Field Observations on Courtship and Spawning Behavior of the Giant Sea Bass, Stereolepis gigas

Abstract

Aspects of the reproductive behavior of Giant Sea Bass, tereolepis gigas, were observed and monitored at Goat Harbor, Santa Catalina Island, California from June 2014 to August 2015. The site was visited daily during the summer months (the known spawning season); aggregations were not present during the rest of the year. Numbers of Giant Sea Bass observed at Goat Harbor ranged from 1 to 19 individuals with an average of 6. Giant Sea Bass produced booming sounds (40-80 Hz), which were often associated with aggressive behavior but may also be associated with courtship. Courtship behavior was observed during the late afternoons and was most prominent around dusk (1900-2100 h). Courtship involved sexually dimorphic, temporary color changes and displays such as circling in pairs and the nudging of the abdominal area of the presumed female by the snout of the presumed male. The courtship behaviors observed were similar to those observed for Giant Sea Bass in captivity. Although spawning was not observed directly, the available evidence suggests that spawning occurs just after dusk. Confirmation of spawning at or near the aggregation site was obtained through DNA barcoding with CO1 primers of eggs sampled from Goat Harbor near dusk. This study provides insights into courtship behavior that can be used to identify potential Giant Sea Bass spawning aggregations in the wild that are crucial for management of the species. © 2018 by the American Society of Ichthyologists and Herpetologists.

Full text

Field Observations on Courtship and Spawning Behavior of the Giant Sea
Bass, Stereolepis gigas
Brian L. F. Clark
1
and Larry G. Allen
1
Aspects of the reproductive behavior of Giant Sea Bass, Stereolepis gigas, were observed and monitored at Goat Harbor,
Santa Catalina Island, California from June 2014 to August 2015. The site was visited daily during the summer months
(the known spawning season); aggregations were not present during the rest of the year. Numbers of Giant Sea Bass
observed at Goat Harbor ranged from 1 to 19 individuals with an average of 6. Giant Sea Bass produced booming sounds
(40–80 Hz), which were often associated with aggressive behavior but may also be associated with courtship. Courtship
behavior was observed during the late afternoons and was most prominent around dusk (1900–2100 h). Courtship
involved sexually dimorphic, temporary color changes and displays such as circling in pairs and the nudging of the
abdominal area of the presumed female by the snout of the presumed male. The courtship behaviors observed were
similar to those observed for Giant Sea Bass in captivity. Although spawning was not observed directly, the available
evidence suggests that spawning occurs just after dusk. Confirmation of spawning at or near the aggregation site was
obtained through DNA barcoding with CO1 primers of eggs sampled from Goat Harbor near dusk. This study provides
insights into courtship behavior that can be used to identify potential Giant Sea Bass spawning aggregations in the wild
that are crucial for management of the species.
COURTSHIP and spawning behavior are critical for
reproductive success because they increase the
likelihood of gamete release and production of
viable offspring. These behaviors allow for conspecifics to
identify one another, portray readiness to reproduce, deter-
mine mate quality, and synchronize gamete release in
aggregating fishes (DeMartini and Sikkel, 2006). Sound
production is common behavior observed in soniferous
(sound producing) fishes during courtship and reproduction
(DeMartini and Sikkel, 2006; Aalbers and Drawbridge, 2008;
Mann et al., 2009; Walters et al., 2009). It has been
hypothesized that fish sounds and vocalizations are used
for development of spawning aggregations (Gilmore, 2003),
to signal reproductive readiness (Connaughton and Taylor,
1996), and for gamete release (Lobel, 2002).
Fishes are known to form aggregations that are temporary
gatherings for specific purposes (Colin et al., 2003). Fishes
aggregate for many different reasons, including feeding
(Heyman et al., 2001), protection and shelter to structure
(Castro et al., 2002), and spawning (Sadovy and Domeier,
2005). Fish spawning aggregations are the only places many
species are able to reproduce (Sadovy and Domeier, 2005).
Spawning aggregations tend to form at predictable sites and
times of the year, and this predictability allows large
quantities of fishes to be harvested with minimal effort
(Sadovy de Mitcheson et al., 2008). This, in turn, may lead
fishers to believe they are harvesting from a healthy
population while actual abundance is declining. This is
known as an ‘‘illusion of plenty,’’ where fishing continues
unrestricted until population collapse, and possibly ending
the fishery (Sadovy and Domeier, 2005; Sadovy de Mitcheson
et al., 2008; Erisman et al., 2011).
Studying reproductive strategies is important for creating
effective management strategies for fisheries (Sadovy and
Eklund, 1999) and has led to regulations for harvesting the
spawning aggregations of many fishes, such as wreckfish,
Polyprion americanus (Wakefield et al., 2013), hapuku,
Polyprion oxygeneios (Wakefield et al., 2010), and goliath
grouper, Epinephelus itajara (Sadovy and Eklund, 1999).
Spawning often occurs when abundances are greatest at
aggregation sites. The observation of high densities of fishes
at a specific site only during certain times of the year
therefore indicates where and when a spawning aggregation
is going to form (Mann et al., 2010). Another indicator of
spawning aggregation sites is the presence of fish eggs and
larvae (Moser and Watson, 2006). Identification of eggs and
larvae has generally been done using morphological differ-
ences, although many species cannot be identified based on
morphology alone (Watson et al., 1999). Therefore, the use of
DNA barcoding (mitochondrial COI sequencing) has been
used to identify fish species that cannot be identified by
morphological traits (Harada et al., 2015).
The Giant Sea Bass, Stereolepis gigas, is a part of the
northeast Pacific nearshore fish fauna, ranging from the Gulf
of California to Humboldt Bay, California (Miller and Lea,
1972) but is most common south of Point Conception (Allen
and Andrews, 2012). It is thought to form spawning
aggregations during the summer months (July–September;
Shane et al., 1996; Love, 2011). Giant Sea Bass are often
found in kelp forests on rocky reefs as adults, while juveniles
are found at sandy bottom areas (Domeier, 2001). These
large, demersal teleosts reach lengths greater than 2 m,
weights greater than 200 kg, and ages of up to 76 years (Horn
and Ferry-Graham, 2006; Allen and Andrews, 2012; Hawk
and Allen, 2014; House et al., 2016).
