Content uploaded by Ronald J. Kendall
Author content
All content in this area was uploaded by Ronald J. Kendall on Mar 14, 2018
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
Parasitology Open
cambridge.org/pao
Research Article
Cite this article: Kalyanasundaram A,
Blanchard KR, Henry C, Brym MZ, Kendall RJ
(2018). Phylogenetic analysis of eyeworm
(Oxyspirura petrowi) in northern bobwhite
(Colinus virginianus) based on the nuclear 18S
rDNA and mitochondrial cytochrome oxidase 1
gene (COX1). Parasitology Open 4,e7,1–7.
https://doi.org/10.1017/pao.2018.2
Received: 18 December 2017
Revised: 18 January 2018
Accepted: 19 January 2018
Key words:
18S; COX1; eyeworm; Filarioidea; northern
bobwhite; Oxyspirura petrowi; Phylogeny;
Thelazia callipaeda
Author for correspondence: Ronald
J. Kendall, E-mail: ron.kendall@ttu.edu
© Cambridge University Press 2018. This is an
Open Access article, distributed under the
terms of the Creative Commons Attribution
licence (http://creativecommons.org/licenses/
by/4.0/), which permits unrestricted re-use,
distribution, and reproduction in any medium,
provided the original work is properly cited.
Phylogenetic analysis of eyeworm (Oxyspirura
petrowi) in northern bobwhite (Colinus
virginianus) based on the nuclear 18S rDNA
and mitochondrial cytochrome oxidase
1 gene (COX1)
Aravindan Kalyanasundaram, Kendall R. Blanchard, Cassandra Henry,
Matthew Z. Brym and Ronald J. Kendall
The Wildlife Toxicology Laboratory, Texas Tech University, Box 43290, Lubbock, TX 79409-3290, USA
Abstract
Oxyspirura petrowi is a heteroxenous nematode found in northern bobwhite (Colinus virginianus)
of the Rolling Plains ecoregion of Texas. Despite its impact on this popular gamebird, genetic
level studies on O. petrowi remain relatively unexplored. To accomplish this, we chose the
previously studied nuclear rDNA 18S region as well as the mitochondrial COX1 gene region
of O. petrowi to investigate phylogenetic relations between O. petrowi and other nematode
species. In this study, we generate primers using multiple alignment and universal nematode
primers to obtain a near-complete 18S and partial COX1 sequence of O. petrowi, respectively.
Phylogenetic trees for O. petrowi’s 18S and COX1 gene regions were constructed using the
Maximum Likelihood and Maximum Parsimony method. A comparative analysis was done
based on the nuclear and mitochondrial region similarities between O. petrowi and other
nematode species that infect both humans and animals. Results revealed a close relation to
the zoonotic eyeworm Thelazia callipaeda as well as a close relation with filarial super family
(Filarioidea) such as the human eyeworm Loa loa and Dirofilaria repens eyeworm of dog and
carnivores.
Introduction
Oxyspirura petrowi (Spirurida: Thelaziidae) is a heteroxenous nematode found in a variety of
avian species in the USA. O. petrowi infects the eyes of its hosts, situating on the surface of the
eye, underneath the nictitating membrane and eyelids, as well as in the ducts and glands
behind the eye (Dunham et al.2014a,b). First identified in Germany in the family Laniidae
(Skrjabin, 1929), O. petrowi has since been identified in several other orders of birds including
Galliformes and Passeriformes in Michigan (Cram, 1937) as well as various parts of the USA
since (Saunders, 1935;McClure,1949; Pence, 1972; Dunham and Kendall, 2017).
Of the regions that O. petrowi has been identified, the Rolling Plains ecoregion of west
Texas is one of the most targeted areas of research on this parasite. This is largely because
of the decline in northern bobwhite (Colinus virginianus; hereafter bobwhite) within this
region. A highly popular gamebird in the USA, bobwhites in the rolling plains have experi-
enced an annual decline of >4% over the past several decades (Sauer et al.2013). The decline
has been credited to many factors including habitat loss, habitat fragmentation, agricultural
practices and weather conditions (Brennan, 1991; Rollins, 2007; Hernandez et al.2013).
However, until recently, parasites have remained undervalued in their potential effects on
the decline.
