Content uploaded by Noor Saber
Author content
All content in this area was uploaded by Noor Saber on Mar 11, 2018
Content may be subject to copyright.
Content uploaded by Noor Saber
Author content
All content in this area was uploaded by Noor Saber on Mar 11, 2018
Content may be subject to copyright.
Current Research in Microbiology and Biotechnology
Vol. 6, No. 2 (2018): 1530-1535
Research Article
Open Access
I
IS
SS
SN
N:
:
2
23
32
20
0-
-2
22
24
46
6
The inhibitory effect of fluphenazine decanoate and
caffeine on Staphylococcus aureus efflux pumps
Noor Saber* and Nuha Joseph Kandala
Biotechnology Department, College of Science, University of Baghdad, Iraq.
* Corresponding author: Noor Saber; e-mail: noorsabeer1993@gmail.com
ABSTRACT
The role of Staphylococcal efflux pump in antibiotics and biocides resistance considered global issue and finding
cheap, easy to handling and nontoxic efflux pump inhibitors is a persistent need since inhibition of efflux pumps
would increase the susceptibility of pathogenic bacteria and restore the antibiotics/biocides activity and
considered as critical criteria depended in studying extruding ability in efflux proteins. In this study, the
inhibitory effect of two inhibitors (fluphenazine decanoate and caffeine) was investigated in 94 isolates of
S.aureus isolates selected from 183 isolates according to resistant MDR pattern, 36 of them were positive for
efflux activity detected using cartwheel method and confirmed by estimation MIC level of benzilkonium chloride,
cetrimide, chloroxylenol, and chlorohexidine gluconate, the obtained results of this study showed that
fluphenazine decanoate and caffeine, in the presence of low concentration of ethidium bromide as indicator for
efflux activity, are potential inhibitors as the Staphylococcal EP activity to extrude of ethidium bromide was
inhibited completely at 1mg/l of fluphenazine decanoate and 100mg/l of caffeine.
Keywords: Staphylococcus aureus, Efflux Pumps, Efflux pumps inhibitor, Ethidium Bromide.
1. INTRODUCTION
Quaternary ammonium compounds and biguanides are
mainly used in hygiene administration of hospitals,
laboratories, houses, skin decontamination and
cleaning of surgical equipment (1). Excessive and
unappropriated consumption of such compounds
interferes with the existence of some pathogenic
microorganisms related to multi drug resistant hospital
acquired infection since such compounds cause
selective pressure leading to antibiotics cross-
resistance (2,3). Main mechanism which reduced
bacterial susceptibility to biocides is protein network
impeded in plasma membrane called MDR efflux
pumps, MDR efflux pump transfer vast range of
substrates included biocides, metal ion, antibiotics by
process known as active efflux, although efflux pump is
occupied by bacterial cell and not act as true resistant
mechanism but their overexpression provide survival
advantages (4,5) besides their actual physiological role
as signal transporter for virulence activation, secretion
of adherence factors and toxin (6,7,8). Efflux protein
belong to five family of transporter included ABC
cassette superfamily which depend on ATP hydrolysis
as energy source, the multidrug and toxic-compound
extrusion family (MATE), resistance nodulation
division superfamily (RND), the small multi drug
resistance superfamily (SMR) and The major facilitator
super family (MFS) (9,10). Staphylococcus aureus is
intrinsic pathogen and frequent cause of human skin,
wound and deep tissue infection, pneumonia, septic
arthritis, septicemia and nosocomial infection in
addition to food poisoning, since first isolation in 1884
(11,12), these days, less than 90% of S.aureus strains
resistant to penicillin derivatives, tetracycline,
fluoroquinolones, aminoglycosides, macrolides and
chloramphenicol which emerge occupied as part of
methicillin resistant Staphylococcus aureus resistant
profile (Jang, 2016) the MDR character in MRSA
isolates contributed by array of chromosomal and
plasmid efflux pumps that confer resistant to
antibiotics and biocides (13,14). Dyes such as ethidium
Received: 02 February 2018 Accepted: 17 February 2018 Online: 01 March 2018
http://crmb.aizeonpublishers.net/content/2018/2/crmb1530-1535.pdf 1530
1531
Noor Saber et al. / Curr Res Microbiol Biotechnol. 2018, 6(2): 1530-1535
http://crmb.aizeonpublishers.net/content/2018/2/crmb1530-1535.pdf
bromide (EtBr), rhodamine 6G, acriflavine and pyronin
Y applied in many research procedures including DNA
staining and tracking the transport processes in both
microbial and eukaryotic cell (15). In particular, EtBr
known as good efflux substrate that used for efflux
activity detection synergistically with efflux pump
inhibitor (16). The current study evaluate the resistant
profile of 183 isolates of Staphylococcus aureus isolated
from different clinical sources at Baghdad hospitals
and investigated the efflux activity among resistant
isolates using EtBr agar based method, MIC and efflux
inhibition by caffeine and fluphenazine decanoate.
