High-fat diet induces depression-like behaviour in mice associated with changes in microbiome, neuropeptide Y, and brain metabolome

Abstract

Objectives: The biological mechanisms linking diet-related obesity and depression remain unclear. Therefore, we examined the impact of high-fat diet (HFD) on murine behaviour, intestinal microbiome, brain metabolome, neuropeptide Y (NPY) expression, and dipeptidyl peptidase-4 (DPP-4) activity.
Methods: Male C57Bl/6J mice were fed an HFD (60 kJ% from fat) or control diet (12 kJ% from fat) for 8 weeks, followed by behavioural phenotyping. Caecal microbiome was analysed by 16S rDNA sequencing, brain metabolome by ¹H nuclear magnetic resonance, NPY expression by PCR and immunoassay, and dipeptidyl peptidase-4 (DPP-4) activity by enzymatic assay. The effect of a 4-week treatment with imipramine (7 mg/kg/day) and the DPP-4 inhibitor sitagliptin (50 mg/kg/day) on HFD-induced behavioural changes was also tested.
Results: HFD led to a depression-like phenotype as revealed by reduced sociability and sucrose preference. In the caecum, HFD diminished the relative abundance of Bacteroidetes and increased the relative abundance of Firmicutes and Cyanobacteria. In the brain, HFD modified the metabolome of prefrontal cortex and striatum, changing the relative concentrations of molecules involved in energy metabolism (e.g. lactate) and neuronal signalling (e.g. γ-aminobutyric acid). The expression of NPY in hypothalamus and hippocampus was decreased by HFD, whereas plasma NPY and DPP-4-like activity were increased. The HFD-induced anhedonia remained unaltered by imipramine and sitagliptin.
Discussion: The depression-like behaviour induced by prolonged HFD in mice is associated with distinct alterations of intestinal microbiome, brain metabolome, NPY system, and DPP-4-like activity. Importantly, the HFD-evoked behavioural disturbance remains unaltered by DPP-4 inhibition and antidepressant treatment with imipramine.

Full text

Full Terms & Conditions of access and use can be found at
http://www.tandfonline.com/action/journalInformation?journalCode=ynns20
Nutritional Neuroscience
An International Journal on Nutrition, Diet and Nervous System
ISSN: 1028-415X (Print) 1476-8305 (Online) Journal homepage: http://www.tandfonline.com/loi/ynns20
High-fat diet induces depression-like behaviour
in mice associated with changes in microbiome,
neuropeptide Y, and brain metabolome
Ahmed M. Hassan, Giulia Mancano, Karl Kashofer, Esther E. Fröhlich, Andrija
Matak, Raphaela Mayerhofer, Florian Reichmann, Marta Olivares, Audrey M.
Neyrinck, Nathalie M. Delzenne, Sandrine P. Claus & Peter Holzer
To cite this article: Ahmed M. Hassan, Giulia Mancano, Karl Kashofer, Esther E. Fröhlich, Andrija
Matak, Raphaela Mayerhofer, Florian Reichmann, Marta Olivares, Audrey M. Neyrinck, Nathalie
M. Delzenne, Sandrine P. Claus & Peter Holzer (2018): High-fat diet induces depression-like
behaviour in mice associated with changes in microbiome, neuropeptide Y, and brain metabolome,
Nutritional Neuroscience, DOI: 10.1080/1028415X.2018.1465713
To link to this article: https://doi.org/10.1080/1028415X.2018.1465713
© 2018 The Author(s). Published by Informa
UK Limited, trading as Taylor & Francis
Group
View supplementary material
Published online: 26 Apr 2018. Submit your article to this journal
Article views: 22 View related articles
View Crossmark data

High-fat diet induces depression-like
behaviour in mice associated with changes in
microbiome, neuropeptide Y, and brain
metabolome
Ahmed M. Hassan
1
, Giulia Mancano
2
, Karl Kashofer
3
, Esther E. Fröhlich
1
,
Andrija Matak
3
, Raphaela Mayerhofer
1
, Florian Reichmann
1
,
Marta Olivares
4
, Audrey M. Neyrinck
4
, Nathalie M. Delzenne
4
,
Sandrine P. Claus
2
, Peter Holzer
1,5
1
Research Unit of Translational Neurogastroenterology, Division of Pharmacology, Otto Loewi Research Centre,
Medical University of Graz, Graz, Austria,
2
Department of Food and Nutritional Sciences, University of Reading,
Reading, UK,
3
Diagnostic and Research Institute of Pathology, Medical University of Graz, Graz, Austria,
4
Metabolism and Nutrition Research Group, Louvain Drug Research Institute, Université catholique de Louvain,
Brussels, Belgium,
5
BioTechMed-Graz, Graz, Austria
Objectives: The biological mechanisms linking diet-related obesity and depression remain unclear.
Therefore, we examined the impact of high-fat diet (HFD) on murine behaviour, intestinal microbiome,
brain metabolome, neuropeptide Y (NPY) expression, and dipeptidyl peptidase-4 (DPP-4) activity.
Methods: Male C57Bl/6J mice were fed an HFD (60 kJ% from fat) or control diet (12 kJ% from fat) for 8
weeks, followed by behavioural phenotyping. Caecal microbiome was analysed by 16S rDNA sequencing,
brain metabolome by
1
H nuclear magnetic resonance, NPY expression by PCR and immunoassay, and
dipeptidyl peptidase-4 (DPP-4) activity by enzymatic assay. The effect of a 4-week treatment with
imipramine (7 mg/kg/day) and the DPP-4 inhibitor sitagliptin (50 mg/kg/day) on HFD-induced
behavioural changes was also tested.
Results: HFD led to a depression-like phenotype as revealed by reduced sociability and sucrose preference.
In the caecum, HFD diminished the relative abundance of Bacteroidetes and increased the relative
abundance of Firmicutes and Cyanobacteria. In the brain, HFD modified the metabolome of prefrontal
cortex and striatum, changing the relative concentrations of molecules involved in energy metabolism
(e.g. lactate) and neuronal signalling (e.g. γ-aminobutyric acid). The expression of NPY in hypothalamus
and hippocampus was decreased by HFD, whereas plasma NPY and DPP-4-like activity were increased.
The HFD-induced anhedonia remained unaltered by imipramine and sitagliptin.
Discussion: The depression-like behaviour induced by prolonged HFD in mice is associated with distinct
alterations of intestinal microbiome, brain metabolome, NPY system, and DPP-4-like activity. Importantly,
the HFD-evoked behavioural disturbance remains unaltered by DPP-4 inhibition and antidepressant
treatment with imipramine.
Keywords: Obesity, High-fat diet, Depression, Microbiome, Metabolome, Dipeptidyl peptidase-4, Neuropeptide Y, γ-Aminobutyric acid
Introduction
Unfavourable nutrition
1,2
and obesity
3
are risk factors
for developing depression. Moreover, obesity is a pre-
dictor of poor prognosis of depression and an
unfavourable response to antidepressants.
4
In spite of
this epidemiological evidence, the pathophysiological
mechanisms that are responsible for the enhanced
risk of depression due to low diet quality and obesity
remain unclear. Obesogenic diet and obesity affect
the composition of the intestinal microbiota in
humans and experimental animals.
5,6
Several studies
have also identified significant differences in the intes-
tinal microbiome of depressed and non-depressed
subjects.
7,8
It is, however, largely unexplored whether
diet-induced alterations in the community structure
Correspondence to: Peter Holzer, Research Unit of Translational
Neurogastroenterology, Division of Pharmacology, Otto Loewi Research
Centre, Medical University of Graz, A-8010 Graz, Austria; BioTechMed-
Graz, A-8010 Graz, Austria. Email: peter.holzer@medunigraz.at
Supplemental data for this article can be accessed at https:// doi.org/
10.1080/1028415X.2018.1465713
© 2018 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License (http://creativecommons.org/
licenses/by-nc-nd/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited, and is not
altered, transformed, or built upon in any way.
DOI 10.1080/1028415X.2018.1465713 Nutritional Neuroscience 2018
1

