ArticlePDF Available

Enhanced VEGF Expression in Hair Follicle Dermal Papilla Cells by Centella asiatica Linn.

Authors:

Abstract and Figures

Centella asiatica Linn. (C. asiatica) extract has been shown to possess high antioxidant activity due to its phenols and flavonoids. This study tested the efficacy of 70%-ethanol (EtOH) crude extracts of C. asiatica and its fractions (H2O, EtOAc, CH2Cl2, and hexane) to modulate human follicle dermal papilla cells. In addition, we analyzed the extracts for major phytochemicals as well as free radical scavenging activity. Our results from ABTS and DPPH assays showed that the amounts of phenolic and flavonoid compounds in the extracts were both related to its free radical scavenging activity. While the EtOAc fraction of C. asiatica demonstrated the highest free radical scavenging activity, it was toxic to human follicle dermal papilla cells. The cell viability test was positive when cells were treated with EtOH crude extract and H2O fraction. VEGF gene expression, quantified by real-time PCR analysis of the EtOH crude extract, showed a significant level of induction, indicating that the growth promotion effect in human follicle dermal papilla cells was related to VEGF gene expression, which has a positive hair growth stimulating effect. The EtOH crude extract of C. asiatica may offer potential in hair growth promoting products.
Content may be subject to copyright.
CMU J. Nat. Sci. (2018) Vol. 17(1) 25
Enhanced VEGF Expression in Hair Follicle Dermal
Papilla Cells by Centella asiatica Linn.
Pahol Saansoomchai1, Apinun Limmongkon1, Damratsamon Surangkul1,
Teera Chewonarin2 and Metawee Srikummool1*
1Department of Biochemistry, Faculty of Medical Science, Naresuan University, Phitsanulok
65000, Thailand
2Department of Biochemistry, Faculty of Medicine, Chiang Mai University, Chiang Mai
50200, Thailand
*Corresponding author. E-mail: metaweesr@nu.ac.th
https://doi.org/10.12982/CMUJNS.2018.0003
ABSTRACT
Centella asiatica Linn. (C. asiatica) extract has been shown to possess high antioxidant
activity due to its phenols and avonoids. This study tested the ecacy of 70%-ethanol
(EtOH) crude extracts of C. asiatica and its fractions (H2O, EtOAc, CH2Cl2, and hexane)
to modulate human follicle dermal papilla cells. In addition, we analyzed the extracts for
major phytochemicals as well as free radical scavenging activity. Our results from ABTS
and DPPH assays showed that the amounts of phenolic and avonoid compounds in the
extracts were both related to its free radical scavenging activity. While the EtOAc fraction of
C. asiatica demonstrated the highest free radical scavenging activity, it was toxic to human
follicle dermal papilla cells. The cell viability test was positive when cells were treated with
EtOH crude extract and H2O fraction. VEGF gene expression, quantied by real-time PCR
analysis of the EtOH crude extract, showed a signicant level of induction, indicating that
the growth promotion eect in human follicle dermal papilla cells was related to VEGF
gene expression, which has a positive hair growth stimulating eect. The EtOH crude
extract of C. asiatica may oer potential in hair growth promoting products.
Keywords: Antioxidant activities, Centella asiatica, Phytochemical screening, Real-time
PCR, Gene expression
INTRODUCTION
Hair protects the scalp from the environment, including heat, cold, and UV radiation,
and serves as a measure of beauty. As its loss can result in distress and psychological problems,
prevention or treatment strategies need to be investigated. So far, only two drugs, minoxidil
and nasteride, have been approved for the treatment of hair loss in men by the US Food and
Drug Administration (Park et al., 2012).
Hair follicles of any hair type have a unique life cycle comprised of three main stages –
anagen, catagen, and telogen, each of which leads to the destruction and regeneration of hair
follicles over a lifetime. The regulation of the hair cycle is complicated and involves several
CMU J. Nat. Sci. (2018) Vol. 17(1)26
factors (Hibino and Nishiyama, 2004) that are not well understood. Genetic factors, cytokine
imbalance, and oxidative stress can cause abnormal hair follicle cycling and subsequent hair
loss (Rho et al., 2005; Aron et al., 2013). Many cytokines and receptors are involved in the
cell cycle of human follicle dermal papilla cells, including the vascular endothelial cell growth
factor (VEGF) (Shin et al., 2014), vascular endothelial cell growth factor receptor (VEGFR)
(Li et al., 2012), broblast growth factor (FGF) (Rho et al., 2005), insulin-like growth factor
(IGF) (Panchaprateep and Asawanonda, 2014), epidermal growth factor (EGF) (Bressan et
al., 2014), keratinocyte growth factor (KGF) (Gopu et al., 2015), and transforming growth
factor (TGF) (Kang et al., 2013; Shin et al., 2014). Some hair regeneration has been achieved
by molecular eect and growth factors (Danilenko et al., 1996) and follicle dermal stem cells
(Rahmani et al., 2014). Some evidence has suggested that VEGF and VEGFR could induce
the proliferation of human follicle dermal papilla cells through ERK activation (Li et al.,
2012). TGF has been related to human follicle dermal papilla cell death involving free radicals
(Soma et al., 2003; Rho et al., 2005).
Medicinal plants, including Centella asiatica Linn. (C. asiatica), are natural sources
of bioactive compounds that possess health-promoting eects. C. asiatica has been used to
treat a range of ailments, including the common cold (Roy et al., 2013). In Thailand, its fresh
leaves have been used to treat wounds and burns and its extract has been used to reduce
swelling and infection. C. asiatica extract is widely available in Thailand and cost eective
(Taemchuay et al., 2009). Many scientic studies have researched traditional applications of
C. asiatica extract (Bylka et al., 2014; Hashim, 2014). C. asiatica extract contains several
bioactive compounds, including saponins, essential oils, avone derivatives, sesquiterpenes,
triterpenic acid, and triterpenic steroids (Roy et al., 2013). It also has been reported to contain
bioactive compounds, such as terpenes, avonoids, and polyphenols, that are related to its
potent antioxidative activities (Hashim et al., 2011; Nurlaily et al., 2012; Orhan et al., 2013).
Extracts from C. asiatica leaves consist of gallic acid and ferulic acid, which have antioxidant
and anti-inammatory eects (Ramesh et al., 2014). Another study has shown that C. asiatica
extracts exhibited antioxidant activity and UV protection eects (Hashim et al., 2011). Many
beauty products are currently available that incorporate C. asiatica extracts, such as cosmetic
creams, hand and body lotions, eye gel, and face mask products (Bylka et al., 2014). A previous
study found that C. asiatica extract enlarged hair follicles (Jain and Dass, 2015) and inhibited
the activity of 5α-reductase that causes hair loss (Jain et al., 2016). However, few hair care
or restoration products contain the extract, as its eect on the hair root remains unclear; the
molecular mechanisms involved in plant extracts modulating gene expression are not well
understood.
The in vitro treatment of human follicle dermal papilla cells could, possibly, provide
a gateway to hair regeneration and sustainably protect against hair loss. The objective of this
study was to search for any potential eect, especially involving antioxidant activity, of C.
asiatica extract on growth and molecular regulation in human follicle dermal papilla cells.
