ArticlePDF Available

Minoxidil Acts as an Antiandrogen: A Study of 5α-reductase Type 2 Gene Expression in a Human Keratinocyte Cell Line

Authors:

Abstract and Figures

Although more than three decades have passed since the first use of minoxidil in androgenetic alopecia (AGA), its mechanisms of action have still not been comprehensively understood. 5α-reductase (5α-R) has an active role as the predominant enzyme in both AGA and female pattern hair loss (FPHL), which are also the main therapeutic indications of topical minoxidil. But there is insufficient literature data regarding the interaction of minoxidil and the enzyme 5α-R. Herein, we studied the in vitro expression levels of 5α-R type 2 (5α-R2) in a minoxidiltreated human keratinocyte cell line (HaCaT) in order to elucidate the relation of these two parameters. Cell proliferation assay was performed by a XTT reagent (a yellow tetrazolium salt). After determination of non-cytotoxic concentration, HaCaT cells were treated with minoxidil. Ribonucleic acid (RNA) isolations were carried out from both non-treated and treated cell groups using a TRI reagent (an RNA, DNA, and protein isolation reagent). Gene expressions of 5α-R2 as study material and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the control were determined by real time-quantitative polymerase chain reaction (RT-qPCR) analysis. Results were represented as 5α-R2/GAPDH fold change. Minoxidil treatment resulted in a 0.22 fold change for 5α-R2 (p < 0.0001). This antiandrogenic effect of minoxidil, shown by significant downregulation of 5α-R2 gene expression in HaCaT cells, may be one of its mechanisms of action in alopecia. © 2017, Croatian Dermatovenerological Society. All rights reserved.
Content may be subject to copyright.
ACTA DERMATOVENEROLOGICA CROATICA
Minoxidil Acts as an Antiandrogen: A Study of
5α-reductase Type 2 Gene Expression in a Human
Keratinocyte Cell Line
Acta Dermatovenerol Croat 2017;25(4):271-275 ORIGINAL SCIENTIFIC ARTICLE
271
Corresponding author:
Erkin Pekmezci, MD
Gozde Hastanesi
Inonu Cd. No 145
44100 Malatya
Turkey
erkinpekmezci@gmail.com
Received: April 12, 2016
Accepted: November 4, 2017
ABSTRACT Although more than three decades have passed since the rst use
of minoxidil in androgenetic alopecia (AGA), its mechanisms of action have
still not been comprehensively understood. 5α-reductase (5α-R) has an ac-
tive role as the predominant enzyme in both AGA and female pattern hair loss
(FPHL), which are also the main therapeutic indications of topical minoxidil.
But there is insucient literature data regarding the interaction of minoxidil
and the enzyme 5α-R. Herein, we studied the in vitro expression levels of 5α-R
type 2 (5α-R2) in a minoxidil-treated human keratinocyte cell line (HaCaT) in
order to elucidate the relation of these two parameters. Cell proliferation assay
was performed by a XTT reagent (a yellow tetrazolium salt). After determina-
tion of non-cytotoxic concentration, HaCaT cells were treated with minoxidil.
Ribonucleic acid (RNA) isolations were carried out from both non-treated and
treated cell groups using a TRI reagent (an RNA, DNA, and protein isolation
reagent). Gene expressions of 5α-R2 as study material and glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) as the control were determined by real
time-quantitative polymerase chain reaction (RT-qPCR) analysis. Results were
represented as 5α-R2 / GAPDH fold change. Minoxidil treatment resulted in a
0.22 fold change for 5α-R2 (p < 0.0001). This antiandrogenic eect of minoxidil,
shown by signicant downregulation of 5α-R2 gene expression in HaCaT cells,
may be one of its mechanisms of action in alopecia.
KEY WORDS: minoxidil, 5α-R, mechanism of action
Erkin Pekmezci1, Murat Türkoğlu2
1Gozde Group Hospitals, Dermatology Department, Malatya, Turkey; 2Biota
Laboratories, Istanbul, Turkey
INTRODUCTION
Oral minoxidil has been used to treat hypertension
since 1960s. Hypertrichosis as a consequence of min-
oxidil treatment was observed shortly thereafter, and
these observations led to the development of topical
minoxidil as a treatment for hair loss. Although it is
being used for the treatment of male androgenetic
alopecia (AGA) and female pattern hair loss (FPHL) for
approximately three decades, but our understanding
of its mechanisms of action on the hair follicle is still
very limited (1,2). Due to the blood pressure lower-
ing eect of oral minoxidil through relaxing the vas-
cular smooth muscle by the action of its sulphated
metabolite, as an opener of sarcolemmal adenosine
triphosphate sensitive potassium channels (KATP ), it is
postulated that its stimulatory eect on hair growth
is also related with the opening of potassium chan-
nels (1,3,4). Cutaneous blood ow was observed to
increase 10-15 minutes after the application of topi-
cal minoxidil (5). A number of in vitro eects of min-
oxidil have been described in monocultures of vari-
ous skin and hair follicle cell types including stimu-
lation of cell proliferation, slowing the senescence of
272 ACTA DERMATOVENEROLOGICA CROATICA
keratinocytes, inhibition of collagen synthesis, stimu-
lation of vascular endothelial growth factor (VEGF),
and prostaglandin synthesis (1,6-8). Some or all of
these eects may be relevant to hair growth, but the
application of results obtained in cell culture studies
to the complex biology of the hair follicle is uncertain
(1).
