Influences of oceanic islands and the Pleistocene on the biogeography and evolution of two groups of Australasian parrots (Aves: Psittaciformes: Eclectus roratus, Trichoglossus haematodus complex). Rapid evolution and implications for taxonomy and conservation

Abstract

The Australasian region is a centre of biodiversity and endemism, mainly based on the tropical climate in combination with the large amount of islands. During the Pleistocene, islands of the Sahul Shelf (Australia, New Guinea, Aru Islands) had been part of the same land mass, while islands within the Wallacea (Lesser Sunda Islands, Moluccas, Sulawesi etc.) remained isolated. We investigated biogeographical avian diversification patterns of two species complexes across the Wallacea and the Sahul Shelf: the Eclectus Parrot Eclectus roratus Wagler, 1832, and the Rainbow Lorikeet Trichoglossus haematodus Linnaeus, 1771. Both species are represented by a large number of described geographical subspecies. We used mitochondrial cytochrome b (cyt b) sequences for phylogenetic and network analysis to detect biogeographic roles of islands and avian diversification patterns. The number of threatened taxa in this region is increasing rapidly and there is an urgent need for (sub-)species conservation in this region. Our study provides first genetic evidence for treating several island taxa as distinct species. In both species complexes similar genetic patterns were detected. Genetic diversification was higher across the islands of the Wallacea than across the islands of the Sahul Shelf. Divergence in E. roratus can be dated back about 1.38 million years ago, whereas in the younger T. haematodus it was 0.80 million years ago. Long distance dispersal was the most likely event for distribution patterns across the Wallacea and Sahul Shelf. The geographic origin of the species-complex Eclectus roratus spp. is supposed to be Wallacean, but for the species-complex Trichoglossus haematodus spp. it is supposed to be non-Wallacean. Trichoglossus euteles, so far considered a distinct species, clearly belongs to the Trichoglossus-haematodus-complex. The only case of sympatry in the complex is the distribution of T. (h.) euteles and T. h. capistratus on Timor, which means a rapid evolution from one ancestor into two distinct species within only 800,000 years. For all other taxa a Checkerboard distribution pattern is present. In this complex, 8 taxa are already treated as separate species (del Hoyo et al. 2014). Based on genetic evidence, the following populations are supported to represent phylogenetic units: (1) N New Guinea (haematodus) incl. Biak (rosenbergii), Bismarck Archipelago (massena), and New Caledonia (deplanchii); (2) Flores (weberi); (3) E Australia (moluccanus) incl. Aru Islands (nigrogularis) and S New Guinea (caeruleiceps); (4) N Australia (rubritorquis); (5) Timor 1st lineage (capistratus) incl. Sumba (fortis); (6) Bali and Lombok (mitchellii); (7) Sumbawa (forsteni); (8) Timor 2nd lineage (euteles). Those 8 phylogenetic units are not identical to the 8 species listed by del Hoyo et al. (2014). Several populations on smaller islands are under decline, a separate species status may lead to a higher conservation status in both species complexes, which are currently listed as “Least Concern”. Eclectus roratus is currently treated as monospecific. Based on genetic evidence, the following populations are suggested being treated as valid species: (1) Sumba (Eclectus cornelia), (2) Tanimbar Islands (E. riedeli), (3) Moluccas (E. roratus), and (4) New Guinea (E. polychloros incl. Aru Islands (E. aruensis), and Solomon Island (E. solomonensis).

Full text

EUROPEAN JOURNAL OF ECOLOGY
European Journal of Ecology
47
Geological background and Pleistocene inuence on Aus-
tralasia
The Indo-Malayan or Australasian region underwent sev-
eral major geological periods, a good overview is given in
Hall (2002). New Guinea collided with the East Philippines-
Halmahera system 25 Ma, resulng in a rotaon of the Phil-
ippine Sea Plate. Since 25 Ma the Pacic Plate and Australia
are moving, causing rotaons and sending microconnental
fragments to SE Asia. About 5 Ma boundaries and plate mo-
ons changed again. The region was and sll is changing at
a rapid rate based on plate tectonics and volcanic acvity. A
complex geological paern is observed in Sulawesi. While
West Sulawesi originates from the Sunda Shelf in SE Asia, East
Sulawesi originates from the Australian plate; both merged
Inuences of oceanic islands and the
Pleistocene on the biogeography and evoluon
of two groups of Australasian parrots (Aves:
Psiaciformes: Eclectus roratus, Trichoglossus
haematodus complex). Rapid evoluon and
implicaons for taxonomy and conservaon
EJE 2017, 3(2): 47-66, doi: 10.1515/eje-2017-0014
Michael P. Braun1*, Matthias Reinschmidt2, Thomas Datzmann3, David Waugh2, Rafael Zamora2, Annett
Häbich2, Luís Neves2, Helga Gerlach2, Thomas Arndt4, Claudia Mettke-Hofmann5, Hedwig Sauer-Gürth1 &
Michael Wink1
1Heidelberg University,
Institute of Pharmacy
and Molecular Biotech-
nology, Dep. Biology,
Im Neuenheimer Feld
364, 69120 Heidelberg,
Germany
*Corresponding author,
E-mail: psittaciden@
yahoo.de
2Loro Parque Fundacíon,
Camino Burgado, 38400
Puerto de la Cruz (Tener-
ife), Spain
3Senckenberg Collection
of Natural History Dres-
den Museum of Zoology,
Koenigsbruecker Landstr.
159, 01109 Dresden,
Germany
4Thomas Arndt, Brück-
enfeldstraße 28, 75015
Bretten, Germany
5School of Natural
Sciences & Psychology,
Liverpool John Moores
University, Byrom Street,
Liverpool, L3 3AF,
United Kingdom
The Australasian region is a centre of biodiversity and endemism, mainly based on the tropical climate in com-
bination with the large amount of islands. During the Pleistocene, islands of the Sahul Shelf (Australia, New
Guinea, Aru Islands) had been part of the same land mass, while islands within the Wallacea (Lesser Sunda Is-
lands, Moluccas, Sulawesi etc.) remained isolated. We investigated biogeographical avian diversication patterns
of two species complexes across the Wallacea and the Sahul Shelf: the Eclectus Parrot
Eclectus roratus
Wagler,
1832, and the Rainbow Lorikeet
Trichoglossus haematodus
Linnaeus, 1771. Both species are represented by a
large number of described geographical subspecies. We used mitochondrial cytochrome
b
(cyt
b
) sequences for
phylogenetic and network analysis to detect biogeographic roles of islands and avian diversication patterns.
The number of threatened taxa in this region is increasing rapidly and there is an urgent need for (sub-)species
conservation in this region. Our study provides rst genetic evidence for treating several island taxa as distinct
species.
In both species complexes similar genetic patterns were detected. Genetic diversication was higher across the
islands of the Wallacea than across the islands of the Sahul Shelf. Divergence in
E. roratus
can be dated back
about 1.38 million years ago, whereas in the younger
T. haematodus
it was 0.80 million years ago. Long distance
dispersal was the most likely event for distribution patterns across the Wallacea and Sahul Shelf. The geographic
origin of the species-complex
Eclectus roratus
spp. is supposed to be Wallacean, but for the species-complex
Trichoglossus haematodus
spp. it is supposed to be non-Wallacean.
Trichoglossus euteles
, so far considered a
distinct species, clearly belongs to the
Trichoglossus-haematodus
-complex. The only case of sympatry in the
complex is the distribution of
T. (h.) euteles
and
T. h. capistratus
on Timor, which means a rapid evolution from
one ancestor into two distinct species within only 800,000 years. For all other taxa a Checkerboard distribution
pattern is present. In this complex, 8 taxa are already treated as separate species (del Hoyo et al. 2014). Based
on genetic evidence, the following populations are supported to represent phylogenetic units: (1) N New Guinea
(
haematodus
) incl. Biak (
rosenbergii
), Bismarck Archipelago (
massena
), and New Caledonia (
deplanchii
); (2)
Flores (
weberi
); (3) E Australia (
moluccanus
) incl. Aru Islands (
nigrogularis
) and S New Guinea (
caeruleiceps
);
(4) N Australia (
rubritorquis
); (5) Timor 1st lineage (
capistratus
) incl. Sumba (
fortis
); (6) Bali and Lombok
(
mitchellii
); (7) Sumbawa (
forsteni
); (8) Timor 2nd lineage (
euteles
). Those 8 phylogenetic units are not identi-
cal to the 8 species listed by del Hoyo et al. (2014). Several populations on smaller islands are under decline, a
separate species status may lead to a higher conservation status in both species complexes, which are currently
listed as “Least Concern”.
Eclectus roratus
is currently treated as monospecic. Based on genetic evidence, the
following populations are suggested being treated as valid species: (1) Sumba (
Eclectus cornelia
), (2) Tanimbar
Islands (
E. riedeli
), (3) Moluccas (
E. roratus
), and (4) New Guinea (
E. polychloros
incl. Aru Islands (
E. aruensis
),
and Solomon Island (
E. solomonensis
).
INTRODUCTION
ABSTRACT
avifauna; Checkerboard distribution; vicariance; dispersal; island biogeography; geographic isolation; Indone-
sia; Loriidae; population genetics; Psittacidae
KEYWORDS
© 2017 Michael P. Braun et al.
This is an open access article distributed under the Creative Commons Attribution-NonCommercial-NoDerivs license

EUROPEAN JOURNAL OF ECOLOGY
48
in the late Miocene. Moreover, the Lesser Sunda Islands are of
dierent origin and its current formaon became part of the
Wallacea during the past 0-15 million years (Hall 2002).
The Australasian region includes Australia, New Zea-
land, New Guinea and the Wallacea, see Figure 1. The region
is a hotspot of biodiversity and endemism (Marsden & Fielding
1999; Carstensen et al. 2012). The Wallacea is a biogeographic
region including the Lesser Sunda Islands, Sulawesi, and the
Moluccas, it is located between the Orientalis (S Asia) and
the Australis (Australia, New Guinea, and New Zealand). The
Wallacea is dened as a transion zone between the Indoma-
layan and the Australian fauna using Wallace’s line (birds) as
the western border and Lydekker’s line (mammals) as the east-
ern border (Lydekker 1896; Newton 2003; Wallace 1876), see
Figure 1. Pleistocene sea level changes had a strong inuence
on the shoreline of Australasia (Figure 1). When glaciaons oc-
curred in the northern hemisphere, sea levels were usually low,
whereas a rise in sea levels occurred during warm periods. Dur-
ing the last glacial maximum (18,000 years BP), with a sea level
of 120 to 130 m below the current shoreline, Australia, New
Guinea and the Aru archipelago were part of the same land
mass of the Sahul Shelf (Lavering 1993; Voris 2000). The cli-
mate of N Australia was drier than today, leading to an increase
of grassland replacing eucalypt forests (Van der Kaars 1991).
Avifauna of the Wallacea
In general, 17% of all land bird species occur on islands, but the
land birds of Australasia hold the highest proporon of island
Figure 1. Australasian region including the Wallacea. Regions shaded in grey represent land mass, white regions represent sea. A: current sea level;
B: sea level of 120 m below the current shoreline (18,000 years BP). The islands of the Wallacea (shape) remained isolated both from the Sunda
and Sahul Shelf during the Pleistocene (Voris 2000). During the last Pleistocene, Australia, New Guinea and the Aru Islands were part of the same
land mass (Sahul Shelf). Map by courtesy of H. Voris, Fieldmuseum Chicago.
.

