ArticlePDF Available

Abstract and Figures

Controlling of ligand mediated G-quadruplex (GQ) DNA formation and stabilization is an important and challenging aspect due to its active involvement in many biologically important processes like, DNA replication, transcription etc. Here, we have demonstrated that topotecan (TPT), a potential anticancer drug, can instigate the formation and stabilization of GQ-DNA (H24→GQ-DNA) in the absence of Na⁺/K⁺ ions, through circular dichroism, fluorescence, NMR, UV melting and molecular dynamics (MD) simulation studies. The primary binding mode of TPT to GQ was found to be stacking at the terminal rather than binding to the groove. We also have reverted this conformational transition (GQ-DNA→H24) using a molecular container, cucurbit[7]uril (CB7) by means of translocation of the drug (TPT) from GQ-DNA to its nanocavity. Importantly, we have carried out the detection of these conformational transitions using the fluorescence color switch of the drug, which is more direct and simple than some of the other methods that involve sophisticated and complex detection techniques.
Content may be subject to copyright.
This is an Accepted Manuscript, which has been through the
Royal Society of Chemistry peer review process and has been
accepted for publication.
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.
You can find more information about Accepted Manuscripts in the
author guidelines.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the ethical guidelines, outlined
in our author and reviewer resource centre, still apply. In no
event shall the Royal Society of Chemistry be held responsible
for any errors or omissions in this Accepted Manuscript or any
consequences arising from the use of any information it contains.
Accepted Manuscript
rsc.li/pccp
PCCP
Physical Chemistry Chemical Physics
www.rsc.org/pccp
ISSN 1463-9076
PERSPECTIVE
Darya Radziuk and Helmuth Möhwald
Ultrasonically treated liquid interfaces for progress in cleaning and
separation processes
Volume 18 Number 1 7 January 2016 Pages 1–636
PCCP
Physical Chemistry Chemical Physics
View Article Online
View Journal
This article can be cited before page numbers have been issued, to do this please use: S. Satpathi, R. K.
Singh, A. Mukherjee and P. Hazra, Phys. Chem. Chem. Phys., 2018, DOI: 10.1039/C8CP00325D.
1
Controlling an Anticancer Drug Mediated G-
quadruplex Formation and Stabilization by a
Molecular Container
Sagar Satpathi, Reman K. Singh, Arnab Mukherjee*
a
and Partha Hazra*
ab
a
Department of Chemistry, Indian Institute of Science Education and Research (IISER), Pune.
Dr. Homi Bhabha Road, Pashan, Pune, India 411008. Fax: +91 20 2589 8022.
E-mail: p.hazra@iiserpune.ac.in, arnab.mukherjee@iiserpune.ac.in, Tel: +91 20 2590 8076.
b
Centre for Energy Science, Indian Institute of Science Education and Research (IISER), Pune
(411008), Maharashtra, India
Page 1 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
2
ABSTRACT
Controlling of ligand mediated
G-quadruplex (
GQ) DNA formation and stabilization is
an important and challenging aspect due to its active involvement in many biologically
important processes like, DNA replication, transcription etc.
Here, we have demonstrated
that topotecan (TPT), a potential anticancer drug, can instigate the formation and stabilization of
GQ-DNA (H24→GQ-DNA) in the absence of Na
+
/K
+
ions, through circular dichroism,
fluorescence, NMR, UV melting and molecular dynamics (MD) simulation studies. The primary
binding mode of TPT to GQ was found to be stacking at the terminal rather than binding to the
groove. We also have reverted this conformational transition (GQ-DNA→H24) using a
molecular container, cucurbit[7]uril (CB7) by means of
translocation of the drug (TPT) from
GQ-DNA to its
nanocavity.
Importantly, we have carried out the detection of these
conformational transitions using the fluorescence color switch of the drug, which is more
direct and simple than some of the other methods that involve sophisticated and complex
detection techniques.
Page 2 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
3
Introduction
Among different secondary structures of DNA, G-quadruplex DNA (GQ) has received
special attention among researchers due to its potential therapeutic applications in the
field of cancer research.
1, 2
In general, human telomeric DNA contains tandem repeats of
guanine rich sequences (i.e. d(TTAGGG)) which end in a single stranded 3
overhang
fashion with 100-200 bases.
3, 4
Replication of this non-coding DNA part, i.e. telomere, is
governed by the telomerase enzyme, and this was found to be overexpressed in cancerous
cells in comparison to normal cells.
5
Under physiological condition, the overhang strand
in telomere can form different types of GQ structures depending on the directionality of
the strands. This GQ structure formation is found to have an inhibitory effect towards the
telomerase enzyme.
6, 7
Since then, stabilization of GQ structures by small organic
molecules or ligands have been regarded as one of the potential active fields for
anticancer research.
1, 8-10
Apart from quadruplex stabilization using external ligands,
significant attempts have also been made in literature to study G-quadruplex stabilization
using internal turn-on fluorescence probes, i.e. using modified nucleotides.
11-14
Interestingly, highly stable G-quartets in GQ structures behave as a rigid knot for DNA
unwinding, which is one of the major and primary steps towards DNA replication. Thus,
some biologically important processes, like, DNA replication and transcription processes
are hampered due to the GQ formation.
15
Generally, different types of helicase enzymes
(FANCJ, pif1, WRN etc.) unwind these GQ structures to carry out the DNA replication
process.
15, 16
But additional stability by ligands towards GQ structure inhibits the activity
of helicase enzymes to a large extent which is found to be detrimental for DNA
replication processes.
15, 17
Thus, controlling of this ligand mediated GQ formation is
Page 3 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
4
equally important and challenging in addition to their GQ stabilization aspect. In this
quest, many researchers have tried to regulate the G-quadruplex formation using several
external stimuli.
18-20
However, most of these approaches for GQ reversibility depends on
using light sensitive modified nucleobases,
18
pH dependent inorganic complex
21
and
metal mediated conformational switch.
19
Although there are several reports about
molecular container controlled ligand binding to duplex DNA,
22-24
studies on regulating
this type of ligand mediated GQ DNA formation are rather limited.
25-28
Therefore, it is
important to develop a new strategy for controlling ligand mediated GQ formation and
stabilization, which is found to be more general approach considering the versatile
applicability towards GQ stabilizing ligands based on small organic molecules. During
our ongoing project, Zhou and coworkers reported the reversible manipulation of GQ-
DNA structures through supramolecular host-guest interactions using CD and NMR
techniques.
29
However, it would be very simple and effective if the GQ formation and
reversible conformational transition by external stimuli can be directly monitored using
fluorescence color switch.
Herein, we have employed an anti-cancer drug, topotecan (TPT)
to detect this conformational switch between GQ DNA and single stranded/random coil
DNA (H24 DNA)
with the help of fluorescence color switching of the drug
, which makes this
approach more advantageous compared to the previous studies.
Topotecan (TPT) exhibits its antitumor activity by means of inhibiting topoisomerase
I (topo I) enzyme through the formation of a cleavable ternary complex (i.e. DNA-TPT-
topo I).
30, 31
Close analogue of TPT, camptothecin has been found to synergistically
increase the therapeutic efficacy of an antitumor GQ ligand.
32
Very recently, Yuan and
Page 4 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
5
coworkers reported the transcriptional regulation in C-Myb genes through the binding of
TPT to the
Scheme 1
. Different protolytic forms of Topotecan (TPT).
G-quadruplex in presence of ammonium ion.
33
Keeping its therapeutic application in
mind, researchers have explored the optical properties of TPT in bulk and various
restricted and organized biological assemblies.
34-39
TPT exhibits interesting fluorescence
property based on its different protolytic forms like, enol (E), cationic (C) and
zwitterionic (Z) forms depending on the pH and polarity of the medium (
Scheme 1
).
40-42
Uniqueness in the photophysical property of TPT lies in its distinctly different emission
maxima for different forms (Z* emits at ~530 nm and C* at ~430 nm). Here, we have
utilized the large difference (~100 nm) in the emission maxima between these two forms
for probing the conformational transition between GQ and its subsequent transition to
single stranded/random coil form by a molecular container. We have shown that TPT can
instigate and further stabilize the GQ structure in absence of any ion (Na
+
/K
+
) from a
biologically relevant human telomeric sequence, H24 DNA (5′-
d(TTAGGGTTAGGGTTAGGGTTAGGG)-3′). With the help of MD simulation study,
we have proposed the mechanism of this stabilization process. To regulate this GQ
formation, we have introduced
cucurbit[7]uril
(CB7,
Fig. S1
) in the solution, which can
Page 5 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
6
revert this transition, i.e., GQ H24. Interestingly, this entire process can be monitored
through fluorescence color switch from green (H24-TPT system) to violet (H24-TPT-
CB7
system
). The entire conformational transitions have been also monitored by other
spectroscopic tools, like, circular dichroism (CD), nuclear magnetic resonance (NMR),
thermal melting and time-resolved fluorescence techniques. Keeping the large number of
aromatic/drug molecule’s ability for GQ stabilization in literature, this present study may
offer an alternative approach to regulate and monitor the formation of G-quadruplex
structure without exerting any intricate and laborious technique.
