ArticlePDF Available

Metadichol®, Vitamin C and GULO Gene Expression in Mouse Adipocytes

Authors:

Abstract and Figures

Metadichol, a novel nano emulsion of lipid alcohols, up regulates the expression of GULO gene in mouse at picogram levels. 3T3-L1 pre adipocyte cells were differentiated using differentiating media. Post differentiation, the cells were treated with different concentrations of Metadichol for 24 hours and untreated cells served as control. Whole RNA was isolated after the treatment period and semi-quantitative reverse transcription PCR was run with GULO gene specific primer to obtain cDNA. Relative gene expression of GULO was determined by analysis of GULO gene amplicons using image J software. The GULO gene expression in the treated cells was up regulated fourfold relative to basal level of untreated cells. Relative gene expression at concentrations 1 μg/ml, 100 ng/ml, 1 ng/ml, 100 pg/ml, 1 pg/ml was found to be 2.11, 2.64, 2.96, 3.96, 3.25 fold compared to control
Content may be subject to copyright.
Metadichol®, Vitamin C and
GULO
Gene Expression in Mouse Adipocytes
Palayakotai R Raghavan*
Nanorx Inc, PO Box 131, Chappaqua, NY 10514, USA
*Corresponding author: Palayakotai R Raghavan, Founder and CEO, Nanorx Inc, Po Box 131, Chappaqua, NY 10514, USA, Tel: 9146710224; E-mail:
raghavan@nanorxinc.com
Received date: November 20, 2017; Accepted date: January 02, 2018; Published date: January 09, 2018
Copyright: © 2018 Raghavan PR. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution and reproduction in any medium, provided the original author and source are credited.
Abstract
Metadichol, a novel nano emulsion of lipid alcohols, up regulates the expression of GULO gene in mouse at
picogram levels. 3T3-L1 pre adipocyte cells were differentiated using differentiating media. Post differentiation, the
cells were treated with different concentrations of Metadichol for 24 hours and untreated cells served as control.
Whole RNA was isolated after the treatment period and semi-quantitative reverse transcription PCR was run with
GULO gene specific primer to obtain cDNA. Relative gene expression of GULO was determined by analysis of
GULO gene amplicons using image J software. The GULO gene expression in the treated cells was up regulated
fourfold relative to basal level of untreated cells. Relative gene expression at concentrations 1 μg/ml, 100 ng/ml, 1
ng/ml, 100 pg/ml, 1 pg/ml was found to be 2.11, 2.64, 2.96, 3.96, 3.25 fold compared to control.
Keywords: GULO (Gulonolactone oxidase); Vitamin C; Ascorbic
acid; Vitamin D receptor; Gene expression; Metadichol; Reverse
transcription polymerase chain reaction; Inverse agonist; Aryl
hydrocarbon agonist; Long chain alcohols; Nano formulation;
GULO
gene expression; Mouse 3T3-L1 adipocytes
Introduction
Metadichol® is a nanoformulation of long-chain alcohols that in
Zucker diabetic rats and humans has been shown to increases Vitamin
C levels above and beyond what is achieved orally [1-3]. Vitamin C is a
potent antioxidant required for many biological functions [4]. Humans
and a few other species are unable to synthesize their ascorbate, as we
lack the nal enzyme GULO (Gulonolactone oxidase) in the ascorbate
biosynthesis pathway [5]. GULO converts L-gulono-1,4-lactone
(Gulonolactone) to L-ascorbic acid in the liver of most animals. Plasma
levels of ascorbate are maintained though renal processes, and cellular
levels are regulated via ascorbate transporters, and ascorbate is labile
and short-lived [6].
Ascorbic acid (Vitamin C) is necessary for proper folding and
deposition of collagen proteins in the human body and has a
substantial impact on the extracellular matrix (ECM) [7]. Human cells
are unable to synthesize Vitamin C, and it is restored through the diet.
When there is the shortage of Vitamin C human cells cannot maintain
healthy tissues, and Vitamin C deciency in humans causes scurvy,
resulting in ECM dissolution and tissue disintegration.
Vitamin C has emerged as a critical regulator of stem cell behaviors
by enhancing somatic cell reprogramming, leading to a generation of
induced pluripotent stem cells (iPSCs), by modulating the cellular
epigenetic prole [8-10].
is semi quantitative RT-PCR study was initiated to conrm if
Metadichol enhances
GULO
in mouse 3T3-L1 adipocytes cells to
conrm the
in-vivo
results in diabetic Zucker Rats.