Although polygenic heredity is assumed to be
the primary cause, androgens play an important
role in both AGA and FPHL, seemingly independent
of genetic predisposition (9). Androgen-dependent
processes are predominantly due to the binding of
dihydrotestoerone (DHT) to the androgen receptor
(AR). The predisposed scalp exhibits high levels of
DHT and increased expression of AR. DHT-related cell
functions depend on the availability of weak andro-
gens, i.e. their conversion to more potent androgens
via the action of 5α-reductase (5α-R), low enzymatic
activity of androgen inactivating enzymes, and func-
tionally active ARs present in high numbers (10).
Although 5α-R has an active role as the predomi-
nant enzyme in both AGA and FPHL, which are also
the main therapeutic indications of topical minoxidil,
there is insucient literature data about the interac-
tion of the two. Herein, we studied in vitro expression
levels of 5α-R type 2 (5α-R2) in a minoxidil-treated hu-
man keratinocyte cell line (HaCaT) in order to eluci-
date the relation of these two parameters.
PATIENTS AND METHODS
Cell Culture
HaCaT was cultured in Dulbecco’s Modied Eagle’s
medium with high glucose, supplemented with 10%
heat-inactivated fetal bovine serum and 100 U/mL
gentamicin. The cells were maintained at 37°C in a
humidied atmosphere at 5% CO2 in a Newbruns-
wick incubator. All supplements and media were pur-
chased from Sigma Aldrich.
Preparation of Minoxidil Solution
We dissolved 522.5 mg minoxidil in 25 mL distilled
water – 25 mL ethanol mixture to get a 5 mM minoxi-
dil solution. This solution was used as a 100% sample,
and other concentrations (10.0%, 5.0%, 3.0%, 1.0%,
and 0.2%) of the solution were prepared by dilution
with distilled water.
Cell Proliferation Assay
HaCaT cells were seeded into 96-well plates (1×104
cells/well) and were subjected to dierent concentra-
tions of minoxidil solution to assess the cell prolifera-
tion. An XTT reagent (a yellow tetrazolium salt), was
added to the plates after a 72-hour incubation period
according to the manufacturer’s (Roche) instructions.
Cells were then incubated at 37oC for 4 hours in or-
der to reduce the XTT reagent to an orange formazan
compound. The optical density of the soluble forma-
zan compound was measured at 495 nm by a micro-
plate reader (Bio-Rad).
Ribonucleic Acid (RNA) Isolation and Re-
verse Transcription
Total RNA was extracted from cells treated with
minoxidil solution and from untreated cells using a TRI
reagent (an RNA, DNA, and protein isolation reagent),
according to the manufacturer’s (Sigma Aldrich) in-
structions. The concentration and purity of isolated
RNA samples were determined by measuring opti-
cal densities at 260 nm and 280 nm using BioSpec-
nano. The Transcriptor First Strand cDNA Synthesis Kit
(Roche) was used for reverse transcription. Comple-
mentary deoxyribonucleic acid (cDNA) synthesis was
performed with 500 ng total RNA; 2 µM of each nal
concentration of gene-specic primers of 5α-R2 as
study material and glyceraldehyde-3-phosphate de-
hydrogenase (GAPDH) as the control (Integrated DNA
Technologies); 10 U of Transcriptor Reverse Transcrip-
tase; 20 U of Protector RNase Inhibitor; 1 mM each
of dNTP mix and Transcriptor Reverse Transcription
Buer (5X) according to the manufacturers (Roche)
instructions. Primer sequences (5 ‘ – 3’) are presented
in Table 1.
Real-Time Quantitative Polymerase Chain
Reaction (RT-qPCR)
RT-qPCR was carried out in Light Cycler 96 (Roche).