Positive ndings would indicate the potential for developing accessible and aordable value
added hair growth promoting products using ingredients extracted from natural sources rather
than synthetic drugs.
CMU J. Nat. Sci. (2018) Vol. 17(1) 27
MATERIALS AND METHODS
Plant material
A C. asiatica plant was collected from Chiang Rai, Thailand and positively identied
by the taxonomist of Nareasuan University. The leaves were cleaned and dried in an oven at
40°C, then stored at -20°C until use.
Preparing the ethanol crude extract
One kilogram of dried samples were ground into powder and macerated in 4 L of 70%
(v/v) ethanol (EtOH) for 24 h at room temperature. The extraction was performed twice under
the same conditions. Chlorophyll was removed using the charcoal absorption method with
some modication (Limtrakul et al., 2004). Briey, each extract was bleached with 160 g
of activated charcoal. The chlorophyll-free extract was then ltered through Whatman’s
No.1 lter paper and the solvent was removed using a vacuum rotary evaporator (Buchi,
Switzerland) at room temperature. The concentrated aqueous portion was lyophilized (Christ
Alpha1-4 LD, UK) into a powder and further partitioned using four dierent solvents:
hexane, dichloromethane (CH2Cl2), ethyl acetate (EtOAc), and water (H2O). The EtOH crude
extract and four fractions with the highest antioxidant activity were then used in subsequent
experiments.
Evaluating the free radical scavenging activity of the crude extract
Two methods measured the free radical scavenging activity of C. asiatica crude extract:
1) a DPPH inhibition assay following the method of Padmanabhan and Jangle (2012) and
2) an ABTS inhibition assay as described by Gorjanović et al. (2012). With treatments of
various concentrations of the extract, the decrease in absorbance was measured at 517 nm for
the DPPH assay and 735 nm for the ABTS assay; the % inhibition and IC50 value were also
reported.
Measuring total phenolic and avonoid contents of the crude extract
Total phenolic content was determined using the Folin-Ciocalteu method. Quantication
was expressed as milligrams of gallic acid equivalent per gram of extract (mg GE/g of ext)
(Saikia et al., 2012). The total avonoid content (TF) was measured by aluminium chloride
colorimetric assay and expressed in milligrams of catechin equivalent per gram of extract (mg
CE/g of ext) (Saikia et al., 2012).
Human follicle dermal papilla cell cultures and cell viability testing
Human follicle dermal papilla cells cultures were obtained from PromoCell, Germany.
The cells were cultured and maintained in Follicle Dermal Papilla Cell Growth Medium
(PromoCell, Germany) at 37°C in 5% (v/v) CO2. Cytotoxicity of the extract of the human
follicle dermal papilla cells was performed using the Presto-blue (Invitrogen, USA) assay
according to the PrestoBlueTM cell viability reagent protocol. Briey, 2 × 103 of the human
follicle dermal papilla cells were seeded into a 96-well, at-bottomed, microliter plate and
cultured for 24 h. A 100-μl sample of C. asiatica extract at dierent concentrations was
CMU J. Nat. Sci. (2018) Vol. 17(1)28
added to each well and the cells were further cultured for 24 h for one group of cells, and
48 h for another. Then, 20 μl of Presto-blue solution was added to each well and the cells
were incubated for 20 min. The C. asiatica extracts were compared to 1% standard minoxidil
(Sigma-Aldrich, USA) as the control. The absorbance was measured at 570 nm. The eective
time of incubation to human follicle dermal papilla cells was used for studying the mRNA
expression.
Detecting VEGF mRNA expression in C. asiatica–treated human follicle dermal papilla
cells
The human follicle dermal papilla cells were treated with the indicated concentrations of
C. asiatica extract for 24 h. Total RNA was isolated using RNAZol® RT (Molecular Research
Center Inc., USA) according to the manufacturer’s protocol. RNA quality was assessed by
RNA/Protein sample PCR amplication of cDNA performed in a RevertraAce®qPCR RT
Master Mix (Toyobo, Japan). cDNA was obtained from 2 μg/ml of RNA by one cycle of reverse
transcription. Gene expression was quantied using real-time PCR (RT-PCR). Targeted genes
and the details are presented in Table 1. The PCR cycle steps consisted of denaturation at 94°C
for 1 min, annealing at 58°C for 1 min, and a nal extension step at 72°C for 1 min within
40 cycles. Each gene expression was calculated according to the threshold cycle (CT) value,
normalized using the value of sample with the lowest level for each product, and the data were
corrected according to the level of β-actin.
Table 1. Sequences of gene specic primers used in RT-PCR.
Genes Sequences Size Reference
VEGF forward 5’- ATGACGAGGGCCTGGAGTGTG -3’ 91 Soulitzis et al.,
2006
reverse 5’- CCTATGTGCTGGCCTTGGTGAG -3’
β-actin forward, 5’- CTTCCAGCCTTCCTTCCTGG -3’ 162 Soulitzis et al.,
2006
reverse, 5’- TTCTGCATCCTGTCGGCAAT -3’
To verify the RT-PCR, PCR products were analyzed by electrophoresis in 2% agarose
gels. They were then stained with ethidium bromide and photographed on a UV light
transilluminator. PCR product length for VEGF growth factor was analyzed, as well as β-actin.
Statistical analysis
Each experiment was performed in triplicate. All values were presented as a mean
value (Mean ± SD). The statistically signicant dierences between the means of the samples
were calculated by one-way ANOVA and the dierences were considered signicant at a level
of p<0.05 (*).
CMU J. Nat. Sci. (2018) Vol. 17(1) 29
RESULTS
Antioxidant activity of C. asiatica extracts
The antioxidant activity of the C. asiatica extract was measured by its ability to
scavenge DPPH and ABTS radicals.
Figure 1 shows the DPPH (A) and ABTS (B) free radical scavenging assays. The free
radical scavenging activity of C. asiatica extract showed the highest activity in the EtOH
crude extract for DPPH assay and the highest activity in the EtOAc fraction for ABTS assay.
Figure 1. The free radical scavenging activities of C. asiatica extracts.
Note: *The dierences were considered signicant at p<0.05.
Table 2. IC50 of the C. asiatica extracts against DPPH and ABTS radicals.
Fraction
IC50 of C. asiatica extract (μg/ml)
DPPH assay ABTS assay
Hexane >200 >200
CH2Cl2>200 173.20 ± 3.47
EtOAc 134.76 ± 12.09 122.22 ± 7.49
EtOH 34.63 ± 0.76 >200
H2O >200 >200
Ascorbic acid 13.95 ± 0.01 -
Trolox - 6.41 ± 0.03
Note: The presence of IC50 of C. asiatica and standards against DPPH and ABTS radicals are presented as
mean ± SD.
CMU J. Nat. Sci. (2018) Vol. 17(1)30
As shown in Figure 1 and Table 2, the free radical scavenging activity of C. asiatica
extract at 0-200 μg/ml was found to scavenge the DPPH radicals and ABTS radicals in a dose
dependent manner when compared with the positive control, ascorbic acid and Trolox.
The EtOH crude extract of C. asiatica at a concentration of 200 μg/ml displayed the
highest inhibitory eect; it inhibited DPPH radicals at 97.01 ± 0.42% of the ascorbic acid and
also inhibited IC50 at 34.63 ± 0.76 μg/ml. CH2Cl2, hexane, and H2O fractions also displayed
inhibitory eects at the same concentration levels of IC50 (>200 ug/ml).