Impacts of eyeworm infection in quail was first speculated by Jackson and Galley (1963)in
Rolling Plains for Oxyspirura sigmoides (=O. petrowi). In his findings, Jackson reported poten-
tial damage to the eyes of the bobwhite containing more than 15 eyeworms (Jackson and
Green, 1964), as well as strange behaviour that was suspected to be a result of vision impair-
ment (Jackson and Galley, 1963). Further analysis by Dunham et al. (2016) found lesions and
adenitis in the Harderian gland, a gland associated with immune defense (Payne, 1994), and
corneal scaring in bobwhites infected with O. petrowi. It is likely that the damage caused by
these worm burdens can result in reduced foraging efficiency, an inability to effectively escape
predators, as well as an inability to avoid stationary objects like a fence or building (Dunham
et al.2016).
Despite the increased interest in recent years, O. petrowi’s evolutionary relationships with
other parasites are still relatively unexplored. Phylogenetic studies of eyeworms in both
humans and animals could be useful in understanding epidemiological, ecological and evolu-
tionary influences on their hosts. A previous phylogenetic analysis using the 18S gene region of
O. petrowi showed filarial nematode families to have a close genetic relation to O. petrowi
(Xiang et al.2013). However, Xiang et al. (2013) suggest that their results are not strongly reli-
able for the evolutionary affinity of Oxyspirura with other parasites due to lack of sequences in
https://www.cambridge.org/core/terms. https://doi.org/10.1017/pao.2018.2
Downloaded from https://www.cambridge.org/core. Texas Tech University, on 14 Mar 2018 at 18:08:04, subject to the Cambridge Core terms of use, available at
the Thelazioidea super family. This issue can be addressed by
constructing multiple phylogenetic trees using different gene
regions.
To construct representative and reliable phylogenetic relation-
ships, selecting the appropriate gene regions for analysis is
the most important step. Hwang and Kim (1999) suggest an
improper selection of a gene region can lead to poor understand-
ing of the evolutionary relationship. For this reason, they also note
that highly conserved markers of nuclear DNA (rDNA) and
hyper variable regions of mitochondrial DNA (mtDNA) have
been identified as useful in investigating phylogenetic relation-
ships of higher categorical levels (deep branches) and lower
categorical levels (recently diverged branches) of taxonomy,
respectively.
The 18S ribosomal subunit (SSU) of nuclear rDNA is suitable
due to its highly conserved region for strong evolutionary links as
compared with 28S or LSU, 5.8, and Internal Spacers (ITS1 &
ITS2) (Hwang and Kim, 1999). Additionally, 18S has been com-
pletely characterized of its V1–V9 variable regions with V4 as the
region representing 18S variability in eukaryotes (Nickrent and
Sargent, 1991). The V4 region is significant and allows us to dis-
tinguish between family and genera and even species in nematode
diversity studies. For these reasons, 18S is one of the most popular
genetic markers for phylogenetic studies in eukaryotes.
Similarly, mitochondrial DNA has also been used as a popular
molecular marker in genetic diversity studies for nearly three
decades. In recent years, hundreds of complete parasite mito-
chondrial genomes have been studied and characterized (Hu
and Gasser, 2006). Among the mitochondrial genes, cytochrome
oxidase I (COXI) is preferred as a standardized tool for molecular
taxonomy and identification of species (Ratnasingham and
Hebert, 2007). This gene region is often used as a marker for
phylogenetic studies because of its strongly conserved region
across species, easiness to amplify in polymerase chain reaction
(PCR), lack of introns, lack of recombination, and very small
intergenic regions (Galtier et al.2009). It is also an efficient
tool used for DNA barcoding and nematode identification on
species level (Derycke et al.2010).
In order to provide more detail to the evolutionary relation-
ships of O. petrowi to other parasites, as previously done with
18S, we use a near-complete 18S and a partial COX1 gene
sequence of O. petrowi to generate phylogenetic trees. Presently,
there are no phylogenetic studies reported on O. petrowi’s mito-
chondrial COX1 gene. In this study, we analyze the phylogenetic
relationships with the Maximum Likelihood (ML) and Maximum
Parsimony (MP) method using MEGA 7 software. By combining
the analyses of both 18S and COX1, these results could be useful
in understanding O. petrowi’s relationship to other eyeworms as
well as its potential effects on the bobwhite based on these evolu-
tionary relationships.
Materials and methods
Ethics statement
This experiment was approved by Texas Tech University Animal
Care and Use Committee under protocol 16071-08. All bobwhites
were trapped and handled according to Texas Parks and Wildlife
permit SRP-0715-095.
Data availability statement
All data generated or analyzed during this study are included in
this paper. Sequencing data obtained from this study has been
submitted to DNA Data Bank of Japan (DDBJ) (Acc No.
LC316613 and LC333364).
Study area
The experimental study area of the present paper is consistent
with the study area described in Dunham et al. (2014b). The
broader range of application (e.g., Rolling Plains) was described
by Rollins (2007).