Experimental
All work outsourced and carried out by Skanda Life Sciences,
Bangalore, India. Primers synthesized at Eurons Genomics,
Bangalore, India Relative gene expression of
GULO
was determined by
analysis of
GULO
gene amplicons using image J soware.
Cell line
3T3-L1 obtained from ATCC.
Cell culture
3T3-L1 cells were cultured in DMEM complete medium with 10%
heat inactivated fetal bovine Serum, 100 units/ml penicillin G, and 100
μg/ml streptomycin at 37°C, 5% CO2 incubator.
Procedure
Cell seeding
6 ×105 cells were seeded in 35 mm cell culture dishes in DMEM
medium containing 10% FBS and 1% PenStrep. e cells were
incubated for 24 hr in the dishes at 37°C, 5% CO2 humidied
incubator. Aer 24 hr the cells were dierentiated into adipocytes.
Dierentiation of 3T3 L1 cells into Adipocytes
3T3-L1 cells were obtained from the ATCC and grown to
conuence in 12 well culture plates (60,000 cells/well). Two days post
conuence, cell dierentiation was initiated by incubation with 2
µg/ml insulin, 0.25 µM dexamethasone, and 0.5 mM isobutyl-methyl-
xanthine (IBMX) in Dulbecco’s modied eagle media (DMEM)
containing 10% fetal bovine serum and 1% antibiotic antimycotic for
48 h. Medium was removed and replaced with standard medium
containing 2 µg/ml insulin. Aer 2 more days, cells were replaced with
standard medium (Table 1).
B
i
o
l
o
g
y
a
n
d
M
e
d
i
c
i
n
e
ISSN: 0974-8369
Biology and Medicine
Raghavan, Biol Med (Aligarh) 2018, 10:1
DOI: 10.4172/0974-8369.1000426
Research Article Open Access
Biol Med (Aligarh), an open access journal
ISSN: 0974-8369
Volume 10 • Issue 1 • 1000426
Sample Concentration Cell Line
Metadichol
Control (untreated)
3T3-L1
1 μg/ml
100 ng/ml
1 ng/ml
100 pg/ml
1 pg/ml
Table 1: Treatment protocol.
RNA isolation
Treated adipocytes were washed twice with PBS and to the adherent
cells 1 ml of TRIzol (per P35 dish) was added and transferred to the
tube and vortexed. Samples were allowed to stand for 5 minutes at
room temperature. Added 0.2 ml of chloroform per 1 ml of TRIzol
used. Closed the tube and shaken vigorously for 15 seconds. e tube
was allowed to stand at room temperature for 5 minutes. Cells were
centrifuged at 10,000 rpm for 15 min at 4°C. Transparent colorless
upper aqueous phase was transferred to a new tube. 0.5 ml of
isopropanol was added per 1 ml of TRIZOL used, mixed gently by
inverting the sample 5 times and incubate at room temperature for 5
minutes. Contents were centrifuged at 10,000 rpm for 10 minutes at
4°C. Supernatant was discarded and the RNA pellet was washed by
adding 1ml of 70% ethanol. Mix gently by inverting the sample a few
times. Contents were centrifuged for 5 min at 14,000 rpm at 4°C.
Supernatant was discarded by inverting the tube on a clean tissue
paper. Later, the pellet was dried by incubating in a dry bath for 5min
at 55°C. e pellet was then re suspended in 25 µl of DEPC treated
water.
RT-PCR
A semi quantitative reverse transcriptase polymerase chain reaction
(RT-PCR) was carried out using Techno Prime system to determine
the levels GULO and β-Actin mRNA expressions. DNase treatment
was carried out before converting the RNA to cDNA. e cDNA was
synthesized from 2 µg of RNA using the Verso cDNA synthesis kit
(ermo-Fischer Scientic) with oligo dT primer according to the
manufacturer’s instructions. e reaction volume was set to 20 μl and
cDNA synthesis was performed at 42°C for 60 min, followed by RT
inactivation at 85°C for 5 min (Table 2).
Gene Primer pair Sequence Tm Product
size (bp)
β–actin FP TCCTCCTGAGCGCAAGTACTC
T
62 153
RP GCTCAGTAACAGTCCGCCTAG
AA
62
GULO FP CTTTGTTCAACTTCCTGTGG 60 140
RP GGTAGTACATCTCTGGACTG 54
Table 2: Primers details.