C. asiatica extract in the EtOAc fraction displayed the highest inhibitory eect
on ABTS radicals at a concentration of 200 μg/ml, inhibiting 65.33 ± 2.09% of Trolox with
IC50 at 122.22 ± 7.49 μg/ml. The CH2Cl2 fraction inhibited at IC50 of 173.20± 3.47 μg/ml.
EtOH crude extract, hexane fraction, and H2O fraction had the same concentration levels
(>200 ug/ml).
The two active fractions, the EtOH crude extract and EtOAc fraction, have been linked
to solvent polarity that can extract dierent fractions of polar/nonpolar constituents from the
plant. This nding agreed well with the total phenolic and avonoid contents of each fraction,
as shown in Table 3.
Total phenolic and avonoid content in C. asiatica extracts
The amount of phenols and avonoids contained in C. asiatica extracts are shown in
Table 3. The EtOAc fraction contained the most phenolic compounds, at 19.72 ± 0.02 mg
GE/g of extract, closely followed by the CH2Cl2 fraction. The EtOAc fraction contained the
most avonoids, at 6.79 ± 0.12 mg CE/g of extract, with all other fractions containing only
small or trace amounts.
Table 3. Total phenolic (TP) and avonoid (TF) content of C. asiatica extracts.
C. asiatica Hexane CH2Cl2EtOAc EtOH H2O
TP (mg GE/g of ext) 7.71 ± 0.01 17.04 ± 0.01 19.72 ± 0.02 2.68 ± 0.00 0.13 ± 0.00
TF (mg CE/g of ext) 1.10 ± 0.64 1.51 ± 0.36 6.79 ± 0.12 0.54 ± 0.14 0.00 ± 0.00
Note: The present chemical components, including TP and TF, are presented as mean ± SD.
Cytotoxicity of the C. asiatica extracts
The cytotoxicity of the C. asiatica extract from EtOH crude extract and each fraction
were further examined by treating human follicle dermal papilla cells with the extract at
dierent concentrations. The EtOH crude extract and H2O fraction were evaluated for
cytotoxic eects on human follicle dermal papilla cells at dierent doses up to 1,000 μg/ml
extract for 24 h and 48 h (Figure 2). The cell viability was 100% or more compared with the
non-treated cells (0 μg/ml extract). The C. asiatica extract at concentrations of 500 μg/ml and
1,000 μg/ml slightly induced cell proliferation. From this, it can be concluded that the EtOH
crude extract and H2O fraction of C. asiatica did not show any toxicity to the human follicle
dermal papilla cells, and in this regard were as eective as 1 μg of minoxidil (control). No
statistical dierences were found between the viability of the cells treated with minoxidil,
CMU J. Nat. Sci. (2018) Vol. 17(1) 31
and the viability of the cells in the control. Unfortunately, the screening data revealed that the
EtOAc fraction, which possessed the greatest antioxidant activity, was toxic to human follicle
dermal papilla cells (data not show). Therefore, we did not use this fraction for further study.
We then focused on the extract from the safer solvents – EtOH and H2O.
Figure 2. Cell viability of EtOH crude extract and H2O fraction of C. asiatica extract at 24 h
and 48 h. The EtOH crude extract and H2O fraction did not display cytotoxicity to
human follicle dermal papilla cells.
Note: *The dierences were considered signicant at p<0.05.
VEGF gene expression
The EtOH crude extract and H2O fraction (the safer solvents) of C. asiatica at
concentrations of 500 μg/ml and 1,000 μg/ml were used for a gene expressivity assay by RT-
PCR. As shown in Figure 3, both concentrations of EtOH crude extracts of C. asiatica induced
VEGF gene expression (p<0.05), with 500 μg/ml the most at 37.30 ± 9.47. This far exceeded
the slightly induced VEGF gene expression of minoxidil (1.99 ± 0.07); the H2O fraction did
not induce gene expression (data not shown).
The size of the PCR products corresponded to the data shown in Table 1. The band of
VEGF growth factor was presented after incubating the C. asiatica extract with human follicle
dermal papilla cells. C. asiatica extract at the concentration of 500 μg/ml showed a more
intense band than the C. asiatica extract at the concentration 1,000 μg/ml. Similarly to the
β-actin, these concentrations showed the same result as VEGF growth factor (data not show).
The PCR products coresponded to RT-PCR.
CMU J. Nat. Sci. (2018) Vol. 17(1)32
Figure 3. VEGF expression of human follicle dermal papilla cells by the induction of EtOH
crude extract of C. asiatica.
Note: *The dierences were considered signicant at p<0.05.
DISCUSSION
ABTS and DPPH assays determined the anti-oxidative activity of the 70%-EtOH extract
of C. asiatica and its partition fractions (hexane, CH2Cl2, EtOAc, and H2O fractions). The
dierent fractions inhibited the ABTS and DPPH radicals dierently. The EtOH crude extract
showed the strongest inhibitory eect on DPPH radicals, while the EtOAc fraction had the
strongest inhibitory eect on the ABTS radicals. These results indicated that the free radical
scavenging activities correlated to the phenolic and avonoid content in the extract. Moreover,
the inhibitory eect of both the EtOH crude extract and the EtOAc fraction depended on not
only their phytochemical ingredients, but also the solvents used to generate the radicals. Water
was used as the solvent in the ABTS assay, representing the polar solvent borne radicals
(Gorjanović et al., 2012), while methanol used as the solvent in the DPPH assay, representing
the organic solvent borne radicals (Padmanabhan and Jangle, 2012). Rahman et al. (2013)
and Shalaby and Shanab (2013) found that the free radical scavenging activity of an extract
related to the polarity of the solvent, which occurs because the antioxidant molecules engage
in strong interactions with free radicals.
The results showed that the free radical scavenging activity of the C. asiatica extracts
related to the variety of chemicals in the phenols and avonoids, which included many
lipophilic phytochemicals or hydrophilic phytochemicals. Many studies have reported levels
and activities of phenols and avonoids using a chlorophyll-free extraction method (Limtrakul
et al., 2004; Paula et al., 2012). In our study, the C. asiatica extracts and fractions showed total
phenols ranging from 0.13-19.72 mg GE/g of extract. This result agreed with Frederico et al.
(2009) for dierent parts of C. asiatica. The avonoids levels in the C. asiatica extracts were
CMU J. Nat. Sci. (2018) Vol. 17(1) 33
high, up to 6.79 mg CE/g extract. The EtOAc fraction showed the highest amount of phenols
and avonoids. This was consistent with previous reports that indicated that the moderate
polarity of a solvent, such as EtOAc, yields more phenols and avonoids than other solvents
(Wang et al., 2016) and that the polarity of a solvent aects the amount of each (Rahman et
al., 2013).
The cytotoxicity tests showed that the EtOAc fraction harmed human follicle dermal
papilla cells. Natural glycosides were extracted from the plant by the low polarity of the
solvent, causing the harm. Podolak et al. (2010) also described the haemolytic activity and
cytotoxicity to cells of these natural glycosides.