Sample collection
Wild bobwhites were collected in July of 2017 from the same
study area, in the same manner and using the same techniques
previously described by Dunham et al. (2014b). O. petrowi were
collected, aged and sexed as previously described by Dunham
et al.(2014b). Adult eyeworm were washed repeatedly with 1X
Phosphate-buffered Saline (PBS). Samples were preserved in
95% ethanol and stored at −80 °C until DNA extraction.
DNA extraction
Genomic DNA of adult O. petrowi was extracted using Qiagen
DNeasy Blood and Tissue Kit (Qiagen, Germany) according to the
manufacturer’s instruction with slight modifications. Modifications
included homogenization of eyeworms in 180 µL of ATL buffer
with a micro-pestle (Sigma, USA) followed by an addition of 20 µL
proteinase K. Additionally, samples were incubated at 56 °C for
20 min and an elution of 100 µL sterile water was performed as the
final step. Extracted DNA was stored at −20 °C until further use.
Primer designing
Primers for 18S were designed based on CLUSTAL W2 multiple
sequence alignment results. Two forward primers and a reverse
primer for 18S were designed and validated using online primer
designing tools (Table 1). An internal primer was designed
based on the sequence results of 18S to obtain an internal
sequence. For COX1, initial amplification was done using degen-
erative nematode-specific primers (Prosser et al.2013) and pri-
mers were designed (Table 1) using sequencing results of
primary amplification based on methods described in
Kalyanasundaram et al.(2017).
Amplification of O. petrowi 18S and COX1
Both sets of primers were optimized using an annealing tempera-
ture gradient from 55 to 60 °C. PCR reactions contained 5 µLof
2X Red Dye Master Mix (Bioline, England), 0.5 µLof10 µMforward
and reverse 18S and COX1 primers, 3.0 µL of molecular grade
water, and 1 µLofO. petrowi template DNA for a total reaction vol-
ume of 10 µL for 18S and COX1, respectively. PCR reactions were
run under the following parameters: 95 °C for 3 min, 95 °C for
30 s, 57 and 60 °C for 30 s, for both COX1 and 18S. Elongation tem-
perature was kept at 72 °C for 2 min for 18S reactions and 30 s for
Table 1. Oligonucleotide primers for amplifying and sequencing 18S and COX1
regions of O. petrowi
Primer Oligonucleotide sequences Melting temp (°C)
Op18SF 5′CCGATTGATTCTGTCGGCGGTTA 3′59.3
Op18SR 5′CACCTACGGAAACCTTGTTACGAC 3′57.5
Op18SIntF
a
5′CTCAACACGGGAAAACTCACCTG 3′58.1
OxyCOX1F 5′TGAGCTGGTTTAGGTGGTGCTA 3′58.2
Oxy COX1R 5′GAACCAGCTAACACAGGTACAGC 3′57.7
a
Used to obtain missing 18S region by sequencing.
2 Aravindan Kalyanasundaram et al.
https://www.cambridge.org/core/terms. https://doi.org/10.1017/pao.2018.2
Downloaded from https://www.cambridge.org/core. Texas Tech University, on 14 Mar 2018 at 18:08:04, subject to the Cambridge Core terms of use, available at
COX1 reactions with 29 cycles. Final elongation at 7 °C for 5 min
was used to check extended chain. Amplification of the 18S and
COX1 products were visualized on 1.5% agarose gels.
Sequencing
Purified PCR products of 18S and COX1 reactions were sequenced
in both directions using their respective forward and reverse pri-
mers. Based on the sequencing results of 18S, an internal primer
was designed and used to amplify 18S in PCR again. This PCR prod-
uct was then sequenced to obtain the near complete 18S rDNA
sequence. The partial COX1 sequence was confirmed with similar
methods as described by Kalyanasundaram et al. (2017) using
Thelazia callipaeda COX1 sequence (Liu et al.2013) as a compari-
son. Raw sequences were trimmed using DNA chromatogram
explorer (www.dnabaser.com). Final sequences used for analysis
totaled at 1811 bp for 18S and 598 bp for COX1. Sequence similar-
ity was performed using BLAST analyses.
Phylogenetic analysis
MEGA 7 software was used to generate phylogenies of 18S and
COX1 gene regions. O. petrowi 18S and COX1 were separately
aligned with selected sequences of other parasites from the
GenBank, NCBI. Initially, we did multiple alignments with nearly
150 sequences of 18S retrieved from GenBank using CLUSTAL W
program and simple trees were constructed by ML method
(Larkin et al.2007). We used taxa from order Spirurida for con-
structing 18S phylogenetic tree. Based on the alignment results,
identical and unfit/short sequences were removed until enough
quality congregate sequences were made. All gaps were removed
and the total 1634 positions were used in the final dataset.