and function of the intestinal microbiota are associ-
ated with the development of depression.
Neuropeptide Y (NPY) is a factor that potentially
links diet-induced obesity to mood alterations. On the
one hand, NPY is a regulator of appetite and food
intake, and an obesogenic diet is known to affect the
NPY system in several brain areas.
9
On the other
hand, NPY is involved in the regulation of emotional-
affective behaviour and stress resilience.
10
Therefore,
altered NPY signalling in response to an obesogenic
diet may contribute to the neuropsychiatric disturb-
ances observed in obese subjects. NPY signalling can
be altered not only by changes in the activity of Y recep-
tors but also by changes in the expression, release, and
degradation of the peptide. For instance, the activity of
NPY is under the influence of dipeptidyl peptidase-4
(DPP-4) which truncates NPY(1–36) to NPY(3–36),
thus changing its affinity to Y receptor subtypes.
11
Apart from their effects on the intestinal micro-
biome and cerebral NPY system, obesogenic diets
have a major impact on metabolic pathways and
metabolite levels throughout the body.
12
These meta-
bolic imbalances may also transcend to the brain,
affecting the production of neurotransmitters and
other molecules relevant to neuronal signalling and
behaviour and thus contributing to neuropsychiatric
disorders observed in obese subjects. High-throughput
screening of brain metabolites in an animal model of
diet-associated perturbations of behaviour could thus
provide important insights into the mechanisms of
diet-induced disturbances of brain metabolism and
their potential role in neuropsychiatric disorders
associated with obesity.
The overall aim of this work was to explore the
effect of a high-fat diet (HFD) for 8 weeks on
emotional-affective and cognitive behaviour in mice
and to investigate select mechanisms that may accom-
pany diet-induced disturbances of brain function. In
pursuing this goal, five specific hypotheses were
tested: (i) HFD induces a depression-like phenotype
in mice. (ii) The depression-like phenotype induced
by HFD is associated with distinct alterations in the
intestinal microbiome. (iii) HFD changes distinct
metabolite concentrations in the brain that provide
clues to the molecular basis of diet-induced pertur-
bations of behaviour. (iv) The HFD-induced
depression-like behaviour is associated with dysregu-
lated NPY signalling in the brain and altered DPP-4-
like activity in the periphery. (v) The HFD-induced
depression-like phenotype is reversible by imipramine
and the DPP-4 inhibitor sitagliptin.
Methods
Experimental animals
The experiments were carried out with male C57BL/
6J mice obtained from Charles River (Sulzfeld,
Germany) at the age of 8 weeks. The animals were
housed two or three per cage under controlled con-
ditions of temperature (set point 21°C) and air humid-
ity (set point 50%) and under a 12 h light/dark cycle
(lights on at 6:00 h, lights off at 18:00 h). Mice were
habituated for at least 10 days in the animal facility
while being fed a control diet.
Study design
The study was carried out with 156 mice. In all exper-
iments, mice were fed either an HFD (S9003-E710;
60 kJ% from fat, with refined palm oil as a main
source, 24 kJ% from carbohydrate, 16 kJ% from
protein) or a control diet (control; S5745-E7022;
12 kJ% from fat, 65 kJ% from carbohydrate, 23 kJ%
from protein) for 8 weeks. The diets were purchased
from Sniff (Soest, Germany) (Supplementary table
S1). Tap water and respective chow were provided ad
libitum and mice continued to receive the same diet
during behavioural tests. Throughout the study, mice
were weighed once weekly, and weekly food intake
per cage was calculated from the change in food
pellet weights. After the 8-week feeding period the
animals were allocated to four experimental groups
as shown in Fig. 1A.
In experiment 1, mice were subjected to a behav-
ioural test battery including the open field (OF) test,
elevated plus maze (EPM) test, social interaction (SI)
test, novel object recognition (NOR) test, Barnes
maze (BM) test, and hair coat index assessment. The
order of the tests is described in Fig. 1A. Mice were
sacrificed 4 days after the second BM probe trial,
and their brains were collected for metabolomic analy-
sis while blood plasma and colonic tissue were col-
lected for the DPP-4 assay.
In experiment 2, mice were first subjected to the
dark/light box and splash tests. Then they were
single-housed in the LabMaster system (TSE
Systems, Bad Homburg, Germany) to record loco-
motion, fluid intake, food intake, and sucrose prefer-
ence over a 6-day period starting with the beginning
of the light cycle on the second day in the
LabMaster system.
In experiment 3, mice were single-housed in the
LabMaster system to conduct the morphine preference
test.
In experiment 4, mice were sacrificed after the end
of the 8-week feeding period without any behavioural
intervention. Brain, heart blood, colonic tissue, and
caecal contents were collected for assessment of
cerebral NPY, Y1 and Y2 receptor mRNA, corticos-
terone and NPY levels in blood plasma, myeloperoxi-
dase (MPO) concentration in colon, and microbial
community in caecal contents, respectively.
In experiment 5, after 4 weeks of HFD, mice on
HFD were subdivided into three groups: the first
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018
2

group (HFD group) continued to receive plain drink-
ing water, the second group (HFD+Si group) received
sitagliptin (MedChemExpress, Monmouth Junction,
NJ, USA) in the drinking water (50 mg/kg body
weight) for 4 weeks. The third group (HFD+Im
group) received imipramine (Sigma, Vienna, Austria)
at a dose of 7 mg/kg body weight for 4 weeks. The
concentration of the medications in the drinking
water was adjusted as described in Supplementary
information. The selected dose of imipramine given
for 3 weeks blocks depression-like behaviour induced
by chronic stress in mice.
13
The effect of the selected
doses of sitagliptin and imipramine on plasma DPP-
4-like enzyme activity and hair coat index were
tested in a separate group of mice which were sacri-
ficed after the end of the 8-week feeding period
without any behavioural intervention. In the behav-
ioural experiments, sitagliptin and imipramine were
tested for their ability to reverse the HFD-induced be-
havioural changes in the LabMaster system, because in
experiment 2 the HFD-induced alterations of behav-
iour had proved to be most pronounced in this test
paradigm. After 8 weeks of HFD, mice were single-
housed in the LabMaster system to record locomotion,
fluid intake, food intake, and sucrose preference over a
60-hour period starting from the beginning of the dark
Figure 1 Study design, caloric intake, and body weight of mice fed a control or high-fat diet (HFD). (A) Study design. After 8
weeks on an HFD or control diet, mice underwent a battery of behavioural tests (experiments 1, 2, 3, and 5) or were sacrificed
without behavioural testing (experiment 4). In experiment 5, after 4 weeks of HFD, mice were subdivided into three groups: an
HFD+Si group which received sitagliptin (50 mg/kg/day in drinking water), an HFD+Im group which received imipramine (7 mg/
kg/day in drinking water), and a group which received no medications (HFD group). All three groups continued to be on an HFD
for a total of 8 weeks. OF, open field; EPM, elevated plus maze; SI, social interaction; NOR, novel object recognition; BM, Barnes
maze. (B) Weekly caloric intake (calculated per cage, n=11 cages per group), (C) weekly caloric intake for each gram of body
weight (calculated per cage, n=11 cages per group) and (D) body weight of mice (n=33 per group) recorded weekly during the 8-
week feeding period. The data shown in panels B, C, and D were pooled from experiments 1, 2, and 4. Means±standard error of
the mean; *P<0.05, **P<0.01, ***P<0.001 (t-test for comparing groups at each time point).
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018 3

cycle on the second day until the end of the dark cycle
of the fourth day. This time window was selected as it
showed clear differences between the groups in exper-
iment 2.
Behavioural tests
The OF, EPM, and dark/light box tests were used to
assess anxiety-like behaviour, while the NOR and
BM tests were used to estimate learning and
memory. The 3-chamber SI paradigm was used to
determine sociability. The hair coat index and splash
test were used to assess self-care. The hedonic effects
of sucrose and morphine were measured by the
sucrose and morphine preference tests. The circadian
pattern of locomotion, exploration, drinking, and
feeding, as well as sucrose preference and morphine
preference were recorded with the LabMaster system
which allows continuous monitoring of murine behav-
iour in a special housing cage. Details of the behav-
ioural tests are described in Supplementary
information.
Collection of tissues
Mice were sacrificed by decapitation after they had
been deeply anaesthetised with pentobarbital
(150 mg/kg IP). Blood was collected by cardiac punc-
ture with EDTA as anticoagulant. After centrifugation
at 4100gfor 15 min at 4°C, the plasma was frozen
immediately on dry ice. A 1-cm segment of the distal
colon was opened longitudinally, washed in saline,
dried with tissue paper, and then shock-frozen in
liquid nitrogen. The caecal contents were collected in
sterile tubes and shock-frozen on dry ice. The brains
were collected and frozen in 2-methylbutane on dry
ice. All the samples were then stored at −70°C until
analysis.
Microbiome analysis
As described previously,
14
caecal contents were hom-
ogenised on a MagNA Lyser Instrument using
MagNA Lyser Green Beads (Roche Diagnostics
GmbH, Mannheim, Germany) and incubated with
25 mg/ml Lysozyme Chicken Egg White
(Calbiochem) for 30 min at 37°C. DNA was extracted
using the Maxwell RSC automated DNA extraction
system and the Maxwell
®
RSC Blood DNA
Isolation Kit (Promega Corp., Madison, WI, USA)
including a proteinase K digestion step according
to the manufacturer’s instructions. The DNA concen-
tration was determined, and bacterial 16S rDNA was
amplified by PCR with the Rotor-Gene SYBR
Green PCR Kit (Qiagen, Hilden, Germany) using
20 ng DNA as a template. To this end, the 16S
primers F27 –AGAGTTTGATCCTGGCTCAG –
and R357 –CTGCTGCCTYCCGTA –were used as
fusion primers containing Ion Torrent sequencing
adapters. Afterwards PCR products were gel-purified
and the amplicon DNA concentration was deter-
mined. Sequencing of pooled amplicons was per-
formed with the Ion PGM Sequencer and an Ion
Sequencing 400 Kit (both from Life Technologies,
Carlsbad, CA, USA). Contaminating non-bacterial
sequences were removed and Acacia error correction
was applied on all reads using standard parameters.
15
Chimeras were identified by the Usearch algorithm
and removed. The resulting bam file was introduced
into QIIME (v1.8.0) 16S workflow (www.qiime.org).
16
Colonic myeloperoxidase (MPO)
The MPO content of the colon was measured with an
EIA kit specific for the rat and mouse protein (Hycult
Biotechnology, Uden, The Netherlands). Colonic
tissue was homogenised and the assay was run accord-
ing to the manufacturer’s instructions. Assay values
were normalised to protein content of the samples,
which was measured with the BCA protein assay kit
(Pierce Biotechnology, Rockford, IL, USA).
Brain microdissection
The frozen brains were transferred to a cryostat at
−20°C and cut manually into approximately 1 mm
thick slices. These slices were placed on a cold plate
(Weinkauf Medizintechnik, Forchheim, Germany)
set at −18°C, on which prefrontal cortex (Bregma,
+3.20 to −0.22), striatum (Bregma, +1.70 to
−1.94), hypothalamus (Bregma, +0.26 to −2.92),
and hippocampus (Bregma, −0.94 to −4.04) were
microdissected with an iris spatula.
17
The microdis-
sected brain areas were kept in homogenisation tubes
on dry ice and subsequently stored at −70°C until
further processing.
Brain metabolomics
Brain regions of the prefrontal cortex, hypothalamus,
hippocampus, and striatum were homogenised in
0.8 ml mixture of MeOH/H
2
O/CHCl
3
(3:1:3) for 3
min at T=1/50 in a tissue lyser (TissueLyser LT,
Qiagen). Samples were then centrifuged for 10 min
at 4°C at 1228gand 450 μL of the supernatant was
dried at 45°C for 3 h in a speed-vacuum
(Concentrator plus, Eppendorf, Hamburg,
Germany). The pellet was resuspended in 100 μLof
phosphate buffer (0.2 M, 1 mM sodium 3-(tri-methyl-
silyl)propionate-2,2,3,3-d
4
(TSP) in D
2
O/H
2
O 8:2, pH
7.4), and 50 μL was transferred to 1.7 mm NMR capil-
lary tubes for NMR acquisition.
1
H NMR spectra
were acquired on a Bruker AV700 NMR
Spectrometer equipped with a 5 mm
1
H(
13
C/
15
N)
inverse Cryoprobe
®
. All samples were analysed at
300 K with a standard
1
H-1D NOESY (noesypr) and
1
H-1D Carr Purcell Meiboom–Gill spin-echo
(CPMG) pulse sequence (cpmgpr) with water signal
suppression applied during relaxation delay (RD).
The cpmgpr experiment helped in the suppression of
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018
4