PCR
e PCR mixture (nal volume of 20 µL) contained 1 µL of cDNA,
10 µL of Red Taq Master Mix 2x (Amplicon) and 1 µM of each
complementary primer specic for
GULO
and
β-actin
(internal
control) sequence. e samples were denatured at 94°C for 5 minutes,
and amplied using 30 cycles of 94°C for 30 seconds, 52°C for 30
seconds, and 72°C for 1 minute for
GULO
, for β-actin the renaturation
was set to 55°C for 30 seconds followed by a nal elongation at 72°C
for 10 minutes. e optimal numbers of cycles have been selected for
amplication of these two genes experimentally so that amplications
were in the exponential range and have not reached a plateau. 10 µl of
the nal amplication product were run on a 2% EtBr-stained agarose
gel and photographed. Quantication of the results was accomplished
by measuring the optical density of the bands, using the computerized
imaging program Image J. e values were normalized to β-actin
intensity levels.
Lane 1-DNA Ladder; Lane 2- Control (Untreated cells); Lane 3-1
µg/ml treated Cells; Lane 4-100 ng/ml treated cells; Lane 5-1 ng/ml
treated cells; Lane 6-100 pg/ml treated cells; Lane 7-1 pg/ml treated
cells (Figure 1).
Figure 1: Amplication of β-actin gene in 3T3-L1 cells.
Lane 1- DNA Ladder; Lane 2- Control (Untreated cells); Lane 3-1
µg/ml treated Cells; Lane 4-100 ng/ml treated cells; Lane 5-1 ng/ml
treated cells; Lane 6-100 pg/ml treated cells; Lane 7-1 pg/ml treated
cells (Figure 2).
Figure 2: Amplication of
GULO
gene in 3T3-L1 cells.
Citation: Raghavan PR (2018) Metadichol®, Vitamin C and GULO Gene Expression in Mouse Adipocytes. Biol Med (Aligarh) 10: 426. doi:
10.4172/0974-8369.1000426
Page 2 of 4
Biol Med (Aligarh), an open access journal
ISSN: 0974-8369
Volume 10 • Issue 1 • 1000426
Results and Discussion
As discussed above that
in-vivo
study of Metadichol in Diabetic fed
rats and humans increases Vitamin C even though no Vitamin C
is administered. The present study (Table3, Figure 3) is a semi-
quantitative study
in-vitro
study that confirms results of the
in-vivo
study. Metadichol is the irst known agonist of the
GULO
gene that
ampli ies the expression even at one picogram/ml. Researchers have
shown that adding Vitamin C to the culture medium, obtain
high-quality iPSCs (Induced Pluripotent Stem Cells) from mouse
and human cells routinely. What has hampered progress is the low
eiciency and slow kinetics of the reprogramming process. The
activity of Metadichol at picogram levels compares favorably
with known hormones like T3 (thyroid), Estrogen
and Acetylcholine that are active at picogram levels. Vitamin C is
known to enhance production of pluripotent stem cells [11,12]. It
should be noted that one picogram corresponds to 12X in homeopathy
concentration [12]. Metadichol seems to follow the principles of
hormesis, the biological and toxicological concept that low doses are
more potent than larger doses [13]. Given these results, the eects of
Metadichol on human-derived adipocyte cells, is ongoing and
hopefully substantiate these indings and could be bene icial in the
identi ication of biomarkers and development of PSCs will be reported
in due course. Work is continuing how Metadichol aects human-
derived adipocyte cells, which will substantiate the results of this study
and its use in identi ication of biomarkers and development of PSCs
and will be reported in due course.
3T3-L1
Samples Band Intensity of PCR Amplicon of Genes
β-actin GULO Normalized Relative Gene Expression
Control 44477.3 11984.7 0.27 1
1 μg/ml 40980.5 23302.8 0.57 2.11
100 ng/ml 42919.9 30571.7 0.71 2.64
1 ng/ml 40756.2 32477.9 0.8 2.96
100 pg/ml 44945.3 49017.3 1.07 3.96
1 pg/ml 41650 36512.1 0.88 3.25
Table 3: Relative expression of
GULO
in treated and untreated 3T3-L1 cells.
Figure 3: Expression of
GULO
gene in 3T3-L1 adipocytes cells
treated with metadichol.
References
1. Raghavan PR (2014) US patents No. 8.722.093.
2. Raghavan PR (2017) Metadichol® Induced High Levels of Vitamin
C. Case Studies. Vitam Miner 6: 169.
3. Raghavan PR (2017) Metadichol® and Vitamin C Increase In Vivo, an
Open-Label Study. Vitam Miner 6: 163.
4. Mandl J, Szarka A, Bánhegyi G (2009) Vitamin C: Update on physiology
and pharmacology. Br J Pharmacol 157: 1097-1110.