The Giant Sea Bass is a member of the wreckfish family,
Polyprionidae, which is represented by five species within
two genera: Polyprion (three species) and Stereolepis (two
species; Nelson, 2006). Wreckfishes grow to large sizes (.150
cm and .70 kg) and are very long lived (.60 years; Peres and
Klippel, 2003; Hawk and Allen, 2014). Although no formal
studies have been conducted on the reproductive behavior of
members of the wreckfish family, research has been con-
ducted on their reproductive development (age at maturity,
gonadal development, and fecundity). Wreckfishes mature
between 7 and 14 years of age depending on the species
(Sedberry et al., 1999; Peres and Klippel, 2003; Wakefield et
al., 2010), and Giant Sea Bass are thought to fall within this
range (Fitch and Lavenberg, 1971; Domeier, 2001; Allen and
Andrews, 2012). These fishes mature very late in life
1
California State University, Northridge, Department of Biology, 18111 Nordhoff Street, Northridge, California 91330; Email: (LGA) larry.
allen@csun.edu. Send reprint requests to LGA.
Submitted: 1 May 2017. Accepted: 25 October 2017. Associate Editor: K. Martin.
Ó2018 by the American Society of Ichthyologists and Herpetologists DOI: 10.1643/CE-17-620 Published online: 6 March 2018
Copeia 106, No. 1, 2018, 171–179

compared to most other demersal teleosts (Wakefield et al.,
2013). There are no observations of spawning behavior of
species of Polyprion in the wild, but studies of wreckfish and
hapuku reproductive physiology suggested that spawning in
wreckfishes occurs during warm water months (Peres and
Klippel, 2003). This varies with latitude and is around the
Austral winter for both wreckfish (July–October; Peres and
Klippel, 2003) and hapuku (June–August; Wakefield et al.,
2010). These studies have also shown that males have
relatively large testes, which suggests that they engage in
group spawning (Sadovy, 1996; Peres and Klippel, 2003;
Wakefield et al., 2010).
Although it has been hypothesized that wreckfishes are
group spawners based on the large testes of hapuku and
wreckfish, courting pairs of Giant Sea Bass have been
observed in the wild during summer months (June–Septem-
ber; W. Bushing and W. Marti, pers. obs.), and this suggests
that they are pair spawning fish. Observations of pair
spawning in captivity have been made, although there were
only two individuals present in the aquarium (Hovey, 2001).
Spawning was observed on three separate occasions, and
environmental conditions in aquaria mimicked that of the
summer water conditions in California. This only confirms
that they are able to pair spawn, not that pair spawning
would be preferred in nature.
The general goal of this study was to investigate the
reproductive behaviors of Stereolepis gigas in the field and to
compare them with behaviors exhibited in the aquarium by
Hovey (2001). The specific goals of this project were to: 1)
determine when Giant Sea Bass abundances are highest
throughout the day at the aggregation site, 2) describe the
general reproductive behavior including potential associated
sounds and vocalizations, and 3) confirm if Giant Sea Bass
eggs occurred at the aggregation site with DNA barcoding to
confirm spawning in the area.
MATERIALS AND METHODS
Study site.—We conducted this study at Santa Catalina Island,
California (Fig. 1) during June–August in 2014 and 2015. The
Long Point Marine Protected Area (MPA) at Santa Catalina
Island, California, hosts the best-known aggregation of Giant
Sea Bass in southern California (https://www.wildlife.ca.gov/
Conservation/Marine/MPAs/Network/). Prior to the start of
the present study, eight different sites around Catalina were
examined as potential aggregation sites for Giant Sea Bass.
During this study (House et al., 2016), observations of large
aggregations were made at Goat Harbor, on the front
(leeward) side of the island, and at The V’s, on the back
(windward) side of the island. At both Goat Harbor and The
V’s, densities of Giant Sea Bass did not significantly vary
during the study period (June–August periods of 2014 and
2015, no observations were made at The V’s in 2015). Goat
Harbor, an east facing cove, was chosen as the primary study
site because it was 1) within the Long Point MPA that also
includes Italian Gardens, 2) more readily accessible by vessel
than the other sites, 3) protected from the elements (wind,
wave action), and 4) Giant Sea Bass could be observed there
on a daily basis during the summer. While The V’s did have a
large aggregation, the site was difficult to access and water
conditions varied drastically from day to day, making daily
observations unfeasible. Giant Sea Bass were not present at
Goat Harbor during surveys made during the non-spawning
months of October and March 2014, and December 2015 (B.
Clark, pers. obs.). Therefore, for the purposes of this study we
are considering Goat Harbor an aggregation site. Goat Harbor
has a steep slope, dropping from 10–30 m in depth in just
under 150 m distance from shore.
Residency at aggregation site.—To evaluate residency at the
aggregation site, SCUBA divers conducted four, 200-meter
transects at four depths (25, 18, 12, and 8 m) per survey.
These depths were chosen because they allowed divers to
make observations along the entire slope of the study site.
Surveys were conducted one to two times per month (5
surveys in 2014, 4 surveys in 2015). Transects were
conducted during three different time periods: morning
(0800–1200 h), afternoon (1300–1600 h), and evening
(1700–2100 h). The number of individuals were recorded
on each transect (108 total sightings). Distinct individuals
were identified based on spot patterns, scarring, and total
lengths. The number of surveys conducted during the
different time periods differed between the two years (2014,
2015). In 2014, the same numbers of dives were conducted at
each time period (5 dives per period) but no dives could be
conducted after 1800 h. In 2015 diving was focused around
the afternoon and evening time periods (Dives: Morning ¼2,
Afternoon ¼4, Evening ¼4) and evening dives were
conducted after 1800 h. As with most Giant Sea Bass
transects at Catalina Island (House et al., 2016), zero counts
were common (.56%) during transects; therefore, a Kruskal-
Wallis non-parametric test of independence was used to test
for differences in Giant Sea Bass abundances at the study site
by time period (data met the assumptions for this test).
Description of courtship behavior.—Visual observations were
carried out on SCUBA and documented on dive slates as well
as digital video recordings. A total of 63 dives were conducted
at Goat Harbor, totaling over 35 hours of underwater
observation of Giant Sea Bass behavior over the two-year
period. Dives averaged 33.7 minutes per dive and were
partitioned among three time periods: morning (17 dives, 9.1
hrs), afternoon (35 dives, 17.3 hrs), and evening (11 dives, 9
hrs).