broad resonances of lipophilic molecules, allowing the
detection of small polar metabolites. For each spec-
trum, 8 dummy transients were followed by a total
of 128 scans, with an RD of 5 s and an acquisition
time (AQ) of 1.5 s. Scans were accumulated in 64k
data points over a spectral width of 9803.9 Hz. The
free induction decays were multiplied by an exponen-
tial function corresponding to 0.3 Hz line broadening
prior Fourier transformation. All spectra were refer-
enced to the singlet peak of TSP at 0.0 ppm, manually
phased and automatically baseline corrected applying
a Whittaker smoother algorithm in MNova NMR
version 10.0.2 (Mestrelab Research, Santiago de
Compostela, Spain). Metabolites were assigned using
Chenomx Software (Chenomx Inc., Edmonton,
Canada), metabolic databases (HMDB, http://www.
hmdb.ca; BMRB, http://www.bmrb.wisc.edu), and
published literature.
Quantitative polymerase chain reaction (qPCR)
NPY, Y1, and Y2 receptor mRNA was quantified with
real-time PCR (qPCR) as described in Supplementary
information.
Peptide extraction and neuropeptide Y (NPY)
assay
For NPY peptide extraction, microdissected hypo-
thalamic and hippocampal tissues were homogenised
in lysis buffer (50 mM Tris-HCl pH 8, 150 mM
NaCl, 1% (v/v) Triton X-100, 0.5% (v/v) sodium
deoxycholate and 10 mM PMSF) using a Peqlab
Precellys 24 homogeniser. The tissue homogenates
were centrifuged (10,000 rpm, 4°C, 10 min) to pellet
debris, and the protein content of the supernatant
was measured with the BCA protein assay kit (Pierce
Biotechnology, Rockford, IL, USA). Then, a protein
amount of 200 µg from the samples was added to
0.5 ml 2 N acetic acid, and centrifuged for 10 min at
2400 rpm and 4°C. The supernatants were lyophilised
and stored at −70°C until assay. To determine NPY in
the brain samples, the lyophilisates were reconstituted
in assay buffer, while plasma samples were assayed
after a 1:4 dilution with assay buffer. The fluorescence
immunoassay (Phoenix Pharmaceuticals, Burlingame,
CA, USA) was used to measure NPY in both plasma
and extracted brain samples. The assay was run
according to the manufacturer’s instructions.
According to the information provided by the manu-
facturer, the kit recognises mainly NPY(1–36) and
has 14.3% cross-reactivity with NPY(3–36), while
there is no cross-reactivity with peptide YY or pan-
creatic polypeptide. The sensitivity of the assay is
11.9 pg/ml, the intra-assay variability 5–7%, and the
inter-assay variability 12–15%.
DPP-4-like activity
DPP-4-like activity was determined by the cleavage of
para-nitroanilide (PNA) from the synthetic substrate
glycine-proline-PNA (Gly-Pro-PNA; Sigma, St
Louis, MO, USA). Briefly, 20–50 mg of colonic
tissue was resuspended in Tris base buffer (50 mM,
pH 8.3) with 1% (w/v) of n-octyl-glucoside and hom-
ogenised with a Tissue Ruptor (Qiagen). The samples
were centrifuged (3000g, 20 min, 4°C) and the super-
natants were collected and kept on ice for the DPP-4
assay. A volume of 20 µL of the supernatants or
blood plasma was incubated with the substrate Gly-
Pro-PNA. The enzymatic activity resulting in the
release of PNA was measured in a kinetic of 30 min
at 37°C with absorbance measurements (380 nm)
every minute (SpectraMax M2, Molecular Devices,
Sunnyvale, CA, USA). DPP-4-like activity in the
tissue and blood plasma samples was quantified rela-
tive to a standard curve generated with free PNA
(Sigma). Blanks with Tris base buffer and the substrate
glycine-proline-PNA were included in the assay. The
mean absorbance value of the blanks was subtracted
from that of the samples. DPP-4-like activity in
plasma was expressed as mU/ml. In the colonic
tissue, the values were normalised to the amount of
protein quantified by the Bradford method to
express the enzymatic activity as mU/mg protein.
Corticosterone
Plasma levels of corticosterone were determined with
an enzyme-linked immunosorbent assay (EIA) kit
(Assay Designs, Ann Arbor, MI, USA). The assay
was run according to the manufacturer’s instructions.
Statistical analysis
Data obtained by behavioural tests, qPCR, and EIA
were analysed with SPSS 22 (SPSS Inc., Chicago, IL,
USA) and SigmaPlot 13 (Systat Software GmbH,
Erkrath, Germany). For analysis, t-test, Mann
Whitney U-test, one-way ANOVA followed by post
hoc Dunnett’s test or Kruskal–Wallis Htest followed
by post hoc Dunn’s test were used as appropriate. In
Dunnett’s and Dunn’spost hoc tests, HFD was used
as a reference group. A P-value<0.05 was considered
as statistically significant.
Microbiome analysis results were statistically evalu-
ated with R (R Development Core Team, 2011, v3.2.1,
packages stats, missMDA, nlme) using Tibco
®
Spotfire
®
(v7.0.0). Principal coordinate analysis
(PCoA) was performed centred and scaled to unit var-
iance (R function prcomp). The ADONIS test of
weighted UniFrac distances was conducted with the
QIIME compare categories script. The linear discrimi-
nant analysis (LDA) effect size (LEfSe) method
(http://huttenhower.sph.harvard.edu/lefse/) for bio-
marker discovery was used to identify differences in
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018 5