2. MATERIALS AND METHODS
2.1 Collection and characterization
Two hundred isolates of Staphylococcus spp. obtained
from different clinical sources include urinary tract
infection, wound, foot ulcer of diabetic patients,
bactremia, burn, ear, oral and nasal infection, these
isolates collected from different hospitals in Baghdad
city include: Al-Karama hospital, AL -Wassety hospital,
Al-Yarmouk hospital, AL-Kindy hospital, Ibn AL-baldi
hospital, Al-Emam Ali hospital and Al-Sadr hospital. All
isolates transferred with transferable swaps and
cultured on brain heart agar plates, after incubation for
18h at 37°C, all isolates cultured on mannitol salt agar
and prepared for routine biochemical tests included
catalase, oxidase and coagulase considering Bergey's
manual of systematic bacteriology (William et al.,
2009). Only one hundred and eighty-three isolates
were able to ferment mannitol, negative to oxidase and
positive to catalase and coagulase.
2.2 Genomic DNA extraction
In order to confirm the biochemical diagnosis, the
bacterial genomic DNA extracted using salting out
method (17) to use as template for nuc gene detection
which considers critical features distinguish S.aureus
from other Staphylococcal species. All bacterial isolates
activated through transferring single colony to 10ml of
BHB containing 2ml/mg of ampicillin and incubated
overnight at 37°C, all solution prepared as
recommended by Kieser (33). After incubation period
the biomass separated by centrifuge at 8000rpm for
15min, the pellet resuspended in 1ml of STE buffer in
addition to 100µl of lysozyme solution (30mg/ml) and
incubated at 37°C for 1h. After incubation period, 240µl
of freshly prepared 10%SDS added to tubes then
incubated at 55°C for 90min followed by addition of
800µl of 5M NaCl solution, 10min, 5ml of chloroform
was added to tube and homogenized by vortex then
centrifuged. The aqueous layer transformed and
genomic DNA precipitated by cold isopropanol then
centrifuged again. The DNA pellet resuspended with
elution buffer (tris-EDTA) later and stored at freezing
condition.
2.3 Amplification of Staphylococcus aureus
diagnostic gene (nuc)
Amplification mixture was prepared as follows: (1X) of
GoTaq®Green Master Mix provided by (promega/USA),
which consist of Taq DNA polymerase,
deoxynucleotides (dNTP), MgCl2, reaction buffer, and
two dyes (green and yellow) as progress indicator
during electrophoresis, the concentration of nuc-F and
nuc-R primers was (10pmol), 50ng of DNA template
and free-nuclease water was added to accomplish a
total volume 25µl, primer sequence of nuc-F was
(GCGATTGATGGTGATACGGTT) and nuc-R
(AGCCAAGCCTTGACGAACTAAAGC) (18).