RT-PCR analysis tested the stimulating eect of treating cells with EtOH crude extract
of C. asiatica, observed as the expression of VEGF mRNA. The EtOH crude extract of C.
asiatica induced VEGF expression in human follicle dermal papilla cells, possibly leading to
cell proliferation. Our results agreed with other studies of plant extracts (such as Asiasari radix
and Panax ginseng) in enhancing the expression of VEGF (Rho et al., 2005; Shin et al., 2014).
Other reports showed that the proliferation of human follicle dermal papilla cells was involved
with cytokines signaling (Soma et al., 2003; Rho et al., 2005). β-catenin causes the signaling
of human follicle dermal papilla cell proliferation (Driskell et al., 2011). The β-catenin activity
in the human follicle dermal papilla cells regulates a number of other signaling pathways,
including the phosphorelation of downstream signalling, such as the VEGF pathway, that
stimulates cell proliferation (Lachgar et al., 1999; Driskell et al., 2011). VEGF also plays an
important role in angiogenesis in follicle dermal papilla cells (Yano et al., 2001).
Previously, minoxidil was reported to have a concentration-dependent, biphasic eect
on proliferation and dierentiation, as well as on growth stimulation in low doses, and to be
an anti-proliferative through the expression of cytokines (Kwon et al., 2007). In solution at
less than 5%, Minoxidil can safely be applied to the human scalp; this equals a concentration
of 1 mM (Han et al., 2004). Our results showed that minoxidil in solution stimulated the
expression of VEGF, corresponding to Lachgar et al. (1998) and Li et al. (2001). The higher
VEGF expression after treatment with the EtOH crude extract of C. asiatica more eciently
promoted human follicle dermal papilla cells than minoxidil.
CONCLUSION
While many reports have studied C. asiatica extracts, few have looked at its eects
on human follicle dermal papilla cells and the molecular mechanisms that promote the
proliferation of the cells. This study focused on gene expression after incubating the cells with
the C. asiatica extract. The EtOH crude extract of C. asiatica induced the expression of VEGF
mRNA in human follicle dermal papilla cells. Moreover, the phenols and avonoids found
in the C. asiatica extracts demonstrated antioxidant activity that could maintain the growth
of human follicle dermal papilla cells. This study has clearly indicated that the EtOH crude
extract of C. asiatica will be of benet in the development of hair care products and hair loss
therapy.
CMU J. Nat. Sci. (2018) Vol. 17(1)34
REFERENCES
Aron, G.N., Paul, T.R., and Bernard, P.N. 2013. Nonsurgical therapy for hair loss. Facial
Plastic Surgery Clinics of North America. 21(3): 335-342. https://doi.org/10.1016/j.
fsc.2013.04.003
Bressan, R.B., Melo, F.R., Almeida, P.A., Bittencourt, D.A., Visoni, S., Jeremias, T.S., Costa,
A.P., Leal, R.B., and Trentin, A.G. 2014. EGF-FGF2 stimulates the proliferation
and improves the neuronal commitment of mouse epidermal neural crest stem cells
(EPI-NCSCs). Experimental Cell Research. 327(1): 37-47. https://doi.org/10.1016/j.
yexcr.2014.05.020
Bylka, W., Znajdek, A.P., Studzinska, S.E., Danczak-Pazdrowska, A., and Brzezinska, M.
2014. Centella asiatica in dermatology: an overview. Phytotherapy Research. 28(8):
1117-1124. https://doi.org/10.1002/ptr.5110
Danilenko, D.M., Ring B.D., and Pierce, G.F. 1996. Growth factors and cytokines in hair
follicle development and cycling: recent insights from animal models and the
potentials for clinical therapy. Molecular Medecine Today. 2(11): 460-467. https://doi.
org/10.1016/1357-4310(96)10045-9
Driskell, R.R., Clavel, C., Michael, R.M., and Watt, F.M. 2011. Hair follicle dermal papilla
cells at a glance. Journal of Cell Science. 124(8): 1179-1182. https://doi.org/10.1242/
jcs.082446
Frederico, P., Rafael , C.D., Dalton, D.J., Miriam, T.P.L., and Nadia, R.B. 2009. Antioxidant
and cytotoxic activities of Centella asiatica (L) Urb. International Journal of Molecular
Sciences. 10: 3713-3721. https://doi.org/10.3390/ijms10093713
Gopu, S., Paul, L.B., and Mei, B.Q. 2015. Fibroblast heterogeneity and its implications
for engineering organotypic skin models in vitro. European Journal of Cell Biology.
94(11): 483-512. https://doi.org/10.1016/j.ejcb.2015.08.001
Gorjanović, S., Komes, D., Pastor, F.T., Belščak-Cvitanović, A., Pezo, L., Hečimović, I., and
Suznjevic, D. 2012. Antioxidant capacity of teas and herbal infusions: polarographic
assessment. Journal of Agricultural and Food Chemistry. 60(38): 9573-9580. https://
doi.org/10.1021/jf302375t
Han, J.H., Kwon, O.H., Chung, J.H., Cho, K.H., Eun, H.C., and Kim, K.H. 2004. Eect
of Minoxidil on proliferation and apoptosis in dermal papilla cell of human hair
follicle. Journal of Dermatological Science. 34(2): 91-98. https://doi.org/10.1016/j.
jdermsci.2004.01.002
Hashim, P. 2014. The eect of Centella asiatica, vitamins, glycolic acid and their mixtures
preparations in stimulating collagen and bronectin synthesis in cultured human skin
broblast. Pakistan Journal Pharmaceutical Sciences. 27(2): 233-237.
Hashim, P., Sidek, H., Helan, M.H.M., Sabery, A., Palanisamy, U.D., and Ilham, M. 2011.
Triterpene composition and bioactivities of Centella asiatica. Molecules. 16(2): 1310-
1322. https://doi.org/10.3390/molecules16021310
Hibino, T., and Nishiyama, T. 2004. Role of TGF-beta2 in the human hair cycle. Journal of
Dermatological Science. 35(1): 9-18. https://doi.org/10.1016/j.jdermsci.2003.12.003
CMU J. Nat. Sci. (2018) Vol. 17(1) 35
Jain, P.K., and Dass, D.J. 2015. Evaluating hair growth potential of some traditional herbs.
Asian Journal of Pharmaceutical and Clinical Research. 8(6): 150-152.
Jain, R., Monthakantirat, O., Tengamnuay, P., and De-Eknamkul, W. 2016. Identication of
a new plant extract for androgenic alopecia treatment using a non-radioactive human
hair dermal papilla cell-based assay. BMC Complementary and Alternative Medicine.
16(18): 1-9. https://doi.org/10.1186/s12906-016-1004-5
Kang, B.M., Won, G.H., Jang, Y.J., Shin, S.H., Kwack, M.H., Choi, S.S., Kim, M.K., Kim,
J.C., and Sung, Y.K. 2013. Erythropoietin induces insulin-like growth factor-1 from
three-dimensional culture of human dermal papilla cells. Journal of Dermatological
Science. 69(1): 82-84. https://doi.org/10.1016/j.jdermsci.2012.10.005
Kwon, O.S., Han, J.H., Yoo, H.G., Chung, J.H., Cho, K.H., Eun, H.C., and Kim, K.H. 2007.