Amplication of products was detected via interca-
lation of the SYBR green uorescent dye (Fast Start
DNA Green Master Kit, Roche). Briey, total volume of
reaction mix was 20 µL; containing 10 µL SYBR Green
Master Mix (×2), 0.5 µM of reverse and forward prim-
ers, 2.5 ng cDNA, and the appropriate amount of nu-
clease free water. All samples were run as triplicates in
Table 1. Primers (5’ – 3’) of the genes studied
Primers Forward primer Reverse primer
5α-R2 CGCTCTACCAGTACGCCAG AATTAAGCACCGATGCCCGT
GAPDH ATGGGTGTGAACCATGAGAA GTGCTAAGCAGTTGGTGGTG
5α-R2: 5α-reductase; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase used as control
Pekmezci and Turkoglu Acta Dermatovenerol Croat
Minoxidil acts as an antiandrogen 2017;25(4):271-275
ACTA DERMATOVENEROLOGICA CROATICA 273
each run, including a non-template control and four
standards (1:1, 1:10, 1:100, 1:1000). The RT-qPCR pa-
rameters were determined separately for each target
according to melting and annealing temperatures of
primers. Each parameter included a pre-incubation
step for 10 min at 95°C and followed by 45 cycles of
three amplication and melting steps. Melting curve
analysis was performed to verify specicity. For quan-
titation of RT-qPCR results, the Ct method was
used (2-Ct).
Statistical Analysis
All data are representative of three repetitions
(n=3) and expressed as mean ± standard error of the
means (SEM). Statistical evaluation was performed by
an unpaired t-test, using Graph Pad Prism 5 Software
(USA); results with a P value less than 0.05 were ac-
cepted as signicant.
RESULTS
Cytotoxicity Analysis (Cell Proliferation
Assay)
Based on cell proliferation ratios of treated cells
with respect to the control cells, cytotoxicity levels
of the minoxidil solution were determined. Higher
concentrations were found to be cytotoxic for HaCaT
cells. For the subsequent analysis, the possible high-
est concentration was determined as 1%, and HaCaT
cells were incubated with 1% concentration of min-
oxidil solution before total RNA isolation (Figure 1).
Gene Expression Analysis (RT-qPCR)
Results were represented as Target / GAPDH Fold
Change. Results of gene expression analysis via RT-
qPCR showed that minoxidil solution caused sta-
tistically signicant downregulation of 5α-R2 gene
expressions, compared with untreated control cells.
Minoxidil treatment resulted in 0.22 fold changes
(P<0.0001) for 5α-R2 (Figure 2).
DISCUSSION
The pilosebaceous unit is the site of numerous cell
interactions, and although the histology and struc-
ture of the follicle is well-known today, the molecular
events controlling the hair cycle remain obscure. The
development of in vitro and in vivo models, however,
have provided some insights on the role of growth
factors such as insulin like growth factor-1 (IGF-1),
transforming growth factor-α (TGF-α), and VEGF, as
well as androgens such as DHT and cytokines such as
interleukin-1 (IL-1) (7,11).
Although the basic etiopathogenesis is not thor-
oughly understood, besides the aspect of genetic
predisposition, the role of androgens in AGA is well
established (2,10,12,13). The concentrations of DHT,
5α-R, and ARs are increased in a balding scalp. The
higher the concentration of androgens and ARs, the
greater the eect on the expression of genes which
control follicular cycling (14). The nding indicate
Xq12, the X chromosome region which encodes the
AR, may represent a common genetic factor under-
lying both AGA and FPHL (15-18). Although the X
chromosomal location of the AR gene indicates that
the maternal line is the major inheritance of AGA in
men, family studies showing resemblance of hair loss
between fathers and sons suggest that some autoso-
mal genes might also contribute to the phenotype
(2,16,19). In a study on the identication of new sus-
ceptibility genes, strong evidence was found for an
alopecia susceptibility locus on chromosome 3q26
(19). In another study, signicant association was
found with AGA on chromosome 20p11, suggesting
that the 20p11 locus has a role in a yet-to-be-identi-
ed androgen independent pathway (20). It was later
reported that although this locus is responsible from
AGA, it has no association with FPHL (17,18).
On the other hand, contradicting results have
been reported on the interaction of minoxidil and
Figure 1. Cytotoxicity analysis result of minoxidil solution.
