Billbug (Coleoptera: Dryophthoridae: Sphenophorus spp.) Seasonal Biology and DNA-Based Life Stage Association in Indiana Turfgrass

Abstract

Eleven species of billbugs (Coleoptera: Dryophthoridae: Sphenophorus spp. Schönherr) infest managed turfgrass in North America. However, the regional variation in species composition remains unresolved and the seasonal phenology of several species has not been well documented. The latter gap is largely due to the inability to identify the larval stage to species-a confounding problem with several sympatric insect species. We used field trapping (adults) and soil sampling (larvae and pupae) surveys along with a DNA-based life-stage association to characterize the biology of billbugs associated with turfgrass in the Midwestern United States. Pitfall trapping at four locations in Indiana revealed four billbug species: S. venatus Say, S. parvulus Gyllenhaal, S. minimus Hart, and S. inaequalis Say. Sphenophorus venatus was the most abundant species on warm-season turfgrass while S. parvulus was most abundant on cool-season turfgrass. Investigation of S. venatus seasonal biology revealed two overwintered life stages-larva and adult-which resulted in two overlapping cohorts and two larval generations. Degree-day models describing S. venatus activity were more accurate for first-generation adults and larvae than for overwintering life stages. Maximum-likelihood analyses provided the first molecular species identification of billbug larvae and direct evidence that S. venatus larvae are capable of overwintering above 40°N latitude. Findings clarify the utility of molecular markers (CO1, 18S, and ITS2) for describing billbug larval population dynamics and seasonal phenology in regions where several sympatric billbug species occur. These results support the development of sustainable management strategies based on billbug seasonal phenology in different regions of North America.

Full text

304
© The Author(s) 2018. Published by Oxford University Press on behalf of Entomological Society of America.
All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Horticultural Entomology
Billbug (Coleoptera: Dryophthoridae: Sphenophorus spp.)
Seasonal Biology and DNA-Based Life Stage Association
in Indiana Turfgrass
Alexandra G.Duffy,1,3 Gareth S.Powell,1Jennifer M.Zaspel,1,2 and Douglas S.Richmond1
1Department of Entomology, Purdue University, 901 West State Street, West Lafayette, IN 47907, 2Milwaukee Public Museum, 800
West Wells Street, Milwaukee, WI 53233, and 3Corresponding author, e-mail: agduffy4@gmail.com
Subject Editor: John Trumble
Received 19 September 2017; Editorial decision 14 November 2017
Abstract
Eleven species of billbugs (Coleoptera: Dryophthoridae: Sphenophorus spp. Schönherr) infest managed turfgrass
in North America. However, the regional variation in species composition remains unresolved and the seasonal
phenology of several species has not been well documented. The latter gap is largely due to the inability to identify
the larval stage to species—a confounding problem with several sympatric insect species. We used field trapping
(adults) and soil sampling (larvae and pupae) surveys along with a DNA-based life-stage association to characterize
the biology of billbugs associated with turfgrass in the Midwestern United States. Pitfall trapping at four locations
in Indiana revealed four billbug species: S. venatus Say, S. parvulus Gyllenhaal, S. minimus Hart, and S. inaequalis
Say. Sphenophorus venatus was the most abundant species on warm-season turfgrass while S. parvulus was most
abundant on cool-season turfgrass. Investigation of S. venatus seasonal biology revealed two overwintered life
stages—larva and adult—which resulted in two overlapping cohorts and two larval generations. Degree-day models
describing S. venatus activity were more accurate for first-generation adults and larvae than for overwintering life
stages. Maximum-likelihood analyses provided the first molecular species identification of billbug larvae and direct
evidence that S. venatus larvae are capable of overwintering above 40°N latitude. Findings clarify the utility of
molecular markers (CO1, 18S, and ITS2) for describing billbug larval population dynamics and seasonal phenology
in regions where several sympatric billbug species occur. These results support the development of sustainable
management strategies based on billbug seasonal phenology in different regions of North America.
Key words: phenology, degree days, larval identification
Billbugs (Coleoptera: Dryophthoridae) were rst recognized as a seri-
ous pest of turfgrass in the 1960s after an outbreak of the bluegrass
billbug, Sphenophorus parvulus Gyllenhaal, occurred across several
states (Tashiro and Personius 1970). Billbug damage rst appears as
small spots (5–8cm in diameter) of brown, dying turfgrass, which
coalesce to form large, irregular patches (Vittum etal. 1999). Billbug
damage is arguably the most widely misdiagnosed insect-related tur-
fgrass disorder in North America, often being confused for drought,
soil compaction, or disease (Vittum etal. 1999). As a result, billbugs
often become a perennial problem with the accumulation of dam-
age resulting in seriously degraded stands of turfgrass that are easily
encroached by weeds (Richmond etal. 2000).
Adult billbugs are stem-feeding beetles that chew notches in
the grass tiller and then oviposit within the tiller. For the hunting
billbug, S. venatus, adult feeding and oviposition, as well as larval
feeding, contributes to damage in warm-season grasses (Doskocil
and Brandenburg 2012). In contrast, S.parvulus is considered the
most widespread billbug pest of cool-season turfgrasses, but larvae
are the only known damaging life stage. Younger S.parvulus larvae
hollow out grass tillers, leaving a diagnostic sawdust-like frass and
stems that are easily broken from the plant crowns at the soil sur-
face. Mature larvae reside in the soil and root zone, feeding on plant
crowns, roots, rhizomes, and stolons before pupation (Vittum etal.
1999).
Successful management of billbugs currently relies heavily on
chemical intervention, with three insecticide-based management
strategies, targeting different developmental stages, having been
widely adopted: 1)preventative application of contact insecticides
targeting overwintering adults prior to spring oviposition, 2)pre-
ventive application of plant-systemic insecticides to control adults
and early instar larvae inside the stems, and 3)curative application
of soil insecticides targeting late instar larvae in the soil after dam-
age is visible (Richmond 2016). Successful management utilizing
these strategies is largely dependent on accurately timed insecticide
Journal of Economic Entomology, 111(1), 2018, 304–313
doi: 10.1093/jee/tox340
Advance Access Publication Date: 4 January 2018
Research Article
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018

applications, which varies regionally with species composition and
seasonal phenology. Predictive degree-day models, which assume
that insect development is directly related to ambient temperatures
(Higley etal. 1986), coupled with effective population monitoring,
can aid in accurately timed insecticide applications. Adegree-day
model was developed for the bluegrass billbug S.parvulus in Ohio
(Watschke etal. 2013) to predict initial adult activity in the spring,
presence of larvae in the soil, and observation of damage symptoms.
