A new species of Brachycephalus (Anura, Brachycephalidae) from the coast of Santa Catarina State, southern Atlantic Forest, Brazil

Abstract

We describe a new species of Brachycephalus from municipality of São Francisco do Sul and municipality of Itapoá, in the state of Santa Catarina, Brazil, southern Atlantic Forest. The new species is known from six localities from near sea level up to 250 meters and represents the first record of a “pumpkin-toadlet” occurring in the lowlands. Morphological traits and phylogenetic analysis of a fragment the 16S mtDNA gene place the new species in the Brachycephalus pernix group. The new species is supported by external morphology, osteology, advertisement call, and mtDNA divergence. It is characterized, among other traits by a dorsal body color dark green with a dark brown vertebral stripe, and an orange background; snout-vent length of 9.2–10.8 mm in males and 11.1–12.4 mm in females; and advertisement call short (0.02–0.03 seconds), composed of one high-frequency note (dominant frequency 6.6–7.3 kHz). We observed synchronized alternation in the emission of vocalizations among neighbor males, indicating that males of the new species are able to hear and use vocalizations to interact with each other. We provide descriptions of clutch, eggs, and juvenile and observations on parental care. The new species has not been recorded within any protected area and can be threatened by human-induced habitat loss and modification.

Full text

Accepted by J. Padial: 21 Feb. 2018; published: 12 Apr. 2018
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN
1175-5334
(online edition)
Copyright © 2018 Magnolia Press
Zootaxa 4407 (4): 483
–
505
http://www.mapress.com/j/zt/
Article
483
https://doi.org/10.11646/zootaxa.4407.4.2
http://zoobank.org/urn:lsid:zoobank.org:pub:DC9BD547-0A35-4F22-821C-0ED6F9481937
A new species of Brachycephalus (Anura, Brachycephalidae) from the coast of
Santa Catarina State, southern Atlantic Forest, Brazil
JULIANE PETRY DE CARLI MONTEIRO
1,5
, THAIS HELENA CONDEZ
1
,
PAULO CHRISTIANO DE ANCHIETTA GARCIA
2,3
, ESTEVÃO JASPER COMITTI
2
,
IVAN BOREL AMARAL
4
& CÉLIO FERNANDO BAPTISTA HADDAD
1
1
Departamento de Zoologia and Centro de Aquicultura, Instituto de Biociências, Campus Rio Claro, Av. 24-A 1515, caixa postal 199,
Universidade Estadual Paulista, 13506-900, Rio Claro, São Paulo, Brazil
2
Laboratório de Herpetologia, Departamento de Zoologia, Instituto de Ciências
Biológicas, Av. Antônio Carlos 6627, Universidade Federal de Minas Gerais, 31270-901, Belo Horizonte, Minas Gerais, Brazil
3
Programa de Pós-Graduação em Zoologia, Instituto de Ciências Biológicas, Av. Antônio Carlos 6627, Universidade Federal de
Minas Gerais, 31270-901, Belo Horizonte, Minas Gerais, Brazil
4
Centro Nacional de Pesquisa e Conservação de Répteis e Anfíbios, Rua 229 95, Instituto Chico Mendes de Conservação da Biodiver-
sidade, 74605-090, Goiânia, Goiás, Brazil
5
Corresponding author. E-mail: julianepmonteiro@gmail.com
Abstract
We describe a new species of Brachycephalus from municipality of São Francisco do Sul and municipality of Itapoá, in
the state of Santa Catarina, Brazil, southern Atlantic Forest. The new species is known from six localities from near sea
level up to 250 meters and represents the first record of a “pumpkin-toadlet” occurring in the lowlands. Morphological
traits and phylogenetic analysis of a fragment the 16S mtDNA gene place the new species in the Brachycephalus pernix
group. The new species is supported by external morphology, osteology, advertisement call, and mtDNA divergence. It is
characterized, among other traits by a dorsal body color dark green with a dark brown vertebral stripe, and an orange back-
ground; snout-vent length of 9.2–10.8 mm in males and 11.1–12.4 mm in females; and advertisement call short (0.02–0.03
seconds), composed of one high-frequency note (dominant frequency 6.6–7.3 kHz). We observed synchronized alterna-
tion in the emission of vocalizations among neighbor males, indicating that males of the new species are able to hear and
use vocalizations to interact with each other. We provide descriptions of clutch, eggs, and juvenile and observations on
parental care. The new species has not been recorded within any protected area and can be threatened by human-induced
habitat loss and modification.
Key words: Brachycephaloidea, elevational range, morphology, taxonomy
Resumo
Descrevemos uma nova espécie de Brachycephalus para o sul da Mata Atlântica. A nova espécie ocorre nos municípios
de São Francisco do Sul e Itapoá, estado de Santa Catarina, Brasil. A nova espécie é encontrada em seis localidades, desde
altitudes próximas ao nível do mar até 250 metros de altitude, representando o primeiro registro de um sapinho-pingo-de-
ouro com ocorrência em terras-baixas. Os caracteres morfológicos e a análise filogenética realizada com um fragmento
de gene mtDNA posicionam a nova espécie no grupo de Brachycephalus pernix. A nova espécie é suportada pela morfo-
logia externa, osteologia, canto de anúncio e sequências de DNA. Pode ser caracterizada pela coloração dorsal verde es-
cura com uma faixa vertebral marrom e coloração de fundo laranja; comprimento rostro-cloacal 9,2–10,8 mm em machos
e 11,1–12,4 mm em fêmeas; e canto de anúncio curto (0,02–0,03 segundos), composto por uma nota de alta frequência
(frequência dominante 6,6–7,3 kHz). Observamos alternância sincronizada na emissão de vocalizações entre machos viz-
inhos, indicando que os machos da nova espécie são capazes de ouvir e usar as vocalizações para interagirem uns com os
outros. Além disso, apresentamos a descrição da desova, dos ovos e do juvenil da nova espécie, além de observações sobre
o cuidado parental. A nova espécie não foi registrada em áreas protegidas e pode estar ameaçada pela perda e modificação
antrópica de habitats.

MONTEIRO ET AL.
484
·
Zootaxa 4407 (4) © 2018 Magnolia Press
Introduction
The genus Brachycephalus comprises 34 species, all of which are endemic to the Brazilian Atlantic Forest (Napoli
et al. 2011; Ribeiro et al. 2015; Frost 2017). Species in this genus are essentially leaf-litter dwellers and are
characterized by miniaturization (Hanken & Wake 1993; Clemente-Carvalho et al. 2009). The evolutionary process
of miniaturization has resulted in structural modifications including the reduction and loss of functional fingers,
toes, and phalangeal elements (Yeh 2002; Hedges et al. 2008; Clemente-Carvalho et al. 2011). Also, most species
possess conspicuous yellow-orange skin coloration, often associated with the secretion of toxic substances such as
tetrodotoxin and its analogues (Sebben et al. 1986; Pires et al. 2002, 2005; Hanifin 2010; Arcanjo et al. 2015).
Species of Brachycephalus occur from sea level up to 2000 meters along the main Atlantic Forest mountain
ranges (Bornschein et al. 2016a). Currently, three putative species groups have been attributed to the genus based
on morphology and geographic distribution (including elevational and bioclimatic ranges; Pie et al. 2013; Ribeiro
et al. 2015). As defined in Ribeiro et al. (2015), the B. ephippium group comprises species with “bufoniform”
bodies (term defined by Miranda-Ribeiro 1920), and hyperossification of the skull and skeleton; the B. pernix
group comprises species with “bufoniform” bodies, but without hyperossification of the skull and skeleton; and the
B. didactylus group comprises species with “leptodactyliform” bodies (term defined by Napoli et al. 2011), also
without hyperossification of the skull and skeleton. Species of the B. ephippium and B. pernix groups (“pumpkin-
toadlets”) exhibit conspicuous orange coloration and generally restricted geographic distributions, occurring
between 450–1800 meters above sea level (Pie et al. 2013; Ribeiro et al. 2015; Bornschein et al. 2016a; Guimarães
et al. 2017; Ribeiro et al. 2017). In contrast, the B. didactylus group (“flea-toads”) exhibit cryptic coloration and
occurs from the sea level up to 1000 meters of elevation (Izecksohn 1971; Giaretta & Sawaya 1998; Napoli et al.
2011; Condez et al. 2016).
The molecular evidence on species relationships in Brachycephalus (Clemente-Carvalho et al. 2011; Padial et
al. 2014) corroborates the monophyly of the B. ephippium and B. pernix groups (Ribeiro et al. 2015). Species
assigned to the B. ephippium group occur in the states of Espírito Santo, Rio de Janeiro, and São Paulo (at lower
latitudes, from 20°S to 24°S): B. alipioi Pombal & Gasparini, 2006; B. bufonoides Miranda-Ribeiro, 1920; B.
crispus Condez, Clemente-Carvalho, Haddad & Reis, 2014; B. ephippium (Spix, 1824); B. garbeanus Miranda-
Ribeiro, 1920; B. guarani Clemente-Carvalho, Giaretta, Condez, Haddad & Reis, 2012; B. margaritatus Pombal &
Izecksohn, 2011; B. nodoterga Miranda-Ribeiro, 1920; B. pitanga Alves, Sawaya, Reis & Haddad, 2009; B. toby
Haddad, Alves, Clemente-Carvalho & Reis, 2010; and B. vertebralis Pombal, 2001. Subsequently, B. darkside
Guimarães, Luz, Rocha & Feio, 2017 was considered related to these species based on its morphology and
geographic distribution (Guimarães et al. 2017). Brachycephalus atelopoide Miranda-Ribeiro, 1920, a species
from the state of São Paulo, is apparently similar to species in this group, but little is known about this species, its
holotype is lost (Pombal 2010), and the species has not been assigned to any group.
Species assigned to the B. pernix group occur in the states of Paraná and Santa Catarina (at higher latitudes,
from 24°S to 27°S): B. albolineatus Bornschein, Ribeiro, Blackburn, Stanley & Pie 2016; B. auroguttatus Ribeiro,
Firkowski, Bornschein & Pie, 2015; B. boticario Pie, Bornschein, Firkowski, Belmonte-Lopes & Ribeiro, 2015; B.
brunneus Ribeiro, Alves, Haddad & Reis, 2005; B. coloratus Ribeiro, Blackburn, Stanley, Pie & Bornschein 2017;
B. curupira Ribeiro, Blackburn, Stanley, Pie & Bornschein 2017; B. ferruginus Alves, Ribeiro, Haddad & Reis,
2006; B. fuscolineatus Pie, Bornschein, Firkowski, Belmonte-Lopes & Ribeiro, 2015; B. izecksohni Ribeiro, Alves,
Haddad & Reis, 2005; B. leopardus Ribeiro, Firkowski & Pie, 2015; B. mariaeterezae Bornschein, Morato,
Firkowski, Ribeiro & Pie, 2015; B. olivaceus Bornschein, Morato, Firkowski, Ribeiro & Pie, 2015; B. pernix
Pombal, Wistuba & Bornschein, 1998; B. pombali Alves, Ribeiro, Haddad & Reis, 2006); B. quiririensis Pie &
Ribeiro, 2015; B. tridactylus Garey, Lima, Hartmann & Haddad, 2012; and B. verrucosus Ribeiro, Firkowski,
Bornschein & Pie, 2015.
In contrast, available phylogenetic hypotheses for Brachycephalus (Clemente-Carvalho et al. 2011; Padial et
al. 2014) do not corroborate the monophyly of the B. didactylus group, as proposed by Ribeiro et al. (2015) [B.
didactylus (Izecksohn, 1971); B. hermogenesi (Giaretta & Sawaya, 1998); B. pulex Napoli, Caramaschi, Cruz &
Dias, 2011; and B. sulfuratus Condez, Monteiro, Comitti, Garcia, Amaral & Haddad, 2016]. Brachycephalus
didactylus and B. hermogenesi were placed in the B. ephippium group, though B. hermogenesi was recovered in a
variety of different positions (Clemente-Carvalho et al. 2011; Padial et al. 2014). Having never been previously
evaluated in a phylogenetic context, B. sulfuratus was recently recovered as related to the B. pernix group (Condez

