawler Teaching, Rizgary,
Raparin and West Emergency hospitals in Erbil
city during the period of 2nd of June to 5th of
October 2012, fifty isolates were identified as
K. pneumoniae.
The isolates of K. pneumoniae identified.On
MacConkey agar, the colonies of K.
pneumoniae are typically appear as large,
mucoid and pink (figure1) with red pigment
usually diffusing into the surrounding medium
indicating fermentation of lactose and acid
production (Winn et al., 2006).
Figure (1): K. pneumoniae colonies on MacConkey agar
All of the isolates were positive for
citrate, catalase and urease tests, whereas,
oxidase negative. They all ferment glucose and
lactose and gave yellow slant and yellow butt
(acidic/acidic) reaction, while H2S negative.
Furthermore, they were non-motile. The
identity of the isolates was confirmed by using
Vitek2 system. The sheet of the results of
identification by Vitek2 system is shown in the
appendix. It shows that the isolates were
identified as K. pneumoniae subsp.
pneumoniae with probability of 99% which is
considered as an excellent level of
identification.
ESBL screening by disc diffusion method
was done for all fifty K. pneumoniae isolates
by using three antibiotic discs as screening
agent which were CTX, CI and ATM
according to CLSI, (2011) recommendations.
Out of these fifty, thirty-four isolates (68%)
were resistant to at least one of the three ESBL
screening agents. Twenty-six (52%) of the
isolates were resistant to all the three tested
antibiotics, one isolate was resistant for CI and
ATM, three isolates showed resistance against
CTX and ATM, one isolate resistant for CTX
and CI, one isolate resistant for ATM and CI,
one of them resistant for CI and two isolates
resistant for ATM alone. The present results
agree with that of Shukla et al., (2004) who
reported that 72% of the isolates were resistant
to the 3GCs tested. However, they are
incompatible with the results of Subha and
Ananthan, (2002) who found that 87% of their
isolates showed resistance to all the three
3GCs.
Extended-spectrum β-lactamases have
been found in a wide range of Gram-negative
bacteria and has emerged as an important
mechanism of resistance in these bacteria.
However, the major strains expressing these
enzymes belong to the family
Enterobacteriaceae (Ramazanzadeh, 2010), K.
pneumoniae remains as the major ESBL-

29 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
producing organism isolated worldwide (Iroha
et al., 2011). In addition, over reliance on
3GCs for treatment of Gram negative
infections is one of the prime factors
responsible for increased resistance to this class
of antibiotics. As ESBLs are frequently
encoded by genes located on different
transferrable genetic elements, a variety of
epidemiological situations have been identified
(Widmer, 2008).
Among fifty isolates tested to know
whether they are ESBL producer or not by
DDST, only four (8%) of them gave positive
result. As it is shown in the figure (2), the
synergy between a cephalosporin and
clavulanic acid indicate a positive result. This
result agrees with that of Subha and Ananthan,
(2002) who reported that 6.66% of K.
pneumoniae isolates are ESBL positive by
DDST.Although DDST is considered as a
reliable method for ESBL detection, it has been
known to suffer from the non-standardization
of the distance of disc placement (Tofteland et
al., 2007). Another reason may be AmpC
enzymes which are induced by clavulanate
(which inhibit them poorly) and may then
attack the cephalosporins, masking synergy
arising from inhibition of the ESBL (Pfaller
and Segreti, 2006). This can be a cause of
disagreement of the current study with the
previously mentioned ones, in addition to
geographical differences.
Figure (2): ESBL detection by double disc synergy test
(ESBL positive)
Figure (3): ESBL detection by combination disc method
(ESBL positive)
Out of fifty isolates tested for detection
of ESBL production by CDM, twenty-one
(42%) of them were confirmed as ESBL
producer. An increase of 5 mm or more in the
inhibition zone diameter for ceftazidime tested
in combination with clavulanic acid versus its
zone when tested alone, confirm the presence
of ESBL phenotype (figure 3).