Human hair growth enhancement in vitro by green tea epigallocatechin-3-gallate (EGCG).
Phytomedicine. 14(7-8): 551-555. https://doi.org/10.1016/j.phymed.2006.09.009
Lachgar, S., Charveron, M., Gall, Y., Plouet, J., and Bonafe, J.L. 1998. Minoxidil upregulates
the expression of vascular endothelial growth factor in human hair dermal papilla
cells. British Journal of Dermatology. 138(3): 407-411. https://doi.org/10.1046/j.1365-
2133.1998.02115.x
Lachgar, S., Charveron, M., Sarraute, J., Mourard, M., Gall, Y., and Bonafe, J.L. 1999. In
vitro main pathways of steroid action in cultured hair follicle cells: vascular approach.
Journal of Investigative Dermatology Symposium Proceeding, 4(3), 290-295.
Li, W., Man, X.Y., Li, C.M., Chen, J.Q., Zhou, J., Cai, S.Q., Lu, Z.F., and Zheng, M. 2012.
VEGF induces proliferation of human hair follicle dermal papilla cells through
VEGFR-2-mediated activation of ERK. Experimental Cell Research. 318(14): 1633-
1640. https://doi.org/10.1016/j.yexcr.2012.05.003
Li, M., Marubayashi, A., Nakaya, Y., Fukui, K., and Arase, S. 2001. Minoxidil-induced hair
growth is mediated by adenosine in cultured dermal papilla cells: possible involvement
of sulfonylurea receptor 2B as a target of minoxidil. Journal of Investigative
Dermatology. 117(6): 1594-1600. https://doi.org/10.1046/j.0022-202x.2001.01570.x
Limtrakul, P., Khantamat, O., and Pintha, K. 2004. Inhibition of P-glycoprotein activity
and reversal of cancer multidrug resistance by Momordica charantia extract. Cancer
Chemotherapy and Pharmacology. 54: 525-530. https://doi.org/10.1007/s00280-004-
0848-4
Nurlaily, A., Noor Baitee, A. R. and Musalmah, M. 2012. Comparative antioxidant and anti-
inammatory activity of dierent extracts of Centella asiatica (L.) Urban and its active
compounds, Asiaticoside and Madecassoside. Medicine and Health. 7(2): 62-72.
Orhan, I.E., Atasu, E., Senol, F.S., Ozturk, N., Demirci, B., Das, K., and Sekeroglu, N.
2013. Comparative studies on Turkish and Indian Centella asiatica (L.) Urban (gotu
kola) samples for their enzyme inhibitory and antioxidant eects and phytochemical
characterization. Industrial Crops and Products. 47: 316–322. https://doi.org/10.1016/j.
indcrop.2013.03.022
Padmanabhan, P., and Jangle, S.N. 2012. Evaluation of DPPH radical scavenging activity and
reducing power of four selected medicinal plants and their combinations. International
Journal of Pharmaceutical Science and Drug Research. 4(2): 143-146.
CMU J. Nat. Sci. (2018) Vol. 17(1)36
Panchaprateep, R., and Asawanonda, P. 2014. Insulin-like growth factor-1: roles in
androgenetic alopecia. Experimental Dermatology. 23(3): 216-218. https://doi.
org/10.1111/exd.12339
Park, P.J., Moon, B.S., Lee, S.H., Kim, S.N., Kim, A.R., Kim, H.J., Park, W.S., Choi, K.Y.,
Cho, E.G., and Lee, T.R. 2012. Hair growth-promoting eect of Aconiti Ciliare Tuber
extract mediated by the activation of Wnt/β-catenin signaling. Life Sciences. 91(19-
20): 935-943. https://doi.org/10.1016/j.lfs.2012.09.008
Paula, C.C., Sonia, S.F., Tatiana, S.W., and Sandra, C.G. 2012. Evaluation of the antimicrobial
and antioxidant activities of essential oils, extracts and their main components from
oregano from Madeira Island, Portugal. Food Control. 23(2): 552-558. https://doi.
org/10.1016/j.foodcont.2011.08.031
Podalak, I., Galanty, A., and Sobolewska, D. 2010. Saponins as cytotoxic agents: a review.
Phytochemisty Reviews. 9: 425–474. https://doi.org/10.1007/s11101-010-9183-z
Rahman, M., Hossain, S., Rahaman, A., Fatima, N., Nahar, T., Uddin, B., and Basunia, M.A.
2013. Antioxidant activity of Centella Asiatica (Linn.) Urban: impact of extraction
solvent polarity. Journal of Pharmacognosy and Phytochemistry. 1(6): 27-32.
Rahmani, W., Abbasi, S., Hagner, A., Raharjo, E., Kumar, R., Hotta, A., Magness, S., Metzger,
D., and Biemaskie, J. 2014. Hair follicle dermal stem cells regenerate the dermal sheath,
repopulate the dermal papilla, and modulate hair type. Developmental Cell. 31(5): 543-
558. https://doi.org/10.1016/j.devcel.2014.10.022
Ramesh, B.N., Girish, T.K., Raghavendra, R.H., Naidu, K.A., Rao, U.J., and Rao, K.S. 2014.
Comparative study on anti-oxidant and anti-inammatory activities of Caesalpinia
crista and Centella asiatica leaf extracts. Jornal of Pharmacy and Bioallied Sciences.
6(2): 86-91. https://doi.org/10.4103/0975-7406.129172
Rho, S.S., Park, S.J., Hwang, S.L., Lee, M.H., Kim, C.D., Lee, I.H., Chang, H.Y., and Rang,
M.J. 2005. The hair growth promoting eect of Asiasari radix extract and its molecular
regulation. Journal of Dermatological Science. 38(2): 89-97. https://doi.org/10.1016/j.
jdermsci.2004.12.025
Roy, D.C., Barman, S.K., and Shaik, M.M. 2013. Current updates on Centella asiatica:
phytochemistry, pharmacology and traditional uses. Medicinal Plant Research. 3(4):
20-36. https://doi.org/10.5376/mpr.2013.03.0004
Saikia, S., Dutta, H., Saikia, D., and Mahanta, C.L. 2012. Quality characterization and
estimation of phytochemical content and antioxidant capacity of aromatic pigmented
and non-pigmented rice varieties. Food Research International. 46(1): 334-340. https://
doi.org/10.1016/j.foodres.2011.12.021
Shalaby, E.A., and Shanab, S.M.M. 2013. Comparision of DPPH and ABTS assays for
determining antioxidant potential of water and methanol extracts of Spirulina platensis.
Indian Journal of Geo-Marine Sciences. 42(5): 556-564.
Shin, D.H., Cha, Y.J., Yang, K.E., Jang, I.S., Son, C.G., Kim, B.H., and Kim, J.M. 2014.
Ginsenoside Rg3 up-regulates the expression of vascular endothelial growth factor in
human dermal papilla cells and mouse hair follicles. Phytotherapy Research. 28(7):
1088-1095. https://doi.org/10.1002/ptr.5101
CMU J. Nat. Sci. (2018) Vol. 17(1) 37
Soma, T., Dohrmann, C.E., Hibino, T., and Raftery, L.A. 2003. Prole of transforming
growth factor-beta responses during the murine hair cycle. Journal of Investigative
Dermatology. 121(5): 969-975. https://doi.org/10.1046/j.1523-1747.2003.12516.x
Soulitzis, N., Karyotis, I., Delakas, D., and Spandidos, A. 2006. Expression analysis of peptide
growth factors VEGF, FGF2, TGFB1, EGF and IGF1 in prostate cancer and benign
prostatic hyperplasia. International Journal of Oncology. 29: 305-314.