Courtship and aggressive behaviors between individuals
were recorded following the protocols of Erisman and Allen
(2006). Behaviors involving two individuals (a gravid female
and a male) similar to those described by Hovey (2001) were
considered courtship behaviors. Interactions between males
Fig. 1. Map depicting Santa Catalina Island, California. This study was
conducted at Goat Harbor within the Long Point State Marine Reserve.
172 Copeia 106, No. 1, 2018

in which one male terminated the interaction was considered
aggression. Outside of courtship, no aggressive interactions
between males and females were observed; female to female
aggression was never observed. Individuals within 0.5 m of
each other were considered either paired (two individuals) or
grouped (three or more individuals). Behaviors were then
cataloged into an ethogram (catalogue of behaviors) describ-
ing various reproductive behaviors.
Audio and video were paired using GOPROt(GoPro, Inc.
USA) Hero 3 cameras to ground-truth vocalizations produced
by Giant Sea Bass. A digital spectrogram long-term acoustic
recorder (Soundtrap 202: Ocean InstrumentsNZ) also was
used to capture vocalizations. This device was anchored to
the bottom at 20 m depth and passively recorded vocaliza-
tions for 1 minute every 5 minutes, 24 hours each day
(Rowell et al., 2012) during both the 2014 and 2015 field
seasons. Sounds captured by the Soundtrap and Hero 3 then
were analyzed using AUDACITYt(AUDACITY Team, 2015:
free audio editor and recorder) to identify the frequencies
produced (Hz).
Confirmation of Giant Sea Bass eggs at aggregation site.—
Spawning was not observed directly at Goat Harbor during
our study; therefore, alternative methods to detect spawning
were pursued. Fish egg samples were collected from Goat
Harbor where courtship activity was observed, to see if
spawning had occurred at or near the site. A 1 m diameter
zooplankton net (0.505 mm nitex mesh) was towed for 5 min
at 3 m from the surface on the evening (2100–2215 h) of 7
July 2015, and eggs were stored immediately in 95% ethanol.
Upon removing the eggs from storage one month later, they
were rinsed with molecular grade de-ionized water. Fish eggs
were sorted from other zooplankton under a dissecting
microscope at 50X. The diameter of Giant Sea Bass eggs
ranges from 1.5–1.6 mm (Shane et al., 1996), so eggs were
separated into two groups, those ,1 mm diameter and 1
mm diameter (accounting for eggs that may have decreased
in size from the ethanol). Data suggest that Giant Sea Bass
hatch around 4.1 mm in length, which is roughly 6 days post
spawning (Shane et al., 1996). A subsample of eggs (n¼20)
was staged and found to be in early developmental stages
(between the 64 and 256 cells). Individual eggs were then
placed into tubes with a buffer (2/3 AE buffer and 1/3 D. I.
water) and crushed using a sterile pipette tip (Harada et al.,
2015) to release DNA.
To amplify DNA, we used universal fish COI primers: COI
VF1 forward primer (50–TTCTCAACCAACCACAAAGA-
CATTGG–30) and COI VRI reverse (50–TA-
GACTTCTGGTGGCCAAAGAATCA–30). PCR reaction used a
10 ll solution: 5 lL Qiagen MasterMix, 0.9 ll BSA, 2.1 lL
water, and 1 lL primer mix (2 lL forward, 2 lL reverse
primers and 96 lL water). PCRs were performed in a
GeneAmp 9700 thermal cycler (Applied Biosystems). The
thermocycler profile used was 958C for 15 min, 35 cycles of
958C for 30 s, 508C for 45 s, and 728C 1 min, and then 728C
for 10 min. PCR samples were run on 10% agarose gel and
amplified DNA was detected using ethidium bromide. A
subsample was then run on a Quibit 3.0 fluorometer with
high sensitivity to see the concentration of DNA for small
(,1 mm) and large (1 mm) eggs.
Samples were sent to Laragen Inc. for purification and
sequencing. Sequencing products were validated by eye and
aligned in SEQUENCHER (Gene Codes Corporation; Chabot
et al., 2015). Ninety-one unknown egg samples were
sequenced with five known samples of Giant Sea Bass DNA.
After sequencing, results were compared to the NCBI BLAST
database (NCBI Resource Coordinators, 2017). All of the eggs
identified were at least 99% identical to GenBank sequences.
RESULTS
Description of the Goat Harbor aggregation site.—Giant Sea
Bass aggregated adjacent to the rocky reef over large patches
of cobble or sandy bottom with little kelp cover within Goat
Harbor. Counts at this site varied between 1 to 19 individuals
(mean of 6 fish per visit). No patterns in variation were
observed (Fig. 2). Giant Sea Bass were observed at depths
ranging from 6–30 m, although 80% of the fish observed
were between 18 and 25 m in depth. Abundances differed
significantly among these depths (F¼9.140, df ¼3, P¼
0.011), with greater numbers of fish present within the
deepest zone (Fig. 3).
Residency at aggregation site.—During the 2014 and 2015
field seasons, 20 different individuals were observed at Goat
Harbor. The number of individuals observed differed by time
of day in 2014 (H ¼5.99, df ¼2, P¼0.05), but not in 2015
(H ¼4.37, df ¼2, P¼0.11; Fig. 4). The sampling distributions
of data characterizing abundances throughout the day
differed between 2014 and 2015 (H ¼10.74, df ¼1,
P,0.01), so 2014 and 2015 data could not be combined.
Reproductive behavior and phenotypes.—Presumed sexual
dimorphism was observed within this species while at
aggregation sites. Individuals showed distinct color and
morphological differences prior to courting and spawning
(though spawning was not directly observed, so this may be a
supposition). While courting, males presented slim lateral
profiles and became much lighter in color (Fig. 5A), while
females exhibited much more rotund body shapes, became
much darker in color, had a noticeable white patch on their
sides above the vent, and had a very dark mask under the
eyes (Fig. 5B). For this study, individuals were considered
males and females based on these characteristics.