2.4 Susceptibility profiling assay
The susceptibility of 183 isolates toward cefoxitin
(FOX30), ceftriaxone (CRO30), meropenem (MEM10),
norfloxacin (NOR10), ciprofloxacin (CIP5), levofloxacin
(LEV5), trimethoprim (TM5), erythromycin (E15),
tetracycline (T10), tigicycline (15) and mecillinam (10)
accomplished depending on the instruction
recommended by CLSI (19), the inoculum prepared
through culturing several pure colonies in 5ml of brain
heart broth and incubated at 37°C for 4-6h, the
turbidity of broth compared to 0.5 Macfarland standard
then swapped on Muller Hinton agar plates, incubated
and inhibition zone read depending on CLSI, (19).
2.5 Evaluation of efflux activity by Cartwheel
method
Cartwheel method (21) used to evaluate presence or
absence of efflux activity within ninety four selected
isolates according to multi drug resistant pattern, all
selected isolates activated on 5ml of trypton soy broth
(TSB) containing 2mg/ml of ampicillin and incubated at
37°C for 18h, the inoculum diluted with normal saline
solution to become equal to optical density 0.6 at
600nm then 10µl of diluted inoculums streaked on
serious of EtBr-Trypton soy agar (0, 0.25mg/l, 0.5mg/l,
1mg/l, 2mg/l and 4mg/l), the EtBr-agar plates
prepared instantaneously and EtBr added to agar
before solidifying at 45-50°C. After incubation for 18h
at 37°C the result conducted using gel documentation
system to detect the absence of EtBr fluorescence in
bacterial masses that cultured on EtBr-TSA plates
which consider as indicator for efflux activity, negative
isolates for efflux pump developed with florescent at
low concentration of EtBr (0.25mg/l), all results
compared to negative control plates. The result
confirmed using the micro dilution method to estimate
the minimum inhibitory concentration for some widely
used biocides included cetrimide (stock solution
10mg/ml of DMSO), benzylkonium chloride 50%,
chloroxylenol (stock solution 10mg/ml of DMSO) and
chlorohexidine gluconate 4%.This study used the
protocol recommended by CLSI, (22,23).
2.6 Efflux detection synergistically efflux pumps
inhibitor and EtBr
The EtBr agar method used in combination with
fluphenazine decanoate, 2,4dinitrophenol, verapamil
and caffeine at low concentration of (0.25 mg/l) EtBr,
plates of EtBr containing efflux pumps inhibitors
prepared at the same day of experiments and
florescence detected after overnight incubation of the
cultured plates by gel documentation through
comparison with control plate.
1532
Noor Saber et al. / Curr Res Microbiol Biotechnol. 2018, 6(2): 1530-1535
http://crmb.aizeonpublishers.net/content/2018/2/crmb1530-1535.pdf
3. RESULTS AND DISCUSSION
According to the result of biochemical (oxidase,
catalase, coagulase) and molecular (nuc gene) routine
diagnostic procedures, one hundred and eighty three
isolates were confirmed as Staphylococcus aureus
among 200 collected Staphylococcal samples (91.5%)
from different clinical sources included foot ulcer,
urine, wound, burn, ear, nasal, oral and blood from
different hospitals in Baghdad city. The sensitivity
result revealed that the great majority of isolates were
MDR isolates most of isolates were resistant against
more than two antimicrobial agents (24). The cefoxitin
discs were used to differentiated between MRSA and
MSSA isolates depending upon the diameter generated
by antibiotics discs (19), the result were found out that
66.12% were MRSA isolate developed without
inhibition zone of cefoxitin, all isolates that resistant to
cefoxitin were also resistant to ceftriaxone and
meropenem (66.12%). The resistant percentage
toward fluoroquinolones group (norfloxacin,
ciprofloxacin, levofloxacin) was 28.41%. 76.50%,
51.91%, 49.72%, 23.49% and zero was the resistance
percentage to mecillinam, tetracycline, erythromycin,
trimethoprim and tigicycline respectively. The
sensitivity profile of MRSA isolates that were resistant
to cefoxitin displayed in figure (1).