Zootaxa 4407 (4) © 2018 Magnolia Press
·
485
NEW SPECIES OF BRACHYCEPHALUS
et al. 2016), while Brachycephalus pulex has never been included in any molecular analysis. Due to these
uncertainties, it would be premature to assign B. didactylus, B. hermogenesi, B. pulex, and B. sulfuratus to any
group until a more complete hypothesis of Brachycephalus relationships is available.
We contribute to the knowledge of Brachycephalus diversity and distribution by describing a new species from
the coast of the state of Santa Catarina. The new species belongs to the B. pernix group, according to morphology
and DNA analyses, and is supported by divergence in external morphology, osteology, advertisement call, and
DNA sequences.
Material and methods
Data collection. Specimens were collected, euthanized in 5% lidocaine, fixed in 10% formalin, and preserved in
70% ethanol. Muscle tissue was extracted and stored in absolute ethanol. Collecting permits were provided by
ICMBio (SISBIO 45665-2, 49587-1, and 6873-1). Bone and cartilage were cleared and double-stained with
alizarin red and alcian blue following procedures based on Taylor & Van Dyke (1985). Specimens used in the
description, muscle tissues, and recordings are deposited in the Célio F. B. Haddad (CFBH) amphibian collection,
Departamento de Zoologia, Instituto de Biociências, Universidade Estadual Paulista, Rio Claro, São Paulo, Brazil
and the amphibian collection of Centro de Coleções Taxonômicas do Instituto de Ciências Biológicas da
Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, Minas Gerais, Brazil.
Morphology. A single person (J.P.C. Monteiro) took 14 morphometric measurements of the preserved
specimens using a Zeiss Stemi SV 11 stereomicroscope with an ocular micrometer (specimens from CFBH and
UFMG) and a Tecnival stereomicroscope (specimens from Museu de História Natural Capão da Imbuia).
Measurements followed Duellman (1970), Cei (1980), Heyer et al. (1990), and Condez et al. (2016). The
abbreviations for the measurements are: SVL (snout-vent length); HL (head length; from tip of snout to angle of
jaw); HW (head width; greatest width of head located between angle of jaw); ND (nostril diameter); IND
(internostril distance; between inner margins of nostrils); ED (eye diameter); IOD (interorbital distance; between
anterior corners of eyes); END (eye-nostril distance; from anterior corner of the eye to posterior margin of nostril);
AL (arm length); FAL (forearm length); HAL (hand length; between the centrale and the longest finger); THL
(thigh length); TBL (tibia length); and FL (foot length; between the centrale and the longest toe). Sex was
determined by the presence of vocal slits and externally expanded vocal sacs in males and absence in females.
Differences in body size between males and females were tested using the Welch’s T-test in R, under the
assumptions of normality and homogeneity of variances (R Development Core Team 2017, v. 3.4.1). Specimens
examined are presented in the Appendix 1. Comparisons with recent described species, B. coloratus and B.
curupira, were based on literature (Ribeiro et al. 2017). The osteological description was also made using a Zeiss
SteREO Discovery.V20 stereomicroscope with motorized 20x zoom. Data of Brachycephalus albolineatus, B.
coloratus, and B. curupira were obtained from tomography images available at Morpho Source (accessed in http://
morphosource.org). The terminology of bone structures was based on Duellman & Trueb (1986) and Trueb (1993).
Bioacoustics. We recorded and analyzed two calling males from three different populations of the new species
in the state of Santa Catarina (six calling males in total): (1) Vila da Glória, municipality of São Francisco do Sul
(recording JPCM 001 from voucher specimen CFBH 39848, and unvouched recording JPCM 002; 26°13'39"S;
48°41'31"W, Datum WGS 84); (2) Serra da Palha, municipality of São Francisco do Sul (unvouched recordings
JPCM 003–004; 26°17'50"S; 48°40'28"W, Datum WGS 84); and (3) Braço do Norte, municipality of Itapoá
(unvouched recordings JPCM 005-006; 26°07'29"S; 48°43'48"W, Datum WGS 84). The calls were recorded
between 09:50–18:00h, air temperature 17–25°C, and air relative humidity 100%.
All recordings were made with a Marantz PMD-660 digital recorder coupled to an external unidirectional
Sennheiser ME-66 microphone, except for the call of the collected voucher, which was recorded with a Tascam
DR-07MKII digital recorder coupled to an external unidirectional Audio-technica ATR6550 microphone. The
advertisement calls were recorded at approximately one-meter from the calling male. We analyzed 11–28 calls per
individual using a sampling frequency rate of 44.1 kHz and 16-bit resolution in the mono pattern. Spectral and
temporal parameters were measured using the program Raven Pro 1.5, respectively from spectrograms and
oscillograms (Bioacoustics Research Program 2011). Spectrograms were produced with Hanning window type,
window size of 512 samples, overlap 75%, hop size 2.90 ms, DFT 1024 samples, grid spacing 43.1 Hz, 50%

MONTEIRO ET AL.
486
·
Zootaxa 4407 (4) © 2018 Magnolia Press
brightness, 50% contrast and color map Standard Gamma II. Twelve advertisement call parameters were obtained
following the definitions provided by Köhler et al. (2017): (1) call duration (s); (2) inter-call interval (s); (3)
number of notes per call (notes/call); (4) note duration (ms); (5) inter-note interval (ms); (6) note repetition rate
(notes/s); (7) number of pulses per note (pulses/note); (8) pulse repetition rate (pulses/s); (9) dominant frequency
(defined as peak frequency in Raven Pro 1.5); (10) minimum and (11) maximum frequencies (kHz; defined by the
green limits of the band that concentrates greater energy; see Figures 4B); and (12) 5–95% frequency bandwidth
(kHz). Sound figures were prepared in R using the package Seewave 2.0.5, with the settings Hanning window, 90%
overlap, and 256 point resolution (Sueur et al. 2008; R Development Core Team 2017, v. 3.4.1).
Molecular analysis. We extracted total genomic DNA from samples of muscle tissue preserved in absolute
ethanol following a standard salt extraction protocol adapted from Maniatis et al. (1982). We chose a fragment of
the mitochondrial 16S rRNA gene (519 bp) for species comparisons, considering the availability of this fragment
for the majority of Brachycephalus species from B. pernix group in GenBank database (Firkowski et al. 2016).
Also, this fragment has been commonly used as a barcoding marker in amphibian taxonomy due to its low level of
intraspecific variation and high level of interspecific variation (Vences et al. 2005). We carried out DNA
amplification in a 20μl volume reaction using master mix Fermentas Taq Polymerase and reagents (MBI
Fermentas, USA) and the primers 16Sar-L (CGCCTGTTTATCAAAAACAT) and 16Sbr-H
(CCGGTCTGAACTCAGATCACGT) (Palumbi et al. 1991). The polymerase chain reactions (PCR) began with a
denaturation at 94°C (3 min), followed by 37 cycles consisting of denaturation at 94°C (20 s), annealing at 50°C
(20 s), extension at 68°C (45 s), and a final step at 68°C following the final cycle (5 min). PCR products were
purified using Exonuclease and Shrimp Alkaline Phosphatase (Affimetrix/USB, Cleveland, OH) and samples were
sequenced in both directions by Macrogen Inc. (Seoul, South Korea). Consensus sequences were assembled with
CodonCode Aligner 3.5 (Codon Code Corporation) and aligned in Mega 6.06 (Tamura et al. 2013) using Muscle in
default parameters (Edgar 2004).
To test if the DNA sequences corroborate the evidence of divergence in morphological, osteological, and
bioacoustic traits we tested the new species position in a phylogenetic analysis with other 20 Brachycephalus
species. Ischnocnema guentheri, Ischnocnema cf. henselii, and Ischnocnema parva were used as outgroups, and the
tree was rooted with Haddadus binotatus (Hedges et al. 2008). For phylogenetic analysis we used new sequences
(see above) and all available 16S sequence data from GenBank [sequences from municipality of Piraquara, Paraná
state, were assigned to Brachycephalus cf. coloratus; from unidentified sequences in Ribeiro et al. (2017)]. Our
dataset comprises 168 DNA sequences, including 16 sequences of the new species from six distinct localities. A
list of vouchers, localities, and the GenBank accession numbers are available in the Appendix 2. Phylogenetic trees
were obtained using maximum parsimony (MP) in TNT 1.1 (Goloboff et al. 2008). For this analysis we used “new
technology” search, search level 50, sectorial searches, tree drift and tree fusing included (Goloboff 1999), hitting
the best length 100 times. We estimated the Jackknife absolute frequency (Farris et al. 1996) with 1000 replicates
using “new technology” search, driven searches, and checking level every 10 hits in the strict consensus tree. The
topology was edited in Winclada (Nixon 1999–2002). We also calculated the uncorrected pairwise genetic
distances (p-distance) among individuals of the new species and morphologically similar and loosely related
species. The number of base differences between sequences was calculated considering the complete deletion of
gaps and missing data using Mega 6.06 (Tamura et al. 2013).
Description of the new species
Brachycephalus actaeus
sp. nov.
Figures 1, 2, 6, 7, and 8
Holotype. CFBH 39850, adult male, collected at Serra da Palha, Laranjeiras, Ilha de São Francisco do Sul,
municipality of São Francisco do Sul, state of Santa Catarina, Brazil (26°17'50"S; 48°40'28"W, Datum WGS 84, ca
60 meters above sea level), on 19 May 2015, by C.F.B. Haddad, J.P.C. Monteiro, and E.C. Nardin (Figures 1 and
2).
Paratopotypes. CFBH 39851, adult female, collected with the holotype; CFBH 39872, 39873, and UFMG
18973, adult males, collected on 25 November 2015, by J.P.C. Monteiro, T.H. Condez, and E.C. Nardin; CFBH