Similarly, we constructed phylogenetic tree for COX1 sequences
retrieved from GenBank. We used Filarioidea and Thelazioidea
super family as major taxa to generate COX1 phylogeny both
ML and MP method. Species specifically analyzed in this study
include Brugia malayi,Wuchereia bancrofti,Loa loa,Dirofilaria
repens from Filarioidea and O. petrowi,T. callipaeda from
Thelazioidea super family. The complete deletion was used to
treat gaps as missing information and totalled 405 positions in
the final dataset. Phylogenetic tree constructions were performed
using character state including ML and MP method. The boot-
strap value was set at 1000 in order to represent strong evolution-
ary relationships between O. petrowi and other parasites of the
Nematoda phylum.
Results
BLAST analysis results of the 1811 bp sequence of 18S showed a
100% identity to O. petrowi isolates (KF110800-KF110799),
confirming that our sequence corresponds with previously submit-
ted sequences of O. petrowi. Sequence results of O. petrowi’s
18S gene region revealed a 95% to 96% similarity to the 18S region
of B. malayi (AF036588), W. bancrofti (LM006781), L. loa
(XR-002251421) and a 92% similarity to T. callipaeda
(LK982445). Oxyspirura petrowi’s COX1 shows an 86% similarity
to Dirofilaria spp. (KX265050) and an 85% similarity to
Dirofilaria repens (KX265049). Lastly, there is also an 84% similar-
ity between O. petrowi’sand T. callipaeda’s COX1 gene region
(KY908318-KY908318). Both O. petrowi’s 1811 bp 18S sequence
(Fig. 1A) and 598 bp COX1 sequence (Fig. 1B) were submitted in
DDBJ (Acc No. LC316613 and LC333364).
A phylogenetic tree was constructed for both 18S and COX1
gene regions of O. petrowi to determine its evolutionary relation-
ship within the Nematoda phylum (Figs 2 and 3). All O. petrowi
isolates from different geographical locations were placed in one
cluster and received strong support by ML and MP bootstrap ana-
lysis (100%). All clades in the 18S tree received moderate to high
(50–100%) support by ML bootstrap analyses. Bootstrap values
below 50% were removed from the COX1 trees (Fig. 3A and B).
In both 18S and COX1 trees, species of the Filarioidea superfam-
ily placed closely to species of the Thelazioidea superfamily (Figs
2and 3). T. callipaeda (KY908318) is located within the same
clade of O. petrowi in the 18S tree. Similarly, in the COX1 trees,
O. petrowi shares a branch of the tree with T. callipaeda.
Heliconema longissimum (GQ332423) and Spirocerca spp.
(KJ605487) in the Spiroroidea superfamily were also placed in the
same clade of the COX1 trees (Fig. 3A and B).
Discussion
Over the past several decades, molecular phylogenetic studies
have received widespread attention in determining evolutionary
relationships between various specimens as proposed by Nadler
(1995) in their phylogenetic case study of Ascaridinae nematodes.
When morphological features are not similar in parasites, a
molecular comparison involving phylogenetic investigation is a
useful method to infer the genetic relationship between species
(Nadler, 1995). Undoubtedly, morphological evolution can hap-
pen strictly on a genetic basis. Comparisons on the genetic level
can also decisively confirm or deny relationships between para-
sites previously examined using morphological characteristics.
In this study, we observe the nuclear 18S region and mitochon-
drial COX1 region of O. petrowi to better understand these rela-
tionships not readily available by morphology alone.
Our sequences for 18S and COX1 were confirmed using
BLAST analyses. Constructed phylogenetic trees following
BLAST analyses for both 18S and COX1 sequences show strong
support for the monophyly of the genus Oxyspirura. We also
found our phylogenetic results of 18S in congruence with results
of Xiang et al.(2013). Based on 18S results from both studies, all
the parasite species within the superfamilies of the phylogenetic
trees are within the order Spirurida, and the phylogenetic trees
reveal the Oxyspirura genus as a sister group for the Filarioidea
superfamily.
Although the various species of Filarioidea identified in this
study all have a 96% similarity with O. petrowi’s18S region, L.
loa has lower nucleotide variation, indicating that L. loa is of clo-
ser relation to O. petrowi. While the filarial nematodes W. ban-
crofti and B. pahangi cause lymphatic filariasis in the definitive
hosts, L. loa causes loaiasis (Chandy et al.2011;Tanet al.