However, this model does not take into account regional variation
(Dupuy et al. 2017) or populations comprised of multiple billbug
species.
Sixty-four species of Sphenophorus Schönherr are native to
North America (Niemczyk and Shetlar 2000), with 11 species rec-
ognized as pests of managed turfgrass (Held and Potter 2012).
Historically, management regimes have been based on the biology
and ecology of the two most widely distributed pest species, the
bluegrass billbug S. parvulus in cool-season (C3) grasses, and the
hunting billbug S. venatus in warm-season (C4) grasses. However,
billbug species composition varies regionally, resulting in a nation-
wide collage of billbug species assemblages (Johnson-Cicalese 1990,
Dupuy and Ramirez 2016). In recent decades, regional variation in
adult species composition and seasonal phenology has been docu-
mented in Arkansas (Young 2002), Florida (Huang and Buss 2009,
Huang and Buss 2013), New Jersey (Johnson-Cicalese et al. 1990),
North Carolina (Doskocil and Brandenburg 2012), South Carolina
(Chong 2015), Virginia (Kuhn et al. 2013), and Mexico (Ordaz-
González et al 2014). However, despite high damage potential, larval
populations are more difcult to characterize. This is largely due to
co-occurrence of multiple billbug species and the inability to mor-
phologically identify the larvae to species level.
Vaurie’s (1951) revision of Sphenophorus in the United States
and Mexico remains the most comprehensive taxonomic reference
for the genus to date. Later, Johnson-Cicalese et al. (1990) con-
structed an illustrated key to eight Sphenophorus turf pests in the
United States, in which the adults are readily identiable by the
markings and indentations on the pronotum, elytra, abdominal
sclerites, and profemur (Johnson-Cicalese 1990). There are also
several characteristics to distinguish the pupal stage of billbug spe-
cies, primarily setae, the length of the rostrum, and the width of
the pronotum (Satterthwait 1931). However, there are currently no
published external characteristics to distinguish between the species
of white, legless, grub-like billbug larvae (Anderson 1948, Vittum
et al. 1999). When several species co-occur, as is common with
billbugs infesting turfgrass across North America, identication of
larvae based solely on association with the presence of the adults
may be unreliable. Arelatively poor understanding of the seasonal
phenology and overwintering behavior of many Sphenophorus spp.
in the Midwestern United States has constrained the development
and implementation of integrated pest management (IPM) programs
for the billbug species assemblage. Other systems have successfully
employed molecular methods to associate the adult and larval stages
of morphologically cryptic insects (Miller et al. 2005) and multi-
species assemblages (Ahrens etal. 2007). Although molecular life-
stage association has been investigated for white grubs (Coleoptera:
Scarabaeidae) in turfgrass (Doskocil etal. 2008), the utility of this
approach has not been previously examined for billbugs.
Four species typically infest managed turfgrass the
Midwestern United States, S. parvulus, S. venatus, S. minimus
Hart, and S.inaequalis Say (Johnson-Cicalese et al. 1990), but
management strategies in the Midwest are still largely based on
the seasonal ecology of the most common species, S.parvulus.
However, S. venatus has also recently become more abundant
and particularly problematic in this region. Sphenophorus vena-
tus phenology varies regionally across the United States, with
up to six overlapping generations per year in Florida (Huang
and Buss 2009), two overlapping generations per year in North
Carolina (Doskocil and Brandenburg 2012), and one genera-
tion per year in New Jersey (Johnson-Cicalese etal. 1990) and
northwest Arkansas (Young 2002). Although S.venatus may be
capable of overwintering as larvae, even in the more northerly
parts of its range (Doskocil and Brandenburg 2012), the iden-
tity of overwintering larvae has never been confirmed due to the
lack of diagnostic characters. The objectives of this research were
to examine billbug species composition, describe adult seasonal
activity of the most common species, and clarify the seasonal
phenology of S. venatus in Indiana turfgrass systems. We also
aimed to determine if S.venatus larvae are capable of overwin-
tering in this region of the United States. In pursuing this goal, we
evaluated the utility of three genetic loci (cytochrome oxidase c
subunit 1 [COI], 18S, and the second internal transcribed spacer
region [ITS2]) for identifying billbug larvae to specieslevel.
Materials and Methods
Species Composition and Seasonal Activity
Four locations in Indiana with a history of billbug infestations
were selected for monitoring billbug adult species composition
and seasonal activity patterns: 1) Azoysiagrass fairway located
at Rolling Hills Country Club (RHCC) in Warrick County
(April–October 2009), 2) Kentucky bluegrass research plots at
the William H.Daniel Turfgrass Research and Diagnostic Center
(DTRC) (May–August 2014; March–November 2015 and 2016),
3) a stand consisting primarily of Kentucky bluegrass at the
Purdue University nursery (PUN) (March–November 2016), and
4)a Bermudagrass athletic eld at the Purdue University Bimmel
Practice Complex (BPC) (May–August 2014; March 2015–
December 2016). Pitfall traps were constructed from one of two
different materials; cup-type pitfall traps made from plastic deli
cups (473ml) with holes in the bottom for drainage, or linear pit-
fall traps constructed from a 0.9 m section of a polyvinyl chloride
pipe (7.62cm inside diameter) with a 2.5-cm-wide slit cut length-
wise down the majority of one side of the pipe. Acap was fastened
at one end of the linear traps, and the other end was inserted into
a plastic cup with a lid. Linear pitfall traps are generally consid-
ered more efcient because they provide a larger trapping cross
section. However, because of their increased size, their use was not
practical in all cases. To compensate for this, we employed a larger
number of cup pitfalls at sites where installation of linear pitfall
traps was not feasible. The design and number of active traps was
consistent for each monitoring site throughout the duration of the
sampling periods. Two linear pitfall traps were used to monitor
adult activity periods at RHCC (2009), eight cup pitfall traps were
used to monitor DTRC (2014–2016) and BPC (2014–2016), and
four linear pitfall traps were used to monitor PUN (2016). Because
of the differences in trap composition between sites, no between-
site statistical comparisons were made during thestudy.
Traps were surveyed at least once weekly from March to
November. Traps located at the Bermudagrass athletic field were
also monitored once a month from December 2015 to February
2016. Adult billbugs were identified to species in the labora-
tory based on morphological characters described by Vaurie
(1951) and Johnson-Cicalese etal. (1990). For populations that
were monitored over the entire duration of the growing season
305
Journal of Economic Entomology, 2018, Vol. 111, No. 1
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018

(2009, 2015, and 2016), the proportion of total number of
adults trapped was plotted against Julian date and fitted with a
LOWESS regression (ƒ=0.1) to visualize peaks of adult activity
(Trexler and Travis 1993). Males and females were distinguished
by the presence of a groove or depression on the metasternum
and the shape of the first two abdominal sterna (Johnson-
Cicalese etal. 1990). The potential for sex-biased seasonal activ-
ity for S.venatus and S.parvulus was examined in populations
that exceeded 50 total beetles trapped using a repeated measures
analysis of variance (Statistica 13, Dell Inc. 2015).