5. Linster CL, Van Schaftingen E (2007) Vitamin C. Biosynthesis, recycling
and degradation in mammals. FEBS J 274: 1-22.
Gabbay KH, Bohren KM, Morello R, Bertin T, Liu J, et al. (2010)
Ascorbate synthesis pathway. Dual role of ascorbate in bone homeostasis.
J Biol Chem 285: 19510-19520.
Corti A, Casini AF, Pompella A (2010) Cellular pathways for transport
and elux of ascorbate and dehydroascorbate. Arch Biochem Biophys
500: 107-115.
D'Aniello C, Cermola F, Patriarca EJ, Minchiotti G (2017) Vitamin C in
Stem Cell Biology: Impact on Extracellular Matrix Homeostasis and
Epigenetics. Stem Cells Int.
D'Aniello C, Habibi E, Cermola F, Paris D, Russo F, et al. (2016) Vitamin
C and l-proline antagonistic effects capture alternative states in the
pluripotency continuum. Stem Cell Reports 8: 1-10.
Esteban MA, Wang T, Qin B, Yang J, Qin D, et al. (2010) Vitamin C
enhances the generation of mouse and human induced pluripotent stem
cells. Cell Stem Cell 6: 71-79.
Eid W, Abdel-Rehim W (2016) Vitamin C promotes pluripotency of
human induced pluripotent stem cells via the histone demethylase
JARID1A. Biol Chem 97: 1205-1213.
12.Bell IR, Koithan M (2012) A model for homeopathic remedy effects: low
dose nanoparticles, allostatic cross-adaptation, and time-dependent
sensitization in a complex adaptive system. BMC Complement Altern
Med 12: 191.
Citation: Raghavan PR (2018) Metadichol®, Vitamin C and GULO Gene Expression in Mouse Adipocytes. Biol Med (Aligarh) 10: 426. doi:
10.4172/0974-8369.1000426
Page 3 of 4
Biol Med (Aligarh), an open access journal ISSN: 0974-8369 Volume 10 • Issue 1 • 1000426
6
7
8
9
10
11
13 Hayes DP (2007) Nutritional Hormesis. European Journal of
Clinical Nutrition 61: 147-159.
Citation: Raghavan PR (2018) Metadichol®, Vitamin C and GULO Gene Expression in Mouse Adipocytes.
Biol Med (Aligarh) 10: 426. doi: 10.4172/0974-8369.1000426
... This paper deals with Metadichol ® expression on UCB cells leading to increased CD33 expression similar to what we saw in CD34 expression. The increased expression observed with CD33 could be one possible mechanism that could explain its diverse pharmacological actions of Metadochol ® on multiple diseases [25][26][27][28][29][30][31][32][33][34][35][36][37][38]. ...
... We have shown previously that Metadichol ® binds to VDR whose natural ligand is Calcitriol. We have published Metadichol's action on biomarkers implicated in various diseases [25][26][27][28]. It exhibits antimicrobial activity against parasites, viruses, and bacteria. ...
Article
Full-text available
CD33 also known as Siglec-3 is endogenously expressed in stem cells and is a marker for the myeloid lineage of cells. Increased expression of CD33 thus allows it to bind to any Sialic Acids (SIAs). These acids are binding sites for pathogens and toxins. By binding to these acids, CD33 can prevent invasion of hosts by these pathogens. Down-regulation of CD33, increase the release of the pro-inflammatory cytokine TNF-α by monocytes that increases reactive oxygen species that are involved in diseases like diabetes mellitus, Alzheimer's, cardiovascular diseases asthma, and in various cancers. The up-regulation of CD33 using Metadichol ® was studied using Wharton's Jelly Mesenchymal Stem Cells (MSCs) isolated from human umbilical cord and were grown in p-35 dishes until confluent and treatment was carried out with different concentrations. One dish was untreated and considered as control. The treated and untreated cells were analyzed using Flow Cytometry. The cells treated at 100 pg of Metadichol ® has shown the highest increase (>400 fold) in CD33++ expression (48.77%) compared to untreated control (0.11%).
... Vitamin C is also required as a cofactor for the optimal activity of newly characterized hydroxylase enzymes, which regulate the activity, gene transcription, and signaling of hypoxia-inducible factors in immune cells [58][59][60]. Of note, studies have demonstrated that Metadichol administration increases the endogenous vitamin C levels by recycling it to levels that are not achieved by oral intake, and these levels bring about changes in improving diverse biomarkers [61][62][63]. ...