Zootaxa 4407 (4) © 2018 Magnolia Press
·
487
NEW SPECIES OF BRACHYCEPHALUS
39876, adult male, and CFBH 39877, adult female, collected on 02 December 2015, by J.P.C. Monteiro and E.C.
Nardin.
Paratypes. CFBH 39846, adult male, cleared and double-stained, collected at Fazenda Morro Grande, Morro
Grande, Ilha de São Francisco do Sul, municipality of São Francisco do Sul, state of Santa Catarina, Brazil
(26°17'47"S; 48°37'10"W, Datum WGS 84, ca 60 meters above sea level), on 14 November 2014, by E.J. Comitti.
UFMG 18970, adult female, collected on 15 November 2014, by J.P.C. Monteiro, T.H. Condez, and E.J. Comitti;
CFBH 39849, sub-adult female, collected on 21 November 2014, by J.P.C. Monteiro and E.C. Nardin; CFBH
39848, adult male, cleared and double-stained, collected on 21 January 2015, by C.F.B. Haddad, J.P.C. Monteiro,
T.H. Condez, and E.J. Comitti; UFMG 18971, adult male, collected on 01 August 2015, by J.P.C. Monteiro and
E.C. Nardin; CFBH 39855–39858 and 39861, adult males, CFBH 39860, adult female, CFBH 39859, juvenile,
collected on 23 November 2015, by J.P.C. Monteiro, T.H. Condez, and E.C. Nardin; all collected at Centro de
Estudos e Pesquisas Ambientais da Univille (CEPA), Vila da Glória, Distrito do Saí, municipality of São Francisco
do Sul, state of Santa Catarina, Brazil (26°13'39"S; 48°41'31"W, Datum WGS 84, ca 120 meters above sea level).
CFBH 39853 and 39854, adult males, collected on 27 August 2015, by J.P.C. Monteiro and E.C. Nardin; CFBH
39862, adult female, collected on 23 November 2015, by J.P.C. Monteiro, T.H. Condez, and E.C. Nardin; at
Estrada do Saí, Distrito do Saí, municipality of São Francisco do Sul, state of Santa Catarina, Brazil (26°12'06"S;
48°41'37"W, Datum WGS 84, ca 80 meters above sea level). CFBH 39863, 39864, 39867, 39868, and UFMG
18972 adult females, CFBH 39865 and 39870, adult males, collected on 24 November 2015, by J.P.C. Monteiro,
T.H. Condez, and E.C. Nardin; CFBH 39875, adult female, collected on 30 November 2015, by J.P.C. Monteiro
and E.C. Nardin; at Braço do Norte, municipality of Itapoá, state of Santa Catarina, Brazil (26°07'29"S;
48°43'48"W, Datum WGS 84, ca 220 meters above sea level). CFBH 42005–42008, adult females, collected on 17
September 2016, by J.P.C. Monteiro and E.C. Nardin; Fazenda Palmito Juriti, municipality of São Francisco do
Sul, state of Santa Catarina, Brazil (26°08'09"S; 48°43'54"W, Datum WGS 84, 125–170 meters above sea level).
Diagnosis. Brachycephalus actaeus sp. nov. is a new species of the B. pernix group, distinguished from all its
congeners by the following combination of characters: (1) “bufoniform” body; (2) general dorsal body color dark
green with a dark brown vertebral stripe, and orange background more evident in ventral view; (3) absence of
hyperossification of the skull and skeleton; (4) pectoral girdle arciferal and robust, with small ovoid fenestra,
distant from the epicoracoid; (5) radius and ulna fused; (6) finger IV greatly reduced, almost not visible externally;
(7) manus with two prepollical elements; (8) tips of terminal phalangeal elements of fingers I and IV pointed, II
and III arrow-shaped; (9) tibiale and fibulare completely fused; (10) toes I and V present but externally
indistinguishable, toe II greatly reduced, toe III short and distinct, and toe IV larger and robust; (11) pes with distal
tarsal element I present; (12) pes with phalangeal formula 1–2–3–4–0; (13) tips of terminal phalangeal elements of
toes I and II pointed, and of toes III and IV arrow-shaped; (14) arytenoid cartilages not mineralized; (15) body size
(SVL of adults: 9.2–10.8 mm for males and 11.1–12.4 mm for females); (16) proportional measurements HL/SVL
18–24% and ED/HL 52–73%; (17) rounded snout in dorsal and lateral views; (18) protuberant nostrils; (19) skin
texture rough; and (20) advertisement call short (0.02–0.03 seconds), composed of one high-frequency note
(dominant frequency 6.6–7.3 kHz).
Comparisons with other species. Brachycephalus actaeus sp. nov. exhibits a “bufoniform” body and an
orange background color, both characteristics that clearly differentiate it from the “leptodactyliform” species: B.
didactylus, B. hermogenesi, B. pulex, and B. sulfuratus (Izecksohn 1971; Giaretta & Sawaya 1998; Napoli et al.
2011; Condez et al. 2016). These species are generally smaller, exhibit “leptodactyliform” bodies, and always
exhibit a brown background color (Napoli et al. 2011; Condez et al. 2016).
The absence of hyperossification of the skull and skeleton distinguishes Brachycephalus actaeus sp. nov. from
B. darkside, B. ephippium, B. garbeanus, and B. margaritatus, which exhibit the extreme condition of
hyperossification within Brachycephalus, including a dorsal bony shield (Clemente-Carvalho et al. 2009;
Guimarães et al. 2017). The absence of hyperossification also distinguishes the new species from B. alipioi, B.
atelopoide, B. bufonoides, B. crispus, B. guarani, B. nodoterga, B. pitanga, B. toby, and B. vertebralis, which
exhibit the intermediate condition of hyperossification within Brachycephalus (Clemente-Carvalho et al. 2009;
Haddad et al. 2010; Pombal 2010; Clemente-Carvalho et al. 2011; Condez et al. 2014; Condez et al. 2016).
Brachycephalus actaeus sp. nov. differs from B. brunneus, B. coloratus, B. ferruginus, B. izecksohni, and B.
pombali, which possess pectoral girdles with larger fenestra, disposed closer to the epicoracoid (small fenestra
distant from the epicoracoid in the new species). Likewise, B. brunneus, B. ferruginus, B. izecksohni, and B.

MONTEIRO ET AL.
488
·
Zootaxa 4407 (4) © 2018 Magnolia Press
pombali differ in having the radius and ulna not fused, pes with distal tarsal element I absent, and toe V reduced
(Ribeiro et al. 2005; Alves et al. 2006); the new species has the radius and ulna fused, pes with distal tarsal element
I present, and toe V externally not visible. Also, B. albolineatus, B. coloratus, B. curupira, B. ferruginus, and B.
pombali have just one prepollical element, and B. izecksohni has no prepollical element (Ribeiro et al. 2005; Alves
et al. 2006; Bornschein et al. 2016b; Ribeiro et al. 2017); the new species has two prepollical elements. The
phalangeal formula for the pes of B. brunneus, B. izecksohni, and B. pombali is 0–2–3–4–0 (Ribeiro et al. 2005;
Alves et al. 2006), and for B. curupira it is 0–1–3–4–0 (Ribeiro et al. 2017); the phalangeal formula of the pes of
the new species is 1–2–3–4–0. In B. albolineatus, B. coloratus, and B. curupira the fibulare and tibiale are not
completely fused; tips of terminal phalangeal elements of toes II–IV are arrow-shaped (fibulare and tibiale
completely fused; tips of terminal phalangeal elements of toes I and II pointed, III and IV arrow-shaped in the new
species). Finally, the arytenoid cartilages are mineralized in B. albolineatus and B. coloratus (arytenoid cartilages
not mineralized in the new species). Although the osteology of B. pernix was not studied in detail (Pombal et al.
1998), on the basis of the available information its osteology is quite similar to that of the new species. See Figure
3 for osteological details of the new species.
Body size (males SVL = 9.2–10.8 mm; females SVL = 11.1–12.4 mm) distinguishes the new species from
Brachycephalus ferruginus (males SVL = 11.6–12.5 mm; females SVL = 13.0–14.5 mm; Alves et al. 2006), B.
pernix (males SVL = 12.0–13.3 mm; females SVL = 14.1–15.8 mm; Pombal et al. 1998), and B. pombali (males
SVL = 12.6–13.9 mm; females SVL= 14.6–15.3 mm; Alves et al. 2006). Also, in B. coloratus (males SVL = 10.3–
10.6 mm; females SVL = 12.2–13.3 mm; Ribeiro et al. 2017), B. izecksohni (males SVL = 10.3–12.1 mm; females
SVL = 12.5–13.1 mm; Ribeiro et al. 2005), and B. tridactylus (males SVL = 10.6–11.6; females SVL = 13.5–13.8
mm; Garey et al. 2012) males and/or females are slightly larger than in the new species. Brachycephalus actaeus
sp. nov. is distinguishable from B. albolineatus, B. auroguttatus, B. boticario, B. fuscolineatus, B. leopardus, B.
mariaeterezae, B. olivaceus, B. quiririensis, and B. verrucosus by a proportionally shorter head relative to body
length (HL/SVL) and by a proportionally larger eye diameter related to head length (ED/HL). In B. actaeus sp.
nov., HL/ SVL is 18–24% (x
̄ = 20, SD = 1) and ED/HL is 52–73% (x
̄ = 63, SD = 4), for the 32 adult specimens of
the type series, without sexual distinction. In B. albolineatus, HL/SVL is 28–34% (x
̄ = 31, SD = 4) and ED/HL is
36–42% (x
̄ = 38, SD = 4); in B. auroguttatus, HL/ SVL is 29–38% (x
̄ = 33, SD = 2) and ED/HL is 30–44% (x
̄ = 33,
SD = 3); in B. boticario, HL/ SVL is 31–36% (x
̄ = 34, SD = 2) and ED/HL is 30–34% (x
̄ = 32, SD = 1); in B.
fuscolineatus, HL/ SVL is 29–34% (x
̄ = 31, SD = 1) and ED/HL is 36–41% (x
̄ = 39, SD = 1); in B. leopardus, HL/
SVL is 31–35% (x
̄ = 33, SD = 1) and ED/HL is 34–43% (x
̄ = 38, SD = 3); in B. mariaeterezae, HL/ SVL is 29–36%
(x
̄ = 33, SD = 2) and ED/HL is 36–42% (x
̄ = 39, SD = 2); in B. olivaceus, HL/ SVL is 32–36% (x
̄ = 34, SD = 1) and
ED/HL is 26–36% (x
̄ = 32, SD = 3); in B. quiririensis, HL/ SVL is 31–36% (x
̄ = 34, SD = 1) and ED/HL is 28–34%
(x
̄ = 32, SD = 2); and in B. verrucosus, HL/ SVL is 30–36% (x
̄ = 33, SD = 2) and ED/HL is 30–40% (x
̄ = 34, SD =
3) (Pie & Ribeiro 2015; Ribeiro et al. 2015; Bornschein et al. 2016b).
Additionally, Brachycephalus actaeus sp. nov. exhibits a rounded snout in dorsal and lateral views, which
distinguishes it from B. brunneus, which has a slightly mucronate snout in dorsal view (Ribeiro et al. 2005); from
B. leopardus, which has a slightly truncate snout in dorsal and lateral views (Ribeiro et al. 2015); and from B.
quiririensis, which has a mucronate snout in dorsal view (Pie & Ribeiro 2015). Nostrils are not protuberant in B.
auroguttatus, B. pernix, and B. fuscolineatus (Pombal et al. 1998; Ribeiro et al. 2015), which differ from the
protuberant nostrils of the new species.
In Brachycephalus tridactylus, finger IV is not externally visible (Garey et al. 2012), while in the new species
it is reduced but externally distinct. In B. actaeus sp. nov., fingertips I, II, and IV are rounded, differing from B.
pernix in which these fingertips are pointed (Pombal et al. 1998) and from B. brunneus, B. izecksohni, and B.
leopardus, which have the tip of finger II pointed (Ribeiro et al. 2005; Ribeiro et al. 2015).
The texture of the skin on the dorsum of Brachycephalus actaeus sp. nov. is rough; this characteristic
distinguishes the new species from B. albolineatus, B. brunneus, B. coloratus, B. curupira, B. ferruginus, B.
izecksohni, B. leopardus, B. pernix, B. pombali, and B. tridactylus, which have a smooth dorsum (Pombal et al.
1998; Ribeiro et al. 2005; Alves et al. 2006; Garey et al. 2012; Ribeiro et al. 2015; Bornschein et al. 2016b;
Ribeiro et al. 2017).
The dark green general color of Brachycephalus actaeus sp. nov. in life is very distinct from B. boticario, B.
coloratus, B. ferruginus, B. fuscolineatus, B. izecksohni, B. leopardus, B. mariaeterezae, B. quiririensis, B. pernix,
B. pombali, B. tridactylus, and B. verrucosus, which exhibit a bright yellow or orange general dorsal body color