To search for larvae and pupae, 10 soil cores (9cm depth,
10.16cm diameter) were extracted with a standard golf course
cup-cutter and destructively sampled in the field by breaking
apart the soil and searching the roots, thatch, and plant material
for all billbug life stages. Soil sampling occurred on a weekly
basis from April 1 through October 31, 2009 on the zoysiagrass
fairway at RHCC. Sampling occurred weekly on Bermudagrass
at BPC, March through November during 2015 and 2016, and
monthly December 2015 through February 2016. All larvae and
pupae recovered were immediately preserved in 95% ethanol.
To characterize larval biology across the growing season, head
capsule width was used as an indicator of larval development
(Doskocil and Brandenburg 2012). All larvae collected during
2015 and 2016 were dorsally imaged using a Leica DFC450 cam-
era mounted onto a MC165C stereomicroscope. Head capsule
widths were measured using the Leica Application Suite version
4.2.0 (Leica Microsystems).
S.venatus Predictive Degree-DayModels
To develop predictive models for the seasonal activity of adult
S. venatus and larval populations, cumulative degree days
(CDD) were calculated from a biofix date of January 1 with a
single sine calculation method in DegDay v. 1.01 (Snyder 2002)
using the daily maximum/minimum ambient air temperature
data collected from the nearest Indiana State Climate Office
weather station: Southwest Purdue Agricultural Center (Knox
county, 2009) and Purdue Agronomy Center for Research and
Education (Tippecanoe county, 2015 and 2016). The lower
developmental threshold was set at 7.8°C (Kamm 1969, Umble
et al. 2005). The relationships between degree-day accumu-
lations and the cumulative proportion of adults and larvae
collected in the pitfalls and soil samples from the first (over-
wintered) and second (first generation) activity peaks were ana-
lyzed using a two-parameter Weibull-cumulative distribution
function, y = 1/[1 + exp(a + b * x)], where y is the cumulative
proportion of adults or larvae collected, x is CDD (base 7.8°C),
and a and b are shape and scale parameters, respectively. The
shape and scale parameters were estimated in the least squares
nonlinear estimation module of Statistica 13.0 (Dell Inc 2015)
using the Levenberg–Marquardt method and starting values
of 0.001 for all parameters. The nonlinear Weibull-cumulative
distribution function has been widely used to model insect
development (Wagner et al. 1984) and Marquardt methods of
nonlinear regression are typically used to obtain least squares
parameter estimates for these models. This approach uses start-
ing values provided by the researcher to iteratively estimate
regression parameters (Marquardt 1963). Start and end dates
for the overwintered and first-generation adults and larvae
were determined using the activity peaks illustrated in Fig. 1A
and the larval head capsule measurements illustrated in Fig. 2.
DNA-Based Life Stage Association
Following manufacturer protocols, genomic DNA was extracted
using a DNeasy blood and tissue kit (Qiagen, Valencia, CA) from
whole-body homogenizations of the thorax and abdomen for three
S. venatus, S. parvulus, S.minimus, and S. inaequalis adult speci-
mens, seven overwintered larvae collected from Bermudagrass (11
March–7 April 2015, 11–29 March 2016), and three larvae col-
lected from Kentucky bluegrass (14–19 July 2016). Listronotus
maculicollis and Donus zoilus adults were included as outgroups.
DNA was quantied using a ThermoScientic NanoDrop 2000
spectrophotometer.
Three loci, COI, 18S, and ITS2, covering mitochondrial
(mtDNA), ribosomal (rDNA), and nuclear ribosomal (nrDNA)
DNA, respectively, were amplied using polymerase chain reac-
tion (PCR) (Table1). PCR was performed using a BioRad C1000
thermocycler. Amplied DNA fragments were visualized using gel
electrophoresis in a 1% agarose gel in TBE buffer. Amplicons were
then puried using a PCR purication kit following manufacturer
protocols (Qiagen, Valencia,CA).
Purified products were multiplexed by specimen and submit-
ted to the Purdue Genomics Core for sequencing on the Illumina
MiSeq platform following the “Wideseq” pipeline (Powell 2017) .
The resulting short read sequences were mapped back to known
loci reference sequences (COI, AY131117; 18S, AF389038;
ITS2, AY837713) in Geneious R9 (Kearse et al. 2012) follow-
ing parameters used by Powell (2017). Consensus sequences
were also visualized and trimmed using Geneious R9 (Kearse
et al. 2012). Phylogenetic analyses were conducted using the
Cyberinfrastructure for Phylogenetic Research (CIPRES) portal
v3.1 (Miller etal. 2010); a maximum-likelihood was conducted
using the default RAxML settings (1,000 bootstrap replicates).
All outputs were edited and annotated with FigTree v1.2.2
(Rambaut and Drummond 2008).
Table1. COI, 18S, and ITS2 primers and amplification conditions for PCR reactions for Sphenophorus spp. Schönherr adults and larvae
associated with turfgrass in Indiana
Gene Primer sequencea
Hot start
°C (min)
Denature
°C (min)
Anneal °C
(min)
Extend
°C (min)
Final ex-
tend °C
(min)
No.
cycles
CO1 (F)TAATACGACTCACTATAGGGCAACATTTATTTTGATTTTTTGG 94 (2:00) 94 (1:00) 48 (1:00) 72 (1:00) 72 (12:00) 40
(R)ATTAACCCTCACTAAAGTCCAATGCACTAATCTGCCATATTA
18S (F)TACCTGGTTGATCCTGCCAGTAG 95 (10:00) 94 (0:30) 50–55 (0:30) 72 (1:30) 72 (10:00) 41
(R)GACGGTCCAACAATTTCACC
ITS2 (F)AATACGACTCACTATAGGGTGAACATCGACATTTYGAACGCACA 95 (5:00) 95 (1:00) 57–60 (0:30) 72 (1:00) 72 (7:00) 33
(R)TTAACCCTCACTAAAGTTCTTTTCCSCTTAYTRATATGCTTAA
aForward (F) and reverse (R) primer sequence fragments from Cline etal. (2014) and Brown etal (2012).