Courtship was observed most often in pairs (Fig. 6), and
these behaviors were repeated throughout the afternoon and
evening. During surveys, Giant Sea Bass were encountered in
pairs 50% of the time, alone or single 31% of the time, and in
groups (3 or more) 19% of the time. Females were stationary
and in a resting position near the sea floor, unless being
courted by a male. On occasion, both a male and female
would rest in close proximity (within 1–2 m observed on 2
dives). When not in proximity to a female, males were never
observed resting, but were always otherwise observed
swimming and approaching resting females. If the female
reacted to the approach, the female began to swim with the
male, who was ‘‘following’’ closely behind apparently in an
attempt to initiate courtship (Fig. 7A). If the female did not
return to a resting position after being followed, she began to
swim in a circular pattern with the male ‘‘following’’ in a
similar fashion. This behavior would continue for up to
several minutes (30 sec–10 min; Fig. 7B). During circling, the
lead male (if more than one male was ‘‘following’’ the female)
would rub and bump the abdominal area of the female near
the anal fin with its snout often pushing the female upward
into the water column (Fig. 7C). The individuals would
occasionally rise up into the water column (.3 m from the
substrate) and circle much more rapidly (spiral swimming).
This behavior would continue until the female swam back to
the bottom. The male would then either attempt to court the
Clark and Allen—Spawning and courtship in Giant Sea Bass 173

same female again or move to another female in the area.
Observations of three individuals courting were not common
(two out of 18 interactions), with one female and two males
‘‘following’’ the same female. If circling behavior com-
menced, then one of the males would become aggressive
toward the other, essentially displacing the other from the
act of courting. The aggressive male then would resume
courting and nudge the female (Table 1). Although the act of
spawning was not directly observed during this study, we
have produced a diagrammatic depiction of presumed Giant
Sea Bass courtship and possible spawning behavior. The
courting behaviors observed in the wild matched those
described in aquaria by Hovey (2001), so the actual act of
spawning was adapted from his description (Fig. 8).
Courtship behaviors were not observed during the morn-
ing period (0600–1200 h) and appeared to be restricted to the
afternoon and evening hours (1200–2100 h). However, Giant
Sea Bass aggregated at the site throughout the day. First
observations of the presumed courtship behavior were at
1200 h and the last observations occurred after dusk (2000
h). All courtship was observed over depths greater than 12 m.
Presumed courtships that were observed during the after-
noons occurred within a meter of the substratum when more
than 50% of the females were observed in a resting position.
Only three of 18 interactions proceeded past the pre-courting
(‘‘following’’) behavior. During the evenings (after 1700 h)
activity increased, with 10–20% of females observed in a
resting position and individuals not only courting near the
sea floor, but also up in the water column, 5–15 m above the
substrate. Ten of 12 observations of courtship continued past
the ‘‘following’’ behavior stage into the more active circling
behavior in the evening. Based on the 35 hours of
observation of their activity, we hypothesize that spawning
in Giant Sea Bass occurs in the evening just after dusk
(approximately 2030 h). To test this hypothesis, direct
observation of the spawning act using ‘‘night vision’’ or
LED technology awaits future study.
Sound production and vocalizations.—Giant Sea Bass pro-
duced ‘‘boom’’ sounds (single pulses with a low frequency
[40–80 Hz with maximum amplitude at 50 Hz]) that were
often heard when diving within 1 to 10 m of them. On two
separate occasions we were able to verify both visually and
audibly capture these ‘‘booms’’ on video cameras. On both
Fig. 2. The counts of Giant Sea Bass observed at Goat Harbor by survey
date for 2014 and 2015. Counts at this site varied from 1 to 19
individuals (mean of 6 fish per visit).
Fig. 3. The average number of Giant Sea Bass per transect (n¼9) at
four depths (m) at Goat Harbor (6SE) in 2015 (* denotes significantly
different mean based on post hoc Tukey HSD test).
Fig. 4. The mean number of individuals observed by time of day from
diver surveys within Goat Harbor for both 2014 and 2015 (6SE).
Fig. 5. Sexual dimorphism between male (A) and female (B) Giant Sea
Bass in the wild during spawning season, with both in situ photographs
and drawings of these individuals to show greater contrast. Arrows
depict key features in males (A): a slim body profile lighter in color with
concave abdominal profile; and in females (B): a very dark mask under
the eyes, a more rotund body shape, and a noticeable white patch on
the sides above the vent (left to right). (Image Credit: LGA).
174 Copeia 106, No. 1, 2018

occasions the boom was produced because of an interaction
between a diver and an individual fish. The individual would
boom at the initiation of swimming rapidly away from the
diver, causing other fishes in the immediate area to dart away
as well.
Confirmation of Giant Sea Bass eggs at aggregation site.—Of
the 91 eggs sequenced from the zooplankton collection, 30%
of the eggs could not be verified or lined up with
SEQUENCHER (Gene Codes Corporation) and contained
multiple peaks, leaving 67 samples successfully sequenced
(51 large eggs [.1 mm] and 16 small eggs[,1 mm]). Eight
different species of eggs were identified. Among the large
eggs, eight haplotypes were identified, comprising four local
species including Stereolepis gigas (3%), Seriola lalandi (49%),
Sphyraena argentea (19%), and Scomber japonicus (1%). For
small eggs, six haplotypes and four species were identified as
Paralabrax clathratus (19%), Semicossyphus pulcher (3%),
Medialuna californiensis (3%), and Trachurus symmetricus
(1%). After Harada et al. (2015), identifications were based
on 538 bp of sequence data with greater than 99% identity
from the NCBI BLAST database (NCBI Resource Coordinators,
2017).
DISCUSSION
In 2014, we were able to identify Goat Harbor, within the
Long Point MPA, as an aggregation site for Giant Sea Bass
because individuals encountered on transects there num-
bered two or more on an almost daily basis. Eighty percent of
the Giant Sea Bass observed at this site occurred at between
18 m and 25 m depth, which is consistent with observations
made at other locations around Santa Catalina Island (House
et al., 2016). In a previous study (House et al., 2016), we
concluded that only two aggregations consistently occurred
around Santa Catalina Island in the summers of 2014–2015,
with Goat Harbor being the only one on the front side of the
island. Additional surveys at Goat Harbor conducted during
the fall (October 2014, December 2015) and spring (March
2014) encountered no Giant Sea Bass at Goat Harbor (B.
Clark, pers. obs.). These observations strongly suggest that
Goat Harbor is an aggregation site for Giant Sea Bass.