2011). Typically found in humans of west and central Africa,
L. loa is transmitted through a deerfly (Chrysops spp.) vector,
with infective larvae entering the wound produced by the deerfly
and maturing in subcutaneous tissue (CDC, 2015). Loiasis is
caused by both adult worms and microfilaria with clinical symp-
toms of eosinophilia, Calabar swelling, and eyeworm migration in
Fig. 1. Polymerase chain reaction (PCR) amplification of 18S and COX1 gene using spe-
cific primers. (A) 18S rDNA amplification Lane M: 100 bp DNA ladder (Fermentas); Lane
1–5: 18S rDNA amplicon (1811 bp). (B) partial COX1 gene amplification. Lane M: 100 bp
DNA Marker (Fermentas); Lane 1–3: partial COX1 amplified products (598 bp).
Parasitology Open 3
https://www.cambridge.org/core/terms. https://doi.org/10.1017/pao.2018.2
Downloaded from https://www.cambridge.org/core. Texas Tech University, on 14 Mar 2018 at 18:08:04, subject to the Cambridge Core terms of use, available at
Fig. 2. Phylogenetic analysis of O. petrowi based on a near-complete 18S using Maximum Likelihood and Maximum Parsimony methods. (A) Maximum Likelihood: The evolutionary history was inferred using the ML method based on
the Tamura-Nei model. The phylogenetic tree illustrates 18S rDNA sequences of nematodes related to O. petrowi. Bootstrap values above 50 are shown in the tree. All positions containing gaps and missing data were eliminated.
Species name and their nucleotide accession numbers were included in the tree. There were a total of 1634 positions for 18S in the final dataset. Evolutionary analyses were conducted in MEGA7. (B) Maximum Parsimony: The
evolutionary history was inferred using the MP method based on Subtree-Pruning-Regrafting (SPR) algorithm. The phylogenetic tree illustrates 18S rDNA sequences of nematodes related to the eyeworm O. petrowi.
4 Aravindan Kalyanasundaram et al.
https://www.cambridge.org/core/terms. https://doi.org/10.1017/pao.2018.2
Downloaded from https://www.cambridge.org/core. Texas Tech University, on 14 Mar 2018 at 18:08:04, subject to the Cambridge Core terms of use, available at
Fig. 3. Phylogenetic analysis of O. petrowi based on partial COX1 using Maximum Likelihood and Maximum Parsimony methods. (A) Maximum Likelihood: The evolutionary history was inferred using the ML method based on the
Tamura-Nei model. The phylogenetic tree illustrates COX1 sequences of nematodes related to O. petrowi. All positions containing gaps and missing data were eliminated. Species names and corresponding nucleotide accession
numbers were included in the tree. There was a total of 405 positions for 18S in the final dataset. Evolutionary analyses were conducted in MEGA7. (B) Maximum Parsimony: The evolutionary history was inferred using the MP
method based on Subtree-Pruning-Regrafting (SPR) algorithm. The phylogenetic tree illustrates 18S rDNA sequences of nematodes related to O. petrowi.
Parasitology Open 5
https://www.cambridge.org/core/terms. https://doi.org/10.1017/pao.2018.2
Downloaded from https://www.cambridge.org/core. Texas Tech University, on 14 Mar 2018 at 18:08:04, subject to the Cambridge Core terms of use, available at
its hosts (Antinori et al.2012). During eye worm migration, the
parasite may be seen moving in the vitreous cavity, found in
the anterior chamber, or in the cornea, resulting in inflammation
and impaired vision (Barua et al.2005;Nayaket al.2016).
Treatment of L. loa can be dangerous as it can cause brain
inflammation and sometimes complications such as neuropathy
and encephalopathy can occur (CDC, 2015). A recent genomic
study on L. loa found several orthologous kinases that can be
targeted by drugs currently approved for use in humans such as
imatinib (Desjardins et al.2013), potentially providing a safer
treatment. Additionally, Xiang et al.(2013) suggest that the treat-
ment strategies used for human eyeworm infection such as L. loa
would be a model to develop treatment strategies for O. petrowi
infection in quail.
An additional filarial nematode, D. repens of the Filarioidea
superfamily, was identified with COX1 sequencing results.