the composition of the bacterial community and the
expected categorised metagenomic data obtained by
PICRUSt.
18,19
An LDA score of 2 (or −2) was set as
threshold. An alpha significance level of 0.05 was
used in all statistical tests.
As regards the metabolomics data, multivariate stat-
istical analysis was performed on cpmgpr spectra using
Matlab software (The Mathworks, version R2016a)
and algorithms were provided by Korrigan Sciences
Ltd. Cpmgpr spectra were digitalised and imported
into Matlab, where the residual signal of water reson-
ance was manually deleted. All spectra were normal-
ised under the total area and unit variance (UV)
scaled. Principal component analysis (PCA) was per-
formed to detect metabolic group variations and poss-
ible outliers. Data were further analysed using
orthogonal projection to latent structure-discriminant
analysis (O-PLS-DA) where
1
H NMR spectroscopic
profiles were used as matrix of independent variables
(X) and diet as response vector (Y). The two values
R
2
Y ( goodness of fit: percentage of Y explained by
the model) and Q
2
Y (goodness of prediction: percen-
tage of Y predicted after 7-fold cross validation) were
considered to evaluate the validity of O-PLS models.
The significance of selected models was further vali-
dated by 500 random permutation tests. Loadings
plots were colour coded to represent the correlation
between the X matrix and the model scores, allowing
for easier identification of metabolites associated
with class membership.
Results
Mice on HFD gain more weight
HFD-fed mice consumed more calories and gained
more weight than mice on the control diet (Fig. 1B–
D). The average weekly caloric intake relative to
body weight was higher in mice on HFD (mean
+SEM=3.1+0.13 kcal/g) than in mice on the
control diet (mean+SEM=2.5+0.08 kcal/g)
(t
20
=−4.1; P<0.001). Mice on HFD also gained
more weight over the 8-week period (mean
+SEM=12.0+0.54 g) compared to mice on the
control diet (mean+SEM=2.0+0.24 g) (t
44.5
=−16.9;
P<0.001).
HFD induces a depression-like phenotype
Mice on HFD exhibited a depression-like phenotype
as disclosed by the SI test, hair coat index assessment
and sucrose preference test (SPT). In the SI test, four
mice of the control group and two mice of the HFD
group were excluded from analysis as they did not
explore the three chambers of the test apparatus
within the first two minutes (for details, see
Supplementary information). Sociability was
reduced by HFD, relative to the control diet, as
revealed by a significant decrease of mouse
compartment preference (t
16
=2.6; P=0.018) and
mouse near vicinity preference (t
16
=2.7; P=0.016)
(Fig. 2A and B).
The hair coat index (indicative of diminished self-
care) was significantly higher in HFD-fed mice than
in mice on the control diet (U=12; P<0.001)
(Fig. 2C) although no significant difference between
the two groups was seen in the splash test
(Supplementary figure S4). HFD-fed mice exhibited
anhedonia as disclosed by a reduction of cumulative
sucrose intake (t
10
=6.8; P<0.001) and sucrose prefer-
ence (t
4.1
=3.2; P=0.03) (Fig. 2D and E). In contrast
to group-housed mice which enhanced their caloric
intake when on HFD (Fig. 1BandC),therewasa
nominal reduction of caloric intake in HFD-fed mice
kept single-housed in the LabMaster system, but this
reduction was statistically not significant (t
14
=2.1;
P=0.06) (Fig. 2F). Moreover, HFD disrupted the circa-
dian ingestion pattern as shown by an increase of the
percent food intake during the light cycle relative to
the total daily food intake (t
14
=−2.4; P=0.034)
(Fig. 2G). In addition, HFD reduced both horizontal
(t
16
=3.3; P=0.004) and vertical locomotor activity
(t
16
=2.7; P=0.013) (Fig. 2H and I) in the LabMaster
system.
In the morphine preference test, there was a nominal
decrease in morphine consumption by HFD-fed mice,
but this decrease was statistically not significant
(t
11
=2.1; P=0.064) (Fig. 2J), while morphine prefer-
ence over quinine did not significantly differ between
mice on HFD and those on the control diet (Fig.
2K). On the other hand, the total intake of saccharin
solution (combined consumption of morphine and
quinine provided in saccharin solution) was signifi-
cantly blunted in HFD-treated mice (t
11
=4.4;
P<0.001) (Fig. 2L). No significant differences
between mice on the HFD or control diet were
observed in the tests used to measure anxiety (OF,
EPM, and dark/light box tests), learning and
memory (NOR and BM tests) (Supplementary
figures S1–S3). In the NOR test, mice on the control
diet and HFD performed almost identically
(t
21
=0.31, P=0.76). In the BM test, the percent time
spent in the target quadrant was nominally shorter
in mice on HFD in both probe trials (Supplementary
figure S2), but statistically not significant in the first
(t
22
=1.6; P=0.12) and second (t
22
=1.3; P=0.2)
probe trials, respectively.
HFD influences the caecal microbiota composition
and predicts alterations in its metabolic function
The alpha diversity of the microbiome was signifi-
cantly increased in mice on HFD as revealed by
both Shannon and Simpson indices (Fig. 3A), and
PCoA showed that HFD-fed mice harboured a signifi-
cantly different microbial community compared to
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018
6

Figure 2 Behavioural readouts in mice fed a control or high-fat diet (HFD) for 8 weeks. (A,B) Behaviour of mice in the three-
chamber social interaction test (n=8 in the control and n=10 in the HFD group). (C) Hair coat index (n=12 per group). (D,E)
Sucrose solution intake and preference over water measured during a 6-day period (n=5 in the control and n=7 in the HFD group).
(F,G) Total caloric intake and percent food intake during the light cycle, relative to the total daily food intake, as measured during
a 6-day period (n=9 in the control and n=7 in the HFD group). (H,I) Horizontal and vertical locomotion measured during a 6-day
period (n=9 per group). (J–L) Morphine solution intake, morphine solution preference over quinine solution, and total intake of
saccharin solution (present in both morphine and quinine solutions) as measured during a 6-day period (n=6 in the control and
n=7 in the HFD group). The data shown in panels A–C were derived from experiment 1, those in panels D–I from experiment 2, and
those in panels J–L from experiment 3. The bars in panels A, B, D–L represent means+standard error of the mean. The box plot in
panel C depicts the 25th and 75th percentiles (boxes) and the 10th and 90th percentiles (error bars); *P<0.05, **P<0.01,
***P<0.001 (Mann Whitney U-test in panel C, t-test in all other panels).
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018 7

control mice (P=0.001 by the ADONIS test)
(Fig. 3B). The effect of HFD on the microbial commu-
nity remained statistically significant when just one
mouse from each cage was included in the analysis
(n=4 per group; P=0.023 by the ADONIS test).
LEfSe analysis revealed significant differences at
different taxonomic levels between the two treatment
groups. At the phylum level, Bacteroidetes were rela-
tively more abundant in the control group, while
Firmicutes and Cyanobacteria were relatively more
abundant in the HFD group (Fig. 3C). These
changes were reflected in the Firmicutes to
Bacteroidetes ratio which was significantly higher in
the HFD group (U=0; P<0.001) (Fig. 3D).
Additionally, changes between the two treatment
groups were observed at class, order, family, and
genus levels (Fig. 3C, Supplementary figure S5). To
obtain some insight into the potential impact of
these changes on the functional capacity of the micro-
biome, we ran an LefSe analysis on the expected
metagenome that was generated by the PICRUSt tool.
The results identified several metabolic entities that
may be affected, including tryptophan, sphingolipid,
aspartate, and glutamate pathways (Supplementary
figure S6).
HFD reduces colonic MPO
The colonic MPO content was significantly lower in
mice on HFD compared to mice on the control diet
(t
14.2
=2.4; P=0.028) (Supplementary figure S7).
HFD modulates metabolite production in
prefrontal cortex and striatum
PCA analysis-based O-PLS-DA models of four brain
regions (prefrontal cortex, hypothalamus, hippo-
campus, and striatum) were obtained by regressing
the metabolome of each region individually against
diet. The summary of the statistical models is shown
in Fig. 4A. Since the validation test on the O-PLS-
DA model for the hippocampus and hypothalamus
gave a P-value>0.05, these regions were excluded
from further analysis. In the prefrontal cortex
(Fig. 4B and C), HFD was strongly correlated with
enhanced relative concentrations of lactate and glycer-
ophosphocholine. A similar but weaker correlation
between HFD and a rise of alanine, creatine/phospho-
creatine, taurine, myo-inositol, and three unknown
singlets at 3.256, 3.673, and 3.459 ppm were also
observed in the prefrontal cortex. In contrast, the rela-
tive concentrations of γ-aminobutyric acid (GABA)
and choline in this brain region were negatively corre-
lated with HFD (Fig. 4B and C). In the striatum (Fig.
4D and E), HFD was associated with low relative con-
centrations of N-acetylaspartate, glutamine, creatine/
phosphocreatine, and taurine, and high relative con-
centrations of myo-inositol. The metabolic variations
of the prefrontal cortex and the striatum as identified
by the O-PLS-DA model are summarised in Fig. 4F.
HFD reduces NPY expression in the
hypothalamus and hippocampus
HFD attenuated the relative NPY mRNA expression
in the hippocampus (t
10
=3.7; P=0.004) and hypo-
thalamus (t
10
=3.7; P=0.004) (Fig. 5A and B) but
not in the striatum and prefrontal cortex
(Supplementary figure S8). In contrast, the
expression of Y1 and Y2 receptor mRNA remained
unchanged by HFD in all brain areas examined
(Supplementary figures S9 and S10). Analysis of
the NPY system at the peptide level in a different
set of mice with EIA showed that the hypothalamic
NPY concentration was significantly reduced in
HFD-fed mice relative to mice on the control diet
(t
10
=2.9; P=0.016) (Fig. 5E). Likewise, the hippo-
campal NPY level was nominally lower in mice on
HFD but this difference was statistically not signifi-
cant (Fig. 5D).
HFD increases plasma NPY and DPP-4-like
enzyme activity
Relative to the control diet, HFD increased the plasma
level of both NPY (t
13
=−5.3; P<0.001) and DPP-4-
like activity (t
22
=−3.2; P=0.004) (Fig. 4C and F). In
contrast, DPP-4-like activity in the colonic tissue did
not differ between HFD-fed and control animals
(Supplementary figure S11). The plasma concen-
tration of corticosterone remained also unaltered in
mice on HFD, independently of whether they were
housed in groups or singly in the LabMaster system
(Supplementary figure S12).
Sitagliptin reverses the HFD-induced rise of
plasma DPP-4-like enzyme activity
Plasma DPP-4-like enzyme activity differed signifi-
cantly between mice on the control diet, mice on
HFD and HFD-fed mice treated with sitagliptin or
imipramine as revealed by one-way ANOVA
(F
(3,22)
=5.0; P=0.008). Dunnett’spost hoc test dis-
closed that the HFD-evoked rise of plasma DPP-4-
like enzyme activity was reversed by sitagliptin but
remained unaltered by imipramine (Fig. 6A). The
hair coat index which was evaluated in these mice
differed also significantly between the treatment
groups (H
3
=17.7; P<0.001). Dunn’spost hoc test
revealed a significantly higher hair coat index in
mice on HFD compared to those on the control
diet, while no significant change was seen in mice
treated with sitagliptin or imipramine (Supplementary
figure S13).
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018
8