EUROPEAN JOURNAL OF ECOLOGY
49
taxa with a total of 36% (Newton 2003). Endemism is high in the
Wallacean avifauna, with 64% of endemic bird species both in
the Moluccas and Lesser Sunda Islands (Carstensen et al. 2012).
The avifauna of the Wallacea has been a research object for
ornithologists and evoluonary biologists since the me of Al-
fred Russel Wallace and Ernst Mayr (Wallace 1869; Mayr 1941).
Parrots are abundant in the Wallacea and are sll an object of
current research (Marsden & Fielding 1999). 111 parrot species
are threatened with exncon worldwide, represenng 28% of
all parrot species (Olah et al. 2016). It should be recalled that
Australasia is one of the regions with the highest number of
threatened parrot taxa (Collar 2000).
Dispersal, colonizaon, and island evoluon
Dispersal is regarded as a fragmentaon process that can lead
to speciaon (Newton 2003). The ability to colonize new islands
is a key feature of organisms in island biogeography. The ‘spe-
cies-area’ relaonship describes the theory that species num-
bers increase with island size and with proximity to a coloniza-
on source (MacArthur & Wilson 1967; Newton 2003). Given
that relaonship, the number of nave species is approximately
doubling with every ten-fold increase in the land surface area
(Newton 2003).
Colonizaon is dependent on the abundance within
a species’ range, which is a mixture between source and sink
areas. Highest densies (source areas) are mostly found in
the centre of the range (Newton 2003). Source areas enable
a species to produce a surplus of ospring, which are able to
colonize other areas. Sink areas, on the other hand, are most
likely to occur in range boundaries, where condions become
less suitable and populaons oen depend on immigraon
(Newton 2003). While some bird families like herons, rails, par-
rots, pigeons, or kingshers are generally successful colonizers
of oceanic islands, others like pelicans, storks, larks, pheasants,
or birds of paradise are less successful colonizers (Begon et al.
1998). The colonizaon of islands may lead to rapid evoluon
in morphology and behaviour through founder events. As an
example, ightlessness and considerably modied skeleton in
Aldabra White-throated Rail (Dryolimnas cuvieri aldabranus)
may be aained in less than 80,000 years (Newton 2003). The
evoluon of four to ve disnct bird taxa in Northern Melane-
sia occurred within only 300 years (Mayr & Diamond 2001). A
rapid morphological evoluon within only 10 generaons was
detected in introduced ‘habitat island’ bird populaons: intro-
duced Asian Ring-necked Parakeets (Psiacula krameri) in cies
of Europe have broader beaks, longer skulls and longer wings
than in their nave range (Le Gros et al. 2016).
Wallacea vs. Sahul Shelf: Is there a biogeographical paern
which can be explained by the two parrot species complexes?
The Islands of the Wallacea have been geographically isolated
over several millions of years, while the land mass of the Sahul
Shelf connected Australia and New Guinea unl 18,000 years
BP (Voris 2000). Two main quesons arise from this seng.
1) Do bird populaons on shelf islands, that were connected
by land bridges during the Pleistocene, show similar genet-
ic distances when compared to populaons within several
million year old oceanic islands?
2) Is the Wallacea an origin of endemism or are source popu-
laons (ancestral origins) located outside the Wallacea?
Can we assign ancestral lineages to the Wallacea or Sahul
Shelf?
In order to invesgate these quesons, two groups of parrots
nave to the Australasian region were chosen: the Eclectus-
roratus- and the Trichoglossus-haematodus-complex. Their dis-
tribuon paerns are located both inside and outside the Wal-
lacea. For Trichoglossus haematodus, the origin was suggested
to be located in New Guinea with several colonizaon events
to the Wallacea and Australia (see Forshaw 1977). No coloniza-
on scenario has been suggested so far for the species Eclec-
tus roratus. In order to understand the eects of geographical
isolaon on these bird populaons, a haplotype network and
phylogenec analysis were performed.
Study species
Study species 1: Eclectus Parrot Eclectus roratus Wagler, 1832
The Eclectus Parrot, a rain forest dweller (deciduous forest on
Sumba), is known for its well-dened reverse sexual dichroma-
sm: males are greenish and females are red and blue (Forshaw
2006). Furthermore the polyandrous mang system (up to sev-
en males for one female) in this species is unusual in parrots
and some females are known to produce consecuve chicks of
the same sex (Heinsohn et al. 1997). Breeding success in wild
birds is low in this species, only 18% of eggs and 27% of clutches
produced a edgling (Heinsohn & Legge 2003). The greenish
males y long distances to feed the female and brood, and
need to camouage themselves from predators while the red-
and-bluish females compete for rare nest holes (Heinsohn et
al. 2005). Although the sex rao of nestlings is equal, the adult
sex rao in the populaon is skewed towards males (Heinsohn
& Legge 2003). Currently there are nine recognized subspecies:
E. roratus roratus, vosmaeri, cornelia, riedeli, polychloros, solo-
monensis, aruensis, biaki, and macgillivrayi (westermani not
included) (Forshaw 2010). For distribuons see Figure 2. There
is no current discussion about the elevaon of subspecies to
full species within the Eclectus-roratus-complex (see Ekstrom
& Butchart 2014).
Study species 2: Rainbow Lorikeet Trichoglossus haematodus
Linnaeus, 1771
In contrast, the colourful Rainbow Lorikeet, which does not ex-
hibit a pronounced sexual dichromasm, is an abundant, so-
cial, nectarivorous parrot (Forshaw 2010). It is found in open
woodland in the tropical lowlands, and commonly occurs in
urban areas of Australia. It competes with similarly sized birds
for nest holes (Franklin 1997; Waterhouse 1997; Shukuroglou &

EUROPEAN JOURNAL OF ECOLOGY
50
Table 1. Sample informaon of the current study. Origin: LPF: Loro Parque Fundación, Tenerife, Spain; CMH: C. Meke-Hofmann. Some sequences were retrieved from GenBank.
Scienc Name IPMB ID. Accession number Origin Distribuon Wild/Capve
Charmosyna papou 49578 KM372511 LPF New Guinea c
Psieuteles goldiei 31315 KM372512 LPF New Guinea c
Melopsiacus undulatus –EF450826 Australia c
Psiacula alexandri abbo 34985 KM372495 LPF Nicobar Islands c
Eclectus roratus aruensis 34683 KM372496 LPF Aru Islands c
Eclectus roratus aruensis 34684 KM372497 LPF Aru Islands c
Eclectus roratus cornelia 34685 KM372498 LPF Sumba c
Eclectus roratus cornelia 34686 KM372499 LPF Sumba c
Eclectus roratus polychloros 34687 KM372500 LPF New Guinea c
Eclectus roratus riedeli 34688 KM372501 LPF Tanimbar Island c
Eclectus roratus riedeli 34689 KM372502 LPF Tanimbar Island c
Eclectus roratus riedeli 34692 KM372503 LPF Tanimbar Island c
Eclectus roratus –AB177948 Astu et al. (2006) Moluccas w?
Eclectus roratus roratus 34693 KM372504 LPF Buru, Seram c
Eclectus roratus solomonensis 34680 KM372506 LPF Solomon Islands, Bismarck & Admiralty Archipelagos c
Eclectus roratus solomonensis 34682 KM372507 LPF Solomon Islands, Bismarck & Admiralty Archipelagos c
Eclectus roratus solomonensis 34697 KM372508 LPF Solomon Islands, Bismarck & Admiralty Archipelagos c
Eclectus roratus solomonensis 34698 KM372509 LPF Solomon Islands, Bismarck & Admiralty Archipelagos c
Eclectus roratus roratus 34701 KM372505 LPF Moluccas c
Eclectus ssp. unknown origin 34702 MG429727 LPF presumably New Guinea c
Trichoglossus euteles –AB177963 Astu et al. (2006)Timor, Lomblen to Nila & Babar w?
Trichoglossus euteles –AB177943 Astu et al. (2006)Timor, Lomblen to Nila & Babar w?
Trichoglossus haematodus nigrogularis 9353 KM372513 CMH Aru Islands c
Trichoglossus haematodus caeruleiceps 35195 KM372514 LPF S New Guinea c
Trichoglossus haematodus caeruleiceps 35196 KM372515 LPF S New Guinea c
Trichoglossus haematodus caeruleiceps 35197 MG429705 LPF S New Guinea c

EUROPEAN JOURNAL OF ECOLOGY
51
Scienc Name IPMB ID. Accession number Origin Distribuon Wild/Capve
Trichoglossus haematodus caeruleiceps 35198 MG429706 LPF S New Guinea c
Trichoglossus haematodus capistratus 35199 MG429709 LPF Timor c
Trichoglossus haematodus capistratus 35200 KM372516 LPF Timor c
Trichoglossus haematodus capistratus 35201 KM372517 LPF Timor c
Trichoglossus haematodus capistratus 35202 MG429707 LPF Timor c
Trichoglossus haematodus capistratus 31259 MG429708 LPF Timor c
Trichoglossus haematodus capistratus 9346 MG429724 CMH Timor c
Trichoglossus haematodus deplanchii 35205 MG429710 LPF New Caledonia & Loyalty Islands c
Trichoglossus haematodus deplanchii 35206 KM372519 LPF New Caledonia & Loyalty Islands c
Trichoglossus haematodus deplanchii 35207 MG429711 LPF New Caledonia & Loyalty Islands c
Trichoglossus haematodus forsteni 35209 KM372520 LPF Sumbawa Island c
Trichoglossus haematodus forsteni 35210 MG429713 LPF Sumbawa Island c
Trichoglossus haematodus forsteni 35211 MG429712 LPF Sumbawa Island c
Trichoglossus haematodus forsteni 35212 KM372521 LPF Sumbawa Island c
Trichoglossus haematodus fors 9354 MG429726 CMH Sumba Island c
Trichoglossus haematodus massena 35213 MG429714 LPF Karkar, Bismarck Archipelago & Solomon Islands c
Trichoglossus haematodus massena 35214 MG429715 LPF Karkar, Bismarck Archipelago & Solomon Islands c
Trichoglossus haematodus mitchellii 35215 KM372525 LPF Bali & Lombok c
Trichoglossus haematodus mitchellii 35216 KM372526 LPF Bali & Lombok c
Trichoglossus haematodus mitchellii 35217 MG429716 LPF Bali & Lombok c
Trichoglossus haematodus mitchellii 35218 MG429717 LPF Bali & Lombok c
Trichoglossus haematodus moluccanus 35221 MG429718 LPF eastern Australia to Tasmania c
Trichoglossus haematodus moluccanus 35222 KM372527 LPF eastern Australia to Tasmania c
Trichoglossus haematodus moluccanus 35223 KM372528 LPF eastern Australia to Tasmania c
Trichoglossus haematodus moluccanus 9312 MG429722 CMH eastern Australia to Tasmania c
Table 1 connued. Sample informaon of the current study. Origin: LPF: Loro Parque Fundación, Tenerife, Spain; CMH: C. Meke-Hofmann. Some sequences were retrieved from GenBank.