The dashed bar represents the concentration chosen for
incubation. Figure 2. Gene expression level of 5α-reductase type 2 af-
ter minoxidil treatment, compared with untreated control
cells
Pekmezci and Turkoglu Acta Dermatovenerol Croat
Minoxidil acts as an antiandrogen 2017;25(4):271-275
274 ACTA DERMATOVENEROLOGICA CROATICA
its androgen-dependent mechanisms of action: In
a study on the eect of minoxidil on testosterone
metabolism through cultured dermal papilla cells of
balding or non-balding scalp and dermal broblasts,
5α-R activity was slightly increased in dermal papilla
cells of a balding scalp, while there was no increase in
other groups of cells. In the same study, the increase
of 17β-hydroxysteroid dehydrogenase activity was
much higher with minoxidil in dermal papilla cells of
a balding scalp (21). In another study, minoxidil was
found to be a weak inhibitor of human hair follicle 5α-
R (22). Although one study found no antiandrogenic
potential of minoxidil on androgen-dependent cuta-
neous structures in an animal model (23), it was con-
tradicted by another group because female animals
were used in the trial, and testosterone which can
be converted to estradiol in hair follicles, rather than
DHT, was chosen. The later study analyzing the anti-
androgenic potential of minoxidil claimed that min-
oxidil suppresses AR-related functions by decreasing
AR transcriptional activity and reducing the expres-
sion of AR targets at the protein level (24).
The signicant suppression of 5α-R2 in HaCaT cells
by minoxidil in our study, although not at the recep-
tor level, supports the thesis of minoxidil’s antiandro-
genic mechanism of action. This thesis, together with
the literature data on the X chromosome-linked AR
pathway and the autosomal chromosome-linked an-
drogen independent pathway in the etiopathogen-
esis of alopecia, it may provide a better explanation
of why some patients do not respond well to minoxi-
dil therapy. Although further studies are needed, this
thesis may also allow the exclusion of poor respond-
ers to minoxidil therapy and avoid waste of time in
clinical practice by identifying probable androgen-in-
dependent alopecia patients to some extent.
CONCLUSION
The antiandrogenic eect of minoxidil, demon-
strated by signicant downregulation of 5α-R2 gene
expression in HaCaT cells in our study, may be one
of its mechanisms of action in AGA and FPHL, which
is not being emphasized well in the dermatology
literature.
References:
1. Messenger AG, Rundegren J. Minoxidil: mecha-
nism of action on hair growth. Br J Dermatol.
2004;150:186-94.
2. Rathnayake D, Sinclair R. Male androgenetic alo-
pecia. Expert Opin Pharmacother. 2010;11:1295-
304.
3. Buhl AE, Waldon DJ, Conrad SJ, Mulholland MJ,
Shull KL, Kubicek MF, et al. Potassium channel
conductance: a mechanism aecting hair growth
both in vitro and in vivo. J Invest Dermatol.
1992;98:315-9.
4. Buhl AE, Conrad SJ, Waldon DJ, Brunden MN.
Potassium channel conductance as a control
mechanism in hair follicles. J Invest Dermatol.
1993;101:148-52.
5. Wester RC, Maibach HI, Guy RH, Nowak E. Minoxi-
dil stimulates cutaneous blood ow in human
balding scalp: pharmacodynamics measured by
laser doppler velocimetry and photopulse plet-
hysmography. J Invest Dermatol. 1984;82:515-7.
6. Cohen RL, Alves ME, Weiss VC, West DP, Chambers
DA. Direct eects of minoxidil on epidermal cells
in culture. J Invest Dermatol. 1984;82:90-3.
7. Lachgar S, Charveron M, Gall Y, Bonafe JL. Minoxi-
dil upregulates the expression of vascular en-
dothelial growth factor in human hair dermal pa-
pilla cells. Br J Dermatol. 1998;138:407-11.
8. Baden HP, Kubilus J. Eect of minoxidil on cultu-
red keratinocytes. J Invest Dermatol. 1983;81:558-
60.
9. Bienova M, Kucerova R, Fiuraskova M, Hajduch
M, Kolar Z. Androgenetic alopecia and current
methods of treatment. Acta Dermatoven APA.
2005;14:5-8.
10. Trüeb RM. Molecular mechanisms of androgene-
tic alopecia. Exp Gerontol. 2002;37:981-90.
11. Bernard BA. Molecular approach of hair biology. C
R Seances Soc Biol Fil. 1994;188:223-33.
12. Tazi-Ahnini R, McDonagh AJ, Cox A, Messenger
AG, Britton JE, Ward SJ, et al. Association analysis
of IL-1α and IL-1β variants in alopecia areata. He-
redity. 2001;87:215-9.
13. Ellis JA, Sinclair R, Harrap SB. Androgenetic alope-
cia: pathogenesis and potential for therapy. Ex-
pert Rev Molec Med. 2002;4:1-11.