Figure 1: Resistance percentage of MRSA isolates to antibiotics, antibiotic abbreviations are: T (Tetracycline), E (Erythromycin),
NOR (Norfloxacin), CIP (Ciprofloxacin) LEV (Levofloxacin), TM (Trimethoprim), TGC (Tigecycline).
The results of sensitivity assay of this study were
approximately similar to the local studies at different
years included 2017 (25), 2015 (26), 2013 (27) and
2011 (28) in Baghdad city. Most of the applied
antimicrobial agents considered target for
Staphylococcal efflux pumps (2), among 183 isolates,
94 isolate selected according the MDR resistant
patterns, especially the isolates that were resistant to
(fluoroquinolones group) because such antibiotics
considered as good efflux pumps target. The detection
of efflux pumps handled using concentration series of
TSA-EtBr agar plates, each plate with specific
concentration cultured with 8 isolates in the form of
cartwheel, after incubation period the result
documented under UV light using gel documentation
device detect the presence or absence of fluorescence
in the mass of bacterial growth, presence of flourscnce
within bacterila cell at low concentration mean
negative result because the bacterial cell don’t have
efflux pumps that enable it to extrude EtBr in opposite
to positive isolates as represented in figure (2).
1533
Noor Saber et al. / Curr Res Microbiol Biotechnol. 2018, 6(2): 1530-1535
http://crmb.aizeonpublishers.net/content/2018/2/crmb1530-1535.pdf
Figure 2: Presence and absence of fluorescence associated with S.aureus efflux pumps on 0.25mg/ml of EtBr-TSA plates, All
isolates on section (2-7) documented as positive, isolates in section 1 represented negative isolate.
Interestingly, the result detected thirteen isolates with
higher efflux activity (at concentration 2mg/ml) in
comparison to the activity level of other isolates, finally,
sex isolate only showed no fluorescent at 4mg/ml of
EtBr). The isolates that showed no fluorescence on
2mg/ml or higher documented as isolates in
overexpression situation for efflux pumps
determinants, these result either from enhancing the
expression of efflux pumps since EtBr consider
substrate of many Staphylococcal efflux pumps so that
the substrate will effect on regulator gene, or these
isolates belong to special MRSA clone characterized by
overexpression of efflux determinants.The result of all
EtBr assay at different concentration listed in table 1.
Table 1: All selected 94 isolates of S.aureus subjected to different concentration of EtBr.
Situation
0.25mg/l
0.5mg/l
1mg/l
m2mg/l
4mg/l
8mg/l
Positive
46
36
17
13
6
Out resolution
Negative
45
49
57
59
60
Out resolution
No growth
3
6
11
2
6
23
Total (51)
The total number of S.aureus isolates that killed by EtBr
was 51 isolates distributed at different concentration
(0.25-8mg/l) which consider an evident indicates that
EtBr have variable activity against bacteria (20). As
result of exposure to EtBr, one of the isolate transform
to mutant at concentration 4mg/l which consider high
concentration, the mutant isolates produce flourscence
at concentration 0.25-2mg/l but the fluorescent absent
completely at 4mg/l as showed in figure (3).
Figure 3: Mutant isolate production using EtBr as result of high concentration, the mutant isolates was negative at all plates
from 0.25mg/ml to 2mg/ml. at 4mg/ml the isolates transform into positive.
1534
Noor Saber et al. / Curr Res Microbiol Biotechnol. 2018, 6(2): 1530-1535
http://crmb.aizeonpublishers.net/content/2018/2/crmb1530-1535.pdf
The transformation in phenotypic expression situation
can result from mutation at promoter region or at
regulatory genes of efflux pumps genes leading to
overexpression proteins after subjecting to sublethal
dose of antiseptic/dye compounds (5). Number of 8
isolates which characterized by highly overexpression
level of efflux pump selected to confirmed the result of
cartwheel assay through determining the minimum
inhibitory concentration (MIC) level for some widely
used antiseptics included chloroxylenol, benzylkonium
chloride, cetrimide, and chlorohexidine gluconoate. All
selected isolates showed highly resistant level to all
used antiseptics which used at concentration ranged
from commercially used concentration to much higher
level. The MIC for all 8 S.aureus isolates toward PCMX
(2.44 -1250 µg/ml) was higher than 1250 µg/ml, the
result showed that PCMX had no effect on these
bacterial isolates when compared with negative and
positive control, however this result expected
depending on World health organization (WHO);
cloroxylenol (PCMX) less effective against Staphylococci
bacteria (30), these isolates also exhibit high resistance
level >1250 µg/ml to cetrimide (2.44- 1250 µg/ml) and
> 500 µg/ml for BK, and were resistance to the
commercially dose of CHX that applied in mouth wash
antiseptic solution 2%.