EUROPEAN JOURNAL OF ECOLOGY
52
McCarthy 2006; Legault et al. 2011). T. haematodus is strikingly
diverse, the number of taxa diers – according to authors – be-
tween 20 (Forshaw 2010) and 22 subspecies (Arndt 2012), see
Figure 4.
The taxonomy of the Trichoglossus-haematodus-
complex is currently under discussion. Del Hoyo et al. (2014)
disnguish the following taxa, using criteria of Tobias et al.
(2010): (1) T. rosenbergii (monotypic), (2) T. forsteni (incl. mitch-
ellii, djampeanus and stresemanni), (3) T. weberi (monotypic),
(4) T. haematodus (all taxa from New Guinea North and South
including satellite islands and Solomons), (5) T. moluccanus
(incl. septentrionalis), (6) T. capistratus (incl. fors and avotec-
tus), and (7) T. rubritorquis (monotypic). (8) T. euteles is treated
as a separate species. Molecular evidence is sll insucient for
this group and was not a basis for the arrangement of del Hoyo
et al. (2014). The taxon T. h. brooki Ogilvie-Grant, 1907 (Aru Is-
lands) is regarded taxonomically invalid, as the two known mu-
seum specimen are of capve origin, most likely to be juveniles
of T. h. nigrogularis (T. A.).
1. MATERIALS AND METHODS
1.1. Sampling
Nucleode sequences of the mitochondrial cytochrome b (cyt
b) gene from two species complexes were analyzed: Eclectus
roratus is represented by six out of nine taxa (Forshaw 2006),
and the Trichoglossus-haematodus-complex by 12 out of 20-22
taxa (see Forshaw 2010; Arndt 2012) plus T. euteles. This al-
lowed us to reconstruct a phylogenec and phylogeographic
scenario. The samples were derived from capve individuals of
E. roratus ssp. and T. haematodus ssp. (see Table 1).
1.2. DNA isolaon, PCR, sequencing
DNA was obtained from blood and ssue samples and stored
in EDTA buer (Carl Roth, Karlsruhe). Total DNA was isolated
using standard proteinase K (Merck, Darmstadt) and phenol/
chloroform protocols (Sambrook et al. 1989). Fragments of the
mitochondrial cytochrome b gene (cyt b) were amplied us-
ing specic primers, see Table 2. The PCR amplicaons were
performed in 50 µl reacon volumes containing 1 × PCR buer
(Bioron, Ludwigshafen), 100 µM dNTPs, 0.2 units of Taq DNA
polymerase (Bioron, Ludwigshafen), 200 ng of DNA and 5 pmol
of primers. PCR was carried out under the following condions:
5 min at 94°C, followed by 35 cycles of 45 s at 94°C, 1 min at
52.0°C, 2 min at 72°C and a nal extension at 72°C for 5 min.
PCR products were precipitated with 4 M NH4Ac and ethanol
(1:1:12) followed by a centrifugaon for 15 min (13,000 rpm).
Sequencing was performed by capillary electrophore-
sis using a MegaBACETM 1000 sequencer (Molecular Dynamics,
Amersham Pharmacia). DNA length of cyt b sequences were
1,140 nucleodes (Braun 2014).
Scienc Name IPMB ID. Accession number Origin Distribuon Wild/Capve
Trichoglossus haematodus moluccanus 9323 MG429723 CMH eastern Australia to Tasmania c
Trichoglossus haematodus rosenbergii 35224 MG429719 LPF Biak Island c
Trichoglossus haematodus rosenbergii 35226 KM372529 LPF Biak Island c
Trichoglossus haematodus rosenbergii 35227 KM372530 LPF Biak Island c
Trichoglossus haematodus rosenbergii 9347 MG429725 CMH Biak Island c
Trichoglossus haematodus rubritorquis 35225 KM372531 LPF N Australia c
Trichoglossus haematodus rubritorquis 35228 KM372532 LPF N Australia c
Trichoglossus haematodus rubritorquis 35229 MG429720 LPF N Australia c
Trichoglossus haematodus weberi 35231 KM372533 LPF Flores Island c
Trichoglossus haematodus weberi 35232 KM372534 LPF Flores Island c
Trichoglossus haematodus weberi 35233 MG429721 LPF Flores Island c
Table 1 connued. Sample informaon of the current study. Origin: LPF: Loro Parque Fundación, Tenerife, Spain; CMH: C. Meke-Hofmann. Some sequences were retrieved from GenBank.

EUROPEAN JOURNAL OF ECOLOGY
53
Figure 2. (a) above: Distribuon of all subspecies of Eclectus roratus. Asterisks indicate all available taxa included in the analysis. Each populaon
is represented by a separate colour code, which is also used in the network analysis. Only females are illustrated, males of dierent taxa are similar
and have a bright greenish plumage. Bird of unknown origin clusters within the blue-bellied New Guinea group.
(b) below: Median-joining network of Eclectus Parrots (Eclectus roratus ssp.) in Australasia based on 1,005 nucleodes of cytochrome b (cyt b)
(ε=0). The hypothecal ancestral node (geographical origin) is underlined. Circles indicate dierent populaons/islands. Circle colours correspond
to populaon colour code in distribuon maps. Circle size is proporonal to haplotype frequency in the dataset. Solid lines on the branches within
the network indicate mutaon events. Belly colour of females is indicated as “colour”, characteriscal dierences between taxa are marked with
lines. Only females are illustrated. An individual with unknown origin clusters within the blue-bellied New Guinea group.
,

EUROPEAN JOURNAL OF ECOLOGY
54
1.3. Alignment
The nucleode sequences were aligned using the Clustal W
algorithm (Thompson et al. 1994) with BioEdit version 7.0.9.0
(Hall 1999). DNA sequences were checked for their qual-
ity manually, and for their vertebrate mitochondrial origin by
translang them into amino acids. No internal stop codons or
frame-shis were observed in the sequences. Basic stascs,
Neighbor-joining trees and average uncorrected p-distances
were calculated with MEGA 5.2.2 (Tamura et al. 2011).
1.4. Model selecon
For the best ng evoluonary model, jModelTest (Guindon &
Gascuel 2003; Posada 2008; Darriba et al. 2012) was used. The
model Hasegawa, Kishino and Yano plus invariant sites (HKY+I)
Table 2. Primers used for PCR amplicaon (amp) and DNA sequencing (seq) of cytochrome b gene (cyt b), being 1,140 nt in Psiaciformes.
f= forward, r = reverse; L = light strand, H = heavy strand; Sequencing: X=CY5 uorescent label;
Cyt b – primer sequence (5’-3’) Direcon Use reference
MT-A1 CAACATCTCAGCATGATGAAACTTCG f amp/seq (L) Wink & Sauer-Gürth (2000)
MT-C2-CY XGAGGACAAATATCATTCTGAGG f amp/seq (L) Clouet & Wink (2000)
HThr 16082 TCTTTTGGTTTACAAGACCAATG ramp/seq (H) Kornegay et al. (1993)
Mte GCAAATAGGAAGTATCATTCTGG ramp/seq (H) Fritz et al. (2006)
Mr CATAGAAGGGTGGAGTCTTCAGTTTTTGGTTTACAA ramp/seq (H) modied from Wink et al. (2002)
ND5L 14754 GGACCAGAAGGACTTGCCGACCTA f amp/seq (L) Ribas (2004)
L15311 GTCCTACCATGAGGTCAAATATC f amp/seq (L) Braun (2014)
L15558 TGTGAYAAAATCCCATTCCACCC f amp/seq (L) Braun (2014)
H15400 AAGAATCGGGTTAGGGTGGGG ramp/seq (H) Braun (2014)
H15494 CCTAGGGGRTTRTTTGACC ramp/seq (H) Braun (2014)
L14764_MW TGATACAAAAAAATAGGMCCMGAAGG f amp/seq (L) modied from Sorenson et al. (1999)
Figure 3. Bayesian analysis using BEAST v.1.4.8: maximum clade credibility tree of Eclectus (cyt b, 1,140 nt). Clades corresponding to dierent is-
lands, also reported in the network analysis are well supported. Support values (posterior probabilies) above 0.9 are displayed.


EUROPEAN JOURNAL OF ECOLOGY
55
Figure 4. (a) above: Distribuon of the subspecies of the Trichoglossus-haematodus-complex (T. haematodus 22 ssp. & Trichoglossus euteles, see
Arndt (2012)). Asterisks indicate all available taxa included in the analysis. Each populaon is represented by a separate colour code, which is also
used in the network analysis. The taxon T. h. nigrogularis includes T. h. brooki (Aru Islands, see text). Sympatric distribuon occurs on Timor with
T. euteles and T. h. capistratus.
(b) below: Medium-joining network of the Trichoglossus-haematodus-complex (T. haematodus ssp. & Trichoglossus euteles) in Australasia based on
562 nucleodes of cytochrome b (cyt b) (ε=0). The hypothecal ancestral node (geographical origin) is underlined. Numbers 1 and 2 show median
vectors (presumed ancestral sequence). Names of groups are indicated as “yellow-breasted” etc., characteriscal dierences between taxa are
marked with lines. Circles indicate dierent populaons/islands. Circle colours correspond to populaon colour code in distribuon maps. Circle size
is proporonal to haplotype frequency in the dataset. Solid lines on the branches within the network indicate mutaon events. The taxon T. h. brooki
is included in T. h. nigrogularis (see text). Sympatric distribuon occurs on Timor with T. euteles and T. h. capistratus. The two Australian taxa T. h.
moluccanus and T. h. rubritorquis represent two independent genec lineages. Drawings are with courtesy of Thomas Arndt.
.