306 Journal of Economic Entomology, 2018, Vol. 111, No. 1
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018

Results
Adult Species Composition and Seasonal Activity
In this study, a total of 2,115 adult billbugs were collected across the
four sites surveyed. Four different species were identied: S. venatus,
S. parvulus, S. minimus, and S. inaequalis (Table 2). All four species
were collected on both warm- and cool-season turfgrass, with S. vena-
tus being the most abundant species on warm-season turfgrass and S.
parvulus the most abundant on cool-season turfgrass. S. parvulus, S.
minimus, and S. inaequalis all appeared to be univoltine, with peak
adult activity overlapping in late May through early July (Fig. 1B–D).
However, S. venatus adults remained active throughout the growing
season with multiple peaks of adult activity (Fig. 1A). Three peaks of S.
venatus adult activity were observed consistently across all three trap-
ping seasons: 1) overwintered adults becoming active in the spring, 2)
a second peak of late spring activity, likely resulting from development
and emergence of overwintered larvae, and 3) a broader, less dened
peak likely representing the rst full generation of adults resulting from
the two overwintering cohorts.
Signicantly more male than female S. venatus adults were
trapped at the Bimmel Practice Complex (F1, 2 = 25.72, P = 0.037). In
2015, 67% of the 489 total S. venatus adults trapped at the Bimmel
Table2. Billbug (Sphenophorus spp. Schönherr) species abundances and percent composition of billbug adult population at four locations
in Indiana
Species
Location
Total
Rolling hills Bimmel Center Daniel Center Nursery
Zoysiagrassa (2009) Bermudagrassb (2014–2016) KY bluegrassc (2014–2015) KY bluegrass (2016)
S.venatus 116 (97.5%) 1482 (94.5%) 14 (5.5%) 0 (0.0%) 1,612 (76.2%)
S.parvulus 3 (2.5%) 50 (3.2%) 214 (84.3%) 136 (78.6 %) 403 (19.0 %)
S.minimus 0 (0.0%) 35 (2.2%) 24 (9.4%) 31 (17.9%) 90 (4.3%)
S.inaequalis 0 (0.0%) 2 (0.1%) 2 (0.8%) 6 (3.5%) 10 (0.5%)
Total 119 1569 254 173 2115
Grass species and (years surveyed) are indicated for each location.
aZoysia japonica “Meyer”.
bCynodon dactylon “Patriot”.
cPoa pratensis.
Fig.1. Proportion of Sphenophorus venatus Say (A), S.parvulus Gyllenhaal (B), S.minimus Hart (C), and S.inaequalis Say (D) adults trapped in pitfall traps.
Data are fitted with a robust locally weighted regression (LOWESS fit, ƒ=0.1).
307Journal of Economic Entomology, 2018, Vol. 111, No. 1
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018

Practice Complex were male. Similarly, in 2016, 69% of the 588 S.
venatus adults trapped were male. This differential sex ratio was not
affected by the time of year (F30,60 = 0.64, P = 0.909).
Sixty-eight and twenty-two larvae were collected at the Bimmel
Practice Complex from March to December in 2015 and 2016,
respectively. Larval head capsule width ranged from 0.733 mm
to 2.420 mm and varied across the growing season (Fig. 2).
Overwintered larvae were collected in March, prior to rst-observed
adult activity, in 2015 and 2016. The larva with the widest head
capsule was observed coming out of winter on JD 85 (March
2016, CDD7.8°C=25). Large larvae (>1.7mm) were observed until
JD 190 (July 2015, CDD7.8°C = 1054.8) and JD 187 (July 2016,
CDD7.8°C = 1074.1) and then were not observed again in the soil
for a period of approximately 40 d. The smallest head capsule
widths (<1.0 mm) were observed between JD 152 (May 2016,
CDD7.8°C=575.0) and JD 168 (June 2015, CDD7.8°C=783.7), likely
marking the occurrence of rst-generation larvae in the soil as a result
of reproduction by overwintered adults. Small larvae (<1.0 mm)
were not collected again until 90 d later, on JD 260 (September,
CDD7.8°C= 2059). Medium-sized larvae (between 1.0 and 1.7mm)
were present in the soil during the entire growing season.
Four Sphenophorus pupae were found at the Bimmel Practice
Complex in July 2015 (CDD7.8°C = 1054.8–1385.9). In 2016, one
Sphenophorus pupae was found in July (CDD7.8°C = 1074.1) and
another in August (CDD7.8°C = 1531.1). These dates likely corre-
spond with the end of the immature phase of development for the
rst full generation resulting from overwintered S. venatus adults
and larvae, respectively. All larvae and pupae were collected from
within 6cm of the soil surface.
Sphenophorus venatus Predictive
Degree-DayModel
A two-parameter Weibull-cumulative distribution function was used to
describe the population dynamics of S. venatus overwintered and rst-
generation adults and larvae as a function of CDD7.8°C (Table 3, Fig. 3).
Parameter estimates generated by nonlinear regression were statistically
signicant (α = 0.05) in all cases with the exception of overwintering
larvae at the RHCC location. Based on values for R2 and mean square
error (MSE), overall model t was marginally better for the rst-gener-
ation adult activity than for overwintered adult activity, and the same
pattern was true for larvae. Overwintering adult activity reached 50%
between 120 and 220 CDD7.8°C, whereas the activity of rst-generation
adults reached 50% between 585 and 835 CDD7.8°C. The activity of
overwintering larvae in the soil reached 50% between 102 and 215
CDD7.8°C, whereas the activity of rst-generation larvae reached 50%
between 835 and 1050 CDD7.8°C.
DNA-Based Life Stage Association
We obtained sequences from three specimens of S.venatus, S. par-
vulus, S.minimus, and S.inaequalis adults, 10 Sphenophorus spp.
larvae, one Listronotus maculicollis adult, and one Donus zoilus
adult (Table 4). Maximum-likelihood trees constructed based on
concatenated sequences of COI, 18S, and ITS2 regions resulted in
well-supported groupings for all four adult species (bootstraps ≥
73%) (Fig.4). All 10 unknown larvae were recovered with one of
the known adult species (bootstraps ≥ 63%) (Fig.4). All seven over-
wintered larvae collected from Bermudagrass were recovered with
S.venatus adults (bootstraps ≥ 63%) (Fig.4). Two of the three larvae
collected from Kentucky bluegrass were recovered with S.minimus
adults (bootstrap = 88%) and the remaining larva was recovered
with S.parvulus (bootstrap=73%) (Fig.4).
Discussion
Eleven Sphenophorus species are pests of managed turfgrass. However,
the species composition and abundances of turf-infesting billbugs
vary regionally across North America (Dupuy and Ramirez 2016).