Materials and Methods
The 24-mer human telomeric (H24) DNA (5′-d(TTAGGGTTAGGGTTAGGGTTAGGG)-3′)
was purchased from Integrated DNA Technologies (IDT) and used as received. Topotecan (high
purity, 99%) was provided by Sigma-Aldrich and used without further purification. All
experiments and sample preparations were carried out in deionized water. Prior to the
experiments H24-DNA was annealed at 90 °C for 10 min and stored at 4 °C for 24 h. The
concentration of H24-DNA was determined using the molar extinction coefficient of 244 600
M
−1
cm
−1
at 260 nm provided by IDT, USA. It is necessary to mention here that IDT has
determined the molar extinction coefficient using nearest neighbor approximation model. The
concentration of TPT was determined using the molar extinction coefficient of 200 000 M
−1
cm
−1
at 380 nm.
37
Steady state fluorescence measurements were carried out in FluoroMax-4
spectrofluorimeter (Horiba Scientific, U.S.A.). Circular dichroism (CD) spectra were recorded
on a J-815 CD (JASCO, U.S.A.) instrument at 25°C. The data were collected at 1 nm intervals
with 1 nm band width. Each CD profile is an average of 3 scans of the same sample collected at
a scan speed 100 nm/min, with a proper baseline correction from the blank water solution.
Page 6 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
7
NMR spectra of all the samples were collected through Bruker Advance III Ascend 600 MHz
NMR spectrometer operating at 14.1 T and equipped with a 5-mm quad-resonance (
1
H)
cryogenic probe at 298K. All the NMR data were processed using MestReNova-9.0.1.-13254
and origin pro 8.5 software. All the NMR samples were prepared using 90% deionized water
(devoid of any ions) and 10% D
2
O having H24 DNA concentration of 50 M. Then, TPT (150
M) was added in the same solution for the GQ DNA formation. To revert the structure to single
strand/random coil, 1.5 mM CB7 was added in the H24-TPT system (H24: TPT = 1:3). In order
to monitor the peaks in between 10-13 ppm, water suppression was performed.
Time-resolved fluorescence decays were collected using time correlated single photon
counting (TCSPC) setup (Horiba JobinYvon IBH, U.S.A.). In TCSPC, TPT molecules were
excited using 375 nm diode laser (nano-LED 375, fwhm 100 ps) and the emission photons at
respective emission maxima were collected at magic angle using a MCP-PMT (Hamamatsu,
Japan) detector. The lifetime analysis was performed by IBH DAS6 software. We fitted these
decay profiles with minimum number of exponential. Quality of each fit was judged by χ
2
values
and the visual inspection of the residuals. The value of χ
2
1 was considered as best fit for the
plots.
Thermal melting study was performed using Varian Cary 300 Bio UV-Vis
Spectrophotometer (Thermo Fisher Scientific, U.S.A.). Thermal melting was monitored at 290
nm with heating rate of 1 °C/min. Here, we used very small concentration of DNA (~1 µM) to
avoid the absorbance saturation. The melting temperature (T
m
) was determined from the
sigmoidal curve fit of the melting profile.
Isothermal titration calorimetry (ITC) measurements were done using iTC200
microcalorimeter (Microcal-200) at 25 °C. The titration of TPT against H24 DNA was
Page 7 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
8
performed in 20 injections (2 µL of each) into a solution with fixed H24 DNA (200 µL)
concentration in the cell with 200 s resting time between two consecutive injections. To
eliminate the dilution effect, a blank experiment was also carried out by injecting the same
concentration of TPT into deionized water under identical experimental condition. Using single-
site binding model and nonlinear least-squares fitting algorithm method, generated isotherm was
analyzed to yield the relevant thermodynamic parameter.
Simulation Methods
The structure of TPT was generated in GVIEW software. The structure optimization and electron
densities were calculated quantum mechanically using HF theory with 6-31G* basis set in
GAUSSIAN03 software.
43
Using this, RESP charges of TPT atoms were calculated using
ANTECHAMBER module of AMBER11. For all other force-field parameters for TPT, GAFF
force-field was followed.
44
The topology and co-ordinates generated using AmberTools
45, 46
were
converted into GROMACS format by using a perl program amb2gmx.pl.
47
The starting structure of hybrid G-quadruplex (3+1) was taken from protein data bank (PDB
ID 2GKU).
48
The topology and coordinates of GQ were generated by using GROMACS.
49
Amber94 force-field
50
was used for GQ. We created three systems: (i) GQ in water (ii) 1:2
GQ:TPT complex in water, and (iii) 1:1 GQ:TPT complex in water. Each system was solvated
by ~23000 TIP3P water molecules
44
in a cubic box of dimension 90 Å. Physiological
concentration (150 mM) of K
+
and Cl
-
ions as well as extra K
+
ion were used to neutralize the
system.
All the simulations were performed using molecular dynamics software GROMACS-4.5.5.
49
Initially, the system was minimized using the steepest descent
method,
51
followed by heating it to
300K in 100 ps using Berendsen thermostat
52
with coupling constant of 0.2 ps. Restraint of 25
Page 8 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
9
kcal/mol/Å
2
was applied on heavy atoms of GQ during the heating process. The harmonic
restraint was gradually reduced to 0.25 kcal/mol in six steps following the protocol used in
standard DNA simulations.
53
In each step, 100 ps equilibration was carried out at constant
temperature (300 K) and pressure (1 bar) using Berendsen thermostat and barostat
52
with
coupling constants of 0.2 ps each, followed by energy minimization using the steepest descent
method.
51
During the simulation, LINCS algorithm
54
was used to constrain all the bonds. Particle
Mesh Ewald (PME) method
55
was used for electrostatics. The distance cut-offs for the van der
Waals (vdW) and electrostatic long-range interaction was kept at 10 Å. The time step for each
simulation was taken to be 2 fs. At the final equilibration step, we performed the 2 ns
unrestrained equilibration by using the Berendsen thermostat and barostat
52
with coupling
constant of 0.2 ps. After the equilibration steps, multiple normal molecular dynamics simulations
were performed to see the binding of TPT with GQ. Three random configurations of 1:1
GQ/TPT complexes were created, where TPT molecule was placed far away from the GQ. For
each of these three different configurations, three 100 ns simulations were performed. Fig. S5a
(in Supporting Information) shows the initial structure and the most probable structures after the
simulation. For 1:2 GQ/TPT complex, three simulations of 100 ns were performed with different
velocity distribution from a configuration, where both the TPT molecules are far away from the
GQ. Fig. S5b (in SI) shows the initial structure for this system. Thus, a total of 1.2 s simulation
was performed to study the TPT-GQ binding. During this final set of simulations, temperature
was set at 300 K and pressure was set at 1 bar using the Nose-Hoover thermostat
56, 57
and
Parrinello-Rahman barostat,
58
respectively, with 0.2 ps coupling constant.
Definition of Angle Used in Analysis:
Page 9 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
10
Schematic representation of angle between GQ and TPT is shown in Fig. 1a. We have used two
vectors: the vector was constructed from COM of G16, G10, G4, G22 to COM of G17, G9,
G3, G21 and vector
was constructed from COM of GQ to the COM of the drug. The angle of
defined as,  = cos

 . 
. Vector roughly shows the GQ axis. When drug is bound to groove
of GQ (side binding), the angle would be high, and when drug bound to terminal of GQ, the
angle would be low.
Metadynamic Simulation Details:
To calculate the binding free energy of TPT and GQ, well-tempered metadynamics
59
simulation
was performed along X (reaction coordinate). This reaction coordinate was similar to what was
defined for DNA-Drug binding/unbinding mechanism by Wilbee et al.
60
created to measure the
distance between the drug and DNA perpendicular to the DNA helical axis. Here also,
approximately measures the distance of TPT perpendicular to the GQ axis denoted as vector in
Fig. 1a. Fig 1b shows the construction of the reaction coordinate schematically.
Metadynamics simulations were performed for unbinding of TPT: (i) unbinding from terminal
bound complex, (ii) unbinding from groove bound complex. To check the reproducibility of the
well-tempered metadynamics simulation, the same metadynamics simulation was repeated with
different parameters. Gaussian potential of 0.2 kJ/mol height and 0.7Å width were used for both
simulations. The potential disposition rate was 2 ps for the first simulation. The bias factor was
set to 10 for both simulations. We have stopped the simulation when unbinding happened. It took
a total of 30 ns for the first and 25 ns for the second metadynamics simulation. Thus, a total of 55
ns simulation was performed for the metadynamics simulation.