Figure 3 Microbial community profile based on 16S rDNA sequencing of caecal contents of mice fed a control or high-fat diet
(HFD) for 8 weeks (n=12 per group). (A)Microbialdiversityand richness indices. (B) Principal coordinate analysis (PCoA) plot based
on weighted UniFrac distance between samples. (C) Taxonomic cladogram obtained from the linear discriminant analysis (LDA)
effect size (LEfSe) analysis representing statistically significant differences in the abundance of microbial taxa between mice on the
HFD and control diet. Taxa which are relatively more abundant in control mice are shown in green colour while those which are
more abundant in mice on HFD are shown in red colour. To the right side of the cladogram, statisticallysignificant differences down
to the family level are marked by the taxonomic level: phylum (p), class (c), order (o), and family (f ). Only statistically significant
changes (P<0.05) with an LDA score above 2 are presented. (D) Effect of diet on the Firmicutes to Bacteroidetes ratio. The data
shown were derived from experiment 4. The box plots in panels A and D depict the 25th and 75th percentiles (boxes) and the 10th
and 90th percentiles (error bars), the transverse line indicating the median; ***P<0.001 (Mann Whitney U-test).
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018 9

Sitagliptin and imipramine fail to change HFD-
induced behavioural disturbances
When the behaviour of mice on the control diet, mice
on HFD and HFD-fed mice treated with sitagliptin or
imipramine was compared with each other, one-way
ANOVA revealed significant differences in sucrose
intake (F
(3,30)
=51.9; P<0.001), sucrose preference
(F
(3,30)
=4.1; P=0.015), caloric intake (F
(3,35)
=4.3;
Figure 4 Effect of high-fat diet (HFD) on brain metabolome determined by
1
H NMR. (A) Summary of O-PLS-DA models using
individual brain regions and diet as response vector. (B,D) Score plots using HFD (red) and control diet (blue) as vector response in
the prefrontal cortex (B) and striatum (D). The calculated scores (x-axis) are plotted against the cross-validated scores ( y-axis). (C,E)
Loading plots derived from the corresponding O-PLS-DA models showing the metabolic changes and correlations with HFD and
control diet in the prefrontal cortex (C) and striatum (E). In the prefrontal cortex (C), the metabolic changes are downwards
correlated to HFD and upwards to the control diet, while in the striatum (E) the metabolic changes are upwards correlated to HFD
and downwards to the control diet. (F) Summary of metabolic changes in HFD-fed mice in the prefrontal cortex and striatum. The
data shown were derived from experiment 1. Changes are relative to control mice: ↑higher relative concentration; ↓lower relative
concentration; =no changes. The numbering/nomenclature of compounds follows the IUPAC system. Abbreviations: GABA, γ-
aminobutyric acid; NAA, N-acetylaspartate; s, singlet; d, doublet; dd, doublet of doublets; t, triplet; m, multiplet.
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018
10

P=0.010), and horizontal activity (F
(3,35)
=3.8;
P=0.019) (Fig. 6B–E). Dunnett’spost hoc test revealed
that the HFD-induced decrease in sucrose intake,
sucrose preference, caloric intake, and horizontal
activity remained unchanged by sitagliptin and imi-
pramine (Fig. 6B–E). A similar pattern was seen
with vertical activity, with significant differences
between the groups revealed by one-way ANOVA
(F
(3,35)
=4.1; P=0.014) but not with Dunnett’spost
hoc test (Fig. 6F).
Discussion
Summary of main findings
The current results show that a palm oil-based HFD
induced a particular depression-like phenotype as
deduced from a decrease in sociability and anhedonia,
reduced activity, and a disturbed circadian ingestion
pattern. The behavioural changes were accompanied
not only by disturbances of the intestinal microbiota
composition and its predicted metabolic function but
also by distinct alterations of brain metabolite levels,
peripheral and cerebral NPY expression, and plasma
DPP-4-like activity. Importantly, the HFD-induced
anhedonia and reduced locomotion were resistant to
treatment with either imipramine or sitagliptin.
HFD-induced behavioural disturbances
Depression is a complex disorder with a wide range of
symptoms, some of which such as social withdrawal,
anhedonia, reduced self-care, rapid fatigability, and
cognitive impairment can be modelled in rodents.
20
Using a multidimensional approach, we found that
mice on HFD showed a depression-related phenotype,
a conclusion based on the results of SI test, hair coat
assessment, SPT, and circadian activity and ingestion
monitoring. A relationship between HFD and
depression-like behaviour in mice and rats has pre-
viously been found, although with inconsistent
results. On the one hand, feeding of single-housed
mice with an HFD (45% of calories from fat) has
been reported to protect against the depressogenic
impact of social stress.
21
On the other hand, feeding
Figure 5 Molecular readouts in brain and plasma of mice fed a control or high-fat diet (HFD) for 8 weeks. (A) Relative expression
of neuropeptide Y (NPY) mRNA in hippocampus (n=6 per group). (B) Relative expression of NPY mRNA (n=6 per group) in
hypothalamus. (C) Plasma concentration of NPY in control (n=7) and HFD group (n=8). (D) Hippocampal concentration of NPY
(n=6 per group). (E) Hypothalamic concentration of NPY (n=6 per group). (F) Dipeptidyl peptidase-4 (DPP-4)-like activity in blood
plasma (n=12 per group). The measurements in panels A–E were taken after 8 weeks of dietary intervention without behavioural
testing (experiment 4) while those in panel F were taken after 8 weeks of dietary intervention followed by behavioural testing
(experiment 1). Means+standard error of the mean; *P<0.05, **P<0.01, ***P<0.001 (t-test).
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018 11

Figure 6 Dipeptidyl peptidase-4 (DPP-4)-like enzyme activity (A) and behavioural readouts (B–F) in mice fed for 8 weeks a
control or high-fat diet (HFD) and in HFD-fed mice treated with sitagliptin (Si; 50 mg/kg/day in drinking water) or imipramine (Im;
7mg/kg/day in drinking water) for 4 weeks. (A) DPP-4-like activity in blood plasma of mice sacrificed after diet and drug
interventions without behavioural testing. (B,C) Sucrose solution intake and preference (n=7–9 per group), (D) caloric intake, and
(E,F) horizontal and vertical locomotor activity (n=9–10 per group) recorded over a 60-hour period in the LabMaster system after
diet and drug interventions. The bars represent means+standard error of the mean. The data shown in panels B–F were derived
from experiment 5 while those in panel A were derived from a separate group of mice which received the same drug treatment as
the mice in experiment 5 but were not subjected to testing in the LabMaster system. *P<0.05, **P<0.01, ***P<0.001 (one-way
ANOVA followed by Dunnett’spost hoc test using HFD as a reference group).
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018
12