EUROPEAN JOURNAL OF ECOLOGY
56
Table 3. Variable sites of the network dataset of Eclectus-roratus-complex. Taxon names and haplotype names given. Sites as numbers top down.
abbreviaon of haplotypes: NG= New Guinea clade incl. Aru Islands, Solomon Islands; SUM= Sumba clade; TAN = Tabimbar clade; MOL= Moluccas clade;
Taxon + IPMB ID haplotype/site
111111112233333334 4 4 4 5 5 6
12333679570167999112 5 2 9 1
1 7 24686880657206 9 1 4 9 9 272
aruensis 34683 NG - - - - - T A T C C C C A T T CCCA A CT T A
aruensis 34684 NG - - - - - . . . . . . . . . . . . . . . . . . .
solomonensis 34680 NG - - - - - . . . . . . . G . . . . . . . . C. .
solomonensis 34682 NG - - - - - . . . . . . . G . . . . . . . .C. .
solomonensis 34697 NG - - - - - . . . . . . . G . . . . . . . . C. .
solomonensis 34698 NG - - - - - . . . . . . . G . . . . . . . . C. .
polychloros 34687 NG - - - - - . . . . . . . . . . . . . . . . . . .
unknown origin 34702 NG - - - - - . . . . . . . . . . . . . . . T C. .
cornelia 34685 SUM - - - - - . . . T . . . . A . . . . . . . C C .
cornelia 34686 SUM - - - - - . . . T . . . . A . . . . . . . C C .
riedeli 34688 TAN CACA A C. . . T . T . C. T . . ...C. G
riedeli 34689 TAN CACA A C. . . T . T . C. T . . . . . C. G
riedeli 34692 TAN CACA A C. . . T . T . C. T . . . . . C. G
roratus AB177948 MOL - G A G G . G C. . T . . . G . A A G C.C. .
roratus 34693 MOL T A T A A . . C. . . . . . . . . . G . . C. .
roratus 34701 MOL T A T A A . . C. . T . . . . . . . G . . C. .
taxon haplotype/site 1 1 1 1 1 1
6677777888889999990 0 0 0 0 0
8 9 01 4 5726 7 7 8 016689056 8 8 8
4 6 2 5 4142707 8 3012 5 0 2 6 8 3 5 9
aruensis 34683 NG G A T C C T T CT A CT T T G T CTCA A T T T
aruensis 34684 NG . . . . . . . . . . . . . . . . . . . . . . . .
solomonensis 34680 NG . . . . . . . . . . T . . . . . . . . . . . . .
solomonensis 34682 NG . . . . . . . . . . T . . . . . . . . . . . . .
solomonensis 34697 NG . . . . . . . . . . T . . . . . . . . . . . . .
solomonensis 34698 NG . . . . . . . . . . T . . . . . . . . . . . . .
polychloros 34687 NG . . . . . . . . . . . . . . . . . . . . . . . .
unknown origin 34702 NG ..........T....... . . . C. .
cornelia 34685 SUM A G C. . . CT . G T . C. T . . C. G G C. .
cornelia 34686 SUM A G C. . . CT . G T . C. T . . C. G G C. .
riedeli 34688 TAN A G CT T C. . CG T C.C.CT . T . . . C C
riedeli 34689 TAN A G CT T C. . CG T C.C.CT . T . . . C C
riedeli 34692 TAN A G CT T C. . CG T C.C.CT . T . . . C C
roratus AB177948 MOL A G C. . . . . . G T . . C. . . . . - - - - -
roratus 34693 MOL A G C. . . . . . G T . . C. . . . . . . . . .
roratus 34701 MOL A G C. . . . . . G T . . C. . . . . . . . . .

EUROPEAN JOURNAL OF ECOLOGY
57
Figure 5. Bayesian Analysis using BEAST v.1.4.8: maximum clade credibility tree of Trichoglossus (cyt b, 1,140 nt). Clades dened in Network 4.6.1.1
are well supported as disnct lineages while the clades “N New Guinea” (rosenbergii, massena, deplanchii) and “S New Guinea” (nigrogularis,
caeruleiceps, moluccanus) remain unresolved. Support values (posterior probabilies) above 0.9 are displayed.

Figure 6. Divergence in T. haematodus can occur very quickly. The youngest lineages (N New Guinea vs. S New Guinea) evolved by dispersal and/or
isolaon (arrows) from New Guinea during the Pleistocene, less than 50,000 years ago, probably as young as 18,000 years ago (last glacial maxi-
mum). Drawings are with courtesy of Thomas Arndt.
.

EUROPEAN JOURNAL OF ECOLOGY
58
Table 4. Variable sites of the network dataset of Trichoglossus-haematodus-complex. Taxon names and haplotype names given. Sites as numbers top down.
abbreviaon of haplotypes: TIM= Timor I clade; FLOR = Flores clade; NNG = N New Guinea; SNG = S New Guinea; SUM = Sumba and Timor II clade; SMBW = Sumbawa
clade; BAL = Bali & Lombok clade; AUS = N Australia clade;
Taxon + IPMB ID haplotype/site
11112222333333445
22336822592235334569171
5 6396179555678398166710
euteles AB177943 TIM - - - - - - G A G A A T A CGCT G CT G T T
euteles AB177963 TIM ------..T..............
weberi 35231 FLOR C A A G A C..T.............C
weberi 35232 FLOR C A A G A C..T.............C
deplanchii 35205 NNG ---------------------..
deplanchii 35206 NNG ---------------------..
massena 35213 NNG CAGAGC. . T . . . . . A . C. . CA . .
massena 35214 NNG CAGAGC. . T . . . . . A . C. . CA . .
rosenbergii 35226 NNG - - - - - - - - T . . . . . A . C. . CA . .
rosenbergii 35227 NNG CAGAGC. . T . . . . . A . C. . CA . .
nigrogularis 9353 SNG - - - - - - - - - . . . . . . . . . T CA . .
caeruleiceps 35195 SNG CA G G G T . . T . . . . . . . . . T CA . .
caeruleiceps 35196 SNG CA G G G T . . T . . .......TCA . .
moluccanus 35222 SNG CA G G G T . . T . . . . . . . . . T CA . .
moluccanus 35223 SNG CA G G G T . . T . . . . . . . . . T CA . .
capistratus 35200 SUM CA G G A C. . T . . C. T . T . . . . A C.
capistratus 35201 SUM CA G G A C. . T . . C. T . T . . . . A C.
fors 9354 SUM - - - - - - . G T . . C. T . T . . . . A C.
forsteni 35209 SMBW - - - - - - - - - G . . . . . T . . . . A . .
forsteni 35212 SMBW ---------------------..
mitchellii 35215 BAL ACG G A CA . T . G . . . . T . . . . A . .
mitchellii 35216 BAL CA G G A CA . T . G . . . . T . . . . A . .
rubritorquis 35225 AUS -------------. .. .A. .A..
rubritorquis 35228 AUS CA G G A C. . T . . . C. . . . A . . A . .
taxon haplotype/site 1 1 1 1
55666777788888999990000
48299022524679125570168
3 2 169026323404270422796
euteles AB177943 TIM CCCA T A CT G CT G A T G T A CTTTCT
euteles AB177963 TIM .....G.................
weberi 35231 FLOR T T T G . G . CA....C. . CT . C...
weberi 35232 FLOR T T T G . G . CA....C. . CT . C...
deplanchii 35205 NNG . . T . . G . CA . C....C C T.....
deplanchii 35206 NNG . . T . . G . CA . C....C C T.....
massena 35213 NNG . . T . . G . CA . C....C C T.....
massena 35214 NNG . . T . . G . CA . C....C C T.....
rosenbergii 35226 NNG . . T . . G . CA . C....C C T.....
rosenbergii 35227 NNG . . T . . G . CA . C....C C T.....
nigrogularis 9353 SNG . A T . . G . CA . CA . . . C C T . . . T .
caeruleiceps 35195 SNG . A T . . G . CA . CA . . . C C T . . . T .