All 94 isolates cultured on TSA plates contained 1mg/l
of fluphenazine decanoate and 0.25mg/l of EtBr, all
isolates compared with the same isolated cultured on
other plates containing 0.25mg/l of EtBr only. The
fluphenazine decanoate record efflux inhibition for all
positive isolates at 0.25mg/l of EtBr, the efflux
inhibition also recorded using caffeine at concentration
100mg/l of caffeine as represented in figure (4). The
result also compared with isolates negative to efflux
inhibition, the effect of verapamil and 2,4 dinitro
phenol at different concentration also examined on
efflux positive and negative isolates but no inhibition
recorded although applying wide range of
concentration. This study provides the first report that
showed the role fluphenazine decanoate as efflux
pumps inhibitor through application with cartwheel
assay instead of using expensive chemical compounds
as inhibitors that widely used in efflux pumps detection
research such as carbonyl cyanide m-
chlorophenylhydrazone (CCCP) and phenylalanine-
arginine-β-naphthylamide (PAβN) (29). Inhibition
mechanisms is not clearly defined but it supposed that
the inhibitor bind directly to the pump or with the
substrate, inhibitors can lead to energy depletion by
disrupting proton gradient or prevent ATP- binding
besides that inhibitor can form large complex with
substrate so that not extruded by efflux activity, as a
result of inhibition the bacterial cell will lose ability to
form biofilm because of the correlation between efflux
pumps and biofilm formation since transporting system
play critical role in signal transport ( cell to cell) of
biomolecules that participate in biofilm formation
(32,31).
Figure 4: Inhibition of efflux transporter using cheap substrate, A- fluphenazine decanoate, B- Caffeine. The effect of inhibitor on
positive and negative isolates detected at 0.25mg/l of EtBr and by comparing the result with other plates contains EtBr only.
4. CONCLUSION
The study reports the emergence of efflux activity in
multi-drug resistant Iraqi hospital isolates of S. aureus
and the role of efflux pumps in antibiotics and biocides
resistant phenotypes as result of cross-resistance
between dyes/biocides and antibiotics resistant. The
obtained result showed that isolates with higher efflux
activity were more resistance to biocides comparing
with low efflux activity isolates that were more
susceptible to biocides. Therefore, implying detection
methods like ethidium bromide agar cartwheel for
efflux pumps activity in routine lab work can be used
for rapid detection of antibiotic/biocide multi-drug
resistant bacteria instead of familiar MIC
measurements. Fluphenazine decanoate (1mg/l) and
caffeine (100mg/l) are good candidates as a cheap
inhibition of efflux pumps activity.
1535
Noor Saber et al. / Curr Res Microbiol Biotechnol. 2018, 6(2): 1530-1535
http://crmb.aizeonpublishers.net/content/2018/2/crmb1530-1535.pdf
© 2018; AIZEON Publishers; All Rights Reserved
This is an Open Access article distributed under the terms of
the Creative Commons Attribution License which permits
unrestricted use, distribution, and reproduction in any
medium, provided the original work is properly cited.
5. REFERENCES
1. Frenzel, E.; Schmidt, S.; Niederweis, M. and Steinhauer, K.
(2011). Importance of porins for biocide efficacy against
Mycobacterium smegmatis. Appl Environ Microbiol.