with an HFD (60% of calories from fat) for 10 weeks
or longer has been reported to induce depression-like
behaviours.
6,22–24
Our findings are consistent with the latter obser-
vation and attest to the reproducibility of HFD-
induced depression-like behaviour which appears to
be unrelated to the type of fat ingested, given that an
HFD based on lard,
6,23–25
coconut oil,
22
or palm oil
(this study) yields similar results. Unlike previous
studies which addressed particular aspects of
depression-like behaviour such as despair behaviour,
22
anhedonia
26
and circadian rhythm disruption,
27
our
work using a battery of tests revealed a particular
pattern of depression-like behaviour: social withdra-
wal (SI test), anhedonia (SPT), fatigue (reduced loco-
motion in the LabMaster system), and a disturbance
of the circadian ingestion pattern (measured by the
LabMaster system). Continuous evaluation of
diurnal activity, ingestive behaviour, and sucrose pre-
ference are among the advantages of the LabMaster
system, while single housing of the experimental
animals in the test system is a potential limitation,
given that single housing can influence several
aspects of behaviour including food intake and sleep-
ing pattern.
28,29
However, the sucrose preference of
male mice has been reported to remain unaffected
after 7, 14, and 21 days of single housing.
30
Although we cannot rule out that single housing modi-
fied the effect of HFD on behaviour, there is other evi-
dence that HFD per se is able to induce anhedonia as
evaluated in diverse test paradigms. Using the pro-
gressive ratio operant task, for example, Sharma
et al.
26
observed anhedonia towards sucrose in mice
maintained on HFD for 6 weeks. Employing the
female urine sniff test in parallel with the SPT,
Dutheil et al.
24
likewise reported consistent anhedonia
to be manifest in rats maintained on HFD for 16
weeks.
In our study, anhedonia was evident not only
from the reduced sucrose intake and preference but
also from the reduced saccharin intake, which indi-
cates that anhedonia towards sweet solutions was
independent of their caloric content. The latter
observation is in keeping with reports that HFD,
while having a hedonic effect in the short term,
causes neuronal adaptations in the brain reward cir-
cuity in the long term and in this way gives rise to
anhedonia.
22,26
Anhedonia is a core symptom of
depression, which is commonly used as a surrogate
index of depression-like behaviour in rodents
because it can easily be recorded without stressing
the animals.
31
Although the HFD-induced increase in the hair coat
index would also be consistent with a depression-like
phenotype, this finding seen after 7 weeks+6daysin
experiment 5 and after 11 weeks+3 days in experiment
1 may also reflect a direct effect of HFD on coat
appearance, given that we did not observe any signifi-
cant change in splash test behaviour after 8 weeks in
experiment 2.
Unlike depression-like behaviour, anxiety-related
behaviour examined with the OF, EPM, and dark/
light box tests as well as learning and memory exam-
ined with the NOR and BM tests were not altered by
HFD within the limited sample size of this study. It
is worth noting that anxiety-like behaviour and/or
cognitive impairment may become manifest only
during particular time windows of prolonged HFD
ingestion. Thus, anxiety-like behaviour in the elevated
zero maze and OF and cognitive impairment in NOR
were observed after a 3-week, but not 6-week, period
of HFD intake.
32
Besides the time window of behav-
ioural testing, the type and concentration of dietary
fat seems to be crucial for the manifestation of cogni-
tive impairment. For example, middle-aged and old
mice did not develop cognitive impairment in response
to chronic intake of 41% HFD (butter fat) but exhib-
ited cognitive deficits following intake of 60% HFD
(lard fat) for 16 weeks.
33,34
We therefore hypothesise
that, in addition to the type of fat (palm oil), the com-
paratively shorter treatment (8 weeks) of younger mice
in our study may explain why HFD failed to signifi-
cantly impair cognitive performance.
HFD-induced changes in gut microbiota
Given that the microbial community structure in the
intestine is altered by obesogenic diet, obesity
5,6
as
well as depression,
7,8,35,36
we addressed the caecal
microbiota as a possible interface in the depressogenic
effect of HFD. Importantly, the caecal microbiota of
HFD-treated mice shared several features with those
found in the stools of patients with depression. For
example, HFD reduced the relative abundance of the
phylum Bacteroidetes, which was also observed in
the faecal microbiota of depressed subjects.
7
Likewise, the Firmicutes to Bacteroidetes ratio,
which correlates with depression symptoms in
humans,
37
was increased in response to HFD as has
been found in obese mice and humans.
5
In addition,
some commonalities exist at lower taxonomic levels,
as the family Lachnospiraceae
35
and the genus
Ruminococcus
36
are underrepresented both in
depressed patients and in HFD-fed mice. It is also
worth noting that the overall diversity of the micro-
biota was increased in response to HFD. The effect
of HFD on diversity of the microbiota is not consistent
in the literature, and both reduced and increased
microbial diversity have been reported in HFD-fed
rodents.
6,38
If the intestinal microbiota contributes to diet-
induced alterations of brain function and behaviour,
it is expected that this interface is carried by microbial
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018 13

metabolites. Estimation of the metabolic consequences
of HFD-induced alterations in the intestinal microbial
community structure by PICRUSt combined with
LEfSe analysis predicts changes in several molecular
entities that may play a role in the pathophysiology
of depression, such as tryptophan,
8
glutamate,
39
and
sphingolipid
40
metabolic pathways. An involvement
of a disturbed intestinal microbiota in the aetiology
of depression is supported by the findings that micro-
biota transplantation from depressed patients or
HFD-treated mice is able to induce a depression-like
phenotype in the recipient germ-free mice or anti-
biotic-treated mice and rats.
6–8
In conceptualising possible links between diet, gut
microbiota, and depressive disorder, it is thought
that a dysfunctional intestinal barrier and a dysregula-
tion of the intestinal immune system play a role
41
given
that commensal microbes shape intestinal immune
responses in health and disease.
42
While a lard-based
HFD has been shown to enhance colonic MPO
enzyme activity which is primarily expressed by neu-
trophils, monocytes, and macrophages,
43
palm oil-
based HFD used in our study reduced the colonic
content of MPO. We explain this apparently contra-
dictory finding by the notion that the metabolic and
inflammatory responses to HFD depend on the type
of dietary fat and not just its caloric content.
44
HFD-induced changes in molecules relevant to
brain function
In order to obtain further clues to the molecular basis
of diet-induced perturbations of behaviour, an NMR-
based metabolomics approach was used to uncover
metabolic effects of HFD in four brain regions of
the mouse. HFD had a particular impact on the meta-
bolic fingerprints of prefrontal cortex and striatum in
which it affected molecules involved in energy metab-
olism, such as creatine/phosphocreatine and lactate.
45
Apart from a shift in these metabolic entities, HFD
had a distinct effect on a number of molecules relevant
to neuronal signalling, such as GABA, glutamine (a
substrate for the generation of both glutamate and
GABA), N-acetylaspartate, choline, taurine, and
myo-inositol.
Several metabolic changes induced by HFD in the
mouse brain have been reported to occur in humans
suffering from depression and/or in particular
animal models of depression. For example, lactate
levels in the cerebrospinal fluid are increased in
several psychiatric disorders including major
depression.
46,47
GABA has previously been found to
be reduced in the prefrontal cortex of rats on
HFD.
48
Attenuated GABAergic signalling is con-
sidered to contribute to the pathophysiology of
major depression,
49
as there is a depletion of GABA
in the prefrontal cortex of depressed patients
50
as
well as of rats with depression-like behaviour
induced by chronic mild stress.
51
Additionally, N-acet-
ylaspartate, a marker of neuronal integrity that
increases in depressed patients in response to anti-
depressant treatment,
52
was reduced in the striatum
of mice with HFD-evoked depression-like behaviour.
In contrast, myo-inositol, which is depleted in the pre-
frontal cortex of depressed patients,
53
was enhanced in
the prefrontal cortex and striatum of mice on HFD.
Although these discrepancies cannot be explained at
present, metabolomic analysis of the brain combined
with metabolomic analysis of the gut microbiota and
the circulatory interface between gut and brain is
likely to become a powerful tool to analyse gut micro-
biota–brain communication in health and disease.
Since NPY is a key regulator of food intake and
emotional-affective behaviour,
10
we hypothesised
that NPY signalling could be dysregulated by HFD
and consequently affect emotional-affective behav-
iour. This was in fact the case as HFD attenuated
hypothalamic NPY expression at both mRNA and
peptide level, whereas in the hippocampus the dimin-
ution of NPY expression was significant at the
mRNA level only. In contrast, the plasma concen-
tration of NPY, which is able to cross the blood–
brain barrier,
54
was elevated in mice on HFD. Our
findings of reduced hypothalamic but increased circu-
lating NPY in response to HFD is consistent with
other reports in mice
55
and with enhanced plasma
NPY levels in obese women.
56
In rats, the HFD-
induced downregulation of hypothalamic NPY is
associated with hypersensitivity to exogenous NPY,
which suggests that HFD in conjunction with its
effect on NPY transcription may regulate the
expression and/or function of Y receptors.
57,58
For
this reason, expression of Y1 and Y2 receptor
mRNA was evaluated but found unchanged. This
lack of effect does not exclude the possibility that
HFD impacts on Y receptor regulation at the
protein level and that HFD might alter Y receptor
expression only in particular subregions of the
hypothalamus.
HFD enhanced DPP-4-like activity in the blood
plasma as found after 8 weeks of HFD in experiment
5 and 12 weeks of HFD in experiment 1. By degrading
NPY(1–36) to NPY(3–36), DPP-4 enhances the affi-
nity of NPY towards Y2 and Y5 receptors but
reduces its activity at Y1 receptors which are known
to be responsible for the antidepressant effect of
NPY.
11,59
Thus, we hypothesised that elevated
plasma DPP-4-like activity may contribute to the
HFD-evoked depression-like phenotype, and therefore
DPP-4 inhibition may attenuate the depression-like
phenotype induced by HFD, given that knockout of
DPP-4 reduces depression-like behaviour in mice.
60
Our hypothesis was tested with the LabMaster
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018
14