EUROPEAN JOURNAL OF ECOLOGY
59
(Hasegawa et al. 1985) was proposed to be the best ng evo-
luonary model for both Trichoglossus and Eclectus mtDNA ac-
cording to Bayesian informaon criterion (BIC).
1.5. Maximum-Likelihood analysis
Starng Maximum-likelihood (ML) trees were obtained using
PhyML 3.0 (Guindon et al. 2010) on Phylogeny.fr (Dereeper et
al. 2008). More sophiscated ML calculaons were performed
using RAxML 7.0.4 (Stamatakis 2006) and RAxML-HPC2 7.6.3
(Stamatakis et al. 2008) on XSEDE (Miller et al. 2010). ML
searches were conducted with the rapid hill-climbing algorithm
under the GTR (General Time Reversible), which is the most
common and general model for DNA (see Tavaré 1986).
1.6. Bayesian analysis, tree eding
Bayesian inferences were performed with BEAST v.1.4.8 (Drum-
mond & Rambaut 2008) and BEAST on XSEDE (Miller et al. 2010).
The searches were conducted under HKY model with four rate
(gamma) categories as model of evoluon. The MCMC chain
length was set to 10,000,000, logging parameters every 1,000
steps, resulng in 10,000 trees. The burnin was set to 1,000 (cut
o the rst 10% of trees). Results of the log les have been sta-
scally evaluated using the program Tracer v.1.4 (Rambaut &
Drummond 2007). Addional Bayesian analysis was performed
using MrBayes 3.2.2 (Ronquist et al. 2012) on XSEDE (Miller et
al. 2010) with HKY and equal rates. Phylogenec trees were ar-
ranged and edited using FigTree v1.4.0 (Rambaut 2012).
1.7. Network
Mitochondrial haplotype alignments (cyt b) were analyzed us-
ing Network v. 4.6.1.1 (Polzin & Daneshmand 2012). The net-
work was calculated using the Median Joining method (MJ)
(Bandelt et al. 1999) with epsilon=0 in order to keep the short-
est tree. The dataset was formaed in Network 4.6.1.1 and re-
drawn for publicaon.
1.8. Molecular clock
For Trichoglossus, and Eclectus no appropriate fossil data were
known which could be used for a molecular dang. However, a
calibraon for cyt b was assumed based on a molecular rate of
2.1% (see Weir & Schluter 2008). This rate has been used in par-
rots (Groombridge et al. 2004; Eberhard & Bermingham 2005;
Tavares et al. 2006; Ribas & Miyaki 2007; Ribas et al. 2009) and
other birds for a period of c. 12 million years (Shields & Wil-
son 1987; Tarr & Fleischer 1993; Fleischer et al. 1998; Weir &
Schluter 2008).
2. RESULTS
In Eclectus roratus and the Trichogossus-haematodus-complex
similar genec paerns were discovered. In both species com-
plexes, a lower genec distance was observed across popula-
ons of the Sahul Shelf (including New Guinea, Aru Islands and
Australia), Bismarck Archipelago, and Solomon Islands, while a
higher genec distance (speciaon) was found in populaons
inside the Wallacea. An overview over variable sites in the mi-
tochondrial dataset of the Eclectus-roratus-complex is given in
Table 3. The overview of the Trichoglossus-haematodus-com-
plex is found in Figure 4.
2.1. Eclectus-roratus-complex: haplotype network, Wallacean
origin and molecular clock
The haplotype network for Eclectus is illustrated in Figure 2.
Based on the haplotype network data, the evoluonary ori-
gin (ancestral node) of the Eclectus-roratus-complex might
be in the Moluccas, so a Wallacean origin is proposed for this
group. In Eclectus three disnct lineages occur within the Wal-
lacea (Sumba, Tanimbar Is., Moluccas), while the New Guinea
lineages (Aru Is., New Guinea, Solomon Is.) show lile genec
distance. In the Eclectus-roratus-complex, populaons from
Tanimbar Islands (E. r. riedeli), Sumba (E. r. cornelia) and the
Moluccas (E. r. roratus) are genecally disnct from the popula-
ons in New Guinea (E. r. polychloros), the Solomon Islands/
caeruleiceps 35196 SNG . A T . . G . CA . CA . . . C C T . . . T .
moluccanus 35222 SNG . A T . . G . CA . CA . . . C C T . . . T .
moluccanus 35223 SNG . A T . . G . CA . CA . . . C C T . . . T .
capistratus 35200 SUM . . T G . G . CA . C....C C TC.C. .
capistratus 35201 SUM . . T G . G . CA . C....C C TC.C. .
fors 9354 SUM . . T G . G . CA . C....C C TC....
forsteni 35209 SMBW . . T . . G G CA T C....C C T . . C. .
forsteni 35212 SMBW . . T . . G G CA . C. G . . C C T . . C. .
mitchellii 35215 BAL . . T . . G . CA . C. . . A C C T . . C. .
mitchellii 35216 BAL . . T . . G . CA . C. . . A C C T . . C. .
rubritorquis 35225 AUS . . T . CG . CA . C....C C T . . C.C
rubritorquis 35228 AUS . . T . CG . CA . C....C C T . . C.C
Table 4. Variable sites of the network dataset of Trichoglossus-haematodus-complex. Taxon names and haplotype names given. Sites as numbers top down.
abbreviaon of haplotypes: TIM= Timor I clade; FLOR = Flores clade; NNG = N New Guinea; SNG = S New Guinea; SUM = Sumba and Timor II clade; SMBW = Sumbawa
clade; BAL = Bali & Lombok clade; AUS = N Australia clade;

EUROPEAN JOURNAL OF ECOLOGY
60
Bismarck Archipelago (E. r. solomonensis), and the Aru Islands
(E. r. aruensis).
The Bayesian analysis is documented in Figure 3.
Based on a molecular rate of 2.1% divergence per one million
years for cyt b in birds (Weir & Schluter 2008), divergence in
the stem clades in Eclectus is set to a maximum of 1.38 million
years ago (p-distance=0.029, see Table 5). The populaon on
the Tanimbar Islands (E. r. riedeli) became isolated at around
1.38 Ma and the Sumba populaon (E. r. cornelia) at around
0.67-0.90 Ma. The populaons of New Guinea, the adjacent
land mass (today e.g. represented by Aru Islands), and the Sol-
omon Islands diverged within the past 0.43-0.81 Ma.
2.2. Trichoglossus-haematodus-complex: haplotype network,
non-Wallacean origin and molecular clock
The haplotype network for the Trichoglossus-haematodus-
complex is illustrated in Figure 4, the Bayesian analysis is given
in Figure 5. Based on the network data, the evoluonary origin
of the Trichoglossus-complex might be situated in N New Guin-
ea, so a non-Wallacean origin is proposed for this group. Based
on the molecular rate of 2.1%-rule (Weir & Schluter 2008) and
the maximum divergence me within the group (N New Guinea
lineage as source populaon to oldest lineages), the evoluon-
ary me frame for the examined taxa of Trichoglossus haema-
todus is set to 0.80 million years ago (p-distance = 0.017, see
Figure 4).
The most likely origin of the Trichoglossus-haem-
atodus-group is northern New Guinea, as shown in Figure 4.
Several genec lineages may be disnguished: (1) T. euteles on
Timor, (2) T. h. weberi on Flores, (3) T. h. fors on Sumba and T.
h. capistratus on Timor, (4) T. h. mitchellii on Bali and Lombok;
(5) T. h. forsteni on Sumbawa (6) T. h. rubritorquis in N Austra-
lia. The two main lineages of New Guinea split at around 0.33
Ma between (7) N New Guinea clade (T. h. rosenbergii, T. h.
massena, T. h. deplanchii) and (8) S New Guinea/Aru Islands/E
Australia clade (T. h. caeruleiceps, T. h. nigrogularis, T. h. moluc-
canus). The most recent divergence events took place in the
late Pleistocene, within the lineages N New Guinea and S New
Guinea/Australia. The genec distance (p-distance <0.001) sug-
gests a rapid evoluon within less than 50,000 years BP, prob-
ably younger than 18,000 years BP (last glacial maximum), see
Figure 6.
3. DISCUSSION
3.1. Vicariance and dispersal
Geological and climac events like Pleistocene sea level
changes resulted in land area dissecon and severing islands.
Populaons with previously connuous distribuons became
fragmented. This process is known as vicariance (concept see
Newton 2003). Subsequently, mutaons and genec dri led
to divergence of populaons in dierent areas from each other,
depending on local selecon pressures and dierences in envi-
ronmental condions. These condions favour a rapid evolu-
on of closely related allospecies under the same superspecies
(concept see Newton 2003). Furthermore, dispersal is a second
fragmentaon process that can lead to speciaon. Individuals
may disperse across pre-exisng barriers to found new popula-
ons. Those populaons may subsequently become genecally
and ecologically isolated from the founder populaon (Newton
2003). Parrots are among the land bird families with relavely
good dispersal and colonizaon abilies on oceanic islands (Be-
gon et al. 1998).
Table 5. Pairwise p-distance values for 16 taxa of Eclectus roratus used in the phylogenec analysis, based on 1,140 mtDNA nucleodes of cytochrome b (cyt b). The
analysis was calculated in MEGA 5.2.2 (Tamura et al. 2011).
No Taxon + IPMB ID 1 23456 7 8 9 10 11 12 13 14 15
1E. r. aruensis 34683
2E. r. aruensis 34684 0.000
3E. r. cornelia 34685 0.017 0.017
4E. r. cornelia 34686 0.017 0.017 0.000
5E. r. polychloros 34687 0.000 0.000 0.017 0.017
6E. r. riedeli 34688 0.023 0.023 0.027 0.027 0.023
7E. r. riedeli 34689 0.023 0.023 0.027 0.027 0.023 0.000
8E. r. riedeli 34692 0.023 0.023 0.027 0.027 0.023 0.000 0.000
9E. r. roratus AB177948 0.017 0.017 0.019 0.019 0.017 0.029 0.029 0.029
10 E. r. roratus 34693 0.009 0.009 0.014 0.014 0.009 0.017 0.017 0.019 0.011
11 E. r. roratus 34701 0.010 0.010 0.015 0.015 0.010 0.018 0.018 0.020 0.010 0.001
12 E. r. solomonensis 34680 0.003 0.003 0.016 0.016 0.003 0.022 0.022 0.022 0.016 0.008 0.009
13 E. r. solomonensis 34682 0.003 0.003 0.016 0.016 0.003 0.022 0.022 0.022 0.016 0.008 0.009 0.000
14 E. r. solomonensis 34697 0.003 0.003 0.016 0.016 0.003 0.022 0.022 0.022 0.016 0.008 0.009 0.000 0.000
15 E. r. solomonensis 34698 0.003 0.003 0.016 0.016 0.003 0.022 0.022 0.022 0.016 0.008 0.009 0.000 0.000 0.000
16 E. r. unknown origin 34702 0.004 0.004 0.015 0.015 0.004 0.023 0.023 0.023 0.016 0.009 0.010 0.003 0.003 0.003 0.003