The present result is in agreement with
that of Nasehi et al., (2010) who showed that
38.5% of their K. pneumoniae isolates had
ESBL phenotype by this method. Among 52%
of the isolates which were resistant to all three
ESBL screening agents, twenty-five (50%)
were confirmed as ESBL producer by both
methods together, CDM identified (42%) alone
and (8%) identified by DDST. It has been
reported that 57.1% of K. pneumoniae were
phenotypic ESBL producer based on
phenotypic confirmatory tests, DDST and
CDM which is in agreement with the current
result (Taşli and Bahar, 2005). The present
result is in agreement with the study that was
carried out by Fazly Bazzaz et al., (2009) who
showed that the prevalence of ESBL producing
K. pneumoniae was 61% by the phenotypic
disc confirmatory tests. The overall high
prevalence of ESBL-positive K. pneumoniae
may be due to the lack of chromosomally
encoded AmpC β-lactamases in the genus
Klebsiella (Tofteland et al., 2007).
Out of 25 phenotypic ESBL producer
isolates in the present study, 17 (68%) resist all
three tested screening agents, while only 9

30 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
(36%) of phenotypic ESBL negative isolates
were resistant during ESBL screening test. The
current results indicate that ESBL screening
can be used for presumptive identification of
potential ESBL producers among urinary
isolates of K. pneumoniae.
The use of phenotypic tests for detection
of ESBL producing microorganisms remains
an issue, causing a great deal of discussion and
controversy. Some factors such as production
of different β-lactamases by the same
microorganism could lead to erroneous
conclusions (Sanguinetti, 2003). Tests based on
the detection of ESBLs by PCR are more
conclusive in defining ESBL production
(Steward, 2001). Recently, molecular methods
have been shown to be absolutely necessary to
detect specific ESBL type (Taşli and Bahar,
2005).
In this study SHV-11 which is a non-
ESBL β-lactamase gene and SHV-12 which is
an ESBL β-lactamase gene were amplified by
using specific primers designed for them. PCR
was done for genomic DNA extracts of all fifty
isolates using SHV-11 primers and for their
plasmid DNA extracts using SHV-12 primers.
After extraction of genomic DNA from
all K. pneumoniae isolates by PCR and gel
electrophoresis were carried out to screen and
determine the presence of blaSHV-11 in the
DNA of K. pneumoniae. PCR was performed
on template DNA of each bacterial isolate
separately for amplification of blaSHV-11
gene via the use of specified oligonucleotide
primers that flanked DNA sequence to be
amplified. After amplification of blaSHV-11
gene, PCR products of all bacterial samples
were ran in agarose gel and visualised by UV-
transilluminator to detect the presence of the
gene. The present results show that out of fifty
isolates of K. pneumoniae, forty-six (92%)
contain blaSHV-11 gene in their genomic
DNA. Although, all isolates in the current
study were resistant for ampicillin, only 92%
possess blaSHV-11 in the genomic DNA. This
suggests that ampicillin resistance in those
isolates which lack blaSHV-11 in their
genomic DNA may be due to blaSHV-1 or
plasmid encoded blaSHV-11, because
blaSHV-1 which is the ancestor of blaSHV-11
is responsible for about 20% of plasmid
encoded ampicillin resistance in K.
pneumoniae (Tzouvelekis and Bonomo, 1999).
Moreover, this result is compatible with that of
Younes, (2010) who stated that only 90%
(54/60) of tested K. pneumoniae in his study
were positive by PCR for SHV genes, despite
expectation that K. pneumoniae isolates present
an intrinsic resistance to ampicillin (Heritage et
al., 1999). Similar resistance findings reported
that 95% (178/187) of K. pneumoniae isolates
collected from Portugal showed reduced
susceptibility to ampicillin had blaSHV
(Mendonça, 2009). Ozdemir et al., (2013)
showed that the gene which was responsible
for resistance to AMP reside in a 5000 bp
mobile DNA segment which had the ability to
translocate itself.
The figure (4) shows the results of PCR
amplification of blaSHV-11 of the phenotypic
ESBL positive K. pneumoniae UTI isolates.