We hypothesize that densities should be significantly
higher around dusk than at other times of the day (morning,
afternoon, and evening), similar to the peak spawning time
in many fishes (Adreani et al., 2004; Erisman and Allen,
2006; Mann et al., 2010; Rowell et al., 2012). Abundances of
Giant Sea Bass in 2014 and 2015 differed significantly;
therefore, the data could not be combined over both years.
Two factors may have caused this discrepancy. In 2015 dives
were not restricted to daylight hours, unlike 2014 (when
dives were not conducted after 1830 h). No Giant Sea Bass
courting activity was observed during morning periods in
2014, and we therefore subsequently focused our efforts on
diving later during the day when more activity was observed.
In 2015 a few dives were conducted during the morning
period (before 1200 h) to confirm the 2014 pattern of
morning inactivity, and all fish then observed were in the
resting position. Dives during the morning period were
discontinued in 2015. Environmental conditions between
the two years might have varied because of the influence of
the 2015 El Ni˜
no. Namely, in 2014 Goat Harbor had large
patches of kelp cover that had disappeared by 2015. Water
temperature also varied between years: average temperatures
were 20.48C and 20.88C in 2014 and 2015, respectively (The
Coastal Data Information Program). Although these discrep-
ant temperatures might not differ significantly, temperature
can play a central role in the seasonal movement and
distribution of fishes (Lowe and Bray, 2006). The depth of the
thermocline (boundary layer at which the temperature of the
water changes rapidly) increased (at about 18 m and 30 m in
2014 and 2015, respectively; B. Clark, pers. obs.). Giant Sea
Bass were mostly observed at 18 to 24 m in both years;
therefore, the described change in the thermocline could
possibly have affected their behavior.
Fig. 7. Diagrammatic depictions of the three common courting behaviors:
Following (A), Circling (B), and Nudging (C). (Image Credit: LGA).
Fig. 6. Pair of Giant Sea Bass photographed off Goat Harbor, Catalina
Island, California by Parker House, July 2014.
Clark and Allen—Spawning and courtship in Giant Sea Bass 175

In 2014, the number of Giant Sea Bass was greatest in the
afternoon (1300–1600 h period). In the late afternoon, Giant
Sea Bass tended to be most active compared to mornings.
Unfortunately, no fish were observed (courting or otherwise)
during the evening period in 2014 because no evening
surveys were conducted that year. In 2015, the pattern of
greater afternoon activity was not repeated, and no difference
in abundance was detectable throughout the day. Although
the abundances of Giant Sea Bass differed from year to year,
their behavior was similar in both years. Marked differences
in types of behavior did occur throughout different periods
of day though. In the afternoons, interactions between
individuals began (50% of all individuals), but activity
remained close to the bottom. In the evenings (after 1600
h) through dusk (2000 h), almost all (80–90%) of the
individuals were no longer in resting positions, and multiple
courtship interactions between males and females were
observed throughout the water column. The similarities in
behaviors seen in 2014 and 2015 associated with time of day
lead us to hypothesize that activity and interactions increase
throughout the day with courtship being initiated in the
afternoon, intensifying in the evening leading to spawning
beginning around dusk. This particular pattern of dusk
spawning is common in many different species of temperate
and tropical fishes (Colin, 1992; Erisman and Allen, 2006;
Aalbers and Drawbridge, 2008).
During this study distinct, presumed sexual dimorphism
was observed in the aggregating Giant Sea Bass. Presumed
females were very rotund (most likely due to large ovaries
filled with hydrated eggs) and would darken in color, with a
dark mask under the eyes and a noticeable white patch on
their sides. The presumed males that we observed retained a
slender body shape but became much lighter in color. Hovey
(2001) observed similar color patterns and changes in the
aquarium where he was able to verify sex of the individuals
via biopsy of gamete tissue that confirmed the sexes of the
different morphs. These changes in color and morphology
have been seen in many other fishes such as kelp bass and
Fig. 8. Proposed depiction of
spawning behavior exhibited by Gi-
ant Sea Bass. The final stages of
courtship and actual spawning are
believed to occur near and just after
dusk as represented by the light to
dark gradient (left to right) in the
illustration. (Image Credit: LGA).
Table 1. Catalogue of observed behaviors during the spawning season in Giant Sea Bass, Stereolepis gigas.
Behavior Frequency Description
Aggregating Common Individuals loosely grouped over sandy bottom adjacent to kelp forest and rocky reefs in numbers of
5–20 individuals.
Resting Common Throughout the entire day, presumed females were commonly observed hovering ,1 m above the
substratum unless approached by a courting male.
Pairing Common A male rests in close proximity to a gravid female, both hovering ,1 m above the substrate.
Approach Common Male advances towards a presumed gravid female to begin courtship behaviors.
Following Common One to three males swim behind a gravid female, no contact with females; common during early
courtship.
Circling Common Gravid female begins to swim in a circular pattern, while the one to two males follow in the same
motion; common during courtship up to several minutes.
Nudging Common The lead presumed male following/circling approaches the female from the side or underneath and
begins rubbing and bumping his snout against the presumed gravid female’s abdominal area near
the anal fin pushing the female upward.
Spiral swimming Rare Male and female begin to circle rapidly upward into the water column; only observed after dusk.
Spawning Not observed
directly
Male and female continue circling near surface, beating with caudal fins, pair tilts slightly along dorsal-
ventral axis with the release of eggs, followed closely by release of sperm (Hovey, 2001).
176 Copeia 106, No. 1, 2018

indicate potential readiness to reproduce (Colin, 1992;
Erisman and Allen, 2006). Although spawning by Giant Sea
Bass was not directly observed during this study, many of the
courtship behaviors we observed in the wild were previously
described during observations of two separate spawning
events of Giant Sea Bass in a large tank at the Aquarium of
the Pacific in Long Beach, California (Hovey, 2001). Thus the
behaviors described herein are assumed to be courting (or
possibly courting/spawning) behaviors based on their similar
nature.
The combination of ‘‘following,’’ ‘‘circling,’’ and ‘‘nudging’’
are behaviors commonly seen in marine fishes (Colin, 1992;
Erisman and Allen, 2006; Erisman et al., 2007; Froeschke et
al., 2007; Aalbers and Drawbridge, 2008) and were also seen
during aquarium observations of spawning Giant Sea Bass
(Hovey, 2001). ‘‘Following’’ behavior was commonly ob-
served to involve a single female and one or more males.