Zootaxa 4407 (4) © 2018 Magnolia Press
·
489
NEW SPECIES OF BRACHYCEPHALUS
(Pombal et al. 1998; Ribeiro et al. 2005; Alves et al. 2006; Garey et al. 2012; Pie & Ribeiro 2015; Ribeiro et al.
2015; Ribeiro et al. 2017). The body color of the new species is similar to B. albolineatus, which has a greenish
general coloration (Bornschein et al. 2016b), and B. olivaceus, which is predominantly dark green to brown
(Ribeiro et al. 2015).
FIGURE 1. Brachycephalus actaeus sp. nov. CFBH 39850 (holotype), adult male. (A) Dorsal and (B) lateral views of head,
(C) ventral view of left hand, and (D) ventral view of left foot. Scale bar = 1.0 mm.
The advertisement call of Brachycephalus actaeus sp. nov. differs in structure and frequency from all known
advertisement calls within Brachycephalus. It is clearly distinct from B. crispus, B. darkside, B. ephippium, and B.
pitanga by having higher frequencies together with a different call structure (Pombal et al. 1994; Araújo et al.
2012; Condez et al. 2014; Guimarães et al. 2017). In these species, the advertisement call is characterized by the
regular repetition of one low-frequency note with several pulses, while in B. actaeus sp. nov. the high-frequency

MONTEIRO ET AL.
490
·
Zootaxa 4407 (4) © 2018 Magnolia Press
notes are composed of just two pulses. In B. crispus, the notes generally last 0.28 seconds and are composed of 10
pulses; the frequency range is 3.5–5.7 kHz, while the dominant frequency is 4.6 kHz (Condez et al. 2014). In B.
darkside, the average note duration is 0.11 seconds and notes are composed of six pulses; the frequency range is
2.5–5.8 kHz [considered dominant frequency in Guimarães et al. (2017)], while the dominant frequency is 3.4 kHz
[considered peak frequency in Guimarães et al. (2017)]. In B. ephippium, notes typically last 0.12 seconds and are
also composed of 12 pulses; the minimum and maximum frequencies are 3.4–5.3 kHz (Pombal et al. 1994). In B.
pitanga, notes last 0.17 seconds and are composed of 11 pulses; the dominant frequency is 4.9 kHz (Araújo et al.
2012). The high frequency of the advertisement call of the new species is comparable to that described for B.
hermogenesi and B. sulfuratus, the latter having the highest dominant frequency known for the genus (Condez et
al. 2016). Nevertheless, the advertisement calls of these species differ from the new species in general structure,
which is long and composed of a set of high-frequency notes. In B. hermogenesi, the call is composed of 1–5 notes;
call lasts 0.2 seconds, with 1–5 pulses (Verdade et al. 2008). The dominant frequency in B. hermogenesi is 6.8 kHz
(Verdade et al. 2008). In B. sulfuratus, the call is composed of 4–7 notes, each one lasting 0.19 seconds, with 9
pulses (Condez et al. 2016). The frequency range is 4.9–9.3 kHz and the dominant frequency is 6.7 kHz (Condez et
al. 2016). When compared to the advertisement calls of its most closely related species, B. pernix and B.
tridactylus, the new species call has shorter notes and higher frequencies. In B. pernix, notes last 0.03–0.06 seconds
and are composed of three pulses; the frequency range is 4.5 kHz–6.7 kHz (Wistuba 1998). In B. tridactylus, the
frequency range is 3.2–6.4 kHz and dominant frequency is 4.8 kHz (Garey et al. 2012).
FIGURE 2. Brachycephalus actaeus sp. nov. CFBH 39850 (holotype), adult male. (A) Dorsal and (B) ventral views. Scale bar
= 2.0 mm.
Description of holotype. Body robust, bufoniform; head wider than long; head length 19% of SVL; snout
short, rounded in lateral and dorsal views (Figures 1A and 1B); nostrils protuberant; canthus rostralis indistinct;
loreal region slightly concave; eyes slightly protruding laterally and dorsally; eye diameter 72% of head length;
tympanum absent; lips nearly sigmoid; vocal sac not expanded externally; vocal slits present; tongue longer than
wide, with the posterior half not adherent to floor of mouth; vomerine teeth absent; choanae small and ovoid,
anterior to eyes. Arm and forearm moderately slender; hands with fingers I and IV reduced; finger II short but
distinct; finger III large and robust; fingertips I, II, and IV rounded, fingertip III pointed; finger lengths IV < I < II
< III; subarticular tubercles absent; inner and outer metacarpal tubercles absent (Figure 1C). Legs relatively short,
moderately robust; thigh length 41% of snout-vent length, tibia length 86% of thigh length; foot with toes I and V
not visible externally; toe II greatly reduced; toe III short and distinct; toe IV large and robust; toe lengths II < III <

Zootaxa 4407 (4) © 2018 Magnolia Press
·
491
NEW SPECIES OF BRACHYCEPHALUS
IV; toe tips II and III rounded, toe tip IV pointed; subarticular tubercles absent; inner and outer metatarsal tubercles
absent (Figure 1D). Skin on top of the head smooth; dorsal body slightly rough and without dermal co-ossification.
Skin on dorsolateral and dorsal surfaces of legs rough and granular; dorsal surface of arms smooth. Skin on ventral
surface of arms, and in pectoral and gular regions smooth; skin on belly and ventral surfaces of legs granular; area
around the cloacal opening rough and granular (Figure 2).
Measurements of holotype (in mm). SVL 9.4; HL 1.8; HW 3.0; ND 0.4; IND 1.1; ED 1.3; IOD 2.1; END 0.6;
AL 2.0; FAL 2.1; HAL 1.4; THL 3.8; TBL 3.3; FL 4.6.
Color in life. (Figure 6) Iris black. General body color orange, dorsal surface of body covered by dark green
blotches; in dorsal view, a poorly defined dark brown stripe extends from the interorbital region to the posterior end
of the vertebral column; arms, legs, fingers III and IV and toe IV dark green, other fingers and toes orange. In
lateral view, eye contour, snout tip, lower lip, and corner of the mouth orange. In ventral view, background color
orange; dark brown blotches are present on throat, cloacal region, and side of the body, extending toward the
dorsum; irregular brownish spots are distributed on belly, arms, legs, fingers, and toes.
Color in preservative. General dorsal body color brown; arms, legs, fingers III and IV and toe IV brown,
other fingers and toes white (Figure 2A). In lateral view, eye contour, snout tip, lower lip, and corner of the mouth
white. In ventral view, general background color is white; brown blotches are present on throat, cloacal region, and
side of the body, extending toward the dorsum; irregular brown spots are distributed on belly, legs, fingers, and toes
(Figure 2B).
FIGURE 3. Details of a cleared and double-stained specimen of Brachycephalus actaeus sp. nov. (paratype CFBH 39848). (A)
Dorsal view of skull and skeleton, arrow indicates radio and ulna fused; (B) right hand in palmar view, arrows indicates the
prepollical elements; (C) right foot in plantar view; (D) ventral view of pectoral girdle, arrows indicate arytenoids cartilage; and
(E) right leg in ventral view, arrow indicates fibulare and tibiale fused. Scale bar = 2.0 mm in A and 0.5 mm in B, C, D, and E.

MONTEIRO ET AL.
492
·
Zootaxa 4407 (4) © 2018 Magnolia Press
Osteology. (Figure 3) Absence of hyperossification of the skull and skeleton; skull slightly wider than long in
dorsal view. Nasals, sphenethmoid, frontoparietals, prootics, and exoccipitals fused; premaxillae broad, not fused
medially, odontoids present; alary process of premaxillae distinct and slightly separated from the nasal; maxillae
arched in ventral view, odontoids present; vomers not fused medially, vomerine odontophores absent; palatine
absent; parasphenoid and sphenethmoid fused and robust; quadratojulgal and pterygoid present; squamosal T-
shaped in lateral view, anterior zygomatic ramus short, approximately ½ of the length of the otic ramus; zygomatic
ramus oriented to articulate with maxillae; mandible edentate; columella absent; tympanic annulus absent.
Arytenoid cartilages not mineralized (Figure 3D). Pectoral girdle arciferal and robust; coracoid, clavicle, and
scapula fused and completely ossified, except for the epicoracoid region, which is cartilaginous; procoracoid and
epicoracoid fused with coracoid but separated from the clavicle by an ovoid fenestra (Figure 3D), distant from the
epicoracoid; scapula, cleithrum, and suprascapula fused and elongated; suprascapula not expanded; omosternum
developed, with distal portion circular and cartilaginous; sternum absent. Vertebral column composed of eight
presacral, non-imbricate vertebrae; hyperossification absent in the spinal processes of the vertebrae; transverse
processes of the first presacral vertebrae indistinguishable; all others presacral vertebrae with unornamented
transverse processes; lengths of transverse processes of presacrals: VIII<II <VIV<II<V<III<IV; sacral diapophyses
moderately expanded; urostyle length slightly larger than presacral region (Figure 3A). Humerus and forearm of
approximately equal length; radius and ulna completely fused (Figure 3A); distal carpals of manus (I–IV) fused
with centrale; radiale and ulnare about the same size; two prepollical elements present; palmar sesamoid present;
phalangeal formula 1–2–3–1; tips of terminal phalangeal elements of fingers I and IV pointed and tips of fingers II
and III arrow-shaped (Figure 3B). Hindlimbs with tibia and fibula fused, forming the tibiofibula; femur and
tibiofibula of approximately equal length; fibulare and tibiale completely fused, but distinguishable; sesamoids
present in knees and foot joints; pes with distal tarsal element I present, II–III fused and IV and V absent; centrale
present; plantar sesamoid present; one reduced prehallical element; phalangeal formula 1–2–3–4–0; tips of
terminal phalangeal elements of toes I and II pointed, III and IV arrow-shaped (Figures 3).
FIGURE 4. Advertisement calls of Brachycephalus actaeus sp. nov., voucher specimen CFBH 39848 (paratype), recorded at
Centro de Estudos e Pesquisas Ambientais da Univille, Vila da Glória, municipality of São Francisco do Sul, state of Santa
Catarina, Brazil, on 21 January 2015, 10:50 a.m., air temperature 25°C, air relative humidity 100%. (A) oscillogram of three
consecutive calls, a single call is highlighted in orange; and (B) spectrogram and oscillogram of a single call.

Zootaxa 4407 (4) © 2018 Magnolia Press
·
493
NEW SPECIES OF BRACHYCEPHALUS
FIGURE 5. Phylogenetic relationships of the genus Brachycephalus based on a fragment of the mitochondrial 16S rRNA (519
base pairs). Topology represents the strict consensus of the 680 most parsimonious trees (of 519 steps). Branch lengths
correspond to the number of unambiguous parsimony transformations. Node values represent > 70% support of Jackknife
absolute frequencies. Sequences of the new species are highlighted in bold. See Appendix 2 for details of sequences included in
this analysis and complete locality names.