After running of PCR products in agarose gel,
the isolates which gave positive result in PCR,
produced a band of 463 bp, which indicated the
presence of blaSHV-11 gene.
Figure (4): Agarose gel electrophoresis (1.2% agarose
for 60-90 minutes) of amplified PCR products of
blaSHV-11 gene (Genomic DNA) of phenotypic ESBL
positive isolates
Lane L: 1500 bp DNA ladder

31 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
Lane 1-41: Amplified PCR product of
blaSHV-11 of phenotypic ESBL positive
isolates
Among phenotypic ESBL producer
isolates, blaSHV-11 found in the genomic
DNA of twenty-four (96%) of the isolates.
The present result is similar to that of
Ghafourian et al., (2011) who reported that
among 67 phenotypic ESBL producer isolates
of K. pneumoniae, PCR amplification of
blaSHV gene in genomic DNA was positive in
94% of the isolates. It has also been shown that
100% of phenotypic ESBL producer isolates of
K. pneumoniae had blaSHV gene in their
genomic DNA by PCR amplification
(Tribuddharat et al., 2007).
Among phenotypic ESBL negative
isolates of K. pneumoniae, twenty-two (88%)
contained blaSHV-11 in their genomic DNA as
shown in the figure (5).
Figure (5): Agarose gel electrophoresis (1.2% agarose
for 60-90 minutes) of amplified PCR products of
blaSHV-11 gene (Genomic DNA) of phenotypic ESBL
negative isolates
Lane L: 1500 bp DNA ladder
Lane 7-46: Amplified blaSHV-11 of ESBL negative
isolates
Consistent with previous results by
Younes, (2010) who demonstrated that
blaSHV-11 was the most prevalent gene
described in his study, blaSHV-11 was highly
prevalent in the current investigation and
among 25 phenotypic ESBL negative isolates
23 isolates possess blaSHV-11. Moreover, out
of 21 isolates included in the study of Lee et
al., (2006) seventeen isolates contain blaSHV-
11 alone and associated with blaSHV-12 in 4
isolates. The blaSHV-11 has been described
most often in K. pneumoniae (Nuesch-
Inderbinen et al., 1997) and may be the
ancestor of blaSHV-2a and blaSHV-12 (Ford
and Avison, 2004). The non-ESBL phenotype
conferred by SHV-11 shows that the Leu35Gln
substitution between SHV-11 and SHV-1 has
little or no significance with respect to
hydrolysis of expanded-spectrum
cephalosporins, therefore, its appearance is
likely to be due to drift rather than antibiotic
selection (Howard, et al. 2002).
In addition, the result of the present study
is in concordance with that of Oliveira et al.,
(2010) who performed PCR for genomic DNA
of all isolates in their study and found that SHV
genotype was present in 78.1% of the K.
pneumoniae isolates.
PCR amplification of blaSHV-12 gene
was performed for plasmid DNA extracts of all
of the isolates by using specific oligonucleotide
primers. Among fifty isolates, twenty-nine
(58%) had blaSHV-12 gene in their plasmids.
Among blaSHV-carrying ESBL producer K.
pneumoniae isolates, 51.4% of the genes
encoded non-ESBL SHV-11, while the rest
produced SHV-type ESBLs, including SHV-12
(34.6%) (Kiratisin et al., 2008). This is
disagree with the results of the present study
which may be due to that PCR amplification
was done only for ESBL positive isolates in
their study.
Among phenotypic ESBL producer
isolates, 72% had blaSHV-12 in their plasmid
DNA and gave a band of 461 bp, whereas 24%
(6 isolates) lack the gene (figure 6). This
absence of blaSHV-12 and presence of ESBL
phenotype could be attributed to hyper
production of non-ESBL β-lactamases, SHV-1
or SHV-11, due to high gene copy number or a
single base pair change in promoter sequence,
or modifications in outer membrane proteins
co-existing with TEM-1, SHV-1 and SHV-11.