Page 10 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
11
Fig. 1. Definition of angle and reaction coordinate using the schematic drawing of the GQ. (a)
Angle is defined using two vectors  and
. Vector  (GQ axis) is constructed from COM of
bases 1 to 4 to COM of base 5-6-7-8 and vector
goes from the COM of GQ bases 2 to 7 to the
COM of 2,3,6,7 bases. Numbers 1-8 are just for schematic representation. When drug is bound to
groove of GQ (side binding), the angle would be ~90˚ and when drug bound to terminal of GQ,
the angle would be ~0˚. (b) Reaction coordinate defined by two vectors
and
as  = 
. 
.
Vector
d
r
is goes from COM of GQ bases 2, 3, 6, 7 to COM of TPT and vector
goes from the
COM of GQ bases 2,7 to the COM of 2-3-6-7 bases. Note that the numbers 1-8 are just for
schematic representation and does not reflect the actual base numbering in the GQ. Same way,
we have defined for terminal bound state, where we have considered 1-2-3-4 bases for definition.
would be ~0, when the drug is bound to either groove or the terminal site of GQ.
Results and Discussions
CD Study
Circular dichroism (CD) measurements have been employed to monitor the
conformational transitions of human telomeric DNA (H24) in presence of TPT. All the
studies have been performed in deionized water (pH 6) to eliminate any possibility of GQ
formation by ion (like Na
+
, K
+
etc.) and also to avoid the hydrolysis of TPT to form toxic
Page 11 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
12
carboxylate (pK
a
~ 7).
34, 40
Notably, distinctly different ellipticity patterns in CD spectra
arise from different GQ topologies.
6
H24 in deionized water exhibits an ellipticity pattern
(positive peak around 260 nm and negative peak around 235 nm) for single
stranded/random coil structure (
Fig. S2
), which gets altered in presence of TPT (
Fig. 2a
,
H24-TPT), and two positive peaks (at 290 and 250 nm) along with two negative peaks (at
235 and 380 nm) appear in the CD profile. Notably, this spectral pattern closely matches
with the ellipticity pattern of hybrid GQ structure (
Fig. S2
).
6, 9
Thus, CD results suggest
the TPT instigated GQ formation, which has a topology closer to mix/hybrid structure
(
Fig. 2a
, H24-TPT and
Fig. S2
). Aqueous solution of TPT shows an intense positive peak
at 225 nm and a negative peak at 380 nm (
Fig. 2b
), which is responsible for the observed
negative peak at 380 nm in the H24-TPT system (
Fig. 2a
, H24-TPT). Next, we have
introduced CB7 to the H24-TPT system and a broad positive ellipticity pattern at 270 nm
and less intense negative peaks at ~240 nm and ~380 nm (
Fig. 2a
, H24-TPT-CB7)
appeared in the CD profile. In order to find the origin of these ellipticity patterns in H24-
TPT-CB7 system, we have recorded the CD spectra of TPT-CB7 (in absence of H24) and
H24-CB7 (in absence of TPT) systems (
Fig. 2b
). TPT-CB7 system exhibits almost
similar ellipticity pattern to that of only TPT (
Fig. 2b
). Interestingly, the observed
ellipticity pattern in H24-CB7 (
Fig. 2b
) resembles to that of H24-TPT-CB7 system (
Fig.
2a
). However, H24-CB7 system (
Fig. 2b
, H24-CB7) shows a broad ellipticity pattern at
270 nm and a weak negative peak at 240 nm, which is different from the ellipticity pattern
of only H24 CD spectrum (
Fig. S2
). Here, it is pertinent to mention that although CB7
does not have any specific interaction with duplex DNA, CB7 can interact with H24 DNA
due to its single stranded nature. The nucleobases in single stranded DNA (i.e. H24) are
Page 12 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
13
more accessible in comparison to the duplex DNA due to the absence of Watson-Crick
base pairing as well as helix formation. It is well known that different nucleobases
interact with CB7 at varying affinity and the absorption spectrum of the nucleobases is
found to be red shifted in presence of CB7.
61-63
Importantly, Venkataramanan and co-
workers reported that the existence of charges “splattering” in guanine-CB7 inclusion
complex is the reason for its higher stability.
63
Similar kinds of interactions between
nucleobases of H24 and CB7 are also pertinent here, which may be responsible for the
different ellipticity pattern of H24 DNA in comparison with H24-CB7. Hence, the
spectral similarity between H24-TPT-CB7 and H24-CB7 system indicates the reformation
of H24 structure from GQ structure due to the translocation of TPT from GQ-DNA to
CB7 nanocavity followed by interaction with CB7 nano-cavity to produce an ellipticity
pattern different from H24 only (
Fig. 2a
). In a nutshell, CD studies suggest the TPT
induced GQ formation in the absence of any ion and its reformation to H24 form in the
presence of CB7 nanocavity.
Page 13 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
14
Fig. 2
(a) Circular dichroism (CD) spectra of H24 DNA in presence of topotecan (TPT)
and TPT + cucurbit[7]uril (CB7). (b) CD spectra of TPT and H24 DNA in presence and
absence of CB7. H24 legend in figure corresponds to the CD spectra of human telomere
in absence of Na
+
/ K
+
ion i.e. in deionized water.
NMR Study
Nuclear magnetic resonance (NMR) spectroscopy is an efficient tool to distinguish the
GQ formation by monitoring the unique chemical shift value (i.e. in the 10-13 ppm
region) of hydrogen bonded imino protons of guanine base pairs.
48
NMR spectrum of
H24 DNA (
Fig. 3
) does not contain any distinct peaks in the 10-13 ppm region indicating
the presence of a single stranded/random coil structure of the G-rich sequence DNA.
However, H24-TPT system (H24:TPT=1:3) (
Fig.
3
) exhibits the characteristic imino
proton peaks between 10 to 13 ppm, which closely matches with the K
+
induced hybrid
type GQ formation.
48
Notably, proton NMR spectrum of TPT does not contain any peak
in the 10-13 ppm region,
64
which clearly indicates that the above-mentioned new peaks
are originated due to the hydrogen bonded imino protons of guanine base pairs during GQ
DNA formation. Interestingly, addition of CB7 molecules in the same H24-TPT system
does not show any imino proton peaks in the 10-13 ppm region (
Fig. 3
), indicating the
formation of single stranded/random coil structure from GQ DNA, probably owing to the
encapsulation of TPT molecules in the CB7 nano-cavity. Thus, NMR spectroscopy
measurements give us a direct evidence of the TPT induced GQ formation and its
conformational transition to single stranded/random coil structure in presence of CB7
molecules by simply monitoring the chemical shift of imino protons in guanine base
pairs.
Page 14 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
15
Fig. 3
1
H NMR spectra of H24 DNA, H24+TPT, H24+TPT+CB7 at 25˚ C.
Steady State Studies (Fluorescence, ITC and UV Thermal Melting)
In bulk water (pH 6), TPT predominantly exists in cationic form (C) in ground state due
to the higher pK
a
values of dimethylamino and 10-hydroxyl groups of 9.5 and 6.99,
respectively (
Scheme 1
).
34, 40
However, in excited state, the zwitterionic form (Z
*
) is the
major emitting species of TPT exhibiting a green emission maxima around ~530 nm,
which originates from the excited state proton transfer (ESPT) between the 10-hydroxyl
group of cationic TPT (C
*
) and water molecules.
34, 36
With gradual addition of H24 DNA,
fluorescence spectrum of TPT shows a decrement in green emission without showing any
significant shift in emission position (
Fig. 4a
). This observation suggests the interaction
Page 15 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
16
between H24 DNA and TPT as a result of GQ DNA formation instigated by TPT.
Absence of any spectral overlap between the donor emission (Z
*
) and the absorption of
acceptor (nucleobases) indicates that this quenching in the emission maximum may be
attributed to the photoinduced electron transfer from guanine nucleobases of DNA to the
zwitterionic form (Z
*
) of TPT, which has been previously observed in G-rich sequences.
37
At higher concentrations of H24, the emission intensity does not change inferring that
almost all TPT molecules involve in the binding to GQ DNA.
Fig. 4
Steady state fluorescence spectra of TPT (
λ
ex
375 nm) in presence of (a) H24 (~ 20
µ
M) and (b) H24 and CB7 (~ 1.5 mM). Arrow indicates the gradual addition of H24 or
CB7 to the solution.