14. Kaliyadan F, Nambiar A, Vijayaraghavan S. Andro-
genetic alopecia: an update. Indian J Dermatol
Venereol Leprol. 2013;79:613-25.
15. Brown CJ, Goss SJ, Lubahn DB, Joseph DR, Wilson
EM, French FS, et al. Androgen receptor locus on
the human X chromosome: regional localization
to Xq11-12 and description of a DNA polymorp-
hism. Am J Hum Genet. 1989;44:264-9.
16. Hillmer AM, Hanneken S, Ritzmann S, Becker
T, Freudenberg J, Brockschmidt FF, et al. Gene-
tic variation in the human androgen receptor
gene is the major determinant of common early
Pekmezci and Turkoglu Acta Dermatovenerol Croat
Minoxidil acts as an antiandrogen 2017;25(4):271-275
ACTA DERMATOVENEROLOGICA CROATICA
onset androgenetic alopecia. Am J Hum Genet.
2005;77:140-8.
17. Redler S, Brockschmidt FF, Tazi-Ahnini R, Drichel D,
Birch MP, Dobson K, et al. Investigation of the male
pattern baldness major genetic susceptibility loci
AR/EDA2R and 20p11 in female pattern hair loss.
Br J Dermatol. 2012;166:1314-8.
18. Nuwaihyd R, Redler S, Heilmann S, Drichel D, Wolf
S, Birch P, et al. Investigation of four novel male an-
drogenetic alopecia susceptibility loci: no associ-
ation with female pattern hair loss. Arch Dermatol
Res. 2014;306:413-8.
19. Hillmer AM, Flaquer A, Hanneken S, Eigelshoven S,
Kortüm AK, Brockschmidt FF, et al. Genome-wide
scan and ne-mapping linkage study of andro-
genetic alopecia reveals a locus on chromosome
3q26. Am J Hum Genet. 2008;82:737-43.
20. Hillmer AM, Brockschmidt FF, Hanneken S, Eigels-
hoven S, Steens M, Flaquer A, et al. Susceptibility
variants for male pattern baldness on chromoso-
me 20p11. Nat Genet. 2008;40:1279-81.
21. Sato T, Tadokoro T, Sonoda T, Asada Y, Itami S,
Takayasu S. Minoxidil increases 17 beta-hydroxis-
teroid dehydrogenase and 5 alpha-reductase ac-
tivity of cultured human dermal papilla cells from
balding scalp. J Dermatol Sci. 1999;19:123-5.
22. Mellin TN, Busch RD, Rasmusson GH. Azasteroids
as inhibitors of testosteron 5 alpha-reductase
in mammalian skin. J Steroid Biochem Mol Biol.
1993;44:121-31.
23. Nuck BA, Fogelson SL, Lucky AW. Topical minoxidil
does not act as an antiandrogen in the ank or-
gan of the golden syrian hamster. Arch Dermatol.
1987;123:59-61.
24. Hsu CL, Liu JS, Lin AC, Yang CH, Chung WH, Wu
WG. Minoxidil may suppress androgen receptor
related functions. Oncotarget. 2014;5:2187-97.
275
Pekmezci and Turkoglu Acta Dermatovenerol Croat
Minoxidil acts as an antiandrogen 2017;25(4):271-275
... Considering the pathogenesis of AGA, OM might be an important mediator for clinical improvement, as shorten of telogen phase and prolongation of anagen phase is a proposed mechanism of action that counteracts the observed hair growth changes occurring in this disorder. In addition, a recent study showed in a cell model experiment that minoxidil caused a significant downregulation of 5α-reductase type 2 gene expressions (−0.22 fold change), compared with untreated control cells, [42] potentially suggesting an addition mechanism of action in AGA. Similarly, taking into account the pathophysiology of alopecia areata (inflammation and hair cycle changes), OM is likely to have a direct influence in the natural course of the disorder. ...
Article
Patients with major presentations of alopecia experience physically harmful effects and psychological comorbidities, such as depression and anxiety. Oral minoxidil (OM) has been suggested by dermatologists as a potential remedy; however, its effectiveness remains unclear. This systematic review aims to collate published studies and to analyze the effect of OM among patients diagnosed with any type of alopecia. For this systematic review, Medline/PubMed, Cochrane Central, EMBASE, Web of Sciences, and Latin American and Caribbean Health Sciences Information System were searched for relevant studies from inception to September 21, 2019. Of 1960 studies retrieved in several electronic databases and three additional records identified though reference list from potentially eligible studies, nine studies (one randomized controlled trial and eight nonrandomized controlled trials) met the requirements and were used in our analysis. Although we found positive effects in favor of OM, this should be interpreted cautiously due to very low quality of the evidence of outcomes in the selected studies. Definitive conclusions are not possible without high‑quality trials. This review has highlighted the absence of high‑quality randomized controlled trials evaluating OM in the treatment of various types of alopecia. Given the mild adverse events of OM, future studies should also analyze doses and duration to maximize efficacy and decrease side effects.