These result in conferring an ESBL similar
phenotype causing false positive results (Wu et
al., 2001). The presence of other types of

32 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
ESBL genes could be counted as another
reason for ESBL phenotype in these isolates
Figure (6): Agarose gel electrophoresis (1.2% agarose
for 60-90 minutes) of amplified PCR products of
blaSHV-12 gene (Plasmid DNA) of phenotypic ESBL
positive isolates
Lane L: 1500 bp DNA ladder
Lanes 1-31: Amplified blaSHV-12 of phenotypic ESBL
positive isolates
The present findings are consistent with
the study of Paterson et al., (2003) who
demonstrated that SHV-type ESBLs were the
most common ESBLs, occurring in 67.1% (49
of 73) of isolates of K. pneumoniae with
phenotypic evidence of ESBL production. It is
also agree with that of (Taşli and Bahar, 2005).
They detected SHV-type ESBLs in 74.3% of
the isolates and among 18 sequenced SHV
amplicons, 5 were SHV-12 (27.7%).
Lin et al., (2010) and Severin et al.,
(2010) found that 100% and 65.3% of their
phenotypic ESBL positive K.pneumoniae
isolates had SHV type ESBL in their plasmid
DNA. The latter showed that (27.6%) of SHV
type ESBLs were of SHV-12 type.
Of the phenotypic ESBL negative isolates of K.
pneumoniae included in the present study, eleven
(44%) isolates contained blaSHV-12 in plasmid
DNA, while the rest lack blaSHV-12 in their
plasmid DNA (figure 7).
Figure (7): Agarose gel electrophoresis (1.2% agarose
for 60-90 minutes) of amplified PCR products of
blaSHV-12 gene (Plasmid DNA) of phenotypic ESBL
negative isolates
Lane L: 1500bp DNA ladder
Lanes 7-47: Amplified blaSHV-12 of the ESBL
negative isolates
Eighteen (72%) isolates among
phenotypic ESBL positive isolates contain
blaSHV-11 gene in genomic DNA and
blaSHV-12 gene in plasmid DNA. This is
agreeing with the hypothesis that chromosomal
copy of non-ESBL SHV is essential for
expression of an ESBL phenotype. Lee et al.,
(2006) showed that K. pneumoniae strains
carrying blaSHV-11 on the chromosome
abundantly express plasmid-derived SHV-12,
concluding that blaSHV-11 was transferred
from the chromosome by an IS26 originating
from a blaSHV-12 element which showed a
direct relationship between IS26 and blaSHV.
Furthermore, 4 isolates from 13 ESBL positive
strains carried copies of a non-ESBL-encoding
gene either blaSHV-1 or blaSHV-11 in
addition to the blaSHV-2a or blaSHV12 gene
(Howard et al., 2002).
Six (24%) of the phenotypic ESBL
positive isolates contain blaSHV-11 in
genomic DNA, while lack blaSHV-12 in
plasmid. This absence of blaSHV-12 in the
plasmid and presence of ESBL phenotype can
be attributed to other types of ESBLs or hyper
production of blaSHV-11.
One (4%) of the phenotypic ESBL positive
isolates lack both genes, which agree with that
of Oliveira et al., (2010) in which nine isolates
were positive for ESBL production by the
phenotypic tests but gave negative result with
PCR.
Among phenotypic ESBL negative isolates,
eleven (44%) of isolates possess blaSHV-11 in
genomic DNA and blaSHV-12 in plasmid
DNA. Despite presence of blaSHV-12 in their
plasmid DNA, these isolates were unable to
give an ESBL phenotype. This can be
attributed to the low level of the expression of
that gene, which cannot give observable ESBL

33 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
phenotype. This result agree with Oliveira et
al., (2010) who reported that fifteen isolates
possess the SHV family but gave negative
ESBL phenotype.
Twelve (48%) of the phenotypic ESBL
negative isolates contain blaSHV-11 in
genomic DNA, while lack blaSHV-12 in
plasmid DNA. This indicates that presence of
blaSHV-12 in plasmid DNA is essential for
giving a positive ESBL phenotype.