MONTEIRO ET AL.
494
·
Zootaxa 4407 (4) © 2018 Magnolia Press
FIGURE 5. (Continued)

Zootaxa 4407 (4) © 2018 Magnolia Press
·
495
NEW SPECIES OF BRACHYCEPHALUS
Advertisement call. The advertisement call of Brachycephalus actaeus sp. nov. is short, comprised of one
high-frequency note and repeated at a rate of 0.13–0.30 calls/second (x
̄ = 0.20 ± 0.07; n = 110; Figure 4A). The call
lasts 0.03–0.04 seconds (x
̄ = 0.04 ± 0.01; n = 110; Figure 4B) and the inter-call interval is 3.27–7.68 seconds (x
̄ =
5.42 ± 1.83; n = 104; Figure 4A). Notes are commonly composed of two pulses (Figure 4B), but we also registered
three pulses, with a repetition rate of 0.26–0.63 pulses/second (x
̄ = 0.42 ± 0.15; n = 229). The minimum frequency
is 3.9–5.9 kHz (x
̄ =4.8 ± 0.7; n = 110), the maximum frequency is 8.5–9.7 kHz (x
̄ = 9.1 ± 0.4; n = 110), and the
dominant frequency is 6.6–7.3 kHz (x
̄ = 6.9 ± 0.3; n = 110); most of the energy (90%) is concentrated within 0.7–
1.1 kHz (x
̄ = 0.8 ± 0.2; n = 110). Spectrograms exhibit a frequency bandwidth that extends to quite high
frequencies, (i.e., > 20 kHz; Figure 4).
Molecular analysis. Considering DNA sequences of the 16S gene (524 aligned basepairs, 168 terminals), the
maximum parsimony analyses retained 680 most parsimonious trees with 519 steps each. The analysis recovered
all specimens from Brachycephalus actaeus sp. nov. as a monophyletic group, with 89% of Jackknife support
(Figure 5). Additionally, our analysis recovered the two main groups of species within Brachycephalus that are
currently recognized; B. ephippium group and B. pernix group. Nonetheless, the position of B. hermogenesi and B.
sulfuratus is uncertain. Our analysis supported the individuality of the new species and recovered its position
within the B. pernix group (B. albolineatus, B. auroguttatus, B. boticario, B. brunneus, B. cf. coloratus, B.
curupira, B. ferruginus, B. fuscolineatus, B. izecksohni, B. leopardus, B. mariaeterezae, B. olivaceus, B. pernix, B.
pombali, B. quiririensis, B. tridactylus, and B. verrucosus; Figure 5). The relationships among several species
within this group were not resolved and some were not recovered monophyletic (B. albolineatus, B. boticario, and
B. fuscolineatus; B. brunneus, B. cf. coloratus, B. curupira, and B. izecksohni; B. auroguttatus, B. ferruginus, B.
mariaeterezae, B. olivaceus, B. pernix, B. pombali, and B. verrucosus). However, character sampling in our
analyses (restricted to 16S) cannot refute relationships inferred with other loci, and call for a more complete
analysis including all available molecular evidence.
According to the calculated genetic distances, the highest divergence between southern Atlantic Forest species
of Brachycephalus is found between the new species and Brachycephalus sulfuratus (9.2%). Brachycephalus
actaeus sp. nov. differs from B. brunneus, B. cf. coloratus, B. curupira, B. izecksohni, B. leopardus, and B.
tridactylus by 6.6–5.3%; from B. albolineatus, B. boticario, and B. fuscolineatus, by 4.3–4.2%; from B. ferruginus,
B. olivaceus, B. pernix, B. quiririensis, and B. verrucosus by 2.4–2.0%; and from B. auroguttatus, B.
mariaeterezae, and B. pombali by 1.9–1.7%. The genetic divergence within the populations of Brachycephalus
actaeus sp. n. is lower (0.2–1.3%) when compared to the interspecific divergence of species in the same clade (1.7–
6.6%), which additionally supports the new species. The highest genetic divergence (1.3%) within Brachycephalus
actaeus sp. nov. was found between mainland populations at Braço do Norte (municipality of Itapoá) and Fazenda
Morro Grande on Ilha de São Francisco do Sul (municipality of São Francisco do Sul). The straight-line distance
between these two localities is about 20 kilometers. Our data also suggest that genetic divergence within the same
population in other Brachycephalus species can be large. For example, we found 0.5% of divergence among the 12
analyzed individuals of B. verrucosus from Morro da Tromba (municipality of Joinville, state of Santa Catarina).
Variation in the type series. Measurements of 32 adult specimens of the type series are given in Table 1. The
sub-adult female (SVL = 10.9 mm) and juvenile (SVL = 5.0 mm) were not included in the analysis of
morphometric variation. The larger SVL of females (average = 11.7 mm; range 11.1–12.4 mm) compared to males
(average = 10.0 mm; range 9.2–10.8 mm) revealed sexual dimorphism in size in the new species (Welch’s t-test T
= 11.9, DF = 29.6, P < 0.01, n = 32). Dorsal skin texture varies from smooth to granular. Color in life varies mainly
in extent of green on the dorsum (Figure 6). In some species the dorsal coloration includes green blotches over the
orange background (Figures 6A, 6C, and 6E), while in others the green color covers the entire dorsum (Figure 6G).
The dark brown vertebral stripe can be well defined and wide, covering almost all of the dorsum (Figures 6A and
6C), or be represented by blotches distributed on the vertebral column and head (Figures 6E and 6G). The eye
contour is orange and can be well defined, resembling a mask; the snout tip is also orange in most individuals
(Figures 6A, 6C, and 6G). Some individuals possess a dorsolateral line of evident granules extending from the
posterior end of the head until the flanks (Figure 6A). In ventral view, irregular dark brown blotches are distributed
on the bright orange background; some individuals have dark blotches only in the cloacal region (Figure 6B), while
others have them concentrated on the throat, belly, cloacal region, and side of the body extending toward the
dorsum (Figures 6D, 6F, and 6H). The mandible contour is orange and clearly distinguishable (Figures 6D and 6F)

MONTEIRO ET AL.
496
·
Zootaxa 4407 (4) © 2018 Magnolia Press
FIGURE 6. Color variation in Brachycephalus actaeus sp. nov. (A) Dorsolateral and (B) ventral views of CFBH 39864
(paratype), adult female, from municipality of Itapoá, state of Santa Catarina. (C) Dorsolateral and (D) ventral views of CFBH
39863 (paratype), adult female, from municipality of Itapoá, state of Santa Catarina. (E) Dorsolateral and (F) ventral views of
CFBH 39876 (paratopotype), adult male, from municipality of São Francisco do Sul, state of Santa Catarina. (G) Dorsolateral
and (H) ventral views of CFBH 39846 (paratype), adult male, from municipality of São Francisco do Sul, state of Santa
Catarina, Brazil.

Zootaxa 4407 (4) © 2018 Magnolia Press
·
497
NEW SPECIES OF BRACHYCEPHALUS
FIGURE 7. Juvenile of Brachycephalus actaeus sp. nov. in life (snout-vent length = 5.0 mm). (A) Dorsolateral and (B) ventral
views of the specimen CFBH 39859 (paratype), from Centro de Estudos e Pesquisas Ambientais da Univille, Vila da Glória,
Distrito do Saí, municipality of São Francisco do Sul, state of Santa Catarina, Brazil.
or with orange shades extending through the gular region (Figure 6H). The only known juvenile is mainly brown in
color, lacking the orange background of the adults (Figure 7); the dorsum is covered by dark brown and red spots;
a dark brown lateral stripe is present from the tip of snout to flanks (Figure 7A); the ventral surface of the body is
slightly transparent, belly mainly white with a dark brown large blotch; an inverted V-shape mark is present on the
chest (Figure 7B). The dorsal pattern, lateral stripe, and the inverted V-shape mark on the chest, observed in
juvenile are similar to the markings on the sympatric species of flea-toad B. sulfuratus. In preservative, the orange
color varies from pale cream to white; brown and green are replaced by dark brown.
TABLE 1 . Measurements (in millimeters) of 32 adults of the type series of Brachycephalus actaeus sp. nov. The
abbreviations for the measurements are listed in the material and methods section. SD = standard deviation.
Males (n = 17) Females (n = 15)
Mean SD Range Mean SD Range
SVL 10.1 0.4 9.2–10.8 11.7 0.3 11.1–12.4
HL 2.0 0.1 1.8–2.3 2.3 0.2 2.1–2.7
HW 3.4 0.2 3.0–3.9 4.0 0.2 3.7–4.4
ND 0.3 0.0 0.3–0.4 0.3 0.1 0.3–0.4
IND 1.2 0.1 1.1–1.4 1.3 0.1 1.3–1.4
ED 1.3 0.1 1.2–1.4 1.4 0.0 1.3–1.5
IOD 2.1 0.1 1.9–2.3 2.4 0.1 2.2–2.6
END 0.6 0.1 0.6–0.8 0.7 0.1 0.6–0.8
AL 2.1 0.2 1.8–2.3 2.3 0.2 2.0–2.8
FAL 2.1 0.1 1.8–2.3 2.3 0.1 2.1–2.5
HAL 1.7 0.1 1.4–1.8 1.9 0.1 1.5–2.1
THL 4.0 0.2 3.8–4.3 4.5 0.2 3.8–4.8
TBL 3.4 0.1 3.2–3.6 3.8 0.2 3.4–4.1
FL 4.8 0.3 4.2–5.4 5.4 0.2 5.0–5.8

MONTEIRO ET AL.
498
·
Zootaxa 4407 (4) © 2018 Magnolia Press
Natural history and ecology. The new species is associated with leaf-litter and lives in the interior of dense
sub-montane and/or lowland ombrophilous Atlantic Forest remnants. These forest remnants are well preserved and
are represented by secondary forests in medium to advanced stages of regeneration. Individuals of Brachycephalus
actaeus sp. nov. were generally found amidst a thin layer of leaf-litter. The species is cryptic and commonly
exhibits the behavior of thanatosis when caught. This species is active during the day and its reproduction period
appears to be annual because males were found calling from January to December at temperatures between 10–
26°C. Calling males were always found under leaves and females were rarely found exposed. Recently, Goutte et
al. (2017) concluded that two species in the genus Brachycephalus are deaf, being incapable of hearing their own
vocalizations. For Brachycephalus actaeus sp. nov. we observed, in several instances, that the vocalizations of one
male stimulate its neighbors to vocalize, resulting in synchronized alternation in the emission of vocalizations
among them. These observations indicate that males of the new species are able to hear and use vocalizations to
interact with each other.
In November of 2015, at Vila da Glória, we captured a male and a female that were kept in a plastic bag. Some
minutes after capture, the pair amplected in an axillary position. Subsequently, in the laboratory, two large yellow
eggs were found amidst the leaves (Figures 8A and 8B); however, we did not observe the duration of amplexus or
the moment of egg deposition. The eggs were covered with a transparent gelatinous capsule that measured 3.3 mm;
without the gelatinous capsule the eggs measured 3.1 mm in diameter (Figure 8B). The eggs were deposited in a
leaf fold and were visited several times by one or both individuals (Figure 8A). We did not observe any physical
contact between the parents and the eggs after oviposition. Apparently, the eggs were not fertilized, and a week
later their surface was covered by fungi.
FIGURE 8. Eggs of Brachycephalus actaeus sp. nov. (A) Male left, CFBH 39861 (paratype) and female right, CFBH 39860
(paratype), after oviposition. (B) Detail of the eggs of Brachycephalus actaeus sp. nov.
In its mainland distribution, Brachycephalus actaeus sp. nov. occurs in syntopy with B. sulfuratus. Calling
males of both species were found together and the advertisement calls are easily distinguishable by their distinct
structures, despite the similarities in their dominant frequencies. Differences between the advertisement calls of
these two species are detailed in the section “Comparisons with other species”.
Distribution. Brachycephalus actaeus sp. nov. is known from six nearby localities along the coast in the state
of Santa Catarina, Brazil (Figure 9). The new species occurs at two localities on Ilha de São Francisco do Sul (Serra
da Palha and Fazenda Morro Grande), and three mainland localities in Distrito do Saí (Centro de Estudos e
Pesquisas Ambientais da Univille, Estrada do Saí, and Fazenda Palmito Juriti), all located in the municipality of
São Francisco do Sul. On the mainland, the new species also occurs at Braço do Norte, municipality of Itapoá, in
the same mountain range (Serra do Saí). The distribution of the new species seems to be restricted to the coastal
region in northeastern Santa Catarina, including lowlands near sea level and coastal mountains up to 250 meters.
We recorded Brachycephalus actaeus sp. nov. at 20 meters above sea level in Serra da Palha, Ilha de São Francisco
do Sul. Despite its occurrence in lowlands, the distribution is restricted to the foothills of the mountains and it is not
associated with the flat relief of the coastal plains.