We have also probed the interaction between TPT and H24 DNA by ITC study, which
exhibits a binding constant of 3.7
×
10
5
M
-1
for H24-TPT system (
Fig. 5
). Moreover, the
ITC results infer that the binding process between TPT and DNA is an enthalpically (
H -
21.8 kcal mol
-1
) driven process as the negative entropy change associated with it (-48.2
cal mol
-1
), and the overall process is a spontaneous one (
G -20.8 kcal mol
-1
). The
Page 16 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
17
exothermic binding process between TPT and DNA molecules can be attributed to both
electrostatic (such as H-bonding) and dispersion types (van der Waals) as found in the
MD simulations studies for TPT and GQ DNA interaction (discussed in later part).
Fig. 5 Upper panel shows the ITC plot of H24 DNA (in syringe) with TPT (in cell), and the
lower panel shows the integrated heat profile of the calorimetric titration plot shown in upper
panel. The solid line represents the best nonlinear least-squares fit to a single binding site model.
Next, we discuss the regulation of GQ formation using a molecular container i.e.
CB7. Addition of CB7 leads to the decrement in the emission intensity at ~530 nm and a
new emission peak for the cationic form of TPT (C
*
) emerges at ~430 nm (
Fig. 4b
).
Highest addition of CB7 (1.5 mM) makes the cationic peak (at 430 nm) as the
Page 17 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
18
predominant one over the zwitterionic form (at 530 nm). This switch of fluorescence
color from green (530 nm) to violet (430 nm) can be attributed to following reasons. First,
the encapsulation of TPT inside the CB7 nanocavity decreases the presence of water
molecule in the vicinity of the cationic form, (C
*
) resulting in the inhibition of ESPT
process responsible for the conversion from C
*
to Z
*
. Second, the upward pK
a
shift of the
10-hydroxyl group (pK
a*
-2.62) inside the CB7 nanocavity (pK
a*
5.51)
34
is also
responsible for this inhibition of ESPT process. As there is no free drug in the solution,
the observed fluorescence color switch from green to violet in presence of molecular
container confirms that TPT molecules translocate from the GQ-DNA to the CB7 nano-
cavity, and is responsible for this DNA structural transition from GQ to H24 form, i.e.,
GQ-DNA→H24
. Binding constant (K) for the TPT with H24 DNA system is found to be
3450 ± 345 M
-1
(Note S1), which is lower than that of TPT with CB7
34
(K = 5000 M
-1
).
Thus, the calculated binding constants from fluorescence measurements also indicate the
translocation of TPT from GQ DNA to CB7 nano-cavity.
To further validate the formation of GQ and its transition to H24 in light of their
stabilities, we have employed thermal melting measurements of H24-TPT in presence and
absence of CB7 nanocavity in 150 mM KCl containing buffer solution (
Fig. 6
). TPT
imposes an additional stabilization of ~9
°
C (T
m
= 77
°
C) towards K
+
ion stabilized GQ
DNA (T
m
= 68
°
C). However, this structural stabilization exhibits a substantial decrement
of ~7
°
C with the incorporation of CB7 in the solution (T
m
= 70
°
C). This decrement in
melting temperature value indicates that CB7 takes away some of the TPT molecules
from the GQ DNA, thereby lowering its stabilization (
Fig. 6
). In a nutshell, we can infer
that disappearance of the characteristic ellipticity pattern and imino proton NMR peaks
Page 18 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
19
for GQ, decrement in melting temperature and fluorescence color switch from green to
violet indicate the reverse process of GQ formation, i.e., GQ-DNA→H24 transition,
proceeding through the encapsulation of TPT molecules inside CB7 nano-cavity, which is
involved in the GQ formation and stabilization process.
Fig. 6
UV melting spectra of GQ in buffer with simultaneous addition of TPT and CB7.
GQ legend corresponds to the melting spectra of human telomere in presence of 150 mM
KCl.
Time-resolved Fluorescence Studies
Time-resolved fluorescence measurements have been employed to explore this
conformational transition of DNA by monitoring the lifetime of TPT molecules. Lifetime
profiles of TPT in absence and presence of H24-DNA/H24-DNA-CB7 have been
collected around ~430 nm for cationic form (C
*
) and ~530 nm for zwitterionic form (Z
*
)
(
Fig. 7a, Table S1
). In bulk water (pH 6), Z
*
form of TPT (collected at 530 nm by
exciting at 375 nm) exhibits a single exponential decay profile with a lifetime of 5.88 ns,
and this lifetime is found to be unaltered (5.88 ns to 5.66 ns) even in the presence of
Page 19 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
20
maximum concentration (20
µ
M) of H24. However, a huge quenching in Z
*
emission
intensity in steady state spectra is observed in presence of H24; hence, it is quite rational
to predict a ground state dark complexation between H24 and TPT molecules as a result
of GQ DNA formation, which does not emit in the excited state (
Fig. S4
). Notably, this
type of static quenching has also been observed for TPT molecules binding with other
types of DNA.
37
Fig. 7 Lifetime decays of TPT (a) at λ
ex
375 nm and λ
col
530 nm (b) at λ
ex
375 nm and λ
col
425
nm in deionised water with simultaneous addition of H24 (20 µM) and CB7 (1.5 mM).
Interestingly, addition of CB7 to the H24-TPT system exhibits a huge increment in the
average lifetime of C* form (collected at 430 nm by exciting at 375 nm) from ~40 ps to
1.62 ns. This can be attributed to the reduction in nonradiative decay pathways of TPT
arising due to the encapsulation of cationic form inside the CB7 nanocavity (
Fig. 7b
,
Table S2
). Enhancement in the C* form lifetime corroborates well with our steady state
results, where a huge increment in the emission intensity of the C* form (around 420 nm)
Page 20 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
21
is observed in presence of CB7. On the other hand, lifetime decays of Z* form (collected
at 530 nm by exciting at 375 nm) shows a decrement from 5.66 ns to 4.54 ns at the
maximum concentration of CB7 (1.5 mM), which has been previously attributed to the
hydrogen bonding interaction between carbonyl groups of the CB7 portal and Z* form of
TPT.
34
In a nutshell, time-resolved fluorescence studies indicate a strong interaction of
TPT with GQ DNA, which is significantly altered in presence of CB7, and the entire
observations corroborate well with our steady state results.
Fig. 8
(a) Representative binding modes of 1:1 and 1:2 GQ/TPT complexes. Distribution
of distance and angle (b) in 1:1 GQ/TPT complex and (c) in 1:2 GQ/TPT complex. (d)
RMSD of GQ in water, 1:1 GQ/TPT and 1:2 GQ/TPT complex. (e) Average free energy
(FE) of binding to the terminal (black) and groove (red) of GQ from two independent
well-tempered metadynamics simulations for 1:1 GQ/TPT complex. The bar in FE
represents the error in FE.
Page 21 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
22
Molecular Dynamics (MD) Simulation Study
Binding mode of TPT to GQ has been explored by utilizing the molecular dynamic
simulation. As discussed in the method section, we have created two systems to explore
the binding of TPT to GQ: one using same concentration of GQ and TPT (1:1 GQ:TPT
complex) and other with the higher concentration of TPT. Starting from the separated
configuration of GQ and TPT for both types of complexes, we performed multiple
simulations with different initial conditions (see Simulation Method). A total of 9
simulations were performed for 1:1 complex, whereas 3 simulations were performed for
1:2 complex. The initial geometries used for the simulation are shown in
Fig. S5
.
Analyses were carried out over the last 80 ns of each trajectory. Two binding modes of
TPT are possible for 1:1 GQ-TPT system. One is a groove (side bind) binding mode,
where the TPT interacts with the groove of GQ and the other is the terminal binding
mode, where TPT molecule stacks at the terminal of the GQ (
Fig. 8a
). The time variation
of distances and angles for all the complexes (1:1 GQ/TPT and 1:2 GQ/TPT complex) are
shown in
Fig. S6
(in SI). To characterize the preferable binding modes, we have
calculated the distribution of distance (from the COM of GQ to COM of TPT) and angle
(between COM of GQ to COM of TPT vector and GQ axis) for TPT around GQ for 1:1
and 1:2 GQ/TPT systems as shown in
Fig. 8b
and
Fig. 8c
. There are two peaks for 1:1
GQ/TPT complex: the first at 15 Å distance and ~30˚ angle, which represents the terminal
bound state (
Fig. 8b
and
Fig. S5
) and the other at 14 Å distance and 40˚ angle, which is
also a terminal bound state but TPT is closer to the backbone of the terminal base pairs.