In Indiana, we trapped four billbug species: S.venatus, S.parvulus,
S. minimus, and S. inaequalis. These four species have previously
been documented in this region of the country based on historical
collection data (Johnson-Cicalese etal. 1990). Johnson-Cicalese etal.
(1990) observed nearly equal abundances of these four species in
cool-season turfgrasses in New Jersey, whereas in the present study,
S.venatus dominated warm-season turfgrasses and S. parvulus was
most abundant in cool-season Kentucky bluegrass. Such dissimilari-
ties in billbug species composition and abundances between trapping
sites within a region has also been documented in South Carolina
(Chong 2015), North Carolina (Doskocil and Brandenburg 2012),
and Florida (Huang and Buss 2013), and may be related to the host
species present, variation in management regimes, or a combination
of these factors.
Three of the four species, S.parvulus, S.minimus, and S. inae-
qualis, all produced one generation a year and had signicant over-
lap in peak adult activity from May to June. In contrast, S.venatus
adults initiated activity earlier in the spring (March) and displayed
multiple peaks of adult activity throughout the growing season.
Important differences in the seasonal activity of S.venatus relative
to the three other sympatric billbug species documented during this
study could complicate management in regions where these pheno-
logically diverse species are present. These ndings emphasize the
importance of proper monitoring, identication, and knowledge of
billbug seasonal biology as prerequisites for sound pest management
programming.
This is the rst study investigating hunting billbug S. venatus
seasonal biology in the Midwest. As in the present study, male-
biased trap captures for S.venatus across the growing season has
been reported in New Jersey (Johnson-Cicalese etal. 1990), Florida
(Huang and Buss 2013), and South Carolina (Chong 2015). The
apparently male-biased sex ratio observed in the present study (67–
69% male) was most similar to ndings of Johnson-Cicalese etal.
(1990) in New Jersey, where 65% of the S.venatus adult population
were male. However, Young (2002) reported a male-biased sex ratio
for only a short period early in the spring rather than across the
Fig. 2. Head capsule widths (mm) of Sphenophorus Schönherr larvae
(n =90) collected from March 2015 to November 2016 at Bimmel Practice
Center in West Lafayette, Indiana. Dashed lines indicate the upper limit of
small (1.0mm) and lower limit of large (1.7mm) larval head capsule widths
as described in Doskocil and Brandenburg (2012). BPC= Bimmel Practice
Complex.
308 Journal of Economic Entomology, 2018, Vol. 111, No. 1
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018

entire year. Because pitfall trapping is a passive collection technique,
the observed male-biased sex ratio of S.venatus populations could
indicate that males are more mobile or more active than females, but
does not necessarily provide conclusive evidence for a male-biased
population. The development of dependable, less passive sampling
techniques, such as those involving semiochemicals, may be required
to condently characterize the sex ratio of S.venatus populations
and determine how sex ratio might inuence seasonal population
dynamics and management options.
The current study provides direct evidence that two generations of
larvae likely occur in Indiana. This assertion is supported by the pres-
ence of small larvae (<1.0mm) in the soil during spring and again dur-
ing the fall. Head capsule widths from eld-collected Sphenophorus
larvae ranged from 0.733mm to 2.420 mm, similar to the range of
a previous study in Florida where head capsule widths ranged from
0.4 to 2.4 mm (Huang 2008). Similar to other weevil species, bill-
bugs are presumed to have ve larval instars (Kamm 1969, Huang
2008, Dupuy and Ramirez 2016), but the relationship between lar-
val size and developmental instar has not been established, partially
due to the difculty of rearing larvae completely to adulthood in lab.
In Utah, Hansen (1987) divided the larval instars from an S. par-
vulus infested range grass nursery into three classes by larval head
capsule width: rst instars <0.6mm, middle instars between 0.6 and
1.15 mm, and late instars <1.15mm. Similarly, in North Carolina,
eld-collected Sphenophorus spp. larvae were also grouped into three
size classes: small (head capsule width <1.0mm), medium (head cap-
sule width between 1.0 and 1.7mm), and large (head capsule width
>1.7mm) (Doskocil and Brandenburg 2012). In the North Carolina
study, medium sized larvae (between 1.0 and 1.7mm) were present
across almost the entire year, whereas small (<1.0 mm) and large
(>1.7mm) larvae were primarily present during two different periods;
May–August and September–October for small larvae (<1.0mm), and
February–April and July–September for large larvae (>1.7mm). Since
observed head capsule widths in the present study also did not provide
the level of resolution necessary to clearly delineate the different larval
instars sizes, larvae were divided into the three size classes proposed
by Doskocil and Brandenburg (2012). These groupings provided
relatively coarse but useful insights into larval phenology during the
growing season that could provide a basis for establishing manage-
ment recommendations focused on the larvalstage.