Two (8%) of the phenotypic ESBL
negative isolates lack both genes in genomic
and plasmid DNA, therefore, their negative
phenotype may be due to absence of these
genes. This is agree with that of Bali et al.,
(2010), in which one of the positive isolates of
K. pneumoniae with CDM had no ESBL with
PCR. These isolates may have other types of
ESBL. It has been shown that the majority
(29/32) of K. pneumoniae isolates harbour
transferable blaSHV whereas, a strain carry
blaSHV-11 and contain the large SHV
transposon was failed to conjugate with the
recipient strain (Younes, 2010). This indicated
chromosomal location which agrees with other
findings that the large SHV transposon is
chromosomal location (Turner et al., 2009).
Furthermore, a strain of K. pneumoniae
possessed blaSHV-12 could not be transferred
by conjugation indicating a non-conjugative
plasmid location (Younes, 2010).
Considering their plasmid profile, 40% of
phenotypic ESBL positive isolates contained
one plasmid, 56% possess two plasmids and
one phenotypic ESBL positive isolate had four
plasmids.
Conclusions
Phenotypic ESBL screening can be used for
presumptive identification of potential ESBL
producer isolates. High prevalence of phenotypic
ESBL producers among Klebsiella pneumoniae
urinary isolates. Both SHV-11 and SHV-12 genes
are more prevalent in phenotypic ESBL producer
isolates. Finally, presence of SHV-11 in genome
and SHV-12 in plasmid DNA is necessary for
phenotypic ESBL production.
REFERENCES
Agraval, P. and Gush, A.N. (2008). Prevalence of
extended-spectrum β-lactamase among Escherichia coli
and Klebsiella pneumoniae in isolates in a tertiary care
hospital. Indian Journal of Pathology and Microbiology,
51(1): 137-142.
Al-Jasser, A.M. (2006). Extended-spectrum β-lactamases
(ESBLs): A global problem. Kuwait Medical Journal, 38
(3): 171-185.
Arora, B. and Arora, D.R. (2008). Practical
Microbiology for Dental Students.1st Ed. CBS Publisher
and Distributors. New Delhi, India.
Atlas, R.M.; Brown, A.E. and Parks, L.C. (1995).
Laboratory Manual of Experimental Microbiology.
Mosby-Year Book, Inc., USA.
Bali, E.B.; Açik, L. and Sultan, N. (2010). Phenotypic
and molecular characterization of SHV, TEM and CTX-
M extended-spectrum β-lactamases produced by
Escherichia coli, Acinitobacter baumannii and
Klebsiella isolates in a Turkish hospital. African Journal
of Microbiology Research, 4(8): 650-654.
Chaves, J.; Ladona, M.G.; Segura, C.; Coira, A.; Reig,
R. and Ampurdanes, C. (2001). SHV-1 β-lactamase is
mainly a chromosomally encoded species-specific
enzyme in Klebsiella pneumoniae. Antimicrobial Agents
and Chemotherapy, 45(10): 2856-2861
Clinical and Laboratory standard institute, CLSI (2011).
Performance standards for antimicrobial susceptibility
testing; 21th informational supplement M100-S-20- U.
30(15), USA, Wayne. PA.
Fazly Bazzaz, B.S.; Naderinasab, M.; Mohamadpoor,
A.H.; Farshadzadeh, Z.; Ahmadi, S. and Yousefi, F.
(2009). The prevalence of extended-spectrum β-
lactamase producing Escherichia coli and Klebsiella
pneumoniae among clinical isolates from a general
hospital in Iran. Acta Microbiologica Et Immunologica
Hungarica, 56(1): 89-99.
Feizabadi, M.M.; Etemadi, G.; Rahmati, M.;
Mohammadi-Yeganeh, S.; Shabanpoor, S. and Asadi, S.
(2007). Antibiotic resistance patterns and genetic
analysis of Klebsiella pneumoniae isolates from the
respiratory tract. National Research Institute of
Tuberculosis and Lung Disease, 6(3): 20-25.