The most probable structures for 1:1 GQ/TPT complex are shown in
Fig. S5
. We have
obtained all possible terminal bound structures. Further, very less population around 90˚
Page 22 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
23
angle clearly indicates that TPT does not prefer to bind to the groove of GQ. However,
for 1:2 GQ/TPT complex, the distribution of distance and angle exhibit two maxima at a
distance of 13.8 Å and angle of 25˚ (indicating the terminal bound state), and at the
distance of 15.9 Å and angle of 79˚ representing the groove bound state (
Fig. 8c
and
Fig.
S5
). Two different binding modes in case of 1:2 GQ/TPT indicates that groove-binding is
the second preferable choice after the terminal position of the GQ is occupied by the first
TPT.
We have also analyzed the stabilities of 1:1 and 1:2 GQ/TPT systems in terms of
their root-mean-square deviation (RMSD) (
Fig. 8d
) of GQ from the crystal structure
geometry. Both systems show less change in RMSD (<5Å), indicating the stability of GQ
in presence of TPT. Further, for control, we have simulated the GQ in the absence of TPT
molecule. The higher RMSD (
Fig. 8d
) values of GQ in absence of TPT molecule
indicates that GQ is not stable in water in the absence of ions. Thus, these RMSD results
indicate that the binding of TPT to GQ is responsible for their GQ stability in absence of
any ion in solution. Overall, MD simulation studies show that the terminal and side
binding modes of TPT are responsible for the translocation of TPT to the nano-cavity of
molecular container due to their easy accessibility from the terminal position.
Since TPT did not unbind from the GQ either from the terminal bound state or
groove-bound state in 100 ns, the dissociation barrier of TPT from GQ must be high, and
computationally demanding using normal MD simulation. Therefore, we have performed
two independent well-tempered metadynamics simulations with different initial
conditions to calculate the free energy of binding of TPT to both the terminal and groove
of GQ using 1:1 GQ/TPT system.
Fig. S7
shows that two independent metadynamics
Page 23 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
24
simulations provide similar free energy profiles from both the terminal and groove-bound
systems. The initial and final representative structures of the metadynamics simulation for
both terminal and groove-bound state are shown in
Fig. S8
.
Fig. 8e
shows that binding
free energy to the terminal (~12kcal/mol) of GQ is 4 kcal/mol (with an error of ~1
kcal/mol) stronger than binding to the groove bound state (~8 kcal/mol). This observation
is consistent with the result of the normal MD simulation, where more often the TPT
molecule binds to the terminal than groove of GQ starting with the separated state for 1:1
GQ/TPT complex, and groove-bound state follows terminal bound state in case of 1:2
complex.
To analyze further the reason for the preference of TPT towards the terminal site
of GQ, we have calculated the total binding energy between the two species, which is
composed of both van der Waals (dispersion interaction) and electrostatic components.
Fig. 9
shows
Fig. 9
Interaction energy between TPT and GQ along unbinding pathways for terminal
(black) and groove-bound (red) states. (a) Total interaction energy between TPT and GQ
and its decomposition into (b) electrostatic energy (Coulomb interaction) and (c) van der
Waals components. The interaction energy is averaged over two metadynamics
simulations. Error bars are shown.
Page 24 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
25
the average total energy obtained from the two metadynamics simulation for both the
terminal and groove bound states for 1:1 complex and their decomposition into dispersive
and electrostatic interaction. We can see that for the terminal bound state (
Fig. 9b
) has
stronger dispersive interaction compared to the groove-bound state (
Fig. 9c
) which,
however, has a stronger electrostatic interaction than the terminal bound state (
Fig. 9b
).
Although both the states are stabilized by both van der Waals and electrostatic energy
components, the stabilization stemming from the dispersive interaction due to stacking of
TPT on GQ outweighs the electrostatic stabilization for the groove-bound state such that
the total energy is more favorable for the terminal bound state (
Fig. 9
).
Mechanism of conformational transitions can be explained with the help of MD
simulation studies. Here, in both terminal and groove bound states, the ammonium alkyl
(-N(CH
3
)
2
) and its adjacent hydroxyl group of TPT are projected out from the G-tetrad
rather than facing inwards (
Fig. S5
). In this scenario, the planar heteroaromatic moiety of
TPT provides the additional stabilization to the G-quartet through van der Waals
interaction, which has also been observed in MD simulation studies (
Fig. 9c
). During
reverse conformational transition (
GQ-DNA→H24
), electron dense carbonyl portals of
CB7 probably interacts with the positively charged ammonium alkyl group of TPT, which
leads to an inclusion complex formation resulting in the translocation of the drug from
GQ to CB7.
Conclusion:
Firstly, we have shown here that topotecan can induce the GQ formation and stabilization
even in the absence of Na
+
/K
+
ion. This conformational transition, i.e. H24→GQ-DNA,
Page 25 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
26
has been monitored through CD, NMR and melting studies. MD simulation studies show
that TPT preferably binds to the terminal of GQ, and the second preferable binding mode
is the groove of GQ. The more rigorous free energy calculation using well-tempered
metadynamics shows that binding to the terminal is 4 kcal/mol stronger than the free
energy of binding to the groove. Although both the electrostatic and van der Waals
interaction contribute to both these binding modes, the former is prevalent for the
terminal binding whereas the latter is stronger for the groove-binding. The overall total
energy is, however, more negative for the terminal binding mode.
Next, this topotecan mediated GQ formation and stabilization has been regulated
by incorporating a molecular container, cucurbit[7]uril (CB7) in the system by means of
forming an inclusion complex with the GQ stabilizer, i.e., topotecan. This reverse
conformational transition i.e., GQ-DNA→H24, has been again probed through the CD,
NMR and melting measurements. Moreover, both these conformational transitions
(H24→GQ-DNA and GQ-DNA→H24) can be easily monitored through fluorescence
emission color of TPT, which changes from green (H24-TPT system) to violet (H24-TPT-
CB7
system
). Ease of detection in this approach makes it more advantageous in
comparison to other methods, which is generally associated with sophisticated and
complex detection techniques hindering their usefulness for its real-time application.
Supporting Information
The Supporting Information is available free of charge on the RSC Publications website at
DOI:XXXX. It contains supporting figures and tables.
Page 26 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
27
Author Information
Corresponding Author
*Email : p.hazra@iiserpune.ac.in, arnab.mukherjee@iiserpune.ac.in
Orcid
Partha Hazra - 0000-0003-0422-1399
Notes
The authors declare no competing financial interest.
Acknowledgement
Authors thank IISER-Pune for providing excellent experimental facilities.
P. H. acknowledges
Science and Engineering Research Board (SERB), Government of India (EMR/2016/004787) for
partial financial supports. A. M. also acknowledges SERB (EMR/2016/001069) for partial
financial support for this work. R. K. S. thanks UGC for fellowship.
References
1. S. Balasubramanian, L. H. Hurley and S. Neidle, Nat Rev Drug Discov, 2011, 10, 261-
275.
2. A. M. Zahler, J. R. Williamson, T. R. Cech and D. M. Prescott, Nature, 1991, 350, 718-
720.
3. T.-m. Ou, Y.-j. Lu, J.-h. Tan, Z.-s. Huang, K.-Y. Wong and L.-q. Gu, ChemMedChem,
2008, 3, 690-713.
4. R. E. Verdun and J. Karlseder, Nature, 2007, 447, 924-931.
5. N. W. Kim, M. A. Piatyszek, K. R. Prowse, C. B. Harley, M. D. West, P. L. Ho, G. M.
Coviello, W. E. Wright, S. L. Weinrich and J. W. Shay, Science, 1994, 266, 2011-2015.
Page 27 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
28
6. J. L. Huppert, Chem. Soc. Rev., 2008, 37, 1375-1384.
7. G. N. Parkinson, M. P. H. Lee and S. Neidle, Nature, 2002, 417, 876-880.
8. A. M. Burger, F. Dai, C. M. Schultes, A. P. Reszka, M. J. Moore, J. A. Double and S.
Neidle, Cancer Res., 2005, 65, 1489-1496.
9. J. Mohanty, N. Barooah, V. Dhamodharan, S. Harikrishna, P. I. Pradeepkumar and A. C.
Bhasikuttan, J. Am. Chem. Soc., 2013, 135, 367-376.
10. R. Rodriguez, G. D. Pantoş, D. P. N. Gonçalves, J. K. M. Sanders and S.
Balasubramanian, Angew. Chem. Int. Ed., 2007, 46, 5405-5407.
11. D. J. M. Blanchard, K. L. Fadock, M. Sproviero, P. S. Deore, T. Z. Cservenyi, R. A.
Manderville, P. Sharma and S. D. Wetmore, J. Mater. Chem. C, 2016, 4, 2915-2924.
12. M. Sproviero, K. L. Fadock, A. A. Witham, R. A. Manderville, P. Sharma and S. D.
Wetmore, Chem. Sci., 2014, 5, 788-796.