77(9):3068-3073
2. Jang, J. Multidrug efflux pumps in Staphylococcus aureus
and their clinical implications. Journal of Microbiology.
54(1):1–8.
3. Smith, K.; Cemmell, C.G. and Hunter I.S. (2008). The
association between biocide tolerance and the presence
or absence of qac genes among hospital-acquired and
community-acquired MRSA isolates. Journal of
antimicrobial chemotherapy. 61, 78–84.
4. Costa, S. S.; Miguel, V.; Amaral, L. and Couto, I. (2013).
Multidrug Efflux Pumps in Staphylococcus aureus: an
Update. The Open Microbiology Journal. 7:59-71.
5. Huet, A. L. A.; Raygada, J. L.; Mendiratrtta, K.; Seo, S. M. and
Kaatz, G. W. (2008).Multidrug efflux pump overexpression
in Staphylococcus aureus after single and multiple in vitro
exposures to biocides and dyes. Microbiology. 154:3144-
3153.
6. Blanco, P.; Hernando-Amado, S.; Reales-Calderon, JA et al.
(2016). Bacterial Multidrug Efflux Pumps: Much More
Than Antibiotic resistance determinants. Microorganisms.
4(1).
7. Lupo, A.;Coyne, S. and Berendok T. U. (2012). Origin and
evolution of antibiotic resistance: the common
mechanisms of emergence and spread in water bodies.
Frontiers in Microbiology. 3(18).
8. Piddock, L. JV. (2006). Multidrug-resistance efflux pumps-
not just for resistance. Microbiology. 4:629-636.
9. Tegos, G. P.; Haynes, M.; Strouse, J. J.; MD, M.; Khan, Md. T.;
Bologa, C. G.; Opera; T. I. and Sklar, L. A. (2011). Microbial
Efflux Pump Inhibition: Tactics and Strategies. Curr
Pharm. 17(13): 1291–1302.
10. Zhang, L and Ma, S. (2010). Efflux Pump Inhibitors: A
Strategy to Combat PGlycoprotein and the NorA Multidrug
Resistance Pump. ChemMedChem. 5:811– 822.
11. Tong, SYC.; Davis, JS.; Eichenberger, E.; Holland, TL. and
Fowler, Jr. (2015). Staphylococcus aureus infections:
epidemiology, pathophysiology, clinical manifestations,
and management. Clin Microbiol Rev. 28(3):603-661.
12. Uhlemann, AC.; Otto, M.; Lowy, D. F. and DeLeo, R. F.
(2014). Evolution of community- and healthcare-
associated methicillin-resistant Staphylococcus aureus.
Infection, Genetics and Evolution. 21:563–574.
13. Johari, S. A.; Kiong, L. S.; Mohtar, M.; Isa, M.M.; Mand, S.;
Mustafa, S. and Ali, A. (2012). Efflux inhibitory activity of
flavonoids from Chromolaena odorata against selected
methicillin resistant Staphylococcus aureus (MRSA)
isolates. African Journal of Microbiology Research.
6(27):5631-5635.
14. Noguchi,N.; Suwa, J.; Narui, K.; Sasatsu, M.; Ito, T.;
Hiramatsu,K. and Song, JH. (2005) Susceptibilities to
antiseptic agents and distribution of antiseptic-resistance
genes qacA/B and smr ofmethicillin-resistant
Staphylococcus aureus isolated in Asia during 1998 and
1999. J Med Microbiol. 54:557–565.
15. Horobin, R. W. & Kiernan, J. A. (2002). Conn’s Biological
Stains, 10th edn. Oxford, UK: BIOS Scientific Publishers.
16. DeMarco, C. E., Cushing, L. A., Frempong-Manso, E., Seo, S.
M., Jaravaza, T. A. & Kaatz, G. W. (2007). Efflux-related
resistance to norfloxacin, dyes, and biocides in
bloodstream isolates of Staphylococcus aureus.
Antimicrob Agents Chemother.51, 3235–3239.