Similar to the 18S results, the COX1 phylogenetic tree placed
the Thelaziidae family close to the Filarioidea superfamily and
revealed less divergence to D. repens. These observations signify
both are sister groups and likely suggests they evolved from the
same ancestor. Dirofilaria spp. are responsible for most filarioid
eye infections and for nodules on the orbital zone or eyelid
(Otranto and Eberhard, 2011; Mateju et al.2016). Found in
humans and other domestic and wild animals, D. repens is trans-
mitted by mosquitos (Czajka et al.2014). Another sister group to
the Thelazioidea superfamily, the Spirocercidae family, causes
spirocercosis in their definitive Canidae hosts in tropical and sub-
tropical regions. Clinical symptoms of spirocercosis include
vomiting, odynophagia, hyper salivation and lesions, with aortic
lesions being the most common and can be deadly (Van der
Merwe et al.2008). Van der Merwe et al.(2008) also states that
species in this family utilize dung beetles as the intermediate host.
Furthermore, our findings in the 18S and COX1 phylogenetic
trees demonstrate the relation of O. petrowi and T. callipaeda in
the Thelaziidae family as they were placed in the same clade of
our phylogenetic trees. T. callipaeda is an eyeworm responsible
for the neglected tropical disease known as thelaziasis in humans
and carnivores of Europe and the East Asia. Thelaziasis produces
clinical signs of epiphora, conjunctivitis, and ulcerative keratitis in
their hosts (Otranto et al.2004). Additionally, T. callipaeda uses
fruit flies, Phortica spp., as the intermediate host to transmit
infection (Otranto et al.2004; Otranto and Eberhard, 2011).
Based on these results, it is plausible that O. petrowi could have
similar impacts on the bobwhite as these parasites have on their
hosts. Future studies need to be carried out on pathological rela-
tions between O. petrowi and these parasites to fully understand
this comparison and effective treatment strategies. Similarly, all
described parasites require an intermediate host to transmit infec-
tion. While it is postulated that the plains lubber grasshopper
(Brachystola magna) is a potential intermediate host (Kistler
et al.2016), it has not been determined whether it is capable of
transmitting to bobwhite. Future investigations into the inter-
mediate host of O. petrowi should prioritize similar species as
the intermediate hosts of the related parasites.
This is the first report of examining a partial sequence of the
mitochondrial gene region of O. petrowi as well as the first report
in comparing this region with the almost-complete nuclear 18S
gene region of O. petrowi with other parasites via phylogenetic
analyses. In spite of partial sequences, both 18S and COX1 phylo-
genetic results strongly concluded the relationship of O. petrowi
with Thelaziidae family. However, further sequencing of the
entire COX1 gene region will help in better understanding
inter- and intra-species similarities. Using phylogenetic network-
ing, the COX1 gene region of O. petrowi could potentially be used
as a biological tag to study the bobwhite population decline.
Future genetic analyses could also help in further characterizing
O. petrowi and how it relates to its contribution to the decline
of bobwhites of the Rolling Plains ecoregion of Texas.
Acknowledgements. We thank Rolling Plains Quail Research Foundation
(23A470) and Park Cities Quail (24A175) for their continued financial support
of our quail research. We thank the owners and employees of our study ranch
for allowing access and providing lodging. Thank you to the Wildlife
Toxicology Laboratory personnel for their field and laboratory assistance.
Financial support. Funding for this work was provided by Park Cities Quail
and Rolling Plains Quail Research Foundation (awarded to Ronald J. Kendall,
Ph.D.).
Conflict of interest. None.
References
Antinori S, Schifanella L, Million M, Galimberti L, Ferraris L, Mandia L,
Trabucchi G, Cacioppo V, Monaco G, Tosoni A, Brouqui P,
Gismondo MR, Giuliani G and Corbellino M (2012) Imported Loa loa filar-
iasis: three cases and a review of cases reported in non-endemic countries in the
past 25 years. International Journal of Infectious Diseases 16,e649–e662.
Barua P, Barua N, Hazarika NK and Das S (2005) Loa loa in the anterior
chamber of the eye: a case report. Indian Journal of Medical Microbiology
23,59–60.
Brennan LA (1991) How can we reverse the northern bobwhite population
decline? Wildlife Society Bulletin 19, 544–555.
Centersfor Disease Control andPrevention (2015)Parasites –Loiasis.Retrieved
December 13, 2017. Available at https://www.cdc.gov/parasites/loiasis/.
Chandy A, Thakur AS, Singh MP and Manigauha A (2011) A review of
neglected tropical diseases: filariasis. Asian Pacific Journal of Tropical
Medicine 4, 581–586.
Cram EB (1937) A review of the genus Oxyspirura, with a morphological
study of O. petrowi Skrjabin 1929, recently discovered in galliform birds
of the northern United States. In Papers on Helminthology Published in
Commemoration of the 30 Year Jubileum of K. I. Skrjabin and of the 15th
Anniversary of the All-Union Institute of Helminthology, Moscow, Russia,
pp. 89–98.