EUROPEAN JOURNAL OF ECOLOGY
61
Table 6. Pairwise p-distance values for 24 taxa of Trichoglossus used in the phylogenec analysis, based on mitochondrial 1,140 nucleodes of cyt b. The analysis was calculated in MEGA 5.2.2 (Tamura et al. 2011).
No Taxon + IPMB ID 1 2 3 456 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
1T. euteles AB177943
2T. euteles AB177963 0.002
3 T. h. nigrogularis 9353 0.014 0.013
4T. h. caeruleiceps 35195 0.015 0.013 0.000
5 T. h. caeruleiceps 35196 0.015 0.013 0.000 0.000
6T. h. capistratus 35200 0.017 0.015 0.012 0.012 0.012
7T. h. capistratus 35201 0.017 0.015 0.012 0.012 0.012 0.000
8T. h. deplanchii 35205 0.012 0.010 0.004 0.004 0.004 0.006 0.006
9T. h. deplanchii 35206 0.012 0.010 0.004 0.004 0.004 0.006 0.006 0.000
10 T. h. forsteni 35209 0.014 0.013 0.010 0.010 0.010 0.008 0.008 0.004 0.004
11 T. h. forsteni 35212 0.016 0.014 0.008 0.008 0.008 0.007 0.007 0.004 0.004 0.003
12 T. h. fors 9354 0.017 0.015 0.011 0.012 0.012 0.002 0.002 0.004 0.004 0.009 0.008
13 T. h. massena 35213 0.013 0.011 0.006 0.007 0.007 0.010 0.010 0.000 0.000 0.008 0.004 0.010
14 T. h. massena 35214 0.013 0.011 0.006 0.007 0.007 0.010 0.010 0.000 0.000 0.008 0.004 0.010 0.000
15 T. h. mitchellii 35215 0.015 0.013 0.009 0.012 0.012 0.009 0.009 0.003 0.003 0.005 0.004 0.010 0.010 0.010
16 T. h. mitchellii 35216 0.015 0.013 0.009 0.010 0.010 0.007 0.007 0.003 0.003 0.005 0.004 0.010 0.009 0.009 0.002
17 T. h. moluccanus 35222 0.015 0.013 0.000 0.000 0.000 0.012 0.012 0.004 0.004 0.010 0.008 0.012 0.007 0.007 0.012 0.010
18 T. h. moluccanus 35223 0.015 0.013 0.000 0.000 0.000 0.012 0.012 0.004 0.004 0.010 0.008 0.012 0.007 0.007 0.012 0.010 0.000
19 T. h. rosenbergii 35226 0.013 0.011 0.006 0.006 0.006 0.010 0.010 0.000 0.000 0.008 0.004 0.009 0.000 0.000 0.007 0.007 0.006 0.006
20 T. h. rosenbergii 35227 0.013 0.011 0.006 0.007 0.007 0.010 0.010 0.000 0.000 0.008 0.004 0.010 0.000 0.000 0.010 0.009 0.007 0.007 0.000
21 T. h. rubritorquis 35225 0.014 0.013 0.010 0.010 0.010 0.009 0.009 0.004 0.004 0.007 0.006 0.010 0.008 0.008 0.006 0.006 0.010 0.010 0.008 0.008
22 T. h. rubritorquis 35228 0.015 0.013 0.010 0.010 0.010 0.009 0.009 0.004 0.004 0.008 0.006 0.012 0.009 0.009 0.009 0.007 0.010 0.010 0.008 0.009 0.000
23 T. h. weberi 35231 0.013 0.011 0.013 0.014 0.014 0.013 0.013 0.012 0.012 0.014 0.016 0.013 0.013 0.013 0.015 0.013 0.014 0.014 0.012 0.013 0.014 0.013
24 T. h. weberi 35232 0.013 0.011 0.013 0.014 0.014 0.013 0.013 0.012 0.012 0.014 0.016 0.013 0.013 0.013 0.015 0.013 0.014 0.014 0.012 0.013 0.014 0.013 0

EUROPEAN JOURNAL OF ECOLOGY
62
3.2. Speciaon events in Australasia
Both vicariance and dispersal may be of importance for specia-
on processes in the two examined parrot species complexes.
Populaons may diverge quite quickly in morphological terms,
especially in the Trichoglossus-haematodus complex. Genec
dierenaon was lower for shelf populaons connected by
land bridges during the Pleistocene and Holocene than for
older populaons on isolated islands across the Wallacea. The
higher genec diversity in the Wallacea may be a consequence
of several independent colonizaon events from source islands
(Eclectus: Moluccas, Trichoglossus: New Guinea) to sink islands
(e.g. Lesser Sunda Islands), where some populaons may have
become exnct and were later replaced by new invasions.
The distribuon paerns of land birds in the Wallacea
which are younger than 5 million years are apparently due to
long distance dispersal and not due to tectonic acvity (con-
cept see Carstensen et al. 2012). Based on the nding that spe-
ciaon in the two examined parrot complexes is much younger,
it is clear that tectonic acvity can neither explain speciaon
in Eclectus, nor in Trichoglossus. Their occurrence on oceanic
islands should be aributed to long distance dispersal or vicari-
ance during the Pleistocene and Holocene.
3.3. Genec origin inside or outside the Wallacea
Two separate scenarios for Eclectus and Trichoglossus can be
inferred from both phylogenec analysis and molecular dang.
Eclectus scenario: out-of-Moluccas-hypothesis
As shown in Figure 2, the most likely origin of Eclectus spp. is
in the Moluccas (roratus). The Lesser Sunda Islands with Sum-
ba (cornelia), the Tanimbar islands (riedeli) and New Guinea
(polychloros, solomonensis, aruensis) had presumably been
colonized from there, very likely also N Australia (macgillivrayi)
which was not included in the dataset. Eclectus is capable of
long-distance dispersal: Pleistocene and Holocene fossils were
found on Tonga, c. 2,700 km SE of the current distribuon,
probably also on Rota (Mariana Is.) (Steadman 1993). An expla-
naon for the low genec distance across the Sahul Shelf may
be land bridges during the Pleistocene (Voris 2000) or recent
dispersal.
Trichoglossus scenario: out-of-New-Guinea-hypothesis
In the T.-haematodus-complex at least four dierent lineages
occur on the Lesser Sunda Islands (euteles, weberi, capistratus/
fors, mitchellii/forsteni), Australia was colonized by two dier-
ent lineages (rubritorquis and moluccanus). A similar coloniza-
on paern of the Rainbow Lorikeet was proposed by Forshaw
(1977) without given the genec background. He stated that
Australia had been colonized twice, through S New Guinea and
through the Lesser Sunda islands. This conjecture is supported
by this study.
The nding of the populaons in N Australia and the
Lesser Sunda Islands being closely related is puzzling because
the taxa are found more than 1,000 km from each other. A simi-
lar biogeographic paern as in mitchellii/forsteni/rubritorquis
(Lesser Sunda Islands and N Australia) can be found in fruit
doves. Plinopus alligator lives in N Australia, P. cinctus on the
Lesser Sunda Islands except Sumba, and P. dohertyi on Sumba
(Cox 1997). This nding may be explained by the smaller geo-
graphic distance between Lesser Sunda Islands and the Sahul
Shelf during the Pleistocene.
3.4. Eclectus and Trichoglossus: rapid evoluon and implica-
ons for taxonomy
In the Eclectus-roratus-complex four morphologically and
biogeographically disnct lineages are clearly dened gene-
cally. A separate species status based on genec distance is
supported for the following populaons: (1) Sumba (cornelia),
(2) Tanimbar Is. (riedeli), (3) Moluccas (roratus), and (4) New
Guinea (including aruensis, polychloros, solomonensis, and
probably other blue-bellied taxa in and around New Guinea
and N Australia). A taxonomic revision for Eclectus roratus is
suggested in Table 7, but further studies including more mate-
rial of wild populaons are needed.
In case of the crypc Western Ground Parrot (Pezo-
porus wallicus aviventris) p-distance values of 4.4–5.1% be-
tween western and eastern populaons of Australia were equal
to a divergence me of 2 Ma, suggesng a separate species
status for the western populaon P. wallicus (Murphy et al.
2011). In the Trichoglossus-haematodus-complex, the situaon
is more complicated. The distribuon of the T. haematodus
taxa reects the Checkerboard distribuon paern (Diamond
1975), meaning that two closely related species never occur
on the same islands, based on the presence of competors
(Newton 2003). The case of T. (h.) euteles and T. h. capistratus
is puzzling as both are occurring on the island of Timor, which
is contradictory to the Checkerboard distribuon for closely re-
lated species. The sympatry of euteles and capistratus suggests
that both taxa are evoluonary suciently disnct from each
other to form two disnct species. Given the p-distance of 1.7%
and the me frame of 800,000 years, a rapid evoluon into two
disnct species took place. This is the highest p-distance value
within the T. haematodus complex. The smaller T. (h.) euteles
lives at altudes from sea level to 2,400 m and seems to be
commoner than the larger T. h. capistratus on Timor, replac-
ing capistratus at higher altudes and on several nearby is-
lands (Juniper & Parr 2003). T. h. rosenbergii is considered a full
species by del Hoyo et al. (2014) based on its dierent colour
paern and the isolated populaon on the island of Biak. Our
data shows an idencal haplotype of rosenbergii together with
other taxa from the islands north of New Guinea (massena,
deplanchii). It is a case of dramacally rapid evoluon within
less than 50,000 years, probably less than 18.000 years BP, see
Figure 6. The same situaon is present in the Australia-S New
Guinea clade. T. h. moluccanus (E Australia), T. h. nigrogularis
(Aru Is.) and T. h. caeurleiceps (S New Guinea) share a common
haplotype. A similar case of very recent speciaon is known
from the swi complex Apus apus/A. pallidus, which are con-
sidered disnct species, but share a common haplotype. The
same is true for the complex A. anis/A. nipalensis, see Päck-

EUROPEAN JOURNAL OF ECOLOGY
63
ert et al. (2012). Other examples of rapid radiaon within the
parrot family is the genus Psiacula (Braun et al. 2016) with
the South Asian Ring-necked Parakeet showing a new breed-
ing behavior or rapid morphological changes in a dierent cli-
mate such as in temperate Europe (Braun 2007, 2014; Le Gros
et al. 2016).
In summary, our study largely follows the suggesons
of del Hoyo et al. (2014), but addionally provides molecular
data for a majority of taxa as a supplementary criterion. The
following 8 dierent lineages are proposed for recognion in
taxonomy based on mitochondrial haplotypes: (1) haplotype N
New Guinea (rosenbergii, massena, deplanchii), (2) haplotype S
New Guinea (nigrogularis, caeruleiceps, moluccanus), (3) Flores
(weberi), (4) Timor (euteles), (5) Timor and Sumba (capistratus,
fors), (6) Bali/Lombok (mitchellii), (7) Sumbawa (forsteni), and
(8) N Australia (rubritorquis). A taxonomic revision for T. hae-
matodus is suggested in Table 8.
3.5. Implicaons for conservaon and further research
Studies in several groups of organisms increase the importance
of Australasia for global biodiversity (Springer et al. 1998; Ap-
lin 2006; Sanders et al. 2008). While morphological or ecologi-
cal change is low in some groups of non-migratory songbirds,
leading to a so-called ‘crypc diversity’ (Lohman et al. 2010;
Fernandes et al. 2013), the invesgated parrots were found to
diverge to a greater extent.
The study shows that speciaon is underway in Aus-
tralasia. Diversicaon took place in both Eclectus and Tricho-
glossus. This highlights the importance of areas of endemism,
in which the Wallacea clearly belongs. For conservaon reason,
several taxa are suggested being elevated to species level under
the criteria of Tobias et al. (2010). Although T. haematodus has
been regarded as a common species with a conservaon status
of “Least Concern” (Staerseld et al. 2014), the elevaon of
several populaons to species level will lead to a dierent situ-
aon (see Taylor 2013). Several populaons are now under de-
cline, especially due to the trapping pressure, especially on Biak
(T. h. rosenbergii) with a populaon < 10,000 birds, but also on
Flores (T. h. weberi), on Bali/Lombok (T. h. mitchellii), on Sum-
bawa (T. h. forsteni) and other populaons on smaller islands
(Taylor 2013). The taxon mitchellii currently is in the situaon of
being ‘exnct in the wild’ from both Bali and Lombok (T.A., R.
Wüst, pers. comm., 2015), the status of many other taxa is sll
insuciently known.
In the Eclectus-roratus-complex, the elevaon of sev-
eral populaons to species level will lead to a dierent situaon
regarding the current conservaon status of “Least Concern”
(Ekstrom & Butchart 2014). Populaons on Sumba (E. r. corne-
lia) and Tanimbar Islands (E. r. riedeli) are endangered through
trapping pressure, while E. r. roratus became exnct on Ambon,
Saparua and Haruku for the same reason (Arndt 2008).
Further invesgaons are recommended. As only
capve individuals were sampled, a taxon sampling of all wild
populaons and supplemental methods may reveal further in-
formaon on the speciaon processes of these and other Aus-
tralasian birds.
For conservaon policy of parrots in Australasia and
Indonesia it is strongly recommended to (1) conserve the small-
er island populaons, (2) ban trapping of wild birds for the pet
trade, and (3) ban the release of traded non-nave populaons
into new areas in order to avoid genec mixture between dif-
ferent populaons.
Acknowledgements
We thank the Loro Parque Fundacíon, Tenerife for providing
samples. We thank Crisna Dreisörner, Sara Capelli and Hein-
rich Müller for valuable help in sampling. We thank Roland
Wirth (ZGAP) for biogeographical comments on the Plinopus-
complex, Nicole Braun, Javier Gonzalez and two anonymous re-
viewers for helpful advice in improving the manuscript.
Table 7. Suggested taxonomic revision of Eclectus roratus based on phylogenec
units. Only taxa used in the study are displayed.
Species includes
Eclectus roratus E. r. roratus
Eclectus cornelia E. r. cornelia
Eclectus riedeli E. r. riedeli
Eclectus polychloros E. r. polychloros
E. r. aruensis
E. r. solomonensis
Table 8. Suggested taxonomic revision of Trichoglossus haematodus based on
phylogenec units. Only taxa used in the study are displayed.
Species includes
Trichoglossus haematodus T. h. rosenbergii
T. h. massena
T. h. deplanchii
Trichoglossus weberi T. h. weberi
Trichoglossus moluccanus T. h. moluccanus
T. h. nigrogularis
T. h. caeruleiceps
Trichoglossus rubritorquis T. h. rubritorquis
Trichoglossus capistratus T. h. capistratus
T. h. fors
Trichoglossus mitchellii T. h. mitchellii
Trichoglossus forsteni T. h. forsteni
Trichoglossus euteles T. (h.) euteles