13. K. L. Fadock and R. A. Manderville, ACS Omega, 2017, 2, 4955-4963.
14. R. A. Manderville and S. D. Wetmore, Chem. Sci., 2016, 7, 3482-3493.
15. O. Mendoza, A. Bourdoncle, J.-B. Boulé, R. M. Brosh and J.-L. Mergny, Nucleic Acids
Res., 2016, DOI: 10.1093/nar/gkw079.
16. K. Paeschke, M. L. Bochman, P. D. Garcia, P. Cejka, K. L. Friedman, S. C.
Kowalczykowski and V. A. Zakian, Nature, 2013, 497, 458-462.
17. Y. Wu, K. Shin-ya and R. M. Brosh, Mol. Cell. Biol., 2008, 28, 4116-4128.
18. S. Ogasawara and M. Maeda, Angew. Chem. Int. Ed., 2009, 48, 6671-6674.
19. D. Monchaud, P. Yang, L. Lacroix, M.-P. Teulade-Fichou and J.-L. Mergny, Angew.
Chem. Int. Ed., 2008, 47, 4858-4861.
Page 28 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
29
20. Y. Shi, H. Sun, J. Xiang, H. Chen, S. Zhang, A. Guan, Q. Li, S. Xu and Y. Tang, Chem.
Commun., 2016, 52, 7302-7305.
21. J.-L. Yao, X. Gao, W. Sun, X.-Z. Fan, S. Shi and T.-M. Yao, Inorg. Chem., 2012, 51,
12591-12593.
22. F. Li, Y. Xu, H. Li, C. Wang, A. Lu and S. Sun, New J. Chem., 2014, 38, 1396-1400.
23. P. Kundu, S. Ghosh, S. Das and N. Chattopadhyay, Phys. Chem. Chem. Phys., 2016, 18,
3685-3693.
24. D. V. Berdnikova, T. M. Aliyeu, T. Paululat, Y. V. Fedorov, O. A. Fedorova and H.
Ihmels, Chem. Commun., 2015, 51, 4906-4909.
25. X. Yang, D. He, J. Cao, X. He, K. Wang and Z. Zou, RSC Adv., 2015, 5, 84553-84559.
26. P. Galer, B. Wang, P. Šket and J. Plavec, Angew. Chem. Int. Ed., 2016, 55, 1993-1997.
27. C. Riccardi, I. Russo Krauss, D. Musumeci, F. Morvan, A. Meyer, J.-J. Vasseur, L.
Paduano and D. Montesarchio, ACS Appl. Mater. Interfaces, 2017, 9, 35574-35587.
28. D. M. Engelhard, R. Pievo and G. H. Clever, Angew. Chem. Int. Ed., 2013, 52, 12843-
12847.
29. T. Tian, Y. Song, L. Wei, J. Wang, B. Fu, Z. He, X.-R. Yang, F. Wu, G. Xu, S.-M. Liu,
C. Li, S. Wang and X. Zhou, Nucleic Acids Res., 2017, 45, 2283-2293.
30. D. Mirchandani, H. Hochster, A. Hamilton, L. Liebes, H. Yee, J. P. Curtin, S. Lee, J.
Sorich, C. Dellenbaugh and F. M. Muggia, Am. Assoc. Cancer Res., 2005, 11, 5912-
5919.
31. Y. Pommier, Nat. Rev. Cancer, 2006, 6, 789-802.
Page 29 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
30
32. C. Leonetti, M. Scarsella, G. Riggio, A. Rizzo, E. Salvati, M. Incalci, L. Staszewsky, R.
Frapolli, M. F. Stevens, A. Stoppacciaro, M. Mottolese, B. Antoniani, E. Gilson, G. Zupi
and A. Biroccio, Clin. Cancer Res., 2008, 14, 7284.
33. F. Li, J. Zhou, M. Xu and G. Yuan, Int. J. Biol. Macromol., 2017, DOI:
https://doi.org/10.1016/j.ijbiomac.2017.10.010.
34. K. Gavvala, A. Sengupta, R. K. Koninti and P. Hazra, ChemPhysChem, 2013, 14, 3375-
3383.
35. M. R. di Nunzio, Y. Wang and A. Douhal, J. Photochem. Photobiol., A: Chem, 2013,
266, 12-21.
36. R. K. Koninti, K. Gavvala, A. Sengupta and P. Hazra, J. Phys. Chem. B, 2015, 119, 2363-
2371.
37. H. Joshi, A. Sengupta, K. Gavvala and P. Hazra, RSC Adv., 2014, 4, 1015-1024.
38. S. A. Strel'tsov, A. L. Mikheikin, S. L. Grokhovsky, V. A. Oleinikov and A. L. Zhuze,
Mol. Biol., 2002, 36, 400-411.
39. S. Streltsov, V. Oleinikov, M. Ermishov, K. Mochalov, A. Sukhanova, Y. Nechipurenko,
S. Grokhovsky, A. Zhuze, M. Pluot and I. Nabiev, Biopolymers, 2003, 72, 442-454.
40. W. J. M. Underberg, R. M. J. Goossen, B. R. Smith and J. H. Beijnen, J. Pharm. Biomed.
Anal., 1990, 8, 681-683.
41. M. R. di Nunzio, Y. Wang and A. Douhal, J. Phys. Chem. B, 2012, 116, 7522-7530.
42. M. R. di Nunzio, Y. Wang and A. Douhal, J. Phys. Chem. B, 2012, 116, 8182-8190.
43. M. J. Frisch, G. W. Trucks, H. B. Schlegel, G. E. Scuseria, M. A. Robb, J. R. Cheeseman,
G. Scalmani, V. Barone, G. A. Petersson, H. Nakatsuji, X. Li, M. Caricato, A. V.
Marenich, J. Bloino, B. G. Janesko, R. Gomperts, B. Mennucci, H. P. Hratchian, J. V.
Page 30 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
31
Ortiz, A. F. Izmaylov, J. L. Sonnenberg, Williams, F. Ding, F. Lipparini, F. Egidi, J.
Goings, B. Peng, A. Petrone, T. Henderson, D. Ranasinghe, V. G. Zakrzewski, J. Gao, N.
Rega, G. Zheng, W. Liang, M. Hada, M. Ehara, K. Toyota, R. Fukuda, J. Hasegawa, M.
Ishida, T. Nakajima, Y. Honda, O. Kitao, H. Nakai, T. Vreven, K. Throssell, J. A.
Montgomery Jr., J. E. Peralta, F. Ogliaro, M. J. Bearpark, J. J. Heyd, E. N. Brothers, K.
N. Kudin, V. N. Staroverov, T. A. Keith, R. Kobayashi, J. Normand, K. Raghavachari, A.
P. Rendell, J. C. Burant, S. S. Iyengar, J. Tomasi, M. Cossi, J. M. Millam, M. Klene, C.
Adamo, R. Cammi, J. W. Ochterski, R. L. Martin, K. Morokuma, O. Farkas, J. B.
Foresman and D. J. Fox, Journal, 2016.
44. J. Wang, R. M. Wolf, J. W. Caldwell, P. A. Kollman and D. A. Case, J. Comput. Chem.,
2004, 25, 1157-1174.
45. D. A. Case, T. E. Cheatham, T. Darden, H. Gohlke, R. Luo, K. M. Merz, A. Onufriev, C.
Simmerling, B. Wang and R. J. Woods, J. Comput. Chem., 2005, 26, 1668-1688.
46. W. D. Cornell, P. Cieplak, C. I. Bayly and P. A. Kollmann, J. Am. Chem. Soc., 1993, 115,
9620-9631.
47. E. J. Sorin and V. S. Pande, Biophys. J., 2005, 88, 2472-2493.
48. K. N. Luu, A. T. Phan, V. Kuryavyi, L. Lacroix and D. J. Patel, J. Am. Chem. Soc., 2006,
128, 9963-9970.
49. B. Hess, C. Kutzner, D. van der Spoel and E. Lindahl, J. Chem. Theory Comput., 2008, 4,
435-447.
50. W. D. Cornell, P. Cieplak, C. I. Bayly, I. R. Gould, K. M. Merz, D. M. Ferguson, D. C.
Spellmeyer, T. Fox, J. W. Caldwell and P. A. Kollman, J. Am. Chem. Soc., 1995, 117,
5179-5197.
Page 31 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
32
51. W. H. T. Press, S. A.; Vetterling, W. T.; Flannery, B. P. , Numerical Recipes in
FORTRAN; The Art of Scientific Computing, Cambridge University Press, New York, 3rd
edition edn., 1992.
52. H. J. C. Berendsen, J. P. M. Postma, W. F. v. Gunsteren, A. DiNola and J. R. Haak, J.
Chem. Phys., 1984, 81, 3684-3690.