Czajka C, Becker N, Jost H, Poppert S, Schmidt-Chanasit J, Kruger A and
Tannich E (2014) Stable transmission of Dirofilaria repens nematodes, nor-
thern Germany. Emerging Infectious Diseases Journal 20, 328–331.
Derycke S, Vanaverbeke J, Rigaux A, Backeljau T and Moens T (2010)
Exploring the use of cytochrome oxidase c subunit 1 (COI) for DNA bar-
coding of free-living marine nematodes. PLoS ONE 5, e13716.
Desjardins CA, Cerqueira GC, Goldberg JM, Hotopp JCD, Haas BJ,
Zucker J, Ribeiro JMC, Saif S, Levin JZ, Fan L, Zeng Q, Russ C,
Wortman JR, Fink DL, Birren BW and Nutman TB (2013) Genomics
of Loa loa, a Wolbachia-free filarial parasite of humans. Nature Genetics
45, 495–500.
Dunham NR and Kendall RJ (2017) Eyeworm infections of Oxyspirura
petrowi, Skrjabin, 1929 (Spirurida: Thelaziidae), in species of quail from
Texas, New Mexico and Arizona, USA. Journal of Helminthology 91,
491–496.
Dunham NR, Peper ST, Baxter CE and Kendall RJ (2014a) The parasitic
eyeworm Oxyspirura petrowi as a possible cause of decline in the
threatened lesser prairie-chicken (Tympanuchus pallidicinctus). PLoS ONE
9, e108244.
Dunham NR, Soliz LA, Fedynich AM, Rollins D and Kendall RJ (2014b)
Evidence of an Oxyspirura petrowi epizootic in Northern bobwhites
(Colinus virginianus). Journal of Wildlife Diseases 50, 552–558.
Dunham NR, Bruno A, Almas S, Rollins D, Fedynich AM, Presley SM and
Kendall RJ (2016) Eyeworms (Oxyspirura petrowi) in Northern bobwhite
(Colinus virginianus) from the Rolling Plains of Texas and Oklahoma,
2011–2013. Journal of Wildlife Diseases 52, 562–567.
Galtier N, Nabholz B, Glémin S and Hurst GD (2009) Mitochondrial DNA
as a marker of molecular diversity: a reappraisal. Molecular Ecology 18,
4541–4550.
Hernandez F, Brennan LA, DeMaso SJ, Sand JP and Wester DB (2013) On
reversing the Northern bobwhite decline: 20 years later. Wildlife Society
Bulletin 37, 177–188.
Hu M and Gasser RB (2006) Mitochondrial genomes of parasitic nematodes –
progress and perspectives. Trends in Parasitology 22,78–84.
6 Aravindan Kalyanasundaram et al.
https://www.cambridge.org/core/terms. https://doi.org/10.1017/pao.2018.2
Downloaded from https://www.cambridge.org/core. Texas Tech University, on 14 Mar 2018 at 18:08:04, subject to the Cambridge Core terms of use, available at
Hwang UW and Kim W (1999) General properties and phylogenetic utilities
of nuclear ribosomal DNA and mitochondrial DNA commonly used in
molecular systematics. The Korean Journal of Parasitology 4, 215–228.
Jackson AS and Galley DJ (1963) Dynamics of Bobwhite Quail in the West Texas
Rolling Plains. Job No. 2 Parasitism in bobwhite quail. Federal Aid Project No.
W-88-R-1. Austin, Texas: Texas Parks and Wildlife Department.
Jackson AS and Green H (1964) Dynamics of Bobwhite Quail in the West Texas
Rolling Plains. Job No. 2 Parasitism in bobwhite quail. Federal Aid Project No.
W-88-R-3. Austin, Texas: Texas Parks and Wildlife Department.
Kalyanasundaram A, Blanchard KR and Kendall RJ (2017) Molecular iden-
tification and characterization of partial COX1 gene from caecal worm
(Aulonocephalus pennula) in Northern bobwhite (Colinus virginianus)
from the Rolling Plains ecoregion of Texas. International Journal for
Parasitology: Parasites and Wildlife 6, 195–201.
Kistler WM, Hock S, Hernout B, Brake E, Williams N, Downing C,
DunhamNR, Kumar N, Turaga U, Parlos J and Kendall RJ (2016)Plains lub-
ber grasshopper (Brachystola magna)asanintermediatehostforOxyspirura
petrowi in northern bobwhites (Colinus virginianus).Parasitology 2,1–8.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,
McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R,
Thompson JD, Gibson TJ and Higgins DG (2007) Clustal W and clustal
X version 2.0. Bioinformatics 23, 2947–2948.