The rst appearance of small larvae (<1.0mm) in the soil May–
June (CDD7.8°C ≥ 575.0) likely marks the rst generation of larvae
resulting from overwintered adults. Similarly, the observation of
small larvae present in the soil again starting in early September
(CDD7.8°C ≥ 2059.0) likely indicates the beginning of the second lar-
val generation. Both of these larval generations are vulnerable tar-
gets for soil insecticide applications. Although all three size classes
were present in the soil in December, only medium (between 1.0 and
1.7mm) and large larvae (>1.7mm) were found in March of the fol-
lowing year. It is unclear if this nding indicates that smaller larvae
Table3. Parameter estimates and regression statistics for two-parameter Weibull-cumulative distribution function y=1/(1+ exp(a + b * x))
describing the relationship between cumulative degree days (base 7.8°C) and Sphenophorus venatus say adult and larval activity at two
different locations in Indiana
Life stage Activity periodaLocationbYear R2MSE Parameter Estimate (±SE) t value df P value
Adult 1 RHCC 2009 1.00 0.013 a 5.755±0.160 35.95 2 <0.001
b −0.028±0.001 −36.17 2 <0.001
Adult 1 BPC 2015 0.99 0.002 a 4.495±0.499 9.01 5 <0.001
b −0.037±0.004 −9.87 5 <0.001
Adult 1 BPC 2016 0.98 0.006 a 6.124±0.993 6.16 8 <0.001
b −0.028±0.004 −6.38 8 <0.001
Adult 1 All All 0.80 0.047 a 3.679±0.947 3.88 19 <0.001
b −0.021±0.006 −3.81 19 0.001
Adult 2 RHCC 2009 0.97 0.005 a 7.009±1.046 6.70 7 <0.001
b −0.008±0.001 −6.72 7 <0.001
Adult 2 BPC 2015 0.98 0.003 a 5.596±0.561 9.98 7 <0.001
b −0.010±0.001 −9.90 7 <0.001
Adult 2 BPC 2016 0.97 0.006 a 6.262±1.019 6.15 7 <0.001
b −0.010±0.002 −6.16 7 <0.001
Adult 2 All All 0.84 0.024 a 5.257±0.906 5.80 25 <0.001
b −0.008±0.001 −5.84 25 <0.001
Larvae 1 RHCC 2009 0.90 0.012 a 9.714±3.985 2.44 3 0.093
b −0.045±0.018 −2.42 3 0.094
Larvae 1 BPC 2015 0.98 0.004 a 2.437±0.328 7.43 8 <0.001
b −0.024±0.003 −8.32 8 <0.001
Larvae 1 BPC 2016 0.96 0.006 a 2.650±0.370 7.15 8 <0.001
b −0.016±0.002 −7.06 8 <0.001
Larvae 1 All All 0.83 0.023 a 2.155±0.424 5.08 23 <0.001
b −0.015±0.003 −5.59 23 <0.001
Larvae 2 RHCC 2009 1.00 0.002 a 12.984±3.009 4.32 3 0.023
b −0.012±0.003 −4.03 3 0.027
Larvae 2 BPC 2015 0.99 0.001 a 5.188±0.383 13.56 8 <0.001
b −0.006±0.000 −13.63 8 <0.001
Larvae 2 BPC 2016 0.98 0.004 a 11.189±1.963 5.70 4 0.004
b −0.013±0.002 −5.82 4 0.004
Larvae 2 All All 0.87 0.020 a 7.016±1.394 5.03 19 <0.001
b −0.008±0.002 −5.05 19 <0.001
aActivity period 1=overwintered, 2=rst true generation.
bRHCC=Rolling Hills Country Club, BPC=Bimmel Practice Complex.
309Journal of Economic Entomology, 2018, Vol. 111, No. 1
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018

(<1.0mm) are unable to successfully overwinter at the more north-
erly latitude of Tippecanoe County, Indiana, or if some development
continued after sampling was decreased to monthly intervals during
the late fall and winter.
Our degree-day models describing the activity of overwintering
and rst-generation adults and larvae could help focus monitoring
and management strategies for S.venatus in the Midwest. The dis-
covery of overwintered S.venatus adults and larvae in March and
April, followed by three to four overlapping peaks of adult and lar-
val activity is indicative of two separate, but overlapping, cohorts
of S. venatus. Overwintered larvae immediately resume feeding on
plant crowns, roots, stolons, and rhizomes in the spring, eventually
emerging as adults during late spring and early summer. This pattern
has been previously observed in cool-season turfgrass in New Jersey
(Johnson-Cicalese etal. 1990), as well as warm-season turfgrass in
Arkansas (Young 2002), Virginia (Chong 2015), and North Carolina
(Reynolds et al. 2015). Preventive application of plant-systemic
insecticides or combination products with both adult and larval
activity could provide a suitable strategy for managing billbug popu-
lations when S.venatus is the dominant species. Although this strat-
egy must be explicitly examined, our models indicate that as much
as 30% of the overwintering larval population was active within the
top 9.0cm of soil at 100 CDD7.8°C, whereas 30% of the overwinter-
ing adult population was active by 125 CDD7.8°C. Because one well-
timed insecticide application could theoretically reduce populations
of both overwintering cohorts, efforts should be made to examine
the utility of different management products when applied within
this relatively narrow window. As a second option, our model indi-
cates that rst-generation S.venatus larvae are active in the soil as
early as 600 CDD7.8°C and this observation is supported by the pres-
ence of small (<1.0mm) larvae in the soil during this period. This
roughly coincides with the 30% activity mark for rst-generation
adults, again providing the potential opportunity to manage both
adults and larvae with a single application of insecticide possess-
ing both adult and larval activity. The degree-day models developed
in this study provide effective predictive power for both adult and
larval activity in the Midwestern United States, particularly for the
rst generations in the late spring (Table3). Because billbugs are
predominantly soil- (larvae) and thatch-dwelling (adults), the devel-
opment of degree-day models based on soil temperature data may
further increase predictive accuracy. However, the relatively robust
estimations provided by the air temperature data in the present study
could make the present models simpler for practitioners to adopt
and implement. It should also be noted that the models presented
herein may not be accurate for different climatic regions of the
United States or where different billbug species assemblages exist
(Dupuy etal. 2017)
The lack of known morphological characters to distinguish bill-
bug larvae to species leaves the seasonal dynamics and differences
in overwintering behavior of billbug larvae largely unresolved. This
study was the rst attempt, to our knowledge, to use molecular meth-
ods to associate billbug adults and larvae. Based on maximum-like-
lihood analyses, the three genetic loci utilized (CO1, 18S, and ITS2)
were useful for distinguishing the four billbug species examined.
Fig.3. Degree-day models (base 7.8°C) describing the activity of overwintered (A and C) and first-generation (B and D) Sphenophorus venatus say adults (A and
B) and larvae (C and D) at two locations in Indiana.
310 Journal of Economic Entomology, 2018, Vol. 111, No. 1
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018

Analysis of concatenated sequences from all three loci resulted in
all seven overwintered larvae to be recovered with S.venatus adults
with strong support, providing the rst direct evidence of S.venatus
larvae overwintering above 40°N latitude.
Maximum-likelihood analyses of concatenated sequences also
recovered a highly supported S.minimus clade that included two lar-
vae. These two larval specimens that were recovered as S.minimus
were collected in June of 2016 from Kentucky bluegrass research
plots at the Purdue University Nursery, where S.parvulus was the
most abundant species, composing greater than 79% of the adult
population (Table2). These results emphasize that identication of
billbug larvae based solely on association with the most abundant
adult species, especially when multiple closely related species co-
exist, is unreliable, and stresses the necessity for the development of
Fig. 4. Maximum-likelihood tree of COI, 18S, and ITS2 concatenated sequences from field-collected Sphenophorus Schönherr spp. larvae (n = 10) and S. venatus,
S. minimus, S. inaequalis, and S. parvulus adults (n = 3 for each species. Replicate number is indicated in parentheses). Numbers at nodes are bootstrap values.
Overwintered larvae are indicated in bold (Larva 01–07).