53. S. B. Dixit, D. L. Beveridge, D. A. Case, T. E. Cheatham, E. Giudice, F. Lankas, R.
Lavery, J. H. Maddocks, R. Osman, H. Sklenar, K. M. Thayer and P. Varnai, Biophys. J.,
2005, 89, 3721-3740.
54. B. Hess, H. Bekker, H. J. C. Berendsen and J. G. E. M. Fraaije, J. Comput. Chem., 1997,
18, 1463-1472.
55. T. Darden, D. York and L. Pedersen, J. Chem. Phys., 1993, 98, 10089-10092.
56. S. Nosé, Mol. Phys., 1984, 52, 255-268.
57. W. G. Hoover, Phys. Rev. A, 1985, 31, 1695-1697.
58. M. Parrinello and A. Rahman, J. Appl. Phys., 1981, 52, 7182-7190.
59. A. Barducci, G. Bussi and M. Parrinello, Phys. Rev. Lett., 2008, 100, 020603.
60. W. D. Sasikala and A. Mukherjee, J. Phys. Chem. B, 2012, 116, 12208-12212.
61. E. I. Cucolea, C. Tablet, H.-J. Buschmann and L. Mutihac, J. Inclusion Phenom.
Macrocyclic Chem., 2015, 83, 103-110.
62. Y. Huang, S.-F. Xue, Q.-J. Zhu and T. Zhu, Supramol. Chem., 2008, 20, 279-287.
63. N. S. Venkataramanan and A. Suvitha, J. Phys. Chem. B, 2017, 121, 4733-4744.
64. K. Hyz, R. Kawcki, E. Bednarek, W. Bocian, J. Sitkowski and L. Kozerski, Magn.
Reson. Chem., 2010, 48, 575-584.
Page 32 of 33Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
33
Table of Contents
G-quadruplex (GQ-DNA) formation has been controlled using a molecular container,
cucurbit[7]uril (CB7) by means of translocating a potential anticancer drug, topotecan from GQ-
DNA to CB7 nano-cavity. Interestingly, this whole cycle can be easily monitored through the
change in emission color of the stabilizing ligand, i.e., topotecan.
Page 33 of 33 Physical Chemistry Chemical Physics
Physical Chemistry Chemical Physics Accepted Manuscript
Published on 16 February 2018. Downloaded by Indian Institute of Science Education & Research Pune on 19/02/2018 06:08:29.
View Article Online
... On the other hand, topotecan cause unpleasant side effects, such as nausea, vomiting, and diarrhea (Topotecan -Chemotherapy Drugs -Chemocare, n.d.). Many studies have described strong G-quadruplex stabilization effects (Li et al., 2018;Satpathi et al., 2018), which might be one possible mode of action. Moreover, it has been proven that higher structures of nucleic acids, and G-quadruplex especially, might be stabilized by use of various natural substances. ...
Article
Full-text available
Non-canonical nucleic acid structures play important roles in the regulation of molecular processes. Considering the importance of the ongoing coronavirus crisis, we decided to evaluate genomes of all coronaviruses sequenced to date (stated more broadly, the order Nidovirales) to determine if they contain non-canonical nucleic acid structures. We discovered much evidence of putative G-quadruplex sites and even much more of inverted repeats (IRs) loci, which in fact are ubiquitous along the whole genomic sequence and indicate a possible mechanism for genomic RNA packaging. The most notable enrichment of IRs was found inside 5 ′ UTR for IRs of size 12+ nucleotides, and the most notable enrichment of putative quadruplex sites (PQSs) was located before 3 ′ UTR, inside 5 ′ UTR, and before mRNA. This indicates crucial regulatory roles for both IRs and PQSs. Moreover, we found multiple G-quadruplex binding motifs in human proteins having potential for binding of SARS-CoV-2 RNA. Non-canonical nucleic acids structures in Nidovirales and in novel SARS-CoV-2 are therefore promising druggable structures that can be targeted and utilized in the future.
... On the other hand, topotecan cause unpleasant side effects, such as nausea, vomiting, and diarrhea (Topotecan -Chemotherapy Drugs -Chemocare). Many studies have described strong G-quadruplex stabilization effects (Li et al., 2018;Satpathi et al., 2018), which might be one possible mode of action. ...
Preprint
Full-text available
Noncanonical nucleic acid structures play important roles in the regulation of molecular processes. Considering the importance of the ongoing coronavirus crisis, we decided to evaluate genomes of all coronaviruses sequenced to date (stated more broadly, the order Nidovirales) to determine if they contain noncanonical nucleic acid structures. We discovered much evidence of putative G-quadruplex sites and even much more of inverted repeats (IRs) loci, which in fact are ubiquitous along the whole genomic sequence and indicate a possible mechanism for genomic RNA packaging. The most notable enrichment of IRs was found inside 5′UTR for IRs of size 12+ nucleotides, and the most notable enrichment of putative quadruplex sites (PQSs) was located before 3′UTR, inside 5′UTR, and before mRNA. This indicates crucial regulatory roles for both IRs and PQSs. Moreover, we found multiple G-quadruplex binding motifs in human proteins having potential for binding of SARS-CoV-2 RNA. Noncanonical nucleic acids structures in Nidovirales and in novel SARS-CoV-2 are therefore promising druggable structures that can be targeted and utilized in the future.
Article
The stability of c-KIT G-quadruplex DNA by ligands has been a significant concern in the growing field of cancer therapy. Thus, it is very important to understand the mechanism behind the high binding affinity of the small drug molecules on the c-KIT G-quadruplex DNA. In this study, we have investigated the binding mode and pathway of APTO253 ligand on the c-KIT G-quadruplex DNA employing a total of 10 μs all atom molecular dynamics simulation and further 8.82 μs simulation via umbrella sampling method using both OL15 and BSC1 latest force fields for DNA structures. From the cluster structure analysis, mainly three binding pathways i.e., top, bottom and side loop stacking modes are identified. Moreover, RMSD, RMSF and 2D-RMSD values indicate that the c-KIT G-quadruplex DNA and APTO-253 molecules are stable throughout the simulation run. Furthermore, the number of hydrogen bonds of each tetrads and the distance between the two central K+ cations confirm that the c-KIT G-quadruplex DNA maintains its conformation in the process of complex formation with the APTO-253 ligand. The binding free energies and the minimum values in potential of mean forces suggest that the binding processes are energetically favorable. Further, we have found that the top stacking mode is the most favorable binding mode among all the three modes for OL15 force field. However, for BSC1 force field, both the top and bottom binding modes of APTO-253 ligand in c-KIT G-quadruplex DNA are comparable to each other. To investigate the driving force for the complex formation, we have noticed that the van der Waals (vdW) and π-π stacking interactions are mainly responsible. Our detailed studies provide the useful information for the discovery of the new drugs in field of stabilization of the G-quadruplex DNAs.
Article
Full-text available
During the past ten years, the importance of cucurbiturils (CB[n]) as macrocyclic hosts in supramolecular assemblies with various types of natural and synthetic nucleic acids (NAs) has increased explosively. As a component of such systems, CB[n] macrocycles can play a wide spectrum of roles from drug and gene delivery vehicles to catalysts/inhibitors of biochemical reactions and even building blocks for NA-based materials. The aim of this highlight article is to describe the development of the CB[n] applications in nucleic acids research and to outline the current situation and perspectives of this fascinating synergistic combination of supramolecular chemistry of CB[n] and NAs.
Article
Relative to the individual intensity-dependent strategy, multicolor fluorescence sensor is promising to achieve a high signaling contrast. In this work, we develop a cucurbituril-based supramolecular and multicolor DNA recognition rationale via indicator competition assay (ICA). Alkaloids of coptisine (COP) and palmatine (PAL) are identified as the proof-of-principle indicators with a lighting-up fluorescence upon supramolecular complexation to cucurbit[7]uril (CB[7]). With an introduced abasic site (AP site) as the contestant, DNAs having pyrimidines opposite this site can compete COP from CB[7] to bring an emission color change from green to yellow brown, while those having purines opposite the AP site don’t compete COP still with the green emission, indicative of a high selectivity for the multicolor nucleotide transversion recognition. However, because of the relative weaker binding of PAL with CB[7], the AP site-containing DNA can take away PAL from its CB[7] complex and resultantly bring a blue-to-green emission color change independent of the AP site-opposite nucleotide identity, dissimilar to the remained blue color for the fully matched DNA without the AP site, suggesting a preferable strategy for the AP site biomarker detection. Our method demonstrates a new way to develop an ICA-based multicolor DNA sensor with the supramolecular cucurbituril complexation to ensure a highly selective performance.