Ford, P.J. and Avison, M.B. (2004). Evolutionary
mapping of the SHV β-lactamase and evidence for two
separate IS26-dependent blaSHV mobilization events
from the Klebsiella pneumoniae chromosome. Journal of
Antimicrobial Chemotherapy, 54: 69-75
Ghafourian, S.; Sekawi, Z.B.; Sadeghifard, N.; Mohebi,
R.; Neela1, V.K.; Maleki, A.; Hematian, A.; Rahbar, M.;
Raftari, M. and Ranjbar, R. (2011). The prevalence of
ESBLs producing Klebsiella pneumoniae isolates in
some major hospitals, Iran. Open Microbiology Journal,
5: 91-95.
Haeggman, S.; Lofdahl, S.; Paauw, A.; Verhoef, J. and
Brisse, S. (2004). Diversity and evolution of the class A
chromosomal β-lactamase gene in Klebsiella
pneumoniae. Antimicrobial Agents and Chemotherapy,
48(7): 2400-2408.
Heritage, J.; M’Zali, F.H.; Gascoyne-Binzi, D. and
Hawkey, D.M. (1999). Evolution and spread of SHV
extended-spectrum β-lactamases in gram-negative

34 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
bacteria. Journal of Antimicrobial Chemotherapy, 44(3):
309-318.
Hirakata, Y.; Matsuda, Y.; Miyazaki, S.; Kamihira, S.;
Kawakami, Y.; Miyazawa, Y.; Ono, N.; Nakazaki, Y.;
Hirata, M.; Inoue, J.D.; Turnidge, J.M.; Bell, R.N.;
Jones, S. and Kohno, N. (2005). Regional variation in
the prevalence of extended-spectrum β-lactamase-
producing clinical isolates in the Asia-Pacific region
(1998-2002). Diagnostic Microbiology and Infectious
Diseases, 52: 323-329.
Howard, C.; Van Daal, A.; Kelly, G.; Schooneveldt, J.;
Nimmo, G. and Giffard, P.M. (2002). Identification and
mini-sequencing-based discrimination of SHV β-
lactamases in nosocomial infection-associated Klebsiella
pneumoniae in Brisbane, Australia. Antimicrobial Agents
and Chemotherapy, 46: 659-664.
Iroha, I.R.; Oji, A.E. and Ayogu, T.E. (2011). Analysis
of antibiotic susceptibility of Klebsiella pneumoniae
strain isolated different clinical specimen in Enugu state.
International Journal of Current Research, 2: 8-14.
Kiratisin, P.; Apisarnthanarak, A.; Laesripa, C. and
Saifon, P. (2008). Molecular characterization and
epidemiology of extended-spectrum β-lactamase
producing Escherichia coli and Klebsiella pneumoniae
isolates causing health care-associated infection in
Thailand, where the CTX-M family is endemic.
Antimicrobial Agents and Chemotherapy, 52(8): 2818-
2824.
Lee, S.H.; Kim, J.Y.; Shin, S.H.; An, Y.J.; Choi, Y.W.;
Jung, Y.C.; Jung, H.I.; Sohn, E.S.; Jeong, S.H. and Lee,
K.J. (2003). Dissemination of SHV-12 and
characterization of new AmpC-type β-lactamase genes
among clinical isolates of Enterobacter species in Korea.
Journal of Clinical Microbiology, 41(6): 2477-2482.
Lee, Y.H.; Cho, B.; Bae, I.K.; Chang, C.L. and Jeong,
S.H. (2006). Klebsiella pneumoniae strains carrying the
chromosomal SHV-11 β-lactamase gene produce the
plasmid-mediated SHV-12 extended-spectrum β-
lactamase more frequently than those carrying the
chromosomal SHV-1 β-lactamase gene. Journal of
Antimicrobial agents and Chemotherapy, 57:1259-1261.
Lin, C.F.; Hsu, S.K.; Chen, C.H.; Huang, J.R. and Lo,
H.H. (2010). Genotypic detection and molecular
epidemiology of extended-spectrum β-lactamase
producing Escherichia coli and Klebsiella pneumoniae
in a regional hospital in central Taiwan. Journal of
Medical Microbiology, 59(6): 665-671.