Article
Topical minoxidil (5% foam, 5% solution, 2% solution) is FDA-approved for androgenetic alopecia (AGA) in men and women. Mechanism of action: Minoxidil acts through multiple pathways (vasodilator, anti-inflammatory agent, inducer of the Wnt/β-catenin signaling pathway, an antiandrogen), and may also affect the length of the anagen and telogen phases. Pharmacokinetics: Approximately 1.4% of topical minoxidil is absorbed through the skin. Minoxidil is a prodrug which is metabolized by follicular sulfotransferase to minoxidil sulfate (active form). Those with higher sulfotransferase activity may respond better than patients with lower sulfotransferase activity. Clinical efficacy (topical minoxidil): In a five-year study, 2% minoxidil exhibited peak hair growth in males at year one with a decline in subsequent years. Topical minoxidil causes hair regrowth in both frontotemporal and vertex areas. The 5% solution and foam were not significantly different in efficacy from the 2% solution. Oral and Sublingual minoxidil (not FDA approved; off-label): After 6 months administration, minoxidil 5mg/day was significantly more effective than topical 5% and 2% in male AGA. Low-dose 0.5 to 5 mg/day may also be safe and effective for female pattern hair loss and chronic telogen effluvium. Sublingual minoxidil may be safe and effective in male and female pattern hair loss.
Article
Full-text available
Background Androgenetic alopecia (AGA) is the most common form of non‐scarring alopecia in humans. Several studies have used different laboratory models to study the pathogenesis and interventions for AGA. These study models have proved beneficial and have led to the approval of two drugs. However, the need to build on existing knowledge remains by examining the relevance of study models to the disease. Objective We sought to appraise laboratory or pre‐clinical models of AGA. Method We searched through databases (PubMed, ScienceDirect, Web of Science, World CAT, Scopus and Google Scholar) for articles on AGA‐related studies from 1942 to March 2019 with a focus on study models. Results The search rendered 101 studies after screening and deduplication. Several studies (70) used in vitro models, mostly consisting of two‐dimensional monolayer cells for experiments involving the characterization of androgen and 5‐alpha reductase (5AR) and inhibition thereof, the effects of dihydrotestosterone (DHT) and biomarker(s) of AGA. Twenty‐seven studies used in vivo models of mice and monkeys to investigate DHT synthesis, the expression and inhibition of 5AR and hair growth. Only four studies used AGA‐related or healthy excisional/punch biopsy explants as ex vivo models to study the action of 5AR inhibitors and AGA‐associated genes. No study used three‐dimensional [3‐D] organoids or organotypic human skin culture models. Conclusion We recommend clinically relevant laboratory models like human or patient‐derived 3‐D organoids or organotypic skin in AGA‐related studies. These models are closer to human scalp tissue and minimize the use of laboratory animals and could ultimately facilitate novel therapeutics.
Article
Full-text available
Androgenetic alopecia (AGA) is one of the commonest reasons for dermatological consultation. Over the last few years our understanding of the pathophysiology of AGA has improved and this has paved way for better diagnostic and therapeutic options. Recent research has dwelled on the role of stem cells in the pathophysiology of AGA and has also identified newer genetic basis for the condition. Dermoscopy/trichoscopy has emerged as a useful diagnostic tool for AGA. While the major treatment options continue to be topical minoxidil, systemic Finasteride and hair transplantations, newer modalities are under investigation. Specific diagnostic and treatment recommendations have also been developed on evidence based principles. This article reviews the recent concepts in relation to AGA. With regards to the pathophysiology we have tried to stress on recent knowledge of the molecular and genetic basis of AGA. We have emphasized on an evidence based approach for treatment and diagnosis.
Article
Full-text available
Although minoxidil has been used for more than two decades to treat androgenetic alopecia (AGA), an androgen-androgen receptor (AR) pathway-dominant disease, its precise mechanism of action remains elusive. We hypothesized that minoxidil may influence the AR or its downstream signaling. These tests revealed that minoxidil suppressed AR-related functions, decreasing AR transcriptional activity in reporter assays, reducing expression of AR targets at the protein level, and suppressing AR-positive LNCaP cell growth. Dissecting the underlying mechanisms, we found that minoxidil interfered with AR-peptide, AR-coregulator, and AR N/C-terminal interactions, as well as AR protein stability. Furthermore, a crystallographic analysis using the AR ligand-binding domain (LBD) revealed direct binding of minoxidil to the AR in a minoxidil-AR-LBD co-crystal model, and surface plasmon resonance assays demonstrated that minoxidil directly bound the AR with a Kd value of 2.6 µM. Minoxidil also suppressed AR-responsive reporter activity and decreased AR protein stability in human hair dermal papilla cells. The current findings provide evidence that minoxidil could be used to treat both cancer and age-related disease, and open a new avenue for applications of minoxidil in treating androgen-AR pathway-related diseases.