Zootaxa 4407 (4) © 2018 Magnolia Press
·
499
NEW SPECIES OF BRACHYCEPHALUS
FIGURE 9. Distribution of Brachycephalus actaeus sp. nov. in northeastern state of Santa Catarina, Brazil. (1) Type locality,
Serra da Palha, Laranjeiras and (2) Fazenda Morro Grande, both at Ilha de São Francisco do Sul, municipality of São Francisco
do Sul; (3) Centro de Estudos e Pesquisas Ambientais da Univille, Vila da Glória, (4) Estrada do Saí, and (5) Fazenda Palmito
Juriti, at mainland region, municipality of São Francisco do Sul; and (6) Braço do Norte, municipality of Itapoá. Abbreviations
to Brazilian states: PR = Paraná, SC = Santa Catarina, and RS = Rio Grande do Sul.
Etymology. The specific epithet actaeus is a Latin adjective that means situated on the edge. It is derived from
the Latin word acta, which was incorporated from Greek, and means shore, coast, or beach. The name is used in
allusion to the typical habitat of the new species, the coastal lowlands of the Atlantic Forest.
Remarks. Most species of Brachycephalus are considered microendemic, occurring at one or a few high
elevation sites along the mountains of the Atlantic Forest (Pie et al. 2013; Bornschein et al. 2016a). However, in
contrast to this pattern, the expanding knowledge for the genus is revealing that even species with small geographic
ranges can be found beyond their type localities and even over broad elevational ranges. At least nine species of
Brachycephalus are known to have broad geographic distributions: B. brunneus (Pie et al. 2013), B. didactylus
(Oliveira et al. 2012), B. ephippium (Clemente-Carvalho et al. 2008), B. hermogenesi (Pimenta et al. 2007;
Verdade et al. 2008), B. leopardus (Bornschein et al. 2016a), B. margaritatus (Pombal & Izecksohn 2011), B.
nodoterga (Clemente-Carvalho et al. 2015; Abegg et al. 2015), B. olivaceus (Bornschein et al. 2016a), B.
quiririensis (Bornschein et al. 2016a), and B. sulfuratus (Condez et al. 2016). Of these, B. didactylus, B.
hermogenesi, and B. sulfuratus also exhibit broad elevational ranges, occurring from sea level up to 1000 meters
(Condez et al. 2016). Broad elevational ranges for species of Brachycephalus have been associated with those
species that possess a “leptodactyliform” body and cryptic coloration (sometimes defined as “flea-toads”), while
those with a “bufoniform” body and conspicuous coloration (sometimes defined as “pumpkin-toadlets”) have been
associated with restricted distributions at higher elevations (Pie et al. 2013; Bornschein et al. 2016a; Guimarães et
al. 2017). However, the new species described herein, Brachycephalus actaeus sp. nov., represents the first record
of a “pumpkin-toadlet” occurring in the lowlands of the Atlantic Forest, and thus is of particular significance to
understanding the evolution of the genus.

MONTEIRO ET AL.
500
·
Zootaxa 4407 (4) © 2018 Magnolia Press
Local adaptation to distinct climatic conditions notwithstanding, it seems likely that the current conditions of
the lowland and sub-montane forests of the southern Atlantic Forest are similar to those required for the persistence
of species of Brachycephalus in the highlands along the southeastern part of the Atlantic Forest. Furthermore, the
development of suitable climatic conditions for Brachycephalus occurrence on the emerged continental shelf
during the Quaternary (Leite et al. 2015) may explain the expansion of its distribution and colonization of coastal
lowlands by Brachycephalus.
Climate change has been demonstrated to be one of the main threats to the conservation of species of
Brachycephalus, especially considering their close association with montane forests, which are particularly
vulnerable to changes in climate and will probably shrink or disappear with a warmer future climate (Haddad et al.
2008). Moreover, with the addition of new lowland records for the genus, alteration in sea level represents another
potential source of negative effects to these species as a result of global climate change. Presently, the main threats
faced by Brachycephalus actaeus sp. nov. are habitat loss and modification associated with the intense rapid urban
expansion and seaport construction in the coastal region of northeastern Santa Catarina. These changes in the land
use are particularly detrimental to the new species, which is an exclusive forest leaf-litter dweller with a limited
area of occurrence. Despite occurring at six localities, the distribution of the new species is restricted to areas near
this coastal region where there are few established conservation units. The new species could potentially be present
inside a protected area called Reserva Particular do Patrimônio Natural (RPPN) Morro da Palha, located near the
type locality. However, its occurrence in Parque Estadual Acaraí (Ilha de São Francisco do Sul) and RPPN Volta
Velha (Itapoá) is not expected because of the flat relief formations present there, such as sandy coastal plains and/or
lowland forests, where populations of Brachycephalus actaeus sp. nov. are not known to occur.
Acknowledgements
We are grateful to E.C. Nardin for valuable help during field surveys; M. Lyra for assistance in the laboratory; J.
Somera for crafting the line drawings; and E. Wild for language suggestions. We thank the Ministério do Meio
Ambiente (MMA/SISBIO) for the collecting permits. We are thankful to private landowners and the Universidade
da Região de Joinville (Univille) for providing lodging at CEPA Vila da Glória and for allowing access to the study
area. We thank Centro de Estudos de Insetos Sociais (CEIS/UNESP/Rio Claro) for providing molecular laboratory
facilities. We also thank H. Zaher, J.P. Pombal Jr., J.C. Moura-Leite, M.R. Pie, and L.F. Ribeiro for allowing access
to preserved specimens under their care. Fieldwork was partially funded by Plano de Ação Nacional para a
Conservação dos Anfíbios e Répteis Ameaçados da Região Sul do Brasil (RAN/ICMBio). J.P.C. Monteiro was
supported by scholarship #131947/2015-0 from Conselho Nacional de Desenvolvimento Científico e Tecnológico
(CNPq) and T.H. Condez was supported by scholarships #141716/10–0 and #201033/2012–7 from CNPq and
#2015/00461-1 from São Paulo Research Foundation (FAPESP). P.C.A. Garcia thanks CNPq by grants. C.F.B.
Haddad thanks grants #2013/50741–7 and #2014/50342-8 from FAPESP, and also CNPq and Fundação Grupo
Boticário de Proteção à Natureza for financial support. We also thank the associated editor, Dr José M. Padial, and
two anonymous reviewers, for the suggestions and corrections that improved our manuscript.
References
Abegg, A.D., Ortiz, F.R., Rocha, B. & Condez, T.H. (2015) A new record for Brachycephalus nodoterga (Amphibia, Anura,
Brachycephalidae) in the state of São Paulo. Brazil. Check List, 11 (1769), 1–3.
https://doi.org/10.15560/11.5.1769
Alves, A.C.R., Ribeiro, L.F., Haddad, C.F.B. & Reis, S.F. (2006) Two new species of Brachycephalus (Anura:
Brachycephalidae) from the Atlantic Forest in Paraná state, southern Brazil. Herpetologica, 62 (2), 221–233.
https://doi.org/10.1655/05-41.1
Araújo, C.B., Guerra, T.J., Amatuzzi, M.C.O. & Campos, L.A. (2012) Advertisement and territorial calls of Brachycephalus
pitanga (Anura: Brachycephalidae). Zootaxa, 3302, 66–67.
Arcanjo, D.D.R., Vasconcelos, A.G., Comerma-Steffensen, S.G., Jesus, J.R., Silva, L.P., Pires Junior, O.R., Costa-Neto, C.M.,
Oliveira, E.B., Migliolo L., Franco, O.L., Restini, C.B.A., Paulo, M., Bendhack, L.M., Bemquerer, M.P., Oliveira, A.P.,
Simonsen, U. & Leite, J.R.S.A. (2015) A novel vasoactive proline-rich oligopeptide from the skin secretion of the frog
Brachycephalus ephippium. PLoS ONE, 10 (12), 1–19.

Zootaxa 4407 (4) © 2018 Magnolia Press
·
501
NEW SPECIES OF BRACHYCEPHALUS
https://doi.org/10.1371/journal.pone.0145071
Bioacoustics Research Program (2011) Raven Pro: interactive sound analysis software, Version 1.5. The Cornell Lab of
Ornithology, New York, USA. Available from: http://www.birds.cornell.edu/raven (accessed 8 December 2016)
Bornschein, M.R., Firkowski, C.R., Belmonte-Lopes, R., Corrêa, L., Ribeiro, L.F., Morato, S.A.A., Antoniazzi-Junior, R.L.,
Reinert, B.L., Meyer, A.L.S., Cini, F.A. & Pie, M. R. (2016a). Geographical and altitudinal distribution of Brachycephalus
(Anura: Brachycephalidae) endemic to the Brazilian Atlantic Rainforest. PeerJ, 4 (e2490), 1–41.
https://doi.org/10.7717/peerj.2490
Bornschein, M.R., Ribeiro, L.F., Blackburn, D.C., Stanley, E.L. & Pie, M.R. (2016b). A new species of Brachycephalus
(Anura: Brachycephalidae) from Santa Catarina, southern Brazil. PeerJ, 4 (e2629), 1–19.
https://doi.org/10.7717/peerj.2629
Cei, J.M. (1980) Amphibians of Argentina. Monitore Zoologico Italiano, Nuova Serie, Monographs, 2, 1–609.
Clemente-Carvalho, R.B.G., Monteiro, L., Bonato, V., Rocha, H., Pereira, G., Oliveira, D., Lopes, R., Haddad, C.F.B., Martins,
E. & Reis, S.F. (2008) Geographic variation in cranial shape in the pumpkin toadlet (Brachycephalus ephippium): a
geometric analysis. Journal of Herpetology, 42 (1), 176–185.
https://doi.org/10.1670/07-141R1.1
Clemente-Carvalho, R.B.G., Antoniazzi, M.M., Jared, C., Haddad, C.F.B., Alves, A.C.R., Rocha, H.S., Pereira, G.R., Oliveira,
D.F., Lopes, R.T. & Reis, S.F. (2009) Hyperossification in miniaturized toadlets of the genus Brachycephalus (Amphibia:
Anura: Brachycephalidae): Microscopic structure and macroscopic patterns of variation. Journal of Morphology, 270 (11),
1285–1295.
https://doi.org/10.1002/jmor.10755
Clemente-Carvalho, R.G.B., Klaczo, J., Perez, I., Alves, A.C.R., Haddad, C.F.B. & Reis, S.F. (2011) Molecular phylogenetic
relationships and phenotypic diversity in miniaturized toadlets, genus Brachycephalus (Amphibia: Anura:
Brachycephalidae). Molecular Phylogenetics and Evolution, 61, 79–89.
https://doi.org/10.1016/j.ympev.2011.05.017
Clemente-Carvalho, R.B.G., Perez, S.I., Tonhati, C.H., Condez, T.H., Sawaya, R.J., Haddad, C.F.B. & Reis, S.F. (2015)
Boundaries of morphological and molecular variation and the distribution range of a miniaturized froglet, Brachycephalus
nodoterga (Anura: Brachycephalidae). Journal of Herpetology, 50 (1), 169–178.
https://doi.org/10.1670/14-119
Condez, T.H., Clemente-Carvalho, R.B.G., Haddad, C.F.B. & Reis, S.F. (2014) A new species of Brachycephalus (Anura:
Brachycephalidae) from the highlands of the Atlantic Forest, southeastern Brazil. Herpetologica, 70 (1), 89–99.
https://doi.org/10.1655/HERPETOLOGICA-D-13-00044
Condez, T.H., Monteiro, J.P.C., Comitti, E.J., Garcia, P.C.A., Amaral, I.B. & Haddad, C.F.B. (2016) A new species of flea-toad
(Anura: Brachycephalidae) from southern Atlantic Forest, Brazil. Zootaxa, 4083 (1), 40–56.
https://doi.org/10.11646/zootaxa.4083.1.2
Condez, T.H., Monteiro, J.P.C. & Haddad, C.F.B. (2017) Comments on the current taxonomy of Brachycephalus (Anura:
Brachycephalidae). Zootaxa, 4290 (2), 395–400.
https://doi.org/10.11646/zootaxa.4290.2.12
Duellman, W.E. (1970) Hylid frogs of Middle America. Monograph of the Museum of Natural History, The University of
Kansas, Lawrence, Kansas, 753 pp.
Duellman, W.E. & Trueb, L. (1986) Biology of amphibians. McGraw-Hill, New York, 670 pp.
Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research,
32 (5), 1792–1797.
https://doi.org/10.1093/nar/gkh340
Farris, J.S., Albert, V.A., Källersjö, M., Lipscomb, D. & Kluge, A.G. (1996) Parsimony jackknifing outperforms neighbor-
joining. Cladistics, 12, 99–124.
https://doi.org/10.1111/j.1096-0031.1996.tb00196.x
Firkowski, C.R., Bornschein, M.R., Ribeiro, L.F. & Pie, M.R. (2016) Species delimitation, phylogeny and evolutionary
demography of co-distributed, montane frogs in the southern Brazilian Atlantic Forest. Molecular Phylogenetics and
Evolution, 100, 345–60.
https://doi.org/10.1016/j.ympev.2016.04.023
Frost, D.R. (2017) Amphibian species of the world: an online reference. Version 6.0. American Museum of Natural History,
New York, USA. Available from: http://research.amnh.org/herpetology/amphibia/index.html (accessed 28 September
2017)
Garey, M.V., Lima, A.M.X., Hartmann, M.T. & Haddad, C.F.B. (2012) A new species of miniaturized toadlet, genus
Brachycephalus (Anura: Brachycephalidae), from southern Brazil. Herpetologica, 68 (2), 266–271.
https://doi.org/10.1655/HERPETOLOGICA-D-11-00074.1.
Giaretta, A.A. & Sawaya, R.J. (1998) Second species of Psyllophryne (Anura: Brachycephalidae). Copeia, 1998, 985–987.
https://doi.org/10.2307/1447345
Goloboff, P.A. (1999) Analyzing large datasets in reasonable times: solutions for composite optima. Cladistics, 15, 415–428.
https://doi.org/10.1111/j.1096-0031.1999.tb00278.x
Goloboff, P., Farris, J. & Nixon, K. (2008) TNT, a free program for phylogenetic analysis. Cladistics, 24, 774–786.