Mendonça, N. R. (2009). Molecular diversity of bla
genes in Klebsiella pneumoniae and Escherichia coli
isolates. Ph.D. thesis in Biology, speciality
Microbiology, by Universidade Nova de Lisboa,
Faculdade de Ciências e Tecnologia.
Nasehi, L.; Shahcheraghi, F.; Nikbin, V.S. and
Nematzadeh, S. (2010). PER, CTX-M, TEM and SHV β-
lactamases in clinical isolates of Klebsiella pneumoniae
isolated from Tehran, Iran. Iranian Journal of Basic
Medical Sciences, 13(3): 111-118.
Nuesch-Inderbinen, M.T.; Kayser, F.H. and Hachler, H.
(1997). Survey and molecular genetics of SHV β-
lactamases in Enterobacteriaceae in Switzerland: two
novel enzymes, SHV-11 and SHV-12. Antimicrobial
Agents and Chemotherapy, 41: 943-949.
Oliveira, C.F.; Salla, A.; Lara, V.M.; Rieger, A.; Orta,
J.A. and Alves, S.H. (2010). Prevalence of extended-
spectrum β-lactamase producing microorganisms in
nosocomial patients and molecular characterization of
the SHV type isolates. Brazilian Journal of
Microbiology, 41(2): 278-282.
Ozdemir, D.; Hassan, S. and Kala, D. (2013). Detection
of conjugative plasmid encoded ampicillin and
tetracycline resistant in Klebsiella pneumoniae.
International Journal of Biology, 5(2): 28- 45.
Paterson, D.L.; Hujer, K.M.; Yeiser, B.; Bonomo, M.D.;
Rice, L.B. and Bonomo, R.A. (2003). Extended-
spectrum β-lactamases in Klebsiella pneumoniae
bloodstream isolates from seven countries: dominance
and widespread prevalence of SHV- and CTX-M-type β-
lactamases. Antimicrobial Agents and Chemotherapy,
47: 3554-3560.
Pfaller, M.A. and Segreti, J. (2006). Overview of the
epidemiological profile and laboratory detection of
extended-spectrum β-lactamases. Clinical Infectious
Diseases, 42:S153-63.
Podschun, R. and Ullmann, U. (1998). Klebsiella spp. as
nosocomial pathogens: epidemiology, taxonomy, typing
methods and pathogenicity factors. Clinical
Microbiology Reviews, 11(4): 589-603
Ramazanzadeh, R. (2010). Etiologic agents and
extended-spectrum β-lactamase production in urinary
tract infections in Sanandaj, Iran. Eastern Journal of
Medicine, 15: 57-62.
Rashed, M.F.; Rahnamaye, F.M.; Saremi, M. and
Sabourian, R. (2008). A survey on urinary pathogens and
their antimicrobial susceptibility among patients with
significant bacteriuria. Iranian Journal of Pathology,
3(4): 191-196.
Ryoo, N.H.; Kim, E.C. and Hong, S.G. (2005).
Dissemination of SHV-12 and CTX-M-type extended-
spectrum β-lactamases among clinical isolates of
Escherichia coli and Klebsiella pneumoniae and
emergence of GES-3 in in Korea
Sambrook, J. and Russell, D.W. (2001). Molecular
Cloning a Laboratory Manual. 3rd Ed., Cold Spring
Harbor Press, New York.
Sanguinetti, M.; Posteraro, B.; Spanu, T.; Ciccaglione,
D.; Romano, L.; Fiori, B.; Nicoletti, G.; Zanetti, S. and
Fadda, G. (2003). Characterization of clinical isolates of
Enterobacteriaceae from Italy by the BD Phoenix
extended-spectrum β-lactamase detection method.
Journal of Clinical Microbiology, 41(4):1463-1468.
Schembri, M.A.; Blom, J.; Krogfelt, K.A. and Klemm, P.
(2005). Capsule and fimbria interaction in Klebsiella
pneumoniae. Infection and Immunity, 73(8): 4626-4633.
Severin, J.A.; Mertaniasih, N.M.; Kuntaman, K.; Lestari,
E.S.; Purwanta, M.; Toom, N.D.; Duerink, D.O.; Hadi,
U.; Belkum, A.V.; Verbrugh, H.A. and Goessens, W.H.