Article
New pathogenic virus outbreaks, occurring with increasing regularity, are leading us to explore novel approaches, which will reduce the reliance on time-consuming vaccine modes to halt the outbreaks. The requirement is to find a universal approach to disarm any new and as yet unknown viruses as they appear. A promising approach could be targeting lipid membranes, which are common to all viruses and bacteria. The ongoing pandemic of severe acute respiratory syndrome-coronavirus 2 (SARS-COV-2) has reaffirmed the importance of interactions between components of the host cell plasma membrane and the virus envelope as a critical mechanism of infection. Metadichol®, a nano lipid emulsion, has been examined and shown to be a strong candidate to help stop the proliferation of SARS-COV-2. Naturally derived substances, such as long-chain saturated lipid alcohols, reduce the infectivity of various types of viruses, including coronaviruses such as SARS-COV-2, by modifying lipid-dependent attachment to human host cells. SARS-COV-2 uses the receptor ACE2 for entry and the serine protease TMPRSS2 for S protein priming. Metadichol®, a nano lipid formulation of long-chain alcohols, has been shown to inhibit TMPRSS2 (EC50 96 ng/ml). Compared to the inhibitor camostat mesylate (EC50 26000 ng/ml), it is 270 times more potent. Additionally, Metadichol® is also a weak inhibitor of ACE2 at 31 µg/ml. Further a live virus assay in Caco2 cells, Metadichol® inhibited SARS-CoV-2 replication with an EC90 of 0.16 µg/ml. Keywords: Coronavirus, SARS-COV-2, COVID-19, ACE2, TMPRSS2, VDR, Metadichol
... Vitamin C is also required as a cofactor for the optimal activity of newly characterized hydroxylase enzymes, which regulate the activity, gene transcription, and signaling of hypoxia-inducible factors in immune cells [58][59][60]. Of note, studies have demonstrated that Metadichol administration increases the endogenous vitamin C levels by recycling it to levels that are not achieved by oral intake, and these levels bring about changes in improving diverse biomarkers [61][62][63]. ...
Conference Paper
Metadichol ® is a food derived nano emulsion that is effective against many viruses ( over 17 of them) . It acts on viruses through multiple pathway most likely through disruption of the protective lipid membrane layer than viruses. In case of COVID 19 we present data that it blocks optimally ACE2 and Nuclear Androgen receptor which controls expression of TMPRSS2. Both TMPRSS2 and ACE 2 are need for viral entry. Optimal blocking is necessary as both ACE2 and AR are needed for other functions in the body to maintain Homeostasis. In addition Metadichol binds to VDR as an inverse agonist the only one known and VDR activation is necessary for a anti viral response. Metadichol also endogenously increases Vitamin C that leads to IgA,IgG and IgM and also Interferons that are needed to mount a anti viral response
... Diseases are connected through closely related gene networks, and this is an approach that can be exploited to modulate multiple targets to enhance therapeutic effect as ligands today are focused on a single target and limited by their efficacy. Metadichol is a safe therapeutic that target multiple genes, pathways and multiple diseases that confirms the relevance of network-based approach of polypharmacology [77] and this has been demonstrated by our studies on other diseases [78][79][80][81][82][83][84][85][86][87][88][89][90][91]. ...
Article
Full-text available
Liver diseases are becoming a major health concern. In the developing countries it is due to microbial infection. In the rest of the developed world it is due to alcohol abuse. Chronic liver disease and cirrhosis are a significant health concern in western countries. It is the fifth most common cause of death, after heart disease, cancer, stroke, and chest disease. The liver is capable of regeneration, but it can be overwhelmed leading to liver diseases like cirrhosis and hepatocellular cancer (HCC). Vitamin D levels are low in most patients with liver diseases, and this suggests possible therapeutic benefits with use of vitamin D or its analogues. Vitamin D, through the vitamin D nuclear receptor (VDR) plays a crucial role in mineral ion homeostasis. The liver has a central role in vitamin D synthesis and there is a need for an agent that will not lead to hypercalcemia. Metadichol, a nano emulsion of long-chain alcohols derived from food, is an inverse agonist of Vitamin D can fill this void. In Diabetic rat studies, it inhibits TNF alpha, ICAM1 (intracellular adhesion molecule), CCL2 (chemokine CC motif) also referred to as monocyte chemoattractant protein 1 (MCP1). All these cytokines, chemokines are known to have important role in liver diseases. We show that Metadichol indeed does work in liver disease patients by normalizing essential liver enzymes ALT, AST and ALP, and GGT. This approach is an example where Metadichol targets multiple genes and via multiple pathways to bring about homeostasis of the liver and is a useful, safe, non-toxic product in treating liver diseases and alleviating a global threat.