system in which the HFD-induced behavioural
changes indicative of a depression-like phenotype
had proved to be most pronounced. The pertinent
findings, however, rejected this hypothesis, since sita-
gliptin did not affect the HFD-evoked anhedonia
and attenuation of locomotion. In spite of the failure
of sitagliptin to reverse the depression-like phenotype,
the contribution of DPP-4 in depression-like behav-
iour cannot be totally ruled out, since sitagliptin suc-
cessfully counteracts the depression-like behaviour
induced by HFD in rats.
25
In addition, sitagliptin
exerts antidepressant effects in experimental para-
digms of depression-like behaviour such as the forced
swim test and tail suspension test in mice.
61
The
absence of such an antidepressant effect in our study
reinforces the contention that HFD induces
depression-like behaviour through distinct pathophy-
siological mechanisms.
The anhedonia and hypolocomotion induced by
HFD were not only resistant to sitagliptin but also
to the tricyclic antidepressant imipramine. This lack
of effect of imipramine is consistent with previous
reports that escitalopram fails to have an antidepress-
ant effect in mice fed with HFD and that both fluox-
etine and desipramine are unable to produce an
antidepressant effect in db/db obese mice.
23,62
These
findings are in line with the poor response of obese
patients to antidepressants.
4
The HFD-induced
depression-like phenotype in mice could therefore be
a candidate model for studying antidepressant resist-
ance in obese subjects.
Conclusions
In conclusion, HFD induces a particular pattern of
depression-like behaviour in mice. Although a causal
relationship between the diet-induced disturbance of
the gut microbiota and the depression-like phenotype
awaits to be explored, the association of distinct
changes in gut microbial community, NPY system,
brain metabolome, and behavioural perturbations pro-
vides important clues to the potential signalling path-
ways between HFD and neurobehavioural pathologies.
Acknowledgments
The authors thank Margit Eichholzer for running the
EIA and extracting mRNA and Martina Hatz and
Theresa Maierhofer for their help with the PCR.
Disclaimer statements
Contributors AMH and PH designed the experiments.
AMH performed the HFD model, behavioural tests,
brain microdissection, and PCR and analysed the per-
tinent data including those obtained with EIA. KK
and AM ran the microbiome analysis, while GM
and SPC conducted the metabolomics analysis. MO,
AMN, and NMD performed the DPP-4 assay and
analysed the data. EEF, RM, and FR extracted
tissues for analysis. FR validated the primers used in
the study. AMH and PH wrote the manuscript, and
all authors revised the manuscript.
Funding This work was supported by EU grant 613979
(MyNewGut, www.mynewgut.eu) and the Austrian
Science Fund (FWF grants P25912-B23 and W1241-
B18). MO is a beneficiary of a ‘MOVE-IN Louvain’
Incoming Post-doctoral Fellowship co-funded by the
Marie Curie Actions of the European Commission.
Conflicts of interest None.
Ethics approval All experiments were approved by an
ethical committee at the Federal Ministry of Science,
Research and Economy of the Republic of Austria
(permit BMWFW-66.010/0131-WF/II/3b/2014 issued
on 4 September 2014, and permit BMWFW-66.010/
0050-WF/V/3b/2017 issued on 18 April 2017).
ORCID
Giulia Mancano http:// orcid.org/0000-0003-0484-
4836
Esther E. Fröhlich http://orcid.org/0000-0001-
6985-0642
Florian Reichmann http://orcid.org/0000-0002-
5833-3698
Marta Olivares http://orcid.org/0000-0002-7966-
2781
Nathalie M. Delzenne http:// orcid.org/0000-0003-
2115-6082
Sandrine P. Claus http:// orcid.org/0000-0002-
3789-9780
Peter Holzer http://orcid.org/0000-0002-5754-395X
References
1 Sanchez-Villegas A, Toledo E, de Irala J, Ruiz-Canela M, Pla-
Vidal J, Martinez-Gonzalez MA. Fast-food and commercial
baked goods consumption and the risk of depression. Public
Health Nutr 2012;15(3):424–32.
2 Jacka FN, Mykletun A, Berk M, Bjelland I, Tell GS. The associ-
ation between habitual diet quality and the common mental dis-
orders in community-dwelling adults: the Hordaland Health
study. Psychosom Med 2011;73(6):483–90.
3 Luppino FS, de Wit LM, Bouvy PF, Stijnen T, Cuijpers P,
Penninx BW, et al. Overweight, obesity, and depression: a sys-
tematic review and meta-analysis of longitudinal studies. Arch
Gen Psychiatry 2010;67(3):220–29.
4 Kloiber S, Ising M, Reppermund S, Horstmann S, Dose T,
Majer M, et al. Overweight and obesity affect treatment response
in major depression. Biol Psychiatry 2007;62(4):321–26.
5 Million M, Lagier JC, Yahav D, Paul M. Gut bacterial micro-
biota and obesity. Clin Microbiol Infect 2013;19(4):305–13.
6 Bruce-Keller AJ, Salbaum JM, Luo M, Blanchard E, Taylor
CM, Welsh DA, et al. Obese-type gut microbiota induce neuro-
behavioral changes in the absence of obesity. Biol Psychiatry
2015;77(7):607–15.
7 Zheng P, Zeng B, Zhou C, Liu M, Fang Z, Xu X, et al. Gut
microbiome remodeling induces depressive-like behaviors
through a pathway mediated by the host’s metabolism. Mol
Psychiatry 2016;21(6):786–96.
8 Kelly JR, Borre Y, O’Brien C, Patterson E, El Aidy S, Deane J,
et al. Transferring the blues: depression-associated gut micro-
biota induces neurobehavioural changes in the rat. J Psychiatr
Res 2016;82:109–18.
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018 15