Table4. Sphenophorus Schönherr and outgroup taxa GenBank accession numbers for COI, 18S, and ITS2 sequences
Taxaa
GenBank Accession #
COI 18S ITS2
S.venatus (Adult 1) MG437074 MG384994 MG385045
S.venatus (Adult 2) MG437085 MG384995 MG385032
S.venatus (Adult 3) MG437071 MG384992 MG385050
S.venatus (Larva 01) MG437075 MG384985 MG385035
S.venatus (Larva 02) MG437087 MG384974 —
S.venatus (Larva 03) MG437086 MG384993 MG385046
S.venatus (Larva 04) MG437081 MG384980 MG385036
S.venatus (Larva 05) MG437082 MG384977 MG385053
S.venatus (Larva 06) MG437084 MG384978 MG385054
S.venatus (Larva 07) MG437083 MG384991 MG385052
S.parvulus (Adult 1) MG437073 MG384984 MG385047
S.parvulus (Adult 2) MG437072 MG384983 MG385049
S.parvulus (Adult 3) MG437069 MG384981 MG385039
S.parvulus (Larva 08) MG437065 MG384986 MG385033
S. minimus (Adult 1) MG437076 MG384987 MG385042
S.minimus (Adult 2) MG437080 MG384973 MG385040
S.minimus (Adult 3) MG437077 MG384989 MG385044
S.minimus (Larva 09) MG437079 MG384988 MG385041
S.minimus (Larva 10) MG437078 MG384990 MG385037
S.inaequalis (Adult 1) MG437066 MG384979 MG385038
S.inaequalis (Adult 2) MG437067 MG384982 MG385051
S.inaequalis (Adult 3) MG437068 MG384972 MG385043
Donus zoilus MG437070 MG384975 MG385034
Listronotus maculicollis MG437064 MG384976 MG385048
aLife stage and replicate number are indicated in parentheses.
311Journal of Economic Entomology, 2018, Vol. 111, No. 1
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018

a billbug larval identication tool. This work provides a foundation
for the development of a useful molecular diagnostic tool to identify
billbug larvae. However, specimens from this study were sampled
from a small geographical region in Indiana and only represent 3
of the 11 documented turfgrass billbug pests. Abroader taxon sam-
pling, covering a larger geographical region, is necessary to produce
a well-supported phylogenetic hypothesis for thisgenus.
This is the rst study to investigate S.venatus adult seasonal biol-
ogy in the Midwestern United States and the rst to provide molecular
conrmation that S.venatus is capable of overwintering in the larval
stage. Results show that S. venatus overwinters in Indiana as both
adults and larvae, resulting in two separate cohorts during the spring,
each producing at least one subsequent generation of larvae and
adults during the remainder of the growing season and the occurrence
of a second generation of larvae. The seasonal biology of S.venatus
presents obvious management challenges in this region of the United
States where billbug management programs have largely been based
on the seasonal biology of S.parvulus, a univoltine species that only
overwinters as an adult. Although an assortment of synthetic insecti-
cide products with extended residual activity are currently available,
proper timing will likely be paramount in order to reduce the number
of applications required. Acombination of cultural, biological, and
chemical management strategies that include contact or plant-sys-
temic insecticides targeting adult and larval stages during the spring
should also be evaluated. Results of the present study provide a foun-
dation for future work concentrating on the development of a molecu-
lar tool to associate billbug life stages. Such a tool will be useful for
investigating larval phenology across North America where different
assemblages of sympatric billbug species occur.
Acknowledgments
We thank Kirsten Brichler, Danielle Craig, and Garrett Price for eld assist-
ance. We are grateful for the cooperation of Brad Coole and Jeff Sexton
(Rolling Hills Country Club), Brian Bornino (Purdue Sports Turf), and Glenn
Hardebeck and Aaron Kreider (William H. Daniel Turfgrass Research and
Diagnostic Center) for providing monitoring sites. We also thank the Viktoria
Krasnyanskya, Phillip San Miguel, and Rick Westerman (Purdue Genomics
Core) for assisting with Illumina sequencing workows. Finally, we thank our
reviewers for providing useful comments that greatly improved the manuscript.
Funding was provided by the United States Golf Association (2015-10-525).
ReferencesCited
Ahrens, D., M.T. Monaghan, and A. P.Vogler. 2007. DNA-based taxonomy
for associating adults and larvae in multi-species assemblages of chafers
(Coleoptera: Scarabaeidae). Mol. Phylogenet. Evol. 44: 436–449.
Anderson, W. H. 1948. Larvae of some genera of Calendrinae
(Rhynchophorinae) and Stromboscerinae (Coleoptera: Curculionidae).
Ann. Entomol Soc Am. 41: 413–437.
Brown, S. D., K.F. Armstrong, and R. H.Cruickshank. 2012. Molecular phy-
logenetics of a South Pacic sap beetle species complex (Carpophilus spp.,
Coleoptera: Nitidulidae). Mol. Phylogenet. Evol. 64: 428–440.
Chong, J. 2015. Species richness and seasonal abundance of billbugs,
Sphenophorus spp., from South Carolina golf courses. J. Agr Urban
Entomol. 31: 20–28.
Cline, A. R., T. R.Smith, K.Miller, M.Moulton, M.Whiting, and P.Audisio.
2014. Molecular phylogeny of Nitidulidae: assessment of subfamilial
and tribal classication and formalization of the family Cybocephalidae
(Coleoptera: Cucujoidea). Systematic Entomology. 39: 758–772.
Dell Inc. 2015. Dell Statistica (data analysis software system), version 13. soft-
ware.dell.com.
Doskocil, J. P., and R. L.Brandenburg. 2012. Hunting billbug (Coleoptera:
Curculionidae) life cycle and damaging life stage in North Carolina,
with notes on other billbug species abundance. J. Econ. Entomol. 105:
2045–2051.
Doskocil, J. P., N. R. Walker, G. E. Bell, S. M. Marek, J. A. Reinert, and
T. A. Royer. 2008. Species composition and seasonal occurrence of
Phyllophaga (Coleoptera: Scarabaeidae) infesting intensely managed
Bermudagrass in Oklahoma. J. Econ. Entomol. 101: 1624–1632.
Dupuy, M. M., J. A.Powell, and R. A.Ramirez. 2017. Developing a degree-day
model to predict billbug (Coleoptera: Curculionidae) seasonal activity in
Utah and Idaho turfgrass. J. Econ. Entomol. 110: 2180–2189.
Dupuy, M. M., and R. A.Ramirez. 2016. Biology and management of billbugs
(Coleoptera: Curculionidae) in Turfgrass. J. Integr. Pest Manag. 7: 6.
Hansen, J. D. 1987. Seasonal history of bluegrass billbug, Sphenophorus
parvulus (Coleoptera: Curculionidae), in range grass nursery. Environ.
Entomol. 16: 752–756.