MONTEIRO ET AL.
502
·
Zootaxa 4407 (4) © 2018 Magnolia Press
https://doi.org/10.1111/j.1096-0031.2008.00217.x
Goutte, S., Mason, M.J., Christensen-Dalsgaard, J., Montealegre-Z, F., Chivers, B.D., Sarria-S, F.A., Antoniazzi, M.M., Jared,
C., Sato, L.A. & Toledo, L.F. (2017) Evidence of auditory insensitivity to vocalization frequencies in two frogs. Scientific
Reports, 7, 12121.
https://doi.org/10.1038/s41598-017-12145-5
Guimarães, C.S., Luz, S., Rocha, P.C. & Feio, R.N. (2017) The dark side of pumpkin toadlet: a new species of Brachycephalus
(Anura: Brachycephalidae) from Serra do Brigadeiro, southeastern Brazil. Zootaxa, 4258 (4), 327–344.
https://doi.org/10.11646/zootaxa.4258.4.2
Haddad, C.F.B., Giovanelli, J.G.R. & Alexandrino, J.M.B. (2008) O aquecimento global e seus efeitos na distribuição e declínio
dos anfíbios. In: Buckeridge, M. (Ed.), A biologia e as mudanças climáticas no Brasil. Ed. RIMA, São Carlos, pp. 195–
206.
Haddad, C.F.B., Alves, A.C.R., Clemente-Carvalho, R.B.G. & Reis, S.F. (2010) A new species of Brachycephalus from the
Atlantic Rain Forest in São Paulo state, southeastern Brazil (Amphibia: Anura: Brachycephalidae). Copeia, 2010, 410–
420.
https://doi.org/10.1643/CH-09-102
Hanifin, C.T. (2010) The chemical and evolutionary ecology of tetrodotoxin (TTX): toxicity in terrestrial vertebrates. Marine
Drugs, 8, 577–593.
https://doi.org/10.3390/md8030577
Hanken, J. & Wake, D.B. (1993) Miniaturization of body size: organismal consequences and evolutionary significance. Annual
Review of Ecology and Systematics, 24, 501–519.
https://doi.org/10.1146/annurev.es.24.110193.002441
Hedges, S.B., Duellman, W.E. & Heinicke, M.P. (2008) New World direct-developing frogs (Anura: Terrarana): molecular
phylogeny, classification, biogeography, and conservation. Zootaxa, 1737, 1–182.
Heyer, W.R., Rand, A.S., Cruz, C.A.G., Peixoto, O.L. & Nelson, C.E. (1990) Frogs of Boracéia. Arquivos de Zoologia, 31 (4),
231–410.
Izecksohn, E. (1971) Novo gênero e nova espécie de Brachycephalidae do estado do Rio de Janeiro, Brasil. Boletim do Museu
Nacional, Zoologia, 280, 1–12.
Köhler, J., Jansen, M., Rodríguez, A., Kok, P.J.R., Toledo, L.F., Emmrich, M., Glaw, F., Haddad, C.F.B., Rödel, M.O. &
Vences, M. (2017) The use of bioacustics in anuran taxonomy: theory, terminology, methods and recommendations for
best practice. Zootaxa, 4251 (1), 001–124.
https://doi.org/10.11646/zootaxa.4251.1.1
Leite, Y.L.R., Costa, L.P., Loss, A.C., Rocha, R.G., Batalha-Filho, H., Bastos, A.C., Quaresma, V.S., Fagundes, V., Paresque,
R., Passamani, M. & Pardini, R. (2015) Neotropical forest expansion during the last glacial period challenges refuge
hypothesis. Proceedings of the National Academy of Sciences of United States of America, 113 (4), 1008–1013.
https://doi.org/10.1073/pnas.1513062113
Maniatis, T., Fritsch, E.F. & Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory
Press, New York, 585 pp.
Napoli, M.F., Caramaschi, U., Cruz, C.A.G. & Dias, I.R. (2011) A new species of flea-toad, genus Brachycephalus Fitzinger
(Amphibia: Anura: Brachycephalidae), from the Atlantic rainforest of southern Bahia, Brazil. Zootaxa, 2739 (1), 33–40.
https://doi.org/10.11646/zootaxa.2739.1.3
Nixon, K.C. (1999-2002) WinClada, v. 1.00.08. Ithaca, New York, USA. Available from: http://www.cladistics.com/
wincDownload.htm (accessed 10 January 2016)
Oliveira, J.C.F., Coco, L., Pagotto, R.V., Pralon, E., Vrcibradic, D., Pombal, J.P. & Rocha, C.F.D. (2012) Amphibia, Anura,
Brachycephalus didactylus (Izecksohn, 1971) and Zachaenus parvulus (Girard, 1853): Distribution extension. Check List,
8 (2), 242–244.
https://doi.org/10.15560/8.2.242
Padial, J.M., Grant, T. & Frost, D.R. (2014) Molecular systematics of terraranas (Anura: Brachycephaloidea) with an
assessment of the effects of alignment and optimality criteria. Zootaxa, 3825 (1), 1–132.
https://doi.org/10.11646/zootaxa.3825.1.1
Palumbi, S., Martin, A., Romano, S., McMillan, W.O., Stice, L. & Grabowski, G. (1991) The simple fool’s guide to PCR.
Version 2. Privately published, Honolulu, HI, 45 pp.
Pie, M.R., Meyer, A.L.S., Firkowski, C.R., Ribeiro, L.F. & Bornschein, M.R. (2013) Understanding the mechanisms
underlying the distribution of microendemic montane frogs (Brachycephalus spp., Terrarana: Brachycephalidae) in the
Brazilian Atlantic Rainforest. Ecological Modelling, 250, 165–176.
https://doi.org/10.1016/j.ecolmodel.2012.10.019
Pie, M.R. & Ribeiro, L.F. (2015) A new species of Brachycephalus (Anura: Brachycephalidae) from the Quiriri mountain range
of southern Brazil. PeerJ, 3 (e1179), 1–9.
https://doi.org/10.7717/peerj.1179
Pimenta, B.V.S., Bérnils, R.S. & Pombal, J.P. (2007) Amphibia, Anura, Brachycephalidae, Brachycephalus hermogenesi:
filling gap and geographic distribution map. Check List, 3 (3), 277–279.
https://doi.org/10.15560/3.3.277
Pires Jr, O.R., Sebben, A., Schwartz, E.F., Largura, S.W.R., Bloch Jr, C., Morales, R.A.V. & Schwartz, C.A. (2002) Occurrence
of tetrodotoxin and its analogues in the Brazilian frog Brachycephalus ephippium (Anura: Brachycephalidae). Toxicon, 40,