Taemchuay, D., Rukkwamsuk, T., Sakpuaram, T., and Ruangwises, N. 2009. Antibacterial
activity of crude extracts of centella asiatica against staphylococcus aureus in bovine
mastitis. Kasetsart Veterinarians. 19(3): 1-10.
Wang, L., Qiu, P., Long, X.F., Zhang, S., Zeng, Z.G., and Tian, Y.Q. 2016. Comparative analysis
of chemical constituents, antimicrobial and antioxidant activities of ethylacetate of
Polygonum cuspidatum and its endophytic actinomycete, Streptomyces sp. A0916.
Chinese Journal of Natural Medicines. 14(2): 117-123. https://doi.org/10.1016/S1875-
5364(16)60004-3
Yano, K., Brown, L.F., and Detmar, M. 2001. Control of hair growth and follicle size by
VEGF-mediated angiogenesis. The Journal of Clinical Investigation. 107(4): 409-417.
https://doi.org/10.1172/JCI11317
... The free radical scavenging activities of Melientha ethanol extract and fractions were measured by two methods. The DPPH inhibition assay and the ABTS inhibition assay was performed and slightly modified as described by previous studies (Abramovič et al., 2018;Saansoomchai et al., 2018). With treatments of various concentrations of the ethanol extract and fractions, the decrease in absorbance was measured at 517 nm for the DPPH assay and 735 nm for the ABTS assay and the IC50 values were also reported. ...
... Total phenolic content (TP) and total flavonoid content (TF) were determined using the Folin-Ciocalteu assay and aluminium chloride colorimetric assay, respectively, as was described by previous studies with minor modifications (Saansoomchai et al., 2018). Quantification was expressed as milligram gallic acid equivalent per gram extract (mg GE/g) for TP and milligram catechin equivalent per gram extract (mg CE/g) for TF. ...
... Melientha extract has been reported to possess various bioactive compounds such as terpenes, flavonoids and polyphenols, which are related to its potent antioxidative activities (Charoenchai et al., 2015). This active fraction has been linked to the solvent polarity that can extract different fractions of polar/nonpolar constituents out of the plant (Saansoomchai et al., 2018). The Moringa oleifera extracts that found in this area also showed the antioxidant activities (Fitriana et al, 2016). ...
Article
The ultimate aim of this study was to evaluate antioxidant activities using DPPH and ABTS assay and antioxidant substances of Melientha suavis Pierre (Melientha) extracts with ethanol (EtOH) and subsequent partition with hexane, dichloromethane (CH2Cl2), ethyl acetate (EtOAc) and distilled water (W). The Melientha extract was assessed the sunscreen activities by sun protection factor which was compared with octyldimethyl PABA. Additionally, the stability test of Melientha extracts added in the cosmetic base-formula was investigated. The sun protection substances of Melientha extracts were determined by GC-MS analysis. Among the extract and fractions, the ethanolic extract showed the highest activities. The IC50 of Melientha extract to free radical scavenging determined by DPPH assay and ABTS assay were 53.20 ± 7.37 μg/ml and 64.17 ± 5.76 μg/ml, respectively. The total phenolic compound of ethanol extract was 149.87 ± 2.72 mg GE/g of ext and total flavonoid content was 51.60 ± 4.12 mg CE/g of ext. The sun protection factor (SPF) of ethanol extract was 26.61 ± 0.10. Cinamate and its derivative which were claim as sunscreen substance was found by GC-MS analysis of Melientha ethanol extract.
... Red jasmine rice extract has been reported to possess various bioactive compounds such as flavonoids and polyphenols, related to its potent anti-oxidative activities 3, 6 . The active W extracts has been linked to the solvent polarity that can extract different fractions of polar/nonpolar constituents out of the plant 13 . The polysaccharides extract from rice brans found in this area also showed the anti-oxidant and antimicrobial activities 3 . ...
... Two methods measured the free radical scavenging activity of rice bury crude extract. The DPPH inhibition assay and the ABTS inhibition assay were performed and slightly modified as described by previous studies 13,22 . With treatments of various extract concentrations, the decrease in absorbance was measured at 517 nm for the DPPH assay, and 735 nm for the ABTS assay, and the percentage of inhibition and IC50 value were also reported. ...
... Total phenolic content (TP) and total flavonoid content (TF) were determined using the Folin-Ciocalteu assay and aluminium chloride colorimetric assay, respectively, as was described by previous studies with minor modifications 13 . Quantification was expressed as milligram gallic acid equivalent per gram extract (mg GE/g of extracts) for TP and milligram catechin equivalent per gram extract (mg CE/g of extracts) for TF. ...
Research
Full-text available
Red jasmine rice is recognized as a healthy food with high phenolic compounds. These compounds present antibacterial and anti-free radical properties. Moreover, colored rice exhibits a biological activity against anticancer. Objectives of this study are 1) exploring a biological screening and cell viability of 70% ethanol and aqueous extracts of red jasmine rice, 2) investigating cytotoxicity to fibroblast NIH3T3 (IC80) that is one hundred cells were found cell viability 80 cells. Red jasmine rice extracts were dried and transformed into a powder using the freeze-drying method. The extracts were treated with fibroblast NIH3T3 for MTT. The highest of IC50 of red jasmine rice extract to scavenge the DPPH and ABTS radicals was found in ethanol extract (53.20±7.37 and 64.17±5.76, respectively). The experiment showed that the ethanol and aqueous extract of red rice did not show cytotoxicity to fibroblast NIH3T3 (IC80). The extracts of red rice show the biological screening of anti-oxidation with total phenolic compounds and flavonoid contents. Moreover, it does not modify the physical properties of the cream formula. It can be concluded that the red rice extract is highly promising for the value addition.
... The ethanolic extract of this plant can promote hair growth via enhancing VEGF expression in HFDP cells. The major active compound of C. asiatica is asiaticoside [47]. Therefore, this compound was also selected to compare the activity with tea seed oil in this study. ...
Article
Full-text available
Synthetic drugs used to treat hair loss cause many side-effects. Natural tea seed oil possesses many activities that can suppress hair loss. However, it is oily and sticky in direct application. In this study, tea seed oil loaded nanostructured lipid carriers (NLC) using Tween 80 (NLC-T), Varisoft 442 (NLC-V), and a combination of both surfactants (NLC-C) was developed. The obtained nanoformulations showed spherical particles in the size range 130–430 nm. Particle size and size distribution of NLC-C and NLC-T after storage at 4, 25, and 40 °C for 90 days were unchanged, indicating their excellent stability. The pH of NLC-T, NLC-V, and NLC-C throughout 90 days remained at 3, 4, and 3.7, respectively. NLC-C showed significantly greater nontoxicity and growth-stimulating effect on human follicle dermal papilla (HFDP) cells than the intact oil. NLC-T and NLC-V could not stimulate cell growth and showed high cytotoxicity. NLC-C showed melting point at 52 ± 0.02 °C and its entrapment efficiency was 96.26 ± 2.26%. The prepared hair serum containing NLC-C showed better spreading throughout the formulation than that containing the intact oil. Using 5% NLC-C showed a 78.8% reduction in firmness of the hair serum while enhancing diffusion efficiency by reducing shear forces up to 81.4%. In conclusion, the developed NLC-C of tea seed oil is an effective alternative in stimulating hair growth. Hair serum containing NLC-C obviously reduces sticky, oily, and greasy feeling after use.