During these interactions males slowly closed the distance
between them and their potential mate, but no actual
contact was ever made. ‘‘Circling’’ behavior would sometimes
begin with multiple males attempting to court a single
female, but shortly after ‘‘circling’’ began, aggression by the
lead male directed at the second and third males would
invariably lead to a cessation of ‘‘circling’’ by the additional
males, thus leaving the pair to continue courting. The
subordinate males would then continue courting, but shift
their attention to other females in the immediate area.
Circles would become tighter and increase in speed as the
male nudged at the abdominal area near the anal fin. This
nudging behavior is known as a sign of readiness to
reproduce by males, as an apparent prelude to starting a
spawning rush similar to what has been observed in white
seabass (Aalbers and Drawbridge, 2008). On two of these
occasions of tighter ‘‘circling,’’ single females spiraled upward
with a single male, but these ended without the apparent
release of any gametes. These apparently ‘‘false rushes’’
involved only two individuals, further supporting our
contention that Giant Sea Bass are primarily pair spawning
fishes. Observations of pair spawning have been observed for
Giant Sea Bass in captivity (Domeier, 2001; Hovey, 2001),
which further supports our observations in the wild.
Although the field observations suggest that Giant Sea Bass
are primarily pair spawning fishes, the possibility remains
that they are group spawners. Many confamilials of similar
size and egg storage capacity are group spawners (Roberts,
1989; Peres and Klippel, 2003; Wakefield et al., 2010).
However, we observed no such group or aggregate spawning
activity in Giant Sea Bass.
The ‘‘booms’’ that the Giant Sea Bass produced were heard
frequently but sporadically. In the summer of 2014, we heard
constant booming on several dives at the site called the ‘‘The
V’s’’ on the backside of the Santa Catalina Island in an
aggregation of 15–20 individuals (Fig. 1). Booms were not as
frequent at Goat Harbor, perhaps because the aggregation at
that site was smaller. These sounds were often heard in
association with an aggressive behavior: 1) an individual
would produce a boom that caused other fishes in the
immediate area (including other Giant Sea Bass) to vacate the
immediate area or 2) a single Giant Sea Bass would become
startled by a diver and boom as it swam away at a rapid pace.
Other large fishes, particularly groupers, produce similar
(‘‘boom’’) sounds during acts of aggression as well as when
they are startled, but they are also used as signals for the
beginning of a spawning rush (Mann et al., 2009, 2010;
Scha
¨rer et al., 2012). Giant Sea Bass might be using sound for
the same purpose during intraspecific interactions.
Because we were unable to directly observe spawning due
to low light levels, we attempted a new approach to verify
whether Giant Sea Bass were actually spawning in the study
area. This approach, in turn, supported our contention that
the behaviors described here were indeed courtship behav-
iors leading to spawning. Use of the universal fish 600 bp
COI primers allowed us to document that multiple species
were spawning at this specific site at Santa Catalina Island.
Eight species were identified as variably contributing to
fertilized fish eggs in the nearfield. Although fish counts
made on our transects did not quantitatively estimate the
numbers of other fish species present in the study area, on
any given day during the summer months high numbers of
all eight species were qualitatively noted as present at this
site. For example, schools of greater than 100 California
yellowtail (Seriola dorsalis) commonly swam through the site,
and kelp bass (Paralabrax clathratus) were the dominant reef
fish in the area. These two species contributed the highest
percentage of eggs recorded within their respective size class
(large: .1 mm; small: ,1 mm). Most importantly, Giant Sea
Bass eggs were identified and comprised at least 3% (2 of 67
eggs) of our sample. This low percentage might be expected
because recently spawned eggs had already begun to disperse
throughout the extremely large volume of water, thus
reducing our chances of collecting their eggs.
With multiple species of broadcast spawners present
around the same time in this open system, the chances of
actually finding any Giant Sea Bass eggs was very slim. The
presence any fertilized eggs at this site does provide support
for Giant Sea Bass using this general area as a spawning
aggregation site, however, and provides conclusive evidence
that the observed behaviors are for courtship. The staged eggs
were all in the 64-cell to 256-cell stage; they therefore were
recently fertilized (within 2–3 hours). Hence these Giant Sea
Bass eggs most likely came from the immediate or nearby
adjacent areas. It is highly likely that these eggs were
produced and fertilized by the Giant Sea Bass observed at
Goat Harbor because no other consistent aggregations have
been recorded on the front side of Santa Catalina Island
(House et al., 2016). This egg-method of monitoring
spawning behavior (Harada et al., 2015) offers an effective
way to monitor spawning activity around the islands and
could be a useful way to find potential areas where spawning
aggregations of Giant Sea Bass and other aggregating fishes
form on the islands and the coast.
The historically low population size of Giant Sea Bass has
discouraged researchers from studying them (Pondella and
Allen,2008),incontrasttopreviousresearchonthe
reproductive physiology and general biology of other, more
abundant wreckfishes of the family Polyprionidae (Roberts,
1989; Peres and Klippel, 2003; Wakefield et al., 2010). House
et al. (2016) document recent temporal increases in Giant Sea
Bass numbers around Santa Catalina Island though, and this
has facilitated our behavioral research. Recent studies have
focused on life history traits as well as the population status
and vulnerability of Giant Sea Bass (Allen and Andrews,
2012; Hawk and Allen, 2014; Chabot et al., 2015). The
present study attempted to increase knowledge of Giant Sea
Bass by examining the different behaviors that they exhibit
in the wild that are associated with reproduction, and it
offers insights into the reproductive behavior of polyprionids
in general. Our observations reported herein match courtship
behaviors encountered in nature to those seen in an
Clark and Allen—Spawning and courtship in Giant Sea Bass 177

aquarium, thus providing new methods for detection of
Giant Sea Bass spawning aggregations. Further repeated
observations of three or more Giant Sea Bass spawning
together in the wild are needed to fully evaluate whether it is
a pair spawning species.
The annual formation of spawning aggregations is very
important to the reproductive success of many fishes, and
the overharvesting of these aggregations can cause detrimen-
tal effects to populations. For critically endangered species
such as the Giant Sea Bass, identifying spawning aggrega-
tions is crucial to their recovery. Observations of courting,
site fidelity, and our verification of the presence of fertilized
Giant Sea Bass eggs at an aggregation site should help
establish protocols used to positively identify spawning
aggregation sites in the future. Further research identifying
additional aggregations are needed for better management of
Giant Sea Bass populations in California and Mexico.