Liu GH, Gasser RB, Otranto D, Xu MJ, Shen JL, Mohandas N, Zhou DH
and Zhu XQ (2013) Mitochondrial genome of the eyeworm, Thelazia cal-
lipaeda (Nematoda: Spirurida), as the first representative from the family
Thelaziidae. PLOS Neglected Tropical Diseases 7, e2029.
Mateju J, Chanova M, Modry D, Mitkova B, Hrazdilova K, Zampachova V
and Kolarova L (2016) Dirofilaria repens: emergence of autochthonous
human infections in the Czech Republic. BMC Infectious Diseases 16, 171.
McClure HE (1949) The eyeworm, Oxyspirura petrowi, in Nebraska pheasants.
Journal of Wildlife Management 13, 304–307.
Nadler SA (1995) Advantages and disadvantages of molecular phylogenetics: a
case study of ascaridoid nematodes. Journal of Nematology 27, 423–432.
Nayak B, Sinha S and Nayak L (2016) Loa loa in the vitreous cavity of the eye.
BMJ Case Reports. doi: 10.1136/bcr-2015-213879.
Nickrent DL and Sargent ML (1991) An overview of the secondary structure
of the V4region of eukaryotic small-subunit ribosomal RNA. Nucleic Acids
Research 19, 227–235.
Otranto D and Eberhard M (2011) Zoonotic helminths affecting the human
eye. Parasite and Vectors 4, 41.
Otranto D, Lia RP, Buono V, Traversa D and Giangaspero A (2004) Biology
of Thelazia callipaeda (Spirurida, Thelaziidae) eyeworms in naturally
infected definitive hosts. Parasitology 129, 627–633.
Payne AP (1994) The harderian gland: a tercentennial review. Journal of
Anatomy 185,1–49.
Pence DB (1972) The genus Oxyspirura (Nematoda:Thelaziidae) from birds in
Louisiana. Proceedings of the Helminthological Society of Washington 39,
23–28.
Prosser SW, Velarde-Aguilar MG, Leon-Regagnon V and Hebert PD (2013)
Advancing nematode barcoding: a primer cocktail for the cytochrome c oxi-
dase subunit I gene from vertebrate parasitic nematodes. Molecular Ecology
Resources 13, 1108–1115.
Ratnasingham S and Hebert P (2007) bold: the barcode of life data system
(http://www.barcodinglife.org). Molecular Ecology Resources 7, 355–364.
Rollins D (2007) Quails on the rolling plains. In Brennan L (ed.). Texas Quails:
Ecology and Management. College Station, Texas, USA: Texas A&M
University Press, pp. 117–141.
Sauer JR, Hines JE, Fallon JE, Pardieck KL, Ziolkowski DJ Jr and Link WA
(2013). The North American Breeding Bird Survey, Results, and Analysis
1966–2013. United States Geological Survey. Laurel, Maryland: Patuxent
Wildlife Research Center.
Saunders GB (1935) Michigan’s studies of sharp-tailed grouse. Transactions of
the American Game Conference 21, 342–344.
Skrjabin KI (1929) Nematoden der Gattung Oxyspirura drasche aus den augen
der vogel, vol. 5. Krai: Soliaznoi Gel’mintologicheskoi Ekspeditsii Sibir,
pp. 213–234.
Tan LH, Fong MY, Mahmud R, Muslim A, Lau YL and Kamarulzaman A
(2011) Zoonotic Brugia pahangi filariasis in a suburbia of Kuala Lumpur
City, Malaysia. Parasitology International 60, 111–113.
Van der Merwe LL, Kirberger RM, Clift S, Williams M, Keller N and Naidoo V
(2008) Spirocerca lupi infection in the dog: a review. Veterinary Journal 176,
294–309.
Xiang L, Guo H, Zhang H, LaCoste L, Rollins D, Bruno A, Fedynich A and
Zhu G (2013) Gene discovery, evolutionary affinity and molecular detection
of Oxyspirura petrowi, an eye worm parasite of game birds. BMC Microbiology
13, 233.
Parasitology Open 7
https://www.cambridge.org/core/terms. https://doi.org/10.1017/pao.2018.2
Downloaded from https://www.cambridge.org/core. Texas Tech University, on 14 Mar 2018 at 18:08:04, subject to the Cambridge Core terms of use, available at