... In vitro studies have demonstrated the anti-hyaluronidase and anti-elastase potential of the C asiatica extract, besides the matrix metalloproteinase-1inhibition (MMP-1) [5]. The C. asiatica extract can stimulate collagen synthesis, upregulate aquaporins −3 (AQCP3) expression [14], and promote free radical scavenging activity [10,23]. Besides that, he extract has been shown to be an efficient skin protector against UV radiation [13], comparable with OMC (octyl methoxy cinnamate) in its protection against UVB absorbance, showing its potential as a natural protector against UVB damage [10]. ...
Article
Full-text available
Nanoparticle technology plays an important role in loading active ingredients and being able to increase their stability and performance. In this work, Centella asiatica extract, a plant with known dermatological and cosmetic applications, was incorporated into colloidal polymer nanocarriers, dispersed in silicophilic medium. Nanocarriers were prepared and characterized for particle size (Dynamic Light Scattering), morphology (Scanning Electron Microscopy) and entrapment efficiency of madecassoside. Physical and chemical stability of the encapsulated extract was monitored for 60 days of storage under specific conditions (25 and 40 °C), quantifying the content of madecassoside by HPLC and the particle size distribution. In vitro safety assays, including halo diffusion, cell viability and cell transformation assay were evaluated for free and encapsulated extracts. Nanocarriers showed an average diameter around 210 nm (Polidispersity Index—PDI 0.2) and the entrapment efficiency of 97.7%. The concentration of madecassoside remained stable over time, indicating that the nanocarriers proposed here were able to protect madecassoside against degradation. In addition, nanocarriers showed non-cytotoxic effects and did not induce cell transformation.
Article
Full-text available
Hair disorders such as hair loss (alopecia) and androgen dependent, excessive hair growth (hirsutism, hypertrichosis) may impact the social and psychological well‐being of an individual. Recent advances in understanding the biology of hair have accelerated the research and development of novel therapeutic and cosmetic hair growth agents. Preclinical models aid in dermocosmetic efficacy testing and claim substantiation of hair growth modulators. The in vitro models to investigate hair growth utilize the hair follicle Dermal Papilla cells (DPCs), specialized mesenchymal cells located at the base of hair follicle that play essential roles in hair follicular morphogenesis and postnatal hair growth cycles. In this review, we have compiled and discussed the extensively reported literature citing DPCs as in vitro model to study hair growth promoting and inhibitory effects. A variety of agents such as herbal and natural extracts, growth factors and cytokines, platelet‐rich plasma, placental extract, stem cells and conditioned medium, peptides, hormones, lipid‐nanocarrier, light, electrical and electromagnetic field stimulation, androgens and their analogs, stress‐serum and chemotherapeutic agents etc. have been examined for their hair growth modulating effects in DPCs. Effects on DPCs’ activity were determined from untreated (basal) or stress induced levels. Cell proliferation, apoptosis and secretion of growth factors were included as primary end‐point markers. Effects on a wide range of biomolecules and mechanistic pathways that play key role in the biology of hair growth were also investigated. This consolidated and comprehensive review summarizes the up‐to‐date information and understanding regarding DPCs based screening models for hair growth and may be helpful for researchers to select the appropriate assay system and biomarkers. This review highlights the pivotal role of DPCs in the forefront of hair research as screening platforms by providing insights into mechanistic action at cellular level, which may further direct the development of novel hair growth modulators. This article is protected by copyright. All rights reserved.
Article
Full-text available
ABSTRAK Keupayaan Centella asiatica (CA) untuk bertindak sebagai antioksidan dan agen anti-radang telah banyak dilaporkan. Namun begitu, kaedah pengekstrakan CA untuk memperoleh hasil yang terbaik masih dipersoalkan. Dalam kajian ini, kami menilai tiga kaedah pengekstrakan CA dan membuat perbandingan ekstrak dari segi aktiviti antioksidan dan anti-radang, dan juga kandungan sebatian bioaktif, asiaticoside dan madecassoside. Centella asiatica diekstrak menggunakan pelarut etanol, metanol dan juga air. Kandungan sebatian fenolik ekstrak diukur menggunakan kaedah reagen Folin-Ciocalteu. Kandungan asiaticoside dan madecassoside ditentukan dengan kaedah HPLC. Aktiviti antioksidan diukur dengan asai 2,2-diphenyl-1-picrylhydrazyl (DPPH) dan asai penurunan kuasa Ferric Reducing Antioxidant Power (FRAP). Aktiviti anti-radang ditentukan dengan kebolehan ekstrak untuk merencatkan enzim tapakjalan keradangan, COX-1 dan COX-2, serta kebolehan ekstrak melindungi sel fibroblas aruhan 12-O-tetradecanoylphorbol-13-acetate (TPA) daripada menghasilkan prostaglandin E 2 (PGE 2). Hasil kajian menunjukkan aras sebatian fenolik, asiaticoside dan madecassoside tertinggi dalam ekstrak etanol, diikuti metanol dan esktrak akues (masing-masing 17.76 g/100g, 15.52 g/100g, 13.16 g/100g untuk sebatian fenolik, 42.86 mg/g, 36.37 mg/g, 2.82 mg/g untuk asiaticoside and 18.66 mg/g, 15.87 mg/g, 3.75 mg/g untuk madecassoside). Ketiga-tiga ekstrak menunjukkan aktiviti antioksidan sederhana berbanding kawalan positif. Kesemua ekstrak, asiaticoside dan madecassoside merencat COX-1 dan COX-2 dan menyekat penghasilan PGE 2 -aruhan TPA. Ekstrak etanol dan metanol merupakan perencat COX yang lebih kuat dan lebih poten daripada ekstrak akues. Oleh itu, walaupun ekstrak akues menunjukkan kebolehan antioksidan yang lebih tinggi, dari segi aktiviti anti-radang, pelarut hidrofobik iaitu etanol dan metanol ternyata lebih baik untuk mengekstrak Centella asiatica. Kata kunci: Antioksidan, anti-radang, ekstrak Centella asiatica, asiaticoside, madecassoside ABSTRACT The potential of Centella asiatica (CA) as an antioxidant and anti-inflammatory agent has been well described. However the extraction method which gives the best yield is debatable. In this study, we evaluated three different methods of extractions and compared the extracts in terms of antioxidant, anti-inflammatory activities as well as the contents of its bioactive compounds, asiaticoside and madecassoside. Centella asiatica was extracted using ethanol, methanol and aqueous extraction methods. The extracts were then measured for their phenolic contents using Folin-Ciocalteu reagent. Asiaticoside and madecassoside were determined using HPLC. Antioxidant activity was measured using the 2,2-diphenyl-1-picrylhydrazyl (DHPP) and ferric reducing antioxidant power (FRAP) assays. Anti-inflammatory activities were determined by the ability of the extracts to inhibit the inflammatory pathway enzyme, COX-1 and COX-2 as well as their ability to protect fibroblasts against 12-O-tetradecanoylphorbol-13-acetate (TPA) -induced production of prostaglandin E 2 (PGE 2). Results showed that the level of phenolic constituents, asiaticoside and madecassoside were highest in the ethanol, followed by methanol and then aqueous extracts (17.76 g/100g, 15.52 g/100g, 13.16 g/100g for phenolics, 42.86 mg/g, 36.37 mg/g, 2.82 mg/g for asiaticoside and 18.66 mg/g, 15.87 mg/g, 3.75 mg/g for madecassoside respectively. All extracts showed considerable antioxidant activity compared to the positive controls. The extracts, asiaticosside and madecassoside inhibited both COX-1 and COX-2 and suppressed the TPA-induced production of PGE 2 . The ethanol and methanol extracts were stronger COX inhibitors and more potent suppressor of PGE 2 formation than aqueous extract. Thus although the aqueous extract showed higher antioxidant potential, in terms of anti-inflammatory activities, the hydrophobic solvents, ethanol and methanol, proved to be the better extraction method for Centella asiatica.