ACKNOWLEDGMENTS
This project would have not been possible without the
effort and support of the ‘‘following’’ people: A big thanks to
the staff at the USC Wrigley Institute for Environmental
Science, especially J. Aguilar, T. Odin, and G. Boivin for their
help in the field and knowledge of Catalina Island. We also
thank W. Marti and B. Bushing for sharing information
about where Giant Sea Bass occur at Catalina Island. We give
special thanks to P. House and M. Jelloian, for the many
hours they spent underwater assisting with observations.
We also extend my undying gratitude to the crew of the R/V
Yellowfin, T. Rowell, M. Ho, S. Ginther, G. Srednick, R.
Dauksis, Z. Scott, S. Zimmerman, and M. Al-Marayati for
their assistance both in the field and in lab, and to B.
Carpenter, C. Chabot, B. Erisman, and M. Steele for their
advice and guidance throughout the project. E. DeMartini
and M. Love both provided invaluable comments on an
earlier draft of this paper. This research was supported by a
Graduate Fellowship at USC Wrigley Institute for Environ-
mental Science, the International Women’s Fishing Associ-
ation, 101 Experiment Backers, Nearshore Marine Fish
Research Program, and the Office of Graduate Studies at
CSUN.
LITERATURE CITED
Aalbers, S. A., and M. A. Drawbridge. 2008. White seabass
spawning behavior and sound production. Transactions of
the American Fisheries Society 137:542–550.
Adreani, M. S., B. E. Erisman, and R. R. Warner. 2004.
Courtship and spawning behavior in the California sheep-
head, Semicossyphus pulcher (Pisces: Labridae). Environ-
mental Biology of Fishes 71:13–19.
Allen, L. G., and A. H. Andrews. 2012. Bomb radiocarbon
dating and estimated longevity of Giant Sea Bass (Stereo-
lepis gigas). Bulletin of the Southern California Academy of
Sciences 111:1–14.
Castro, J. J., J. A. Santiago, and A. T. Santana-Ortega. 2002.
A general theory on fish aggregation to floating objects: an
alternative to the meeting point hypothesis. Reviews in
Fish Biology and Fisheries 11:255–277.
Chabot, C. L., H. A. Hawk, and L. G. Allen. 2015. Low
contemporary effective population size detected in the
Critically Endangered giant sea bass, Stereolepis gigas, due to
fisheries overexploitation. Fisheries Research 172:71–78.
Colin, P. L. 1992. Reproduction of the Nassau grouper,
Epinephelus striatus (Pisces: Serranidae) and its relationship
to environmental conditions. Environmental Biology of
Fishes 34:357–377.
Colin, P. L., Y. J. Sadovy, and M. L. Domeier. 2003. Manual
for the Study and Conservation of Reef Fish Spawning
Aggregations. Society for the Conservation of Reef Fish
Aggregations Special Publication No. 1.
Connaughton, M. A., and M. H. Taylor. 1996. Drumming,
courtship, and spawning behavior in captive weakfish,
Cynoscion regalis. Copeia 1996:195–199.
DeMartini, E. E., and P. C. Sikkel. 2006. Reproduction, p.
483–523. In: The Ecology of Marine Fishes: California and
Adjacent Waters. L. G. Allen, D. J. Pondella, II, and M. H.
Horn (eds.). University of California Press, Berkeley,
California.
Domeier, M. L. 2001. Giant sea bass, p. 209–211. In:
California’s Marine Living Resources: A Status Report. W.
S. Leet, C. M. Dewees, R. Klingbeil, and E. Larson (eds.).
Agriculture and Natural Resources Communication Servic-
es, University of California, Oakland, California.
Erisman, B. E., and L. G. Allen. 2006. Reproductive
behaviour of a temperate serranid fish, Paralabrax clathra-
tus (Girard), from Santa Catalina Island, California, U.S.A.
Journal of Fish Biology 68:157–184.
Erisman, B. E., L. G. Allen, J. T. Claisse, D. J. Pondella, II, E.
F. Miller, J. H. Murray, and C. Walters. 2011. The illusion
of plenty: hyperstability masks collapses in two recreation-
al fisheries that target fish spawning aggregations. Cana-
dian Journal of Fisheries and Aquatic Sciences 68:1705–
1716.
Erisman, B. E., M. L. Buckhorn, and P. A. Hastings. 2007.
Spawning patterns in the leopard grouper, Mycteroperca
rosacea, in comparison with other aggregating groupers.
Marine Biology 151:1849–1861.
Fitch, J. E., and R. N. Lavenberg. 1971. Marine Food and
Game Fishes of California. California Natural History
Guides: 28. University of California Press, Berkeley,
California.
Froeschke, B., L. G. Allen, and D. J. Pondella, II. 2007. Life
history and courtship behavior of Black Perch, Embiotoca
jacksoni (Teleostomi: Embiotocidae), from Southern Cal-
ifornia. Pacific Science 61:521–531.
Gilmore, R. G., Jr. 2003. Sound production and communi-
cation in the spotted seatrout, p. 177–195. In: Biology of
the Spotted Seatrout. S. A. Bortone (ed.). CRC Press, Boca
Raton, Florida.
Harada, A. E., E. A. Lindgren, M. C. Hermsmeier, P. A.
Rogowski, E. Terrill, and R. S. Burton. 2015. Monitoring
spawning activity in a Southern California marine protect-
ed area using molecular identification of fish eggs. PLOS
ONE 10:e0134647.
Hawk, H., and L. G. Allen. 2014. Age and growth of the
Giant Sea Bass, Stereolepis gigas. CalCOFI Report 55:128–
134.
Heyman, W. D., R. T. Graham, B. Kjerfve, and R. E.
Johannes. 2001. Whale sharks, Rhincodon typus, aggregate
to feed on fish spawn in Belize. Marine Ecology Progress
Series 215:275–282.
Horn, M. H., and L. A. Ferry-Graham. 2006. Feeding
mechanisms and trophic interactions, p. 387–410. In:
The Ecology of Marine Fishes: California and Adjacent
Waters. L. G. Allen, D. J. Pondella, II, and M. H. Horn (eds.).
University of California Press, Berkeley, California.