Zootaxa 4407 (4) © 2018 Magnolia Press
·
503
NEW SPECIES OF BRACHYCEPHALUS
761–766.
https://doi.org/10.1016/S0041-0101(01)00279-3
Pires Jr, O.R., Sebben, A., Schwartz, E.F., Morales, R.A.V., Bloch Jr., C. & Schwartz, C.A. (2005) Further report of the
occurrence of tetrodotoxin and new analogues in the anuran family Brachycephalidae. Toxicon, 45, 73–79.
https://doi.org/10.1016/j.toxicon.2004.09.016.
Pombal, J.P., Wistuba, E.M. & Bornschein, M.R. (1998) A new species of brachycephalid (Anura) from the Atlantic Rain
Forest of Brazil. Journal of Herpetology, 32 (1), 70–74.
https://doi.org/10.2307/1565481
Pombal, J.P. (2010) A posição taxonômica das "variedades" de Brachycephalus ephippium (Spix, 1824) descritas por Miranda-
Ribeiro, 1920 (Amphibia, Anura, Brachycephalidae). Boletim do Museu Nacional, Zoologia, 526, 1–12.
Pombal, J.P. & Izecksohn, E. (2011) Uma nova espécie de Brachycephalus (Anura: Brachycephalidae) do estado do Rio de
Janeiro. Papéis Avulsos de Zoologia, 51 (28), 443–451.
https://doi.org/10.1590/S0031-10492011002800001
R Development Core Team (2017) R: A language and environment for statistical computing. R Foundation for Statistical
Computing, Vienna, Austria. Available from: http://www.R-project.org (accessed 5 Aug 2017)
Ribeiro, L.F., Alves, A.C.R., Haddad, C.F.B. & Reis, S.F. (2005) Two new species of Brachycephalus Günther, 1985 from the
state of Paraná, southern Brazil (Amphibia, Anura, Brachycephalidae). Boletim do Museu Nacional, Zoologia, 519, 1–18.
Ribeiro, L.F., Bornschein, M.R., Belmonte-Lopes, R., Firkowski, C.R., Morato, S.A.A. & Pie, M.R. (2015) Seven new
microendemic species of Brachycephalus (Anura: Brachycephalidae) from southern Brazil. PeerJ, 3 (e1011), 1–36.
https://doi.org/10.7717/peerj.1011
Ribeiro, L.F., Blackburn, D.C., Stanley, E.L., Pie, M.R. & Bornschein M.R. (2017) Two new species of the Brachycephalus
pernix group (Anura: Brachycephalidae) from the state of Paraná, southern Brazil. PeerJ, 5 (e3603), 1–28.
https://doi.org/10.7717/peerj.3603
Sebben, A., Schwartz, C.A., Valente, D. & Mendes, E.G.A. (1986) Tetrodotoxin-like substance found in the Brazilian frog
Brachycephalus ephippium. Tox i c o n, 24, 799–806.
https://doi.org/10.1016/0041-0101(86)90105-4
Sueur, J., Aubin, T. & Simonis, C. (2008) Seewave, a free modular tool for sound analysis and synthesis. Bioacoustics-The
international Journal of Animal Sound and its Recording, 18, 213–226.
http://doi.org/10.1080/09524622.2008.9753600
Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013) MEGA6: Molecular evolutionary genetics analysis
version 6.0. Molecular Biology and Evolution, 30, 2725–2729.
https://doi.org/10.1093/molbev/mst197
Taylor, W.R. &Van Dyke, G.C. (1985) Revised procedures for staining and clearing small fishes and other vertebrates for bone
and cartilage study. Cybium, 9, 107–119.
Trueb, L. (1993) Patterns of cranial diversity among the Lissamphibia. In: Hanken, J. & Hall, B.K. (Eds.), The skull. Vol . 2. The
University of Chicago Press, Chicago and London, pp. 255–343.
Vences, M., Thomas, M., Meijden, A.V.D., Chiari, Y. & Vieites, D.R. (2005) Comparative performance of the 16S rRNA gene
in DNA barcoding of amphibians. Frontiers in Zoology, 2 (5), 1–12.
https://doi.org/10.1186/1742-9994-2-5
Verdade, V.K., Rodrigues, M.T., Cassimiro, J., Pavan, D., Liou, N. & Lange, M. (2008) Advertisement call, vocal activity, and
geographic distribution of Brachycephalus hermogenesi (Giaretta and Sawaya, 1998) (Anura, Brachycephalidae). Journal
of Herpetology, 42 (3), 542–549.
https://doi.org/10.1670/07-287.1
Wistuba, E.M. (1998) História natural de Brachycephalus pernix Pombal, Wistuba & Borschein, 1998 (Anura) no Morro
Anhangava, Município de Quatro Barras, Estado do Paraná. Ms. Thesis, Federal University of Paraná, Curitiba, 89 pp.
Yeh, J. (2002) The effect of miniaturized body size on skeletal morphology in frogs. Evolution, 56, 628–641.
https://doi.org/10.1111/j.0014-3820.2002.tb01372.x
APPENDIX 1. Specimens of Brachycephalus examined in morphological analyses.
Brachycephalus albolineatus (9 specimens): Brazil, Santa Catarina, Jaraguá do Sul (CFBH 41754, 41755; JPCM 231, 233;
MHNCI 10290, holotype, 10296–10300, paratopotypes; MNRJ 90349, paratopotype); Brachycephalus auroguttatus (14
specimens): Brazil, Santa Catarina, Garuva (MHNCI 10199–10200, 10202, 10204–10, 10212–14); Brachycephalus boticario
(5 specimens): Brazil, Santa Catarina, Blumenau (MHNCI 10253, 10257–59, 10731); Brachycephalus brunneus (27
specimens): Brazil, Paraná, Campina Grande do Sul (CFBH 7880, 7893, 7894; MHNCI 125, 1919, 1920, 10165–75, 10177–
83; MNRJ 40289–91, paratypes); Brachycephalus ferruginus (7 specimens): Brazil, Paraná: Morretes (CFBH 8028, 8030,
8032, 40436–40438; MZUSP 15787); Brachycephalus fuscolineatus (7 specimen): Brazil, Santa Catarina, Ilhota (CFBH
40448; MHNCI 10227, 10231–34, 10236); Brachycephalus izecksohni (9 specimens): Brazil, Paraná, between Guaratuba e
Paranaguá (MNRJ 7381, 7382, 7384, paratopotypes; CFBH 7375, 7384, 7386, 7387; MZUSP 132892, 132893);
Brachycephalus leopardus (26 specimens): Brazil, Paraná, Tijucas do Sul (CFBH 20940, 20941, 20943–55; MHNCI 10229,
10242, 10244–51). Brachycephalus mariaeterezae (8 specimens): Brazil, Santa Catarina, Joinville (MHNCI 9811, holotype,
10190–94, 10196, 10197); Brachycephalus olivaceus (15 specimens): Brazil, Santa Catarina, Joinville (CFBH 40439–40447;

MONTEIRO ET AL.
504
·
Zootaxa 4407 (4) © 2018 Magnolia Press
MHNCI 9813, holotype, 9815, paratype, 9816–18, paratypes, 10238); Brachycephalus pernix (38 specimens): Brazil, Paraná,
Quatro Barras (CFBH 28888–91; MHNCI 1818–20, 3000–04, paratypes, 3346–52, 3355, 3571, 9806–08, 9810, 10153–64;
MNRJ 17343, holotype); Brachycephalus pombali (7 specimens): Brazil, Paraná, Guaratuba (CFBH 8048, 8051, paratypes;
DZUP 213–16, 220); Brachycephalus quiririensis (72 specimens): Brazil, Santa Catarina, Garuva (CFBH 40392–40435;
MHNCI 10260, 10261, 10263–65, 10267–71; MZUSP 132902, 132904–07, 132910, 132912–14, 132916, 132918,132920,
132921,132925–29); Brachycephalus sulfuratus (6 specimens): Brazil, Santa Catarina, São Francisco do Sul (CFBH 39137,
holotype, 39138–40, paratypes, 39330–32, paratypes); Brachycephalus tridactylus (16 specimens): Brazil, Paraná,
Guaraqueçaba (MHNCI 10185–87, 10189, 10294, 10729, 10730; MNRJ 67312–14; MZUSP 137957, holotype, 137952–56,
paratopotypes); Brachycephalus verrucosus (15 specimens): Brazil, Santa Catarina, Joinville (DZUP 476, paratype; MHNCI
9819, holotype, 9820, paratype, 10215–25, 10228).
APPENDIX 2. List of voucher specimens included in molecular analysis, locality data, and GenBank accession numbers.
In bold, sequences produced by the present work. Other sequences were obtained from GenBank. Abbreviations to
Brazilian states: BA = Bahia, PR = Paraná, RJ = Rio de Janeiro, SC = Santa Catarina, and SP = São Paulo.
Species Voucher Locality data GenBank
accession
number
Brachycephalus actaeus sp. nov. CFBH39863 Braço do Norte, Itapoá, SC MG889441
Brachycephalus actaeus sp. nov. CFBH39866 Braço do Norte, Itapoá, SC MG889439
Brachycephalus actaeus sp. nov. CFBH39867 Braço do Norte, Itapoá, SC MG889440
Brachycephalus actaeus sp. nov. CFBH39846 Fazenda Morro Grande, São Francisco do Sul, SC MG889451
Brachycephalus actaeus sp. nov. CFBH39848 Centro de Estudos e Pesquisas Ambientais da
Univille, Vila da Glória, São Francisco do Sul, SC
MG889445
Brachycephalus actaeus sp. nov. CFBH39850 Serra da Palha, São Francisco do Sul, SC MG889452
Brachycephalus actaeus sp. nov. CFBH39852 Centro de Estudos e Pesquisas Ambientais da
Univille, Vila da Glória, São Francisco do Sul, SC
MG889446
Brachycephalus actaeus sp. nov. CFBH39853 Estrada do Saí, São Francisco do Sul, SC MG889450
Brachycephalus actaeus sp. nov. CFBH39855 Centro de Estudos e Pesquisas Ambientais da
Univille, Vila da Glória, São Francisco do Sul, SC
MG889447
Brachycephalus actaeus sp. nov. CFBH39859 Centro de Estudos e Pesquisas Ambientais da
Univille, Vila da Glória, São Francisco do Sul, SC
MG889448
Brachycephalus actaeus sp. nov. CFBH39862 Estrada do Saí, São Francisco do Sul, SC MG889449
Brachycephalus actaeus sp. nov. CFBH39873 Serra da Palha, São Francisco do Sul, SC MG889453
Brachycephalus actaeus sp. nov. CFBH39877 Serra da Palha, São Francisco do Sul, SC MG889454
Brachycephalus actaeus sp. nov. CFBH 42006 Fazenda Palmito Juriti, São Francisco do Sul, SC MG889442
Brachycephalus actaeus sp. nov. CFBH 42007 Fazenda Palmito Juriti, São Francisco do Sul, SC MG889443
Brachycephalus actaeus sp. nov. CFBH 42008 Fazenda Palmito Juriti, São Francisco do Sul, SC MG889444
Brachycephalus albolineatus CFBH 41754 Morro Boa Vista, Jaraguá do Sul, SC MG889434
Brachycephalus auroguttatus not given not given KX025354–
KX025369
Brachycephalus boticario not given not given KX025370–
KX025377
Brachycephalus brunneus not given not given KX025284–
KX025293
Brachycephalus cf. coloratus not given Morro do Canal, Piraquara, PR KX025270–
KX025272
Brachycephalus cf. coloratus not given Morro do Vigia, Piraquara, PR KX025299
Brachycephalus curupira not given Serra do Salto, São José dos Pinhais, PR KX026514–
KX026518
Brachycephalus didactylus CFBHT 11506 Vale da Revolta, Teresópolis, RJ MG889427
.......continued on the next page

Zootaxa 4407 (4) © 2018 Magnolia Press
·
505
NEW SPECIES OF BRACHYCEPHALUS
APPENDIX 2. (Continued)
Brachycephalus ephippium DZUP 498 Ilhéus, BA KX025517
Brachycephalus ferruginus not given not given KX025236–
KX025238
Brachycephalus ferruginus CFBH 40437 Pico Marumbi, Morretes, PR MG889438
Brachycephalus fuscolineatus not given not given KX025296–
KX025298;
KX025339–
KX025342
Brachycephalus hermogenesi not given Salesópolis, SP MG889426
Brachycephalus izecksohni not given not given KX025254–
KX025264
Brachycephalus leopardus not given not given KX025239–
KX025249
Brachycephalus mariaeterezae not given not given KX025316;
KX025344–
KX025353
Brachycephalus nodoterga CFBHT 2226 Santana do Parnaíba, SP MG889425
Brachycephalus olivaceus not given not given KX025300–
KX025303;
KX025325
Brachycephalus olivaceus CFBH 40440 Castelo dos Bugres, Joinville, SC MG889435
Brachycephalus olivaceus CFBH 42815 Morro do Boi, Corupá, SC MG889436
Brachycephalus pernix not given not given KX025218–
KX025222;
KX025383–
KX025384
Brachycephalus pombali not given not given KX025223–
KX025225;
KX025308–
KX025315
Brachycephalus quiririensis not given not given KX025317–
KX025322
Brachycephalus quiririensis CFBH 40406 Campos do Quiriri, Garuva, SC MG889437
Brachycephalus sulfuratus CFBH 42818 Braço do Norte, Itapoá, SC MG889430
Brachycephalus sulfuratus CFBH 40436 Morro do Anhangava, Quatro Barras, PR MG889428
Brachycephalus sulfuratus CFBH 39146 Castelo dos Bugres, Joinville, SC MG889429
Brachycephalus tridactylus not given not given KX025387–
KX025391
Brachycephalus tridactylus not given Reserva Particular Salto Morato, Guaraqueçaba, PR MG889431
Brachycephalus tridactylus not given Reserva Particular Salto Morato, Guaraqueçaba, PR MG889432
Brachycephalus tridactylus not given Reserva Particular Salto Morato, Guaraqueçaba, PR MG889433
Brachycephalus verrucosus not given not given KX025226–
KX025235;
KX025323–
KX025324
Haddadus binotatus CFBHT 16973 Tijuca, RJ MG889423
Ischnocnema guentheri DZUP 448 Morretes, PR KX025518
Ischnocnema parva CFBHT 16300 Teresópolis, RJ MG889424
Ischnocnema parva MNRJ 44559 Teresópolis, RJ JX267522