Article
Full-text available
ABSTRACT Objective: The present study was carried out in order to study the hair growth activity of some traditional herbal medicinal plants. Herbal traditional drugs are used frequently in therapeutics; more often their chief principles are employed in a more specific manner. Method: Centella asiatica, Cyperus rotundus & Emblica officinalis alcoholic and aqueous extract were prepared and evaluated for the hair growth properties using albino rats. The hair growth formulation was formulated as hair oil and applied topically on shaved skin of rats. Primary skin irritation test, hair length, hair density test were performed. The hair growth-promoting efficacies were evaluated at 0 day, 10 days, 15 days, and 20 days after the application through the hair re-growth area significant hair growth was observed and the hair growth was compared with the standard drug used 2% solution of minoxidil. Result: The result revealed that the hair growth activity of each drug was found proportional to the concentration range tested and compared with standard (2% minoxidil ethanolic solution) by an enlargement of follicular size and prolongation of the anagen phase. It holds the promise of potent herbal alternative for minoxidil. Conclusion: Excellent results of hair growth were observed in formulations prepared by cloth pouch decoction method for preparation of hair oils.
Article
Full-text available
Background Androgenic alopecia (AGA) is a major type of human scalp hair loss, which is caused by two androgens: testosterone (T) and 5α-dihydrotestosterone (5α-DHT). Both androgens bind to the androgen receptor (AR) and induce androgen-sensitive genes within the human hair dermal papilla cells (HHDPCs), but 5α-DHT exhibits much higher binding affinity and potency than T does in inducing the involved androgen-sensitive genes. Changes in the induction of androgen-sensitive genes during AGA are caused by the over-production of 5α-DHT by the 5α-reductase (5α-R) enzyme; therefore, one possible method to treat AGA is to inhibit this enzymatic reaction. Methods RT-PCR was used to identify the presence of the 5α-R and AR within HHDPCs. A newly developed AGA-relevant HHDPC-based assay combined with non-radioactive thin layer chromatography (TLC) detection was used for screening crude plant extracts for the identification of new 5α-R inhibitors. Results HHDPCs expressed both 5α-R type 1 isoform of the enzyme (5α-R1) and AR in all of the passages used in this study. Among the thirty tested extracts, Avicennia marina (AM) displayed the highest inhibitory activity at the final concentration of 10 μg/ml, as the production of 5α-DHT decreased by 52 % (IC50 = 9.21 ± 0.38 μg/ml). Conclusions Avicennia marina (AM) was identified as a potential candidate for the treatment of AGA based on its 5α-R1-inhibitory activity.
Article
Full-text available
Present research was to evaluate and compare the antiradical and antioxidant activities of extracts from Spirulina platensis. In the present study, three extracts (Water, absolute methanol and 50% methanol in water) were analyzed for the total phenolic compounds, phycobiliprotein content: Antiradical and antioxidant activities were evaluated using 2,2-diphenyl-1-picrylhydrazyl (DPPH•) and 2,2-azinobis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging methods at 100 and 200 μg/mL. Results revealed that, absolute methanol extract recorded the highest number of antiradical units 1 mg extract followed in descending order by that of water while the lowest number was that of aqueous methanol (against DPPH and ABTS radical methods) and these correlated with chemical constituents of extract from phenolic and phycobiliprotein compounds. It is elucidated that selection of the cyanobacterium (Spirulina platensis) very important for consumer's health, as it is considered as potential sources of dietary antioxidants.
Article
Full-text available
Advances in cell culture methods, multidisciplinary research, clinical need to replace lost skin tissues and regulatory need to replace animal models with alternative test methods has led to development of three dimensional models of human skin. In general, these in vitro models of skin consist of keratinocytes cultured over fibroblast-populated dermal matrices. Accumulating evidences indicate that mesenchyme-derived signals are essential for epidermal morphogenesis, homeostasis and differentiation. Various studies show that fibroblasts isolated from different tissues in the body are dynamic in nature and are morphologically and functionally heterogeneous subpopulations. Further, these differences seem to be dictated by the local biological and physical microenvironment the fibroblasts reside resulting in "positional identity or memory". Furthermore, the heterogeneity among the fibroblasts play a critical role in scarless wound healing and complete restoration of native tissue architecture in fetus and oral mucosa; and excessive scar formation in diseased states like keloids and hypertrophic scars. In this review, we summarize current concepts about the heterogeneity among fibroblasts and their role in various wound healing environments. Further, we contemplate how the insights on fibroblast heterogeneity could be applied for the development of next generation organotypic skin models.
Article
Full-text available
The dermal papilla (DP) provide instructive signals required to activate epithelial progenitors and initiate hair follicle regeneration. DP cell numbers fluctuate over the hair cycle, and hair loss is associated with gradual depletion/atrophy of DP cells. How DP cell numbers are maintained in healthy follicles remains unclear. We performed in vivo fate mapping of adult hair follicle dermal sheath (DS) cells to determine their lineage relationship with DP and found that a subset of DS cells are retained following each hair cycle, exhibit self-renewal, and repopulate the DS and the DP with new cells. Ablating these hair follicle dermal stem cells and their progeny retarded hair regrowth and altered hair type specification, sug- gesting that they function to modulate normal DP function. This work identifies a bipotent stem cell within the adult hair follicle mesenchyme and has important implications toward restoration of hair growth after injury, disease, and aging.
Article
Reactive oxygen species [ROS] cause oxidative damage to the tissues and protection from such damages are provided by endogenous and exogenous antioxidants. Plant based antioxidants are preferred due to the multiple mechanisms of actions and of the phytochemicals present in them. 80% alcoholic extract of leaves of Aloe vera, Bacopa monniera, Moringa oleifera and rhizome of Zingiber officinale was tested individually and in combination in equal proportion of each extract for DPPH scavenging activity and reducing power. The results indicate that the combination of the extract has better DPPH scavenging action and reducing power compared to the individual plant extract indicating synergistic and supra additive effect of phytochemicals present in the extract.