... Vitamin C is also required as a cofactor for the optimal activity of newly characterized hydroxylase enzymes, which regulate the activity, gene transcription, and signaling of hypoxia-inducible factors in immune cells [58][59][60]. Of note, studies have demonstrated that Metadichol administration increases the endogenous vitamin C levels by recycling it to levels that are not achieved by oral intake, and these levels bring about changes in improving diverse biomarkers [61][62][63]. ...
Conference Paper
Metadichol (US patent 8,722,093) is a Nano emulsion of long-chain alcohols found in many foods. It is commonly called Policosanol and is present in foods such as rice, sugar cane, wheat, peanuts Metadichol acts on Nuclear Vitamin D receptors (VDR) (US patent 9,006,292) that are present in cells throughout the body to stimulate the immune system and inhibit a variety of disease processes, resulting from viral infections.We tested for antiviral activity of Metadichol® in Vero and MDCK cells infected with Influenza A, H1N1, Human Respiratory Syncytial viruse, Dengue, Chikungunya and. Ebola, Marburg. In addition, we tested the efficacy of Metadichol® in preventing cell death caused by Adenovirus, Tacaribe Mammarena virus, Rift Valley Fever virus, SARS coronavirus, Japanese Encephalitis virus, West Nile virus, and Yellow Fever virus. In the in vitro assays, Metadichol showed no cytotoxicity and strongly inhibited cell death caused by each of the viruses tested. Metadichol is a safe and effective inhibitor of enveloped viruses in humans. Since it is known to bind to the vitamin D receptor (VDR) (US patent 9,006,292), its mechanism of action likely involves the competitive displacement of virus particles from VDR’s on host cell membranes. Because it consists of natural components of common foods and has no known negative side effects, Metadichol has the potential to serve as a novel, broad-spectrum antiviral treatment for Dengue, Ebola, Zika, H1N1, SARS, Chikungunya and other enveloped viruses.
Article
Full-text available
Increasing outbreaks of new pathogenic viruses have promoted the exploration of novel alternatives to time-consuming vaccines. Thus, it is necessary to develop a universal approach to halt the spread of new and unknown viruses as they are discovered. One such promising approach is to target lipid membranes, which are common to all viruses and bacteria. The ongoing severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic has reaffirmed the importance of interactions between the virus envelope and the host cell plasma membrane as a critical mechanism of infection. Metadichol®, a nanolipid emulsion of long-chain alcohols, has been demonstrated as a strong candidate that inhibits the proliferation of SARS-CoV-2. Naturally derived substances, such as long-chain saturated lipid alcohols, reduce viral infectivity, including that of coronaviruses (such as SARS-CoV-2) by modifying their lipid-dependent attachment mechanism to human host cells. The receptor ACE2 mediates the entry of SARS-CoV-2 into the host cells, whereas the serine protease TMPRSS2 primes the viral S protein. In this study, Metadichol® was found to be 270 times more potent an inhibitor of TMPRSS2 (EC50=96 ng/mL) than camostat mesylate (EC50=26000 ng/mL). Additionally, it inhibits ACE with an EC50 of 71 ng/mL, but it is a very weak inhibitor of ACE2 at an EC50 of 31 μg/mL. Furthermore, the live viral assay performed in Caco-2 cells revealed that Metadichol® inhibits SARS-CoV-2 replication at an EC90 of 0.16 μg/mL. Moreover, Metadichol® had an EC90 of 0.00037 μM, making it 2081 and 3371 times more potent than remdesivir (EC50=0.77 μM) and chloroquine (EC50=1.14 μM), respectively.
Preprint
Full-text available
New pathogenic virus outbreaks with increasing regularity are leading us to explore novel approaches, which will reduce the reliance on a time-consuming vaccine mode to halt the strike. The requirement is to find a universal approach to disarm any new and as yet unknown viruses as they appear. A promising approach could be by targeting the lipids membranes, common to all viruses and bacteria. The ongoing pandemic of the SARS-coronavirus 2 (SARS-CoV-2) has restated the importance of interactions between components of the host cell plasma membrane and the virus envelope as a critical mechanism of infection. Metadichol ®, a nano lipid emulsion, has been examined and shown to be a strong candidate to help stop the proliferation of the SARS-COV-2. Naturally derived substances, such long chain saturated lipid alcohols reduce the infectivity of various types of viruses, including the coronavirus like SARS-COV-2, by modifying the lipid-dependent attachment to human host cells. SARS-COV-2 uses the receptor ACE2 for entry and the serine protease TMPRSS2 for S protein priming. Metadichol®, a nano lipid formulation of long-chain alcohols, has been shown to inhibit TMPRSS2 (EC50 of 96 ng/ml). Compared to the inhibitor Camostat Mesylate (26000 ng/ml), it is 270 times more potent. Also, Metadichol ® is a moderate inhibitor of ACE2 @ 31 µg/ml. In the SARS-COV2 antiviral assay using CACO2 cells, it has an EC90 of 0.16 µg/ml.