Article
Full-text available
Female pattern hair loss (FPHL) is a common hair loss disorder in women and has a complex mode of inheritance. The etiopathogenesis of FPHL is largely unknown; however, it is hypothesized that FPHL and male pattern baldness [androgenetic alopecia (AGA)] share common genetic susceptibility alleles. Our recent findings indicate that the major AGA locus, an X-chromosome region containing the androgen receptor and the ectodysplasin A2 receptor (EDA2R) genes, may represent a common genetic factor underlying both early-onset FPHL and AGA. This gives further support for the widespread assumption of shared susceptibility loci for FPHL and AGA. However, we could not demonstrate association of further AGA risk loci, including 20p11, 1p36.22, 2q37.3, 7p21.1, 7q11.22, 17q21.31, and 18q21.1, with FPHL. Interestingly, a recent study identified four novel AGA risk loci in chromosomal regions 2q35, 3q25.1, 5q33.3, and 12p12.1. In particular, the 2q35 locus and its gene WNT10A point to an as-yet unknown involvement of the WNT signaling pathway in AGA. We hypothesized that the novel loci and thus also the WNT signaling may have a role in the etiopathogenesis of FPHL and therefore examined the role of these novel AGA risk loci in our FPHL samples comprising 440 German and 145 UK affected patients, 500 German unselected controls (blood donors), and 179 UK supercontrols. Patients and controls were genotyped for the top two single nucleotide polymorphisms at each of the four AGA loci. However, none of the genotyped variants displayed any significant association. In conclusion, the results of this study provide no support for the hypothesis that the novel AGA loci influence susceptibility to FPHL.
Article
Full-text available
We carried out a genome-wide association study in 296 individuals with male-pattern baldness (androgenetic alopecia) and 347 controls. We then investigated the 30 best SNPs in an independent replication sample and found highly significant association for five SNPs on chromosome 20p11 (rs2180439 combined P = 2.7 x 10(-15)). No interaction was detected with the X-chromosomal androgen receptor locus, suggesting that the 20p11 locus has a role in a yet-to-be-identified androgen-independent pathway.
Article
Minoxidil is known to induce hair growth in male pattern baldness, for which development androgen plays a central role. We studied the effect of minoxidil on testosterone metabolism by cultured dermal papilla cells from balding or nonbalding scalp and dermal fibroblasts. In all three groups, 17β-hydroxysteroid dehydrogenase activity was much higher than 5α-reductase activity. Minoxidil increased 17β-hydroxysteroid dehydrogenase activity by nearly 40% (P < 0.001) in dermal papilla cells of balding scalp, whereas the effect was less marked in dermal papilla cells from nonbalding scalp and dermal fibroblasts. 5α-Reductase activity was also slightly increased by minoxidil in dermal papilla cells from balding scalp. Again, the effect on 5α-reductase activity was insignificant in the other two groups of cells. Whether such modification of testosterone metabolism in dermal papilla cells of balding scalp by minoxidil is related to its therapeutic effect remains unknown.