17. Kieser, T. (1995). Preparation and analysis of genomic and
plasmid DNA. Johnines Center, Norwich. NRU 7UTH, UK.
PP:17.
18. Zhang, K.; McClure, J. A.; Elsayed, S. Louie, T. and John, M.
C. (2005). Novel Multiplex PCR Assay for characterization
and concomitant subtyping of Staphylococcal cassette
chromosome mec type I to V in Mithicillin resistant
Staphylococcus aureus. Journal of clinical Microbiology.
43(10):5026-5033.
19. CLSI. (2017). Performance Standards for Antimicrobial
Susceptibility Testing. 27th ed. Wayne, PA: Clinical and
Laboratory Standards Institute.
20. Martins, M.; Santos, B.; Martins, A.; Viveiros, M.; Couto, I.
and Cruz, A. (2006). An Instrument-free Method for the
Demonstration of Efflux Pump Activity of Bacteria. in vivo.
20:657-664.
21. Martins, M.; Viveiros, M.; Couto,I.; Costa,SS.; Pacheco, T.;
Fanning, S.; Pagès, JM. and Amaral L. (2011).
Identification of efflux pump-mediated multidrug-
resistant bacteria by the ethidium bromide-agar
cartwheel method. In Vivo. 25(2):171-178.
22. CLSI. (2012). Methods for Dilution Antimicrobial
Susceptibility Tests for Bacteria That Grow Aerobically;
Approved Standard-Ninth Edition. CLSI document M07-
A9. Wayne, PA: Clinical and Laboratory Standards
Institute.
23. Wiegand, I.; Hilpert, K. and Hancock, R. E. W. (2008). Agar
and broth dilution methods to determine the minimal
inhibitory concentration (MIC) of antimicrobial
substances. 3(2):163-175.
24. Merlino, J.; Watson, J.; Rose, B.; Mary-Pegler, M.; Gottlieb,
T.; Bradbury, R. and Colin,H. (2002). Journal of
Antimicrobial Chemotherapy. 49:793-801.
25. Mohammed, H. A.; Kandala, N. J. and Al-Ogaidi (2017). Use
Multiplex PCR Technique for Distribution the Accessory
Gene Regulatory Polymorphisms among Baghdad Clinical
Staphylococcus aureus Isolates and its Correlation to
Cassette Type. World Journal of Experimental Biosciences.
5(1):23-29.
26. Abdul-Wahab, N. I. (2015). Genotyping of Staphylococcus
aureus isolates based on methicillin resistant genes and its
relatedness to some putative virulence factors. Msc.
Thesis. University of Baghdad.
27. Al-Dahbi- A. M. and Al-Mathkury. H. J. (2013). Distribution
of Methicillin Resistant Staphylococcus aureus in Iraqi
patients and Healthcare Workers. Iraqi Journal of Science.
54(2):293-300.
28. Al-Geobory, H. A. (2011). Comparativestudy between
Methicillin resistant Staphylococcus aureus (MRSA) and
Methicillin sensitive Staphylococcus aureus (MSSA), and
detect the antimicrobial effects of some plant extracts on
them. Msc. Thesis. College of Science/ Baghdad University.
29. Jo, A. and Ahn, J. (2016). Phenotypic and genotypic
characterization of multiple antibiotic-resistant
Staphylococcus aureus exposed to subinhibitory levels of
oxacillin and levofloxacin. BMC Microbiology. 16:170.
30. World Health Organization Model formulary (WHO).
(2008).
31. Marquez, B. Bacterial efflux systems and efflux pumps
inhibitors. (2005). Biochimie. 87:1137–1147.
32. Gupta, D.; Singh, A. and Khan, A. U. (2017). Nanoparticles
as Efflux Pump and Biofilm Inhibitor to Rejuvenate
Bactericidal Effect of Conventional Antibiotics. Nanoscale
Research Letters.12:454.
33. Kieser, T. (1995).Preparation and analysis of genomic and
plasmid DNA. Johnines Center, Norwich. NRU 7UTH, UK.
PP:17
*****