EUROPEAN JOURNAL OF ECOLOGY
64
References
Aplin, K.P. (2006) Ten million years of rodent evoluon in Australasia:
phylogenec evidence and a speculave historical biogeogra-
phy. Evoluon and biogeography of Australasian vertebrates,
707–744.
Arndt, T. (2008) Arndt Lexicon of Parrots 3.0. In: (ed. T. Arndt). Arndt
Verlag, Breen.
Arndt, T. (2012) Keilschwanzloris - Gaung Trichoglossus Stephens,
1826. In, p. Poster. Arndt Verlag, Breen.
Astu, D., Azuma, N., Suzuki, H. & Higashi, S. (2006) Phylogenec re-
laonships within parrots (Psiacidae) inferred from mitochon-
drial cytochrome-b gene sequences. Zoological Science, 23(2),
191–198.
Bandelt, H.J., Forster, P. & Röhl, A. (1999) Median-joining networks for
inferring intraspecic phylogenies. Molecular Biology and Evolu-
on, 16, 37–48.
Begon, M.E., Harper, J.L. & Townsend, C.R. (1998) Ecology. Spektrum
Akademischer Verlag, Heidelberg, Berlin.
Braun, M. (2007) [How does thermal insulaon on buildings – as a re-
sult of EU climate protecon – aect the breeding biology of
tropical Ring-necked Parakeets (Psiacula krameri) in temperate
Central Europe?]. Ornithologische Jahreshee Baden-Würem-
berg, 23(2), 39–56.
Braun, M.P. (2014) Parrots (Aves: Psiaciformes): Evoluonary history,
phylogeography, and breeding biology. Dissertaon, Heidelberg
University, Heidelberg.
Braun, M. P., Bahr, N. & Wink, M. (2016) Phylogenie und Taxonomie der
Edelsiche (Psiaciformes: Psiaculidae: Psiacula), mit Besch-
reibung von drei neuen Gaungen. Vogelwarte, 54(4), 322–324.
Carstensen, D.W., Dalsgaard, B., Svenning, J.-C., Rahbek, C., Fjeldså, J.,
Sutherland, W.J. & Olesen, J.M. (2012) Biogeographical modules
and island roles: a comparison of Wallacea and the West Indies.
Journal of Biogeography, 39, 739–749.
Clouet, M. & Wink, M. (2000) The buzzards of Cape Verde Buteo (buteo)
bannermani and Socotra Buteo (buteo) spp.: First results of a ge-
nec analysis based on nucleode sequences of the cytochrome
b gene. Alauda, 68, 55–58.
Collar, N.J. (2000) Globally threatened parrots: Criteria, characteriscs
and cures. Internaonal Zoo Yearbook, 37, 21–35.
Cox., J. (1997) Columbidae XVIII-XXI: Plinopus, Drepanopla. Hand-
book of the birds of the world: Sandgrouse to cuckoos (ed. by
J. Del Hoyo, A. Ellio and J. Pargatal), pp. 204–225. Lynx, Bar-
celona.
Darriba, D., Taboada, G.L., Doallo, R. & Posada, D. (2012) jModelTest
2: more models, new heuriscs and parallel compung. Nature
Methods, 9, 772.
Del Hoyo, J., Collar, N.J., Chrise, D.A., Ellio, A. & Fishpool, L.D.C.
(2014) Illustrated checklist of the birds of the world volume 1:
Non-passerines. Lynx Edicions.
Dereeper, A., Guignon, V., Blanc, G., Audic, S., Buet, S., Chevenet, F.,
Dufayard, J.F., Guindon, S., Lefort, V., Lescot, M., Claverie, J.M. &
Gascuel, O. (2008) Phylogeny.fr: robust phylogenec analysis for
the non-specialist. Nucleic Acids Research, 465–469.
Diamond, J.M. (1975) Assembly of species communies. Ecology and
evoluon of communies (ed. by M.L. Cody and J.M. Diamond),
pp. 342–444. Mass., Belknap Press, Cambridge.
Drummond, A.J. & Rambaut, A. (2008) BEAST v1.4.8 2002-2008. Bayes-
ian Evoluonary Analysis Sampling Trees.
Eberhard, J.R. & Bermingham, E. (2005) Phylogeny and comparave
biogeography of Pionopsia parrots and Pteroglossus toucans.
Molecular Phylogenecs & Evoluon, 36, 288–304.
Ekstrom, J. & Butchart, S. (2014) Eclectus roratus. IUCN Red List for
birds. Downloaded from hp://www.birdlife.org. Available at:
hp://www.birdlife.org/ (accessed 01.02.2014).
Fernandes, A.M., Gonzalez, J., Wink, M. & Aleixo, A. (2013) Mullocus
phylogeography of the Wedge-billed Woodcreeper Glyphoryn-
chus spirurus (Aves, Furnariidae) in lowland Amazonia: Wide-
spread crypc diversity and paraphyly reveal a complex diver-
sicaon paern. Molecular Phylogenecs and Evoluon, 66,
270–282.
Fleischer, R.C., McIntosh, C.E. & Tarr, C.L. (1998) Evoluon on a volcanic
conveyor belt: using phylogeographic reconstrucons and K–Ar-
based ages of the Hawaiian Islands to esmate molecular evolu-
onary rates. Molecular Ecology, 7, 533–545.
Forshaw, J.M. (1977) Parrots of the World. T.F.H., Neptune, N.J.
Forshaw, J.M. (2006) Parrots of the World - an idencaon guide.
Princeton University Press, Princeton and Oxford.
Forshaw, J.M. (2010) Parrots of the world. Princeton University Press,
41 William St, Princeton, Nj 08540 USA.
Franklin, D.C. (1997) The foraging behaviour of avian nectarivores in a
monsoonal Australian woodland over a six-month period. Corel-
la, 21, 48–54.
Fritz, U., Auer, M., Bertolero, A., Cheylan, M., Fazzo, T., Hundsdörfer,
A.K., Sampayo, M.M., Pretus, J.L., Široký, P. & Wink, M. (2006)
A rangewide phylogeography of Hermann’s tortoise, Testudo
hermanni (Replia: Testudines: Testudinidae): implicaons for
taxonomy. Zoologica Scripta, 35, 531–543.
Groombridge, J.J., Jones, C.G., Nichols, R.A., Carlton, M. & Bruford,
M.W. (2004) Molecular phylogeny and morphological change in
the Psiacula parakeets. Molecular Phylogenecs & Evoluon,
31, 96–108.
Guindon, S. & Gascuel, O. (2003) A simple, fast, and accurate algorithm
to esmate large phylogenies by maximum likelihood. System-
ac biology, 52, 696–704.
Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W. &
Gascuel, O. (2010) New Algorithms and Methods to Esmate
Maximum-Likelihood Phylogenies: Assessing the Performance
of PhyML 3.0. Systemac Biology, 59, 307–321.
Hall, R. (2002) Cenozoic geological and plate tectonic evoluon of SE
Asia and the SW Pacic: computer-based reconstrucons, model
and animaons. Journal of Asian Earth Sciences, 20, 353–431.
Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment
editor and analysis program for Windows 95/98/NT. Nucleic Ac-
ids Symposium Series.