Article
Alopecia areata is an inflammatory hair loss disease with a major genetic component. The disease is characterized by focal inflammatory lesions with perifollicular T-cell infiltrates, reflecting the role of local cytokine production in the development of patchy hair loss. IL-1 and IL-1 are important inhibitors of hair growth in vitro. Their effect is opposed by the interleukin-1 receptor antagonist, IL-1ra. Genes of the IL-1 cluster are candidate genes in the pathogenesis of alopecia areata. To investigate the role of the IL-1 system in alopecia areata we examined three biallelic polymorphisms within the IL-1 gene cluster (IL1A+4845, IL1B+3954 and IL1B–511) in 165 patients and a large number of matched controls (n=1150). There was no significant association of IL1B–511 or IL1B+3954 genotypes with the overall dataset, or with disease severity or age at onset, in contrast with a previous report. The results suggested the possibility of an association with IL1A+4845 in the overall dataset [OR 1.39 (95% CI 1.00, 1.93)] although this was not statistically significant. This was due mainly to the contribution from mild cases of alopecia areata [OR 1.48 (0.96, 2.29)], suggesting that IL-1 may have a particular role in the pathogenesis of this subgroup.Keywords: alopecia areata, HLA, IL1A, IL1B, interleukin-1, polymorphism
Article
We have known for over 30 years that minoxidil stimulates hair growth, yet our understanding of its mechanism of action on the hair follicle is very limited. In animal studies, topical minoxidil shortens telogen, causing premature entry of resting hair follicles into anagen, and it probably has a similar action in humans. Minoxidil may also cause prolongation of anagen and increases hair follicle size. Orally administered minoxidil lowers blood pressure by relaxing vascular smooth muscle through the action of its sulphated metabolite, minoxidil sulphate, as an opener of sarcolemmal KATP channels. There is some evidence that the stimulatory effect of minoxidil on hair growth is also due to the opening of potassium channels by minoxidil sulphate, but this idea has been difficult to prove and to date there has been no clear demonstration that KATP channels are expressed in the hair follicle. A number of in vitro effects of minoxidil have been described in monocultures of various skin and hair follicle cell types including stimulation of cell proliferation, inhibition of collagen synthesis, and stimulation of vascular endothelial growth factor and prostaglandin synthesis. Some or all of these effects may be relevant to hair growth, but the application of results obtained in cell culture studies to the complex biology of the hair follicle is uncertain. In this article we review the current state of knowledge on the mode of action of minoxidil on hair growth and indicate lines of future research.
Article
The aetiology of female pattern hair loss (FPHL) is largely unknown. However, it is hypothesized that FPHL and male pattern baldness (AGA) share common susceptibility alleles. The two major susceptibility loci for AGA are the androgen receptor (AR)/ectodysplasin A2 receptor (EDA2R) locus on the X-chromosome, and a locus on chromosome 20p11, for which no candidate gene has yet been identified. To examine the role of the AR/EDA2R and 20p11 loci in the development of FPHL using 145 U.K. and 85 German patients with FPHL, 179 U.K. supercontrols and 150 German blood donors. Patients and controls were genotyped for 25 single nucleotide polymorphisms (SNPs) at the AR/EDA2R locus and five SNPs at the 20p11 locus. Analysis of the AR/EDA2R locus revealed no significant association in the German sample. However, a nominally significant association for a single SNP (rs1397631) was found in the U.K. sample. Subgroup analysis of the U.K. patients revealed significant association for seven markers in patients with an early onset (P = 0·047 after adjustment for the testing of multiple SNPs by Monte Carlo simulation). No significant association was obtained for the five 20p11 variants, either in the overall samples or in the analysis of subgroups. The observed association suggests that the AR/EDA2R locus confers susceptibility to early-onset FHPL. Our results do not implicate the 20p11 locus in the aetiology of FPHL.
Article
The opening of intracellular potassium channels has been suggested as a mechanism regulating hair growth. Enhancing the flux of potassium ions is a mechanism shared by several structurally diverse antihypertensive agents including minoxidil sulfate (the active metabolite of minoxidil), pinacidil, P-1075 (a potent pinacidil analog), RP-49,356, diazoxide, cromakalim, and nicorandil. Of these drugs, minoxidil, pinacidil, and diazoxide have been reported to elicit hypertrichosis in humans. This potassium channel hypothesis was examined by testing these drugs for effects on hair growth both in vitro and in vivo. For the in vitro studies, mouse vibrissae follicles were cultured for 3 d with drug and the effects on hair growth were measured by metabolic labeling. All drugs, except diazoxide, enhanced cysteine incorporation into the hair shafts of the cultured vibrissae. Diazoxide was poorly soluble and thus was tested only at low doses. Minoxidil, P-1075, cromakalim, and RP-49,356 were also evaluated in vivo by measuring hair growth effects in balding stumptail macaque monkeys. The drugs were administered topically to defined sites on balding scalps once per day for 4-5 months and the amount of hair grown was determined by monthly measurements of shaved hair weight. Three of the drugs produced significant increases in hair weight whereas, the RP-49,356 had no effect. These studies provide correlative evidence that the opening of potassium channels is an important regulatory mechanism for hair growth. This provides the impetus for further studies on this potentially important mechanism affecting hair biology.
Article
The gene for the androgen receptor, mutations at which cause the X-linked androgen insensitivity syndrome, has been localized to the q11----q12 region of the human X chromosome by analysis, using a cloned cDNA for the androgen receptor, of somatic cell hybrid panels segregating portions of the X chromosome. A moderate-frequency HindIII RFLP has been found which should be useful in genetic linkage analysis of the various inherited forms of androgen insensitivity.