Article
Full-text available
Progress in understanding and treatment of thrombotic diseases requires new effective methods for the easy, rapid and reversible control of coagulation processes. In this frame, the use of aptamers, and particularly of the thrombin binding aptamer (TBA), has aroused a strong interest, due to its enormous therapeutic potential, associated with a large number of possible applications in biotechnological and bioanalytical fields. Here, we describe a new TBA analogue (named tris-mTBA), carrying three different pendant groups: a dansyl residue at the 3’- and a β-cyclodextrin moiety at the 5’-end – providing a host-guest system which exhibits a marked fluorescence enhancement upon TBA G-quadruplex folding – and a biotin tag, allowing the attachment of the aptamer onto biocompatible streptavidin-coated silica nanoparticles (NPs) of 50 nm hydrodynamic diameter (Sicastar®). The use of nanoparticles for the in vivo delivery of TBA, expected to induce per se increased nuclease resistance and improved pharmacokinetic properties of this oligonucleotide, offers as additional advantage the possibility to exploit multivalency effects, due to the presence of multiple copies of TBA on a single scaffold. In addition, the selected fluorescent system allows monitoring both the presence of TBA on the functionalized NPs and its correct folding upon immobilization, also conferring enhanced enzymatic resistance and bioactivity. The anticoagulant activity of the new tris-mTBA, free or conjugated to Sicastar® NPs, was evaluated by dynamic light scattering experiments. Highly effective and reversible inhibition of thrombin activity toward fibrinogen was found for the free tris-mTBA and especially for the tris-mTBA-conjugated NPs, demonstrating great potential for the biomedical control of blood clotting.
Article
Full-text available
DNA aptamers are single-stranded oligonucleotides that are generated by an in vitro selection method to bind targets with high affinity and specificity. Understanding molecular recognition by DNA aptamers is of fundamental importance in the development of biosensor applications. The small molecule ochratoxin A (OTA) is a fungal-derived food toxin, and OTA DNA aptamers have been established for the development of rapid detection platforms required for food safety. One such OTA aptamer (OTAA) is a guanine-rich DNA oligonucleotide that folds into an antiparallel G-quadruplex (GQ) upon OTA binding, although structural details of the GQ fold and its interaction with OTA are currently unknown. In the present study, the fluorescent nucleobase analogue, 8-thienyl-2′-deoxyguanosine (ThdG), was inserted into various G sites of OTAA to determine the probe impact on GQ folding and OTA binding affinity. Our results suggest that OTAA contains three lateral (l) loops connecting two stacked G-tetrads with an anticlockwise loop progression to afford a −(lll) GQ topology. The phenolic ring system of OTA undergoes π-stacking interactions with the G-tetrads of OTAA. Our results also demonstrate aptamer sites that can be modified with ThdG to afford a fluorescent light-up signal upon OTA binding.
Article
Full-text available
Aryl radical species derived from enzymatic transformations of aromatic mutagens preferentially react at the 8-site of the guanine (G) nucleobase to afford carbon-linked 8arylG adducts. The resulting lesions possess altered biophysical and genetic coding properties compared to the precursor G nucleoside in B-form DNA. Unlike other adducts, these lesions also possess useful fluorescent properties, since direct attachment of the 8aryl ring extends the purine π-system to afford G mimics with red-shifted excitation maxima and emission that can be sensitive to the microenvironment of the 8arylG base within nucleic acid structures. In B-form DNA, 8arylG adducts are disruptive to duplex formation because they prefer to adopt the syn-conformation about the bond connecting the nucleobase to the deoxyribose backbone, which perturbs Watson–Crick (WC) H-bonding with the opposing cytosine (C). Thus, in a B-form duplex, the emissive properties of 8arylG adducts can be employed as a tool to provide insight into adduct conformation, which can be related to their biological outcomes. However, since Gs preferentially adopt the syn-conformation in left-handed Z-DNA and antiparallel G-quadruplex (GQ) structures, 8arylG lesions can be inserted into syn-G positions without disrupting H-bonding interactions. In fact, 8arylG lesions can serve as ideal fluorescent probes in an antiparallel GQ because their emission is sensitive to GQ folding. This perspective outlines recent developments in the biological implications of 8arylG formation together with their utility as fluorescent G analogs for use in DNA-based diagnostic systems.
Article
Full-text available
Guanine-rich DNA strands can fold in vitro into non-canonical DNA structures called G-quadruplexes. These structures may be very stable under physiological conditions. Evidence suggests that G-quadruplex structures may act as ‘knots’ within genomic DNA, and it has been hypothesized that proteins may have evolved to remove these structures. The first indication of how G-quadruplex structures could be unfolded enzymatically came in the late 1990s with reports that some well-known duplex DNA helicases resolved these structures in vitro. Since then, the number of studies reporting G-quadruplex DNA unfolding by helicase enzymes has rapidly increased. The present review aims to present a general overview of the helicase/G-quadruplex field.
Article
Full-text available
Nose has modified Newtonian dynamics so as to reproduce both the canonical and the isothermal-isobaric probability densities in the phase space of an N-body system. He did this by scaling time (with s) and distance (with V¹D/ in D dimensions) through Lagrangian equations of motion. The dynamical equations describe the evolution of these two scaling variables and their two conjugate momenta p/sub s/ and p/sub v/. Here we develop a slightly different set of equations, free of time scaling. We find the dynamical steady-state probability density in an extended phase space with variables x, p/sub x/, V, epsilon-dot, and zeta, where the x are reduced distances and the two variables epsilon-dot and zeta act as thermodynamic friction coefficients. We find that these friction coefficients have Gaussian distributions. From the distributions the extent of small-system non-Newtonian behavior can be estimated. We illustrate the dynamical equations by considering their application to the simplest possible case, a one-dimensional classical harmonic oscillator.
Article
Our bioinformatics research showed that there are four G-rich sequences (S1-S4) in the upstream region of the transcription start site of c-Myb gene, and we have proved that these sequences have the ability to form G-quadruplex structures. This work mainly focuses on G-quadruplex function, recognition and transcription regulation in c-Myb gene, revealing a novel regulatory element in c-Myb proximal promoter region, and its transcription regulation by G-quadruplex binder. The research have identified that the enhancer effect in c-Myb transcription was primarily affected by the G-quadruplex formed by S1 sequence, and the up-regulation effect may due to the removal of repressive progress of MZF-1 by stabilizing G-quadruplex. Attentions are being paid to the development of G-quadruplex binders for selective recognition, and topotecan was found to have high binding affinity in vitro and could effectively affect the c-Myb transcription activities in cells. The regulation of G-quadruplex with binders in transcriptional, translational levels by Q-RT-PCR and western blot is in expectation of providing a strategy for gene expression modulation. In conclusion, our study revealed a G-quadruplex structure in c-Myb proximal promoter region, which is of great importance in the regulation of c-Myb function.
Article
The encapsulation of nucleobases, inside CB7 has gained prominence due to its use as anticancer and antiviral drugs. With this respect, the nonconvalent interactions exists in the nucleobases encapsulated inside the CB7 cavity have been analyzed employing the dispersion corrected density functional theory. The CBn cavity has the ability to encapsulate two guest nucleobases molecules, when they are aligned in parallel configuration. The computed association energy using the two and three body correction method computed at B3LYP-D3 level is close to the experimental estimate. The use of dispersion corrected DF’s are essential to identify the correct binding energies. The solvation energy plays a vital role in the estimation of association energy. QTAIM analysis shows that the Laplacian of the charge density, are negative and the presence of covalent interaction between the guest and host molecule. The NCI-RDG isosurface shows the presence of non-covalent intermolecular interactions such as van der Waal
Article
Multiple cycle regulation of the supramolecular chirality of a cyanine dye has been successfully achieved by using DNA G-quadruplexes as the template, which is easily controllable by repeated addition of Ag+ and cysteine (Cys). This work provides an easy and controllable strategy for the chiral regulation of supramolecules.
Article
In this article, we have addressed to a demanding physicochemical aspect of therapeutic and drug research. We have reported a simple yet prospective technique that can be exploited for the controlled delivery of drugs and/or bioactive small molecules to the most relevant biomolecular target DNA. Exploiting various steady state and time resolved spectroscopic techniques together with the DNA helix melting study, we have shown that a biologically significant photosensitizer, namely, phenosafranin (PSF), can be quantitatively transferred to the DNA from the micellar nanocarrier made up of sodium tetradecyl sulfate (STS) using the external stimulant β-cyclodextrin (β-CD). The complexation property of β-CD with the nanocarrier (STS) has been utilized for the controlled release of the probe from the micelle to the DNA. Non-toxicity of the stimulant and the noninvasive nature of the carrier towards the target are expected to add to the suitability of this approach from a clinical perspective.