9 Gumbs MC, van den Heuvel JK, la Fleur SE. The effect of obe-
sogenic diets on brain neuropeptide Y. Physiol Behav 2016;162:
161–73.
10 Enman NM, Sabban EL, McGonigle P, Van Bockstaele EJ.
Targeting the neuropeptide Y system in stress-related psychiatric
disorders. Neurobiol Stress 2015;1:33–43.
11 Mentlein R. Dipeptidyl-peptidase IV (CD26) –role in the inac-
tivation of regulatory peptides. Regul Pept 1999;85(1):9–24.
12 Du F, Virtue A, Wang H, Yang XF. Metabolomic analyses for
atherosclerosis, diabetes, and obesity. Biomark Res 2013;1(1):
17-7771-1-17.
13 Cline BH, Anthony DC, Lysko A, Dolgov O, Anokhin K,
Schroeter C, et al. Lasting downregulation of the lipid peroxi-
dation enzymes in the prefrontal cortex of mice susceptible to
stress-induced anhedonia. Behav Brain Res 2015;276:118–29.
14 Frohlich EE, Farzi A, Mayerhofer R, Reichmann F, Jacan A,
Wagner B, et al. Cognitive impairment by antibiotic-induced
gut dysbiosis: analysis of gut microbiota-brain communication.
Brain Behav Immun 2016;56:140–55.
15 Bragg L, Stone G, Imelfort M, Hugenholtz P, Tyson GW. Fast,
accurate error-correction of amplicon pyrosequences using
Acacia. Nat Methods 2012;9(5):425–26.
16 Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman
FD, Costello EK, et al. Qiime allows analysis of high-throughput
community sequencing data. Nat Methods 2010;7(5):335–36.
17 Reichmann F, Hassan AM, Farzi A, Jain P, Schuligoi R, Holzer
P. Dextran sulfate sodium-induced colitis alters stress-associated
behaviour and neuropeptide gene expression in the amygdala-
hippocampus network of mice. Sci Rep 2015;5:9970.
18 Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett
WS, et al. Metagenomic biomarker discovery and explanation.
Genome Biol 2011;12(6):R60-2011-12-6-r60.
19 Langille MG, Zaneveld J, Caporaso JG, McDonald D, Knights
D, Reyes JA, et al. Predictive functional profiling of microbial
communities using 16S rRNA marker gene sequences. Nat
Biotechnol 2013;31(9):814–21.
20 Cryan JF, Mombereau C. In search of a depressed mouse: utility
of models for studying depression-related behavior in genetically
modified mice. Mol Psychiatry 2004;9(4):326–57.
21 Finger BC, Dinan TG, Cryan JF. High-fat diet selectively pro-
tects against the effects of chronic social stress in the mouse.
Neuroscience 2011;192:351–60.
22 Sharma S, Fulton S. Diet-induced obesity promotes depressive-
like behaviour that is associated with neural adaptations in
brain reward circuitry. Int J Obes (Lond) 2013;37(3):382–89.
23 Zemdegs J, Quesseveur G, Jarriault D, Penicaud L, Fioramonti
X, Guiard BP. High-fat diet-induced metabolic disorders impairs
5-HT function and anxiety-like behavior in mice. Br J Pharmacol
2016;173(13):2095–3110.
24 Dutheil S, Ota KT, Wohleb ES, Rasmussen K, Duman RS.
High-fat diet induced anxiety and anhedonia: impact on brain
homeostasis and inflammation. Neuropsychopharmacology
2016;41(7):1874–87.
25 Magdy YM, El-Kharashi OA, Nabih ES, Shaker SM, Abd-
Elaziz LF, Aboul-Fotouh S. Potential involvement of JNK1
repression in the hepatic effect of sitagliptin and metformin in
rats subjected to high fat diet and chronic mild distress.
Biomed Pharmacother 2017;85:225–38.
26 Sharma S, Fernandes MF, Fulton S. Adaptations in brain
reward circuitry underlie palatable food cravings and anxiety
induced by high-fat diet withdrawal. Int J Obes (Lond)
2013;37(9):1183–91.
27 Kohsaka A, Laposky AD, Ramsey KM, Estrada C, Joshu C,
Kobayashi Y, et al. High-fat diet disrupts behavioral and mol-
ecular circadian rhythms in mice. Cell Metab 2007;6(5):414–21.
28 Bartolomucci A, Cabassi A, Govoni P, Ceresini G, Cero C, Berra
D, et al. Metabolic consequences and vulnerability to diet-
induced obesity in male mice under chronic social stress. PLoS
One 2009;4(1):e4331.
29 Kappel S, Hawkins P, Mendl MT. To group or not to group?
Good practice for housing male laboratory mice. Animals
(Basel) 2017;7(12). DOI: 10.3390/ani7120088.
30 Berry A, Bellisario V, Capoccia S, Tirassa P, Calza A, Alleva E,
et al. Social deprivation stress is a triggering factor for the emer-
gence of anxiety- and depression-like behaviours and leads to
reduced brain BDNF levels in C57BL/6J mice.
Psychoneuroendocrinology 2012;37(6):762–72.
31 Willner P. Chronic mild stress (CMS) revisited: consistency and
behavioural-neurobiological concordance in the effects of
CMS. Neuropsychobiology 2005;52(2): 90–110.
32 Gainey SJ, Kwakwa KA, Bray JK, Pillote MM, Tir VL, Towers
AE, et al. Short-term high-fat diet (HFD) induced anxiety-like
behaviors and cognitive impairment are improved with treatment
by glyburide. Front Behav Neurosci 2016;10:156.
33 Pistell PJ, Morrison CD, Gupta S, Knight AG, Keller JN,
Ingram DK, et al. Cognitive impairment following high fat
diet consumption is associated with brain inflammation. J
Neuroimmunol 2010;219(1–2):25–32.
34 Porter DW, Kerr BD, Flatt PR, Holscher C, Gault VA. Four
weeks administration of Liraglutide improves memory and
learning as well as glycaemic control in mice with high fat
dietary-induced obesity and insulin resistance. Diabetes Obes
Metab 2010;12(10):891–99.
35 Naseribafrouei A, Hestad K, Avershina E, Sekelja M, Linlokken
A, Wilson R, et al. Correlation between the human fecal micro-
biota and depression. Neurogastroenterol Motil 2014;26(8):
1155–62.
36 Jiang H, Ling Z, Zhang Y, Mao H, Ma Z, Yin Y, et al. Altered
fecal microbiota composition in patients with major depressive
disorder. Brain Behav Immun 2015;48:186–94.
37 Jeffery IB, O’Toole PW, Ohman L, Claesson MJ, Deane J,
Quigley EM, et al. An irritable bowel syndrome subtype
defined by species-specific alterations in faecal microbiota. Gut
2012;61(7):997–1006.
38 Lecomte V, Kaakoush NO, Maloney CA, Raipuria M, Huinao
KD, Mitchell HM, et al. Changes in gut microbiota in rats fed
a high fat diet correlate with obesity-associated metabolic par-
ameters. PLoS One 2015;10(5):e0126931.
39 Mitani H, Shirayama Y, Yamada T, Maeda K, Ashby Jr CR,
Kawahara R. Correlation between plasma levels of glutamate,
alanine and serine with severity of depression. Prog
Neuropsychopharmacol Biol Psychiatry 2006;30(6):1155–58.
40 Jernigan PL, Hoehn RS, Grassme H, Edwards MJ, Muller CP,
Kornhuber J, et al. Sphingolipids in major depression.
Neurosignals 2015;23(1):49–58.
41 Slyepchenko A, Maes M, Jacka FN, Kohler CA, Barichello T,
McIntyre RS, et al. Gut microbiota, bacterial translocation,
and interactions with diet: pathophysiological links between
major depressive disorder and non-communicable medical
comorbidities. Psychother Psychosom 2017;86(1):31–46.
42 Round JL, Mazmanian SK. The gut microbiota shapes intestinal
immune responses during health and disease. Nat Rev Immunol
2009;9(5):313–23.
43 Kim KA, Gu W, Lee IA, Joh EH, Kim DH. High fat diet-induced
gut microbiota exacerbates inflammation and obesity in mice via
the TLR4 signaling pathway. PLoS One 2012;7(10):e47713.
44 Catta-Preta M, Martins MA, Cunha Brunini TM, Mendes-
Ribeiro AC, Mandarim-de-Lacerda CA, Aguila MB.
Modulation of cytokines, resistin, and distribution of adipose
tissue in C57BL/6 mice by different high-fat diets. Nutrition
2012;28(2):212–19.
45 Rae CD. A guide to the metabolic pathways and function of
metabolites observed in human brain 1H magnetic resonance
spectra. Neurochem Res 2014;39(1):1–36.
46 Shungu DC, Weiduschat N, Murrough JW, Mao X, Pillemer S,
Dyke JP, et al. Increased ventricular lactate in chronic fatigue
syndrome. III. Relationships to cortical glutathione and clinical
symptoms implicate oxidative stress in disorder pathophysiology.
NMR Biomed 2012;25(9):1073–87.
47 Bradley KA, Mao X, Case JA, Kang G, Shungu DC, Gabbay V.
Increased ventricular cerebrospinal fluid lactate in depressed
adolescents. Eur Psychiatry 2016;32:1–8.
48 Sandoval-Salazar C, Ramirez-Emiliano J, Trejo-Bahena A,
Oviedo-Solis CI, Solis-Ortiz MS. A high-fat diet decreases
GABA concentration in the frontal cortex and hippocampus of
rats. Biol Res 2016;49:15-016-0075-6.
49 Luscher B, Shen Q, Sahir N. The GABAergic deficit hypothesis of
major depressive disorder. Mol Psychiatry 2011;16(4):383–406.
50 Hasler G, van der Veen JW, Tumonis T, Meyers N, Shen J,
Drevets WC. Reduced prefrontal glutamate/glutamine and
gamma-aminobutyric acid levels in major depression determined
using proton magnetic resonance spectroscopy. Arch Gen
Psychiatry 2007;64(2):193–200.
51 Ma K, Xu A, Cui S, Sun MR, Xue YC, Wang JH. Impaired
GABA synthesis, uptake and release are associated with
depression-like behaviors induced by chronic mild stress. Transl
Psychiatry 2016;6(10):e910.
52 Taylor MJ, Godlewska BR, Norbury R, Selvaraj S, Near J,
Cowen PJ. Early increase in marker of neuronal integrity with
antidepressant treatment of major depression: 1H-magnetic
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018
16

resonance spectroscopy of N-acetyl-aspartate. Int J
Neuropsychopharmacol 2012;15(10):1541–46.
53 Coupland NJ, Ogilvie CJ, Hegadoren KM, Seres P, Hanstock
CC, Allen PS. Decreased prefrontal Myo-inositol in major
depressive disorder. Biol Psychiatry 2005;57(12):1526–34.
54 Kastin AJ, Akerstrom V. Nonsaturable entry of neuropeptide Y
into brain. Am J Physiol 1999;276(3 Pt 1):E479–82.
55 Morris MJ, Chen H, Watts R, Shulkes A, Cameron-Smith D.
Brain neuropeptide Y and CCK and peripheral adipokine recep-
tors: temporal response in obesity induced by palatable diet. Int J
Obes (Lond) 2008;32(2):249–58.
56 Baranowska B, Wasilewska-Dziubinska E, Radzikowska M,
Plonowski A, Roguski K. Neuropeptide Y, galanin, and leptin
release in obese women and in women with anorexia nervosa.
Metabolism 1997;46(12):1384–89.
57 Hansen MJ, Jovanovska V, Morris MJ. Adaptive responses in
hypothalamic neuropeptide Y in the face of prolonged high-fat
feeding in the rat. J Neurochem 2004;88(4):909–16.
58 Chen H, Hansen MJ, Jones JE, Vlahos R, Bozinovski S,
Anderson GP, et al. Regulation of hypothalamic NPY by diet
and smoking. Peptides 2007 Feb;28(2):384–89.
59 Redrobe JP, Dumont Y, Fournier A, Quirion R. The
neuropeptide Y (NPY) Y1 receptor subtype mediates
NPY-induced antidepressant-like activity in the mouse
forced swimming test. Neuropsychopharmacology 2002;26(5):
615–24.
60 El Yacoubi M, Vaugeois JM, Marguet D, Sauze N, Guieu R,
Costentin J, et al. Behavioral characterization of CD26 deficient
mice in animal tests of anxiety and antidepressant-like activity.
Behav Brain Res 2006;171(2):279–85.
61 Kamble M, Gupta R, Rehan HS, Gupta LK. Neurobehavioral
effects of liraglutide and sitagliptin in experimental models.
Eur J Pharmacol 2016;774:64–70.
62 Guo M, Lu XY. Leptin receptor deficiency confers resistance to
behavioral effects of fluoxetine and desipramine via separable
substrates. Transl Psychiatry 2014;4:e486.
Hassan et al. High-fat diet induces depression-like behaviour in mice
Nutritional Neuroscience 2018 17