Article
Full-text available
We recently reported that Metadichol ® [1] brings about a three to four-fold increase in Vitamin C levels in patients without the use of Vitamin C supplementation. In this study of 6 patients who experienced a 5-12 fold increase in plasma Vitamin C levels higher than 80-100 u mol/L level which is the highest reported to date by oral supplementation at high doses of Vitamin C. Metadichol improved in these patients TSH levels, normalized High Blood pressure, fasting glucose levels, reduced eosinophil count, high triglycerides, body fat reduction and increased bone mass, normalized sodium levels, reducing high insulin levels, increased creatinine output in urine and also reducing of Red Cell Distribution width %. Metadichol thus serves as a surrogate for Vitamin C at doses of 5 mg per day as opposed to mega doses that are currently used.
Article
Full-text available
Vitamin C, also known as ascorbic acid, is a water-soluble antioxidant. Today we meet our requirements of vitamin C through consumption of fruits and vegetables or by supplementation. Homo sapiens cannot produce vitamin C like many other species that can convert glucose to vitamin C. The gene for enzyme production is dormant in humans. The gene, GULO, that we all carry converts glucose to Vitamin C. in other species but not in humans and primates. The open-label study showed Metadichol ® raised levels of vitamin C by 3 fold, endogenously without supplementation of Vitamin C. Possible mechanisms for the increased Vitamin C levels through antioxidant pathways are presented. Metadichol ® [1] is a nano-formulation of long chain alcohols derived from sugar cane. In addition to increased Vitamin C levels reduction in Potassium and uric acid, and decreased blood pressure and improvement in quality of life issues were also observed.
Article
Full-text available
Background This paper proposes a novel model for homeopathic remedy action on living systems. Research indicates that homeopathic remedies (a) contain measurable source and silica nanoparticles heterogeneously dispersed in colloidal solution; (b) act by modulating biological function of the allostatic stress response network (c) evoke biphasic actions on living systems via organism-dependent adaptive and endogenously amplified effects; (d) improve systemic resilience. Discussion The proposed active components of homeopathic remedies are nanoparticles of source substance in water-based colloidal solution, not bulk-form drugs. Nanoparticles have unique biological and physico-chemical properties, including increased catalytic reactivity, protein and DNA adsorption, bioavailability, dose-sparing, electromagnetic, and quantum effects different from bulk-form materials. Trituration and/or liquid succussions during classical remedy preparation create “top-down” nanostructures. Plants can biosynthesize remedy-templated silica nanostructures. Nanoparticles stimulate hormesis, a beneficial low-dose adaptive response. Homeopathic remedies prescribed in low doses spaced intermittently over time act as biological signals that stimulate the organism’s allostatic biological stress response network, evoking nonlinear modulatory, self-organizing change. Potential mechanisms include time-dependent sensitization (TDS), a type of adaptive plasticity/metaplasticity involving progressive amplification of host responses, which reverse direction and oscillate at physiological limits. To mobilize hormesis and TDS, the remedy must be appraised as a salient, but low level, novel threat, stressor, or homeostatic disruption for the whole organism. Silica nanoparticles adsorb remedy source and amplify effects. Properly-timed remedy dosing elicits disease-primed compensatory reversal in direction of maladaptive dynamics of the allostatic network, thus promoting resilience and recovery from disease. Summary Homeopathic remedies are proposed as source nanoparticles that mobilize hormesis and time-dependent sensitization via non-pharmacological effects on specific biological adaptive and amplification mechanisms. The nanoparticle nature of remedies would distinguish them from conventional bulk drugs in structure, morphology, and functional properties. Outcomes would depend upon the ability of the organism to respond to the remedy as a novel stressor or heterotypic biological threat, initiating reversals of cumulative, cross-adapted biological maladaptations underlying disease in the allostatic stress response network. Systemic resilience would improve. This model provides a foundation for theory-driven research on the role of nanomaterials in living systems, mechanisms of homeopathic remedy actions and translational uses in nanomedicine.