EUROPEAN JOURNAL OF ECOLOGY
65
Hasegawa, M., Kishino, H. & Yano, T. (1985) Dang of the human-ape
spling by a molecular clock of mitochondrial DNA. Journal of
Molecular Evoluon, 22, 160–174.
Heinsohn, R. & Legge, S. (2003) Breeding biology of the reverse-dichro-
mac, co-operave parrot Eclectus roratus. Journal of Zoology,
259, 197–208.
Heinsohn, R., Legge, S. & Barry, S. (1997) Extreme bias in sex allocaon
in Eclectus parrots. Proceedings of the Royal Society B Biological
Sciences, 264, 1325–1329.
Heinsohn, R., Legge, S. & Endler, J.A. (2005) Extreme reversed sexual
dichromasm in a bird without sex role reversal. Science, 309,
617–619.
Heinsohn, R., Ebert, D., Legge, S. & Peakall, R. (2007) Genec evidence
for cooperave polyandry in reverse dichromac Eclectus par-
rots. Animal Behaviour, 74, 1047–1054.
Juniper, T. & Parr, M. (2003) Parrots - a guide to the parrots of the
world. Christopher Helm, London.
Kornegay, J.R., Kocher, T.D., Williams, L.A. & Wilson, A.C. (1993) Path-
ways of lysozyme evoluon inferred from the sequences of cyto-
chrome b in birds. Journal of Molecular Evoluon, 37, 367–379.
Lavering, I.H. (1993) Quaternary and modern environments of the Van
Diemen Rise, Timor Sea, and potenal eects of addional pe-
troleum exploraon acvity. Bmr, 13, 281–292.
Le Gros, A., Samadi, S., Zuccon, D., Cornee, R., Braun, M. P., Senar, J. C.
& Clergeau, P. (2016) Rapid morphological changes, admixture
and invasive success in populaons of Ring-necked parakeets
(Psiacula krameri) established in Europe. Biological Invasions,
18, 1581–1598.
Legault, A., Chartendrault, V., Theuerkauf, J., Rouys, S. & Barre, N.
(2011) Large-scale habitat selecon by parrots in New Caledo-
nia. Journal of Ornithology, 152, 409–419.
Lohman, D.J., Ingram, K.K., Prawiradilaga, D.M., Winker, K., Sheldon,
F.H., Moyle, R.G., Ng, P.K., Ong, P.S., Wang, L.K. & Braile, T.M.
(2010) Crypc genec diversity in “widespread” Southeast Asian
bird species suggests that Philippine avian endemism is gravely
underesmated. Biological Conservaon, 143, 1885–1890.
Lydekker, R. (1896) A geographical history of mammals. University
Press, Cambridge.
MacArthur, R.H. & Wilson, E.O. (1967) The theory of island geography.
University Press, Princeton.
Marsden, S. & Fielding, A. (1999) Habitat associaons of parrots on the
Wallacean islands of Buru, Seram and Sumba. Journal of Bioge-
ography, 26, 439–446.
Mayr, E. (1941) List of New Guinea birds: a systemac and faunal list
of the birds of New Guinea and adjacent islands. American Mu-
seum of Natural History, New York, N.Y.
Mayr, E. & Diamond, J. (2001) The Birds of Northern Melanesia: Spe-
ciaon, Ecology, and Biogeography. Oxford University Press, UK.
Miller, M.A., Pfeier, W. & Schwartz, T. (2010) Creang the CIPRES
Science Gateway for inference of large phylogenec trees. In:
Gateway Compung Environments Workshop (GCE), 2010 (pp.
1-8). Ieee.
Newton, I. (2003) The speciaon and biogeography of birds. Academic
Press, London, San Diego.
Olah, G., Butchart, S.H.M., Symes, A., Guzmán, I.M., Cunningham, R.,
Brightsmith, D.J. & Heinsohn, R. (2016) Ecological and socio-
economic factors aecng exncon risk in parrots. Biodiversity
and Conservaon, 25, 205–223.
Päckert, M., Martens, J., Wink, M., Feigl, A. & Tietze, D.T. (2012) Mo-
lecular phylogeny of Old World swis (Aves: Apodiformes,
Apodidae, Apus and Tachymarps) based on mitochondrial and
nuclear markers. Molecular Phylogenecs and Evoluon, 63(3),
606–616.
Polzin, T. & Daneshmand, S.V. (2012) NETWORK 4.6.1.1. . Copyright
2004-2012 Fluxus Technology Ltd. All rights reserved.
Posada, D. (2008) jModelTest: phylogenec model averaging. Molecu-
lar Biology and Evoluon, 25, 1253–1256.
Rambaut, A. (2012) FigTree Tree Version 1.4.0 Figure Drawing Tool
2006-2012.
Rambaut, A. & Drummond, A.J. (2007) Tracer v1.4.
Ribas, C.C. (2004) Filogenias Moleculares e Biogeograa Histórica em
Psitacídeos (Aves: Psiacidae): Padrões e Processos de Diversi-
cação no Neotrópico. Universidade de São Paulo, Instuto de
Biociências. São Paulo.
Ribas, C.C. & Miyaki, C.Y. (2007) Comparave analysis of paerns of
diversicaon in four genera of Neotropical Parrots (Aves; Psit-
tacidae). Revista Brasileira de Ornitologia, 15, 245–252.
Ribas, C.C., Miyaki, C.Y. & Cracra, J. (2009) Phylogenec relaonships,
diversicaon and biogeography in Neotropical Brotogeris para-
keets. Journal of Biogeography, 36, 1712–1729.
Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A.,
Höhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsenbeck, J.P.
(2012) MrBayes 3.2: ecient Bayesian phylogenec inference
and model choice across a large model space. Systemac Biol-
ogy, 61, 539–542.
Sambrook, J., Fritsch, E.F. & Manias, T. (1989) Molecular cloning: a
laboratory manual. Cold Spring Harbor Laboratory Press, New
York.
Sanders, K.L., Lee, M.S.Y., Leys, R., Foster, R. & Sco Keogh, J. (2008)
Molecular phylogeny and divergence dates for Australasian ela-
pids and sea snakes (hydrophiinae): evidence from seven genes
for rapid evoluonary radiaons. Journal of evoluonary biol-
ogy, 21, 682–695.
Shields, G.F. & Wilson, A.C. (1987) Calibraon of mitochondrial DNA
evoluon in geese. Journal of Molecular Evoluon, 24, 212–217.
Shukuroglou, P. & McCarthy, M.A. (2006) Modelling the occurrence of
rainbow lorikeets (Trichoglossus haematodus) in Melbourne.
Austral Ecology, 31, 240–253.
Sorenson, M.D., Ast, J.C., Dimche, D.E., Mindell, Y.T. & Mindell, D.P.
(1999) Primers for a PCR-based approach to mitochondrial
genome sequencing in birds and other vertebrates. Molecular
Phylogenecs and Evoluon, 12, 105–114.
Springer, M.S., Westerman, M., Kavanagh, J.R., Burk, A., Woodburne,
M.O., Kao, D.J. & Krajewski, C. (1998) The origin of the Austral-
asian marsupial fauna and the phylogenec anies of the
enigmac monito del monte and marsupial mole. Proceedings
of the Royal Society of London. Series B: Biological Sciences,
265, 2381–2386.

EUROPEAN JOURNAL OF ECOLOGY
66
Stamatakis, A. (2006) RAxML-VI-HPC: Maximum Likelihood-based Phy-
logenec Analyses with Thousands of Taxa and Mixed Models.
Bioinformacs, 22, 2688–2690.
Stamatakis, A., Hoover, P. & Rougemont, J. (2008) A rapid bootstrap
algorithm for the RAxML Web servers. Systemac biology, 57,
758–771.
Staerseld, A., Ekstrom, J., Butchart, S. & Harding, M. (2014) Tricho-
glossus haematodus. IUCN Red List for birds. Downloaded from
hp://www.birdlife.org. Available at: hp://www.birdlife.org/
(accessed 01.02.2014).
Steadman, D.W. (1993) Biogeography of Tongan birds before and aer
human impact. Proceedings of the Naonal Academy of Scienc-
es of the United States of America, 90, 818–822.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar,
S. (2011) Molecular Evoluonary Genecs Analysis Using Maxi-
mum Likelihood, Evoluonary Distance, and Maximum Parsimo-
ny Method. Molecular Biology and Evoluon, 28, 2731–2739.
Tarr, C.L. & Fleischer, R.C. (1993) Mitochondrial-DNA variaon and
evoluonary relaonships in the Amakihi complex. The Auk,
825–831.
Tavaré, S. (1986) Some probabilisc and stascal problems in the
analysis of DNA sequences. Lect. Math. Life Sci, 17, 57–86.
Tavares, E.S., Baker, A.J., Pereira, S.L. & Miyaki, C.Y. (2006) Phylogenec
relaonships and historical biogeography of Neotropical parrots
(Psiaciformes: Psiacidae: Arini) inferred from mitochondrial
and nuclear DNA sequences. Systemac Biology, 55, 454–470.
Taylor, J. (2013) BirdLife Internaonal: Rainbow Lorikeet (Trichoglos-
sus haematodus) is being split: list T. rosenbergii as Vulner-
able and both T. weberi and T. forsteni as Near Threatened?
Available at: hp://www.birdlife.org/globally-threatened-
bird-forums/2013/09/rainbow-lorikeet-trichoglossus-haema-
todus-is-being-split-list-t-rosenbergii-as-vulnerable-and-t-we-
beri-and-t-forsteni-as-near-threatened/ (accessed 20.07.2014).
Thompson, J.G., Higgins, D.G. & Gibson, T.J. (1994) clustal w: improv-
ing the sensivity of progressive mulple sequence alignments
through sequence weighng, posion specic gap penales and
weight matrix choice. Nucleic Acids Research, 22, 4673–4680.
Tobias, J.A., Seddon, N., Sposwoode, C.N., Pilgrim, J.D., Fishpool, L.D.
& Collar, N.J. (2010) Quantave criteria for species delimita-
on. Ibis, 152, 724–746.
Van Der Kaars, W.A. (1991) Palynology of eastern Indonesian marine
piston-cores a late Quaternary vegetaonal and climac record
for Australasia. Palaeogeography Palaeoclimatology Palaeoecol-
ogy, 85, 239–302.
Voris, H.K. (2000) Maps of Pleistocene sea levels in Southeast Asia:
Shorelines, river systems and me duraons. Journal of Bioge-
ography, 27, 1153–1167.
Wallace, A.R. (1869) The Malay Archipelago: The land of the orang-
utan, and the bird of paradise. A narrave of travel, with studies
of man and nature. Macmillan and Co., London.
Wallace, A.R. (1876) The geographical distribuon of animals. Harper,
New York.
Waterhouse, R.D. (1997) Some observaons on the ecology of the
Rainbow lorikeet Trichoglossus haematodus in Oatley, South
Sydney. Corella, 21, 17–24.
Weir, J. & Schluter, D. (2008) Calibrang the avian molecular clock. Mo-
lecular Ecology, 17, 2321–2328.
Wink, M. & Sauer-Gürth, H. (2000) Advances in the molecular system-
acs of African raptors. Raptors at Risk (ed. by R.D. Chancellor
and B.U. Meyburg), pp. 135–147. WWGBP/ Handcock House.
Wink, M., Kuhn, M., Sauer-Gürth, H. & Wi, H.-H. (2002) Ein Eistaucher
(Gavia immer) bei Düren – Fundgeschichte und erste genesche
Herkunsuntersuchungen. Charadrius, 38, 239–245.