Held, D. W., and D. A.Potter. 2012. Prospects for managing turfgrass pests
with reduced chemical inputs. Annu. Rev. Entomol. 57: 329–354.
Huang, T. I. 2008. Billbug (Sphenophorus spp.) composition, abundance, sea-
sonal activity, development time cultivar preference, and response to endo-
phytic ryegrass in Florida. M.S.thesis, University of Florida, Gainsville.
Huang, T., and E. A. Buss. 2009. Billbug (Coleoptera: Curculionidae) spe-
cies composition, abundance, seasonal activity, and developmental time in
Florida. J. Econ. Entomol. 102: 309–314.
Huang, T. I. and E. A. Buss. 2013. Abundance and population dynamics
of adult Sphenophorus inaequalis (Coleoptera: Curculionidae) in Fla.
Entomol. 96: 1609–1611.
Higley, L. G., L. P.Pedigo and K. R.Ostlie. 1986. DEGDAY: a program for
calculating degree- days and assumptions behind the degree-day approach.
Environ. Entomol. 15: 999–016.
Johnson-Cicalese, J. M., G. W. Wolfe, and C. R.Funk. 1990. Biology, distri-
bution, and taxonomy of billbug turf pest (Coleoptera: Curculionidae).
Environ. Entomol. 19: 1037–1046.
Kamm, J. A. 1969. Biology of the billbug Spenophorus venatus conuens, a
new pest of orchargrass. J. Econ. Entomol. 62: 808–812.
Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock,
S. Buxton, A. Cooper, S. Markowitz, C. Duran, etal. 2012. Geneious Basic:
an integrated and extendable desktop software platform for the organiza-
tion and analysis of sequence data. Bioinformatics. 28: 1647–1649.
Kuhn, W. R., R. R.Youngman, K.Love, T.Mize, S.Wu, and C. A.Laub. 2013.
Billbugs (Coleoptera: Curculionidae) new to orchardgrass (Dactylis glom-
erata) grown in Virginia. Entomol. News. 123: 315–316.
Marquardt, D. W. 1963. An algorithm for least-squares estimation of nonlin-
ear parameters. J. Soc. Ind. Apply. Math. 11: 431–441.
Miller, K., Y.Alarie, G. W.Wolfe, and M. F. Whiting. 2005. Association
of insect life stages using DNA sequences: the larvae of Philodytes
umbrinus (Motshulsky) (Coleoptera: Dytiscidea). Syst. Entomol. 30:
499–509.
Miller, M. A., Pfeiffer, W., and Schwartz, T. 2010. Creating the CIPRES
Science Gateway for inference of large phylogenetic trees. Proceedings of
the Gateway Computing Environments Workshop (GCE). 14 November
2010. New Orleans, LA. 1–8.
Niemczyk, H. D. and D. J.Shetlar. 2000. Destructive turf insects, 2nd ed.
H.D.N. Books, Wooster, OH.
Ordaz-González, E. L., A. Equihua-Martínez, I. León-García, R. W.Jones,
A. Aragón, R. H. Hernández and S. Vergara Pineda. 2014. Species of
Sphenophorus (Coleoptera: Dryophthoridae) associated with golf courses
in Mexico. Fla Entomol. 97: 857–860.
Powell, G. 2017. Global phylogenetic framework and revised classication
for the Carpophilinae (Coleoptera: Cucujoidea: Nitidulidae) M.S.thesis.
Purdue University, West Lafayette.
Rambaut, A., and A.Drummond. 2008. FigTree: Tree gure drawing tool,
version 1.2.2. Institute of Evolutionary Biology, University of Edinburgh,
Edinburgh, UK.
Richmond, D. S., H. D. Niemczyk, and D. J. Shetlar. 2000. Overseeding
endophytic perennial ryegrass into stands of Kentucky bluegrass to man-
age bluegrass billbug (Coleoptera: Curculionidae). J. Econ. Entomol. 93:
1662–1668.
Richmond, D. S. 2016. Managing billbugs in turfgrass. https://extension.entm.
purdue.edu/publications/E-266/E-266.html.
312 Journal of Economic Entomology, 2018, Vol. 111, No. 1
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018

Reynolds, D. S., W. C.Reynolds, and R. L.Brandenburg. 2015. Overwintering,
oviposition, and larval survival of hunting billbugs (Coleoptera:
Curculionidae) and implication for adult damage in North Carolina turf-
grass. J. Econ. Entomol. 109: 240–248.
Satterthwait, A. F. 1931. Key to known pupae of the genus Calendra, with
host-plant and distribution notes. Ann. Entomol. Soc. Am. 24: 143–172.
Snyder, R. L. 2002. DegDay, version 1.01. Department of Land, Air, and Water
Resources: University of California, Davis, CA, USA.
Tashiro, H. and K. E.Personius. 1970. Current status of the bluegrass billbug
in its control in western New York home lawns. J. Econ. Entomol. 63:
23–29.
Trexler, J. C. and J.Travis. 1993. Nontraditional regression analyses. Ecology.
74: 1629–1637.
Umble, J., G.Fisher, and S.Rao. 2005. Sampling methods and seasonal phe-
nology of Sphenophorus venatus conuencs Chittenden (Coleoptera:
Curculionidae) in Orchardgrass (Dactylis glomerata L.). J. Agric. Urban
Entomol. 22: 79–85.
Vaurie, P. 1951. Revision of the genus Calendra (formerly Sphenophorus) in
the United States and Mexico (Coleoptera: Curculionidae). Bull. Am. Mus.
Nat. Hist. 93: 33–186.
Vittum, P., M.Villani, and H.Tashiro. 1999. Turfgrass insects of the United
States and Canada. Cornell University Press, Ithaca, NY.
Wagner, T. L., H. I.Wu, P. J.H.Sharpe and R. N.Coulson. 1984. Modeling
distributions of insect development time: a literature review and appli-
cation of the Weibull function. Ann. Entomol. Soc. Am. 77: 475–487.
Watschke, T. L., P. H.Dernoeden and D. J.Shetlar. 2013. Managing Turfgrass
Pests, 2 ed. CRC Press, Boca Raton, FL.
Young, F. B. 2002. Seasonal activity and biology of the hunting billbug,
Sphenophorus venatus vestitus (Coleoptera: Curculionidae) in northwest
Arkansas. M.S.thesis, University of Arkansas, Fayetteville.
313Journal of Economic Entomology, 2018, Vol. 111, No. 1
Downloaded from https://academic.oup.com/jee/article-abstract/111/1/304/4790995
by Purdue University Libraries ADMN user
on 01 March 2018