178 Copeia 106, No. 1, 2018

House, P. H., B. L. F. Clark, and L. G. Allen. 2016. The
return of the king of the kelp forest: distribution,
abundance, and biomass of Giant Sea Bass (Stereolepis
gigas) off Santa Catalina Island, California, 2014–2015,
Bulletin of the Southern California Academy of Sciences
115:1–14.
Hovey, T. 2001. First observations on spawning behavior in
the Giant Sea Bass. California Fish and Game 87:61–66.
Lobel, P. S. 2002. Diversity of fish spawning sounds and the
application of passive acoustic monitoring. Bioacoustics
12:287–288.
Love, M. S. 2011. Certainly More Than You Wanted to Know
About the Fishes of the Pacific Coast. Really Big Press, Santa
Barbara, California.
Lowe, C. G., and R. N. Bray. 2006. Movement and activity
patterns, p. 524–553. In: The Ecology of Marine Fishes:
California and Adjacent Waters. L. G. Allen, D. J. Pondella,
II, and M. H. Horn (eds.). University of California Press,
Berkeley, California.
Mann, D., J. Locascio, M. Scha
¨rer, M. Nemeth, and R.
Appeldoorn. 2010. Sound production by red hind,
Epinephelus guttatus, in spatially segregated spawning
aggregations. Aquatic Biology 10:149–154.
Mann, D. A., J. V. Locascio, F. C. Coleman, and C. C.
Koenig. 2009. Goliath grouper, Epinephelus itajara, sound
production and movement patterns on aggregation sites.
Endangered Species Research 7:229–236.
Miller, D. J., and R. N. Lea. 1972. Guide to coastal marine
fishes of California. California Department of Fish Game
Fish Bulletin 157:1–235.
Moser, H. G., and W. Watson. 2006. Ichthyoplankton, p.
269–319. In: The Ecology of Marine Fishes: California and
Adjacent Waters. L. G. Allen, D. J. Pondella, II, and M. H.
Horn (eds.). University of California Press, Berkeley,
California.
NCBI Resource Coordinators. 2017. Database Resources of
the National Center for Biotechnology Information.
Nucleic Acids Research 45(Database issue):D12–D17.
Nelson, J. S. 2006. Fishes of the World. Fourth edition. Wiley,
Hoboken, New Jersey.
Peres, M. B., and S. Klippel. 2003. Reproductive biology of
southwestern Atlantic wreckfish, Polyprion americanus
(Teleostei: Polyprionidae). Environmental Biology of Fishes
68:163–173.
Pondella, D. J., II, and L. G. Allen. 2008. The decline and
recovery of four predatory fishes from the Southern
California Bight. Marine Biology 154:307–313.
Roberts, C. D. 1989. Reproductive mode in the percomorph
fish genus Polyprion Oken. Journal of Fish Biology 34:1–9.
Rowell, T. J., M. T. Scha
¨rer, R. S. Appeldoorn, M. I. Nemeth,
D. A. Mann, and J. A. Rivera. 2012. Sound production as
an indicator of red hind density at a spawning aggregation.
Marine Ecology Progress Series 462:241–250.
Sadovy, Y. 1996. Reproduction of reef fishery species, 15–59.
In: Reef Fisheries. N. Poluini and C. Roberts (eds.).
Chapman and Hall, London.
Sadovy, Y., and M. Domeier. 2005. Are aggregation-fisheries
sustainable? Reef fish fisheries as a case study. Coral Reefs
24:254–262.
Sadovy, Y., and A. M. Eklund. 1999. Synopsis of biological
data on the Nassau grouper, Epinephelus striatus (Bloch,
1792), and the jewfish, E. itajara (Lichenstein, 1822). FAO
Fisheries Synopsis, 68.
Sadovy de Mitcheson, Y., A. Cornish, M. Domeier, P. Colin,
M. Russell, and K. C. Lindeman. 2008. A global baseline
for spawning aggregations of reef fishes. Conservation
Biology 22:1233–1244.
Scha
¨rer, M. T., M. I. Nemeth, D. Mann, J. Locascio, R. S.
Appeldoorn, and T. J. Rowell. 2012. Sound production
and reproductive behavior of Yellowfin Grouper, Mycter-
operca venenosa (Serranidae) at a spawning aggregation.
Copeia 2012:135–144.
Sedberry, G., C. Andrade, J. Carlin, R. Chapman, B.
Luckhurst, C. Manooch, III, G. Menezes, B. Thomsen,
and G. Ulrich. 1999. Wreckfish Polyprion americanus in the
North Atlantic: fisheries, biology and management of a
widely distributed and long-lived fish. American Fisheries
Society Symposium 23:27–50.
Shane,M.A.,W.Watson,andH.G.Moser.1996.
Polyprionidae: Giant sea basses and wreckfishes, p. 873–
875. In: The Early Stages of Fishes in the California Current
Region. H. G. Moser (ed.). California Cooperative Oceanic
Fisheries Investigations (CalCOFI) Atlas No. 33, Allen Press
Inc., Lawrence, Kansas.
Wakefield, C. B., S. J. Newman, and D. K. Boddington.
2013. Exceptional longevity, slow growth and late matu-
ration infer high inherent vulnerability to exploitation for
bass groper, Polyprion americanus (Teleostei: Polyprionidae).
Aquatic Biology 18:161–174.
Wakefield, C. B., S. J. Newman, and B. W. Molony. 2010.
Age-based demography and reproduction of hapuku,
Polyprion oxygeneios, from the south coast of Western
Australia: implications for management. ICES Journal of
Marine Science 67:1164–1174.
Walters, S., S. Lowerre-Barbieri, J. Bickford, and D. Mann.
2009. Using a passive acoustic survey to identify spotted
seatrout spawning sites and associated habitat in Tampa
Bay, Florida. Transactions of the American Fisheries Society
138:88–98.
Watson, W., R. L. Charter, H. G. Moser, R. D. Vetter, D. A.
Ambrose, S. R. Charter, L. L. Robertson, E. M. Sandknop,
E. A. Lynn, and J. Stannard. 1999. Fine-scale distributions
of planktonic fish eggs in the vicinities of Big Sycamore
Canyon and Vandenberg Ecological Reserves, and Anacapa
and San Miguel Islands, California. California Cooperative
Oceanic Fisheries Investigations Report 40:128–153.
Clark and Allen—Spawning and courtship in Giant Sea Bass 179