(2010). Molecular characterization of extended-spectrum
β-lactamases in clinical Escherichia coli and Klebsiella
pneumoniae isolates from Surabaya, Indonesia. Journal
of Antimicrobial Chemotherapy, 65(3): 465-469.
Shukla, I.; Tiwari, R. and Agrawal, M. (2004).
Prevalence of extended-spectrum β-lactamase producing
Klebsiella pneumoniae in a tertiary care hospital. Indian
Journal of medical Microbiology, 22(2): 87-91.

35 Al-Attar M. and Hassan M./ ZJPAS: 2016, 28 (4): 25-35
Steward, C.D.; Rasheed, J.K.; Hubert, S.K.; Biddle,
J.W.; Raney, P.M.; Anderson, G. J.; Williams, P.P.;
Brittain, K.L. ; Oliver, A.; McGowan, J.E. and Tenover,
F.C. (2001). Characterization of clinical isolates of
Klebsiella pneumoniae from 19 laboratories using the
National Committee for Clinical Laboratory Standards
extended-spectrum β-lactamase detection methods.
Journal of Clinical Microbiology, 39(8): 2864-2872.
Taşli, H. and Bahar, I.H. (2005). Molecular
characterization of TEM and SHV derived extended-
spectrum β-lactamases in hospital based
Enterobacteriaceae in Turkey. Japanese Journal of
Infectious Diseases, 58(3): 162-167.
Tofteland, S.; Haldorsen, B.; Dahl, K.H.; Simonsen,
G.S.; Steinbakk, M.; Walsh, T.R. and Sundsfjord, A.
(2007). Effects of phenotype and genotype methods for
detection of extended-spectrum β-lactamase producing
clinical isolates of Escherichia coli and Klebsiella
pneumoniae in Norway. Journal of Clinical
Microbiology, 45(1): 199-205.
Tribuddharat, C.; Srifuengfung, S. and Chiangjong, W.
(2007). A Correlation between phenotypes and
genotypes of extended-spectrum β-lactamase producing
Klebsiella pneumoniae in a university hospital, Thailand.
Journal of infectious Diseases and antimicrobial agents,
24(3): 117-123.
Turner, P.J. (2005). Extended-spectrum β-lactamases.
Clinical Infectious Diseases, 41(4): 273-275.
Tzouvelekis, L. S. and Bonomo, R. A. (1999). SHV-type
β-lactamases. Current Pharmaceutical Design, 5(11):
847-864.
Widmer, A.F. (2008). Ceftobiprole: a new option for
treatment of skin and soft tissue infections due to
methicillin-resistant Staphylococcus aureus. Clinical
Infectious Diseases, 46(5): 656-658.
Winn, W.; Allen, S.; Janda, W.; Koneman, E.; Procop,
G.; Schreckenberger, P. and Woods, G. (2006).
Koneman's Color Atlas and Textbook of Diagnostic
Microbiology. 6th Ed. Lippincott Williams & Wilkins.
Wu, T.L.; Siu, L.K.; Su, L.H.; Lauderdale, T.L.; Lin,
F.M.; Leu, H.S.; Lin, T.Y. and Ho, M. (2001). Outer
membrane protein change combined with co-existing
TEM-1 and SHV-1 β-lactamases lead to false
identification of ESBL-producing K. pneumoniae.
Journal of Antimicrobial Chemotherapy, 47: 755-761.
Younes, A. M. (2010). Molecular diversity and genetic
organization of antibiotic resistance in Klebsiella
species. PhD. thesis, University of Edinbourgh.
Yum, J.H.; Kim, S.; Lee, H.; Yong, D.; Lee, K.; Cho,
S.N. and Chong, Y. (2005). Emergence and wide
dissemination of CTX-M-type ESBLs and CMY-2- and
DHA-1-type AmpC β-lactamases in Korean respiratory
isolates of Klebsiella pneumoniae. Journal of Korean
Medical Science, 20(6): 961-965.