Article
Full-text available
Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) mice show that the two enzymes, GR and AR, provide approximately 85 and approximately 15% of L-gulonate, respectively. GRKO/ARKO double knock-out mice are unable to synthesize ASC (>95% ASC deficit) and develop scurvy. The GRKO mice ( approximately 85% ASC deficit) develop and grow normally when fed regular mouse chow (ASC content = 0) but suffer severe osteopenia and spontaneous fractures with stresses that increase ASC requirements, such as pregnancy or castration. Castration greatly increases osteoclast numbers and activity in GRKO mice and promotes increased bone loss as compared with wild-type controls and additionally induces proliferation of immature dysplastic osteoblasts likely because of an ASC-sensitive block(s) in early differentiation. ASC and the antioxidants pycnogenol and resveratrol block osteoclast proliferation and bone loss, but only ASC feeding restores osteoblast differentiation and prevents their dysplastic proliferation. This is the first in vivo demonstration of two independent roles for ASC as an antioxidant suppressing osteoclast activity and number as well as a cofactor promoting osteoblast differentiation. Although humans have lost the ability to synthesize ASC, our mouse models suggest the mechanisms by which suboptimal ASC availability facilitates the development of osteoporosis, which has important implications for human osteoporosis.
Article
Full-text available
Nutritional hormesis has the potential to serve as a pro-healthy aging intervention by reducing the susceptibility of the elderly to various chronic degenerative diseases and thereby extending human healthspan. Supportive evidence for nutritional hormesis arising from essential nutrients (vitamins and minerals), dietary pesticides (natural and synthetic), dioxin and other herbicides, and acrylamide will be reviewed and discussed.
Article
Somatic cells can be reprogrammed into induced pluripotent stem (iPS) cells by defined factors, which provide a powerful basis for personalized stem-cell based therapies. However, cellular reprogramming is an inefficient and metabolically demanding process commonly associated with obstacles that hamper further use of this technology. Spontaneous differentiation of iPS cells cultures represents a significant hurdle that hinder obtaining high quality iPS cells for further downstream experimentation. In this study, we found that a natural compound, vitamin C, augmented pluripotency in iPS cells and reduced unwanted spontaneous differentiation during iPS cells maintenance. Gene expression analysis showed that Vitamin C increased the expression of the histone demethylase JARID1A. Furthermore, through gain- and loss-of-function approaches, we show that JARID1A is a key effector in promoting pluripotency and reducing differentiation downstream of vitamin C. Our results therefore highlight a straightforward method for improving the pluripotency and quality of iPS cells; it also shows a possible role for H3K4me2/3 in cell fate determination and establishes a link between vitamin C and epigenetic regulation.
Article
Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of d-glucuronate to l-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) mice show that the two enzymes, GR and AR, provide ∼85 and ∼15% of l-gulonate, respectively. GRKO/ARKO double knock-out mice are unable to synthesize ASC (>95% ASC deficit) and develop scurvy. The GRKO mice (∼85% ASC deficit) develop and grow normally when fed regular mouse chow (ASC content = 0) but suffer severe osteopenia and spontaneous fractures with stresses that increase ASC requirements, such as pregnancy or castration. Castration greatly increases osteoclast numbers and activity in GRKO mice and promotes increased bone loss as compared with wild-type controls and additionally induces proliferation of immature dysplastic osteoblasts likely because of an ASC-sensitive block(s) in early differentiation. ASC and the antioxidants pycnogenol and resveratrol block osteoclast proliferation and bone loss, but only ASC feeding restores osteoblast differentiation and prevents their dysplastic proliferation. This is the first in vivo demonstration of two independent roles for ASC as an antioxidant suppressing osteoclast activity and number as well as a cofactor promoting osteoblast differentiation. Although humans have lost the ability to synthesize ASC, our mouse models suggest the mechanisms by which suboptimal ASC availability facilitates the development of osteoporosis, which has important implications for human osteoporosis.
Article
The mechanisms allowing the cellular transport of ascorbic acid represent a primary aspect for the understanding of the roles played by this vitamin in pathophysiology. Considerable research effort has been spent in the field, on several animal models and different cell types. Several mechanisms have been described to date, mediating the movements of different redox forms of ascorbic acid across cell membranes. Vitamin C can enter cells both in its reduced and oxidized form, ascorbic acid (AA) and dehydroascorbate (DHA), utilizing respectively sodium-dependent transporters (SVCT) or glucose transporters (GLUT). Modulation of SVCT expression and function has been described by cytokines, steroids and post-translational protein modification. Cellular uptake of DHA is followed by its intracellular reduction to AA by several enzymatic and non-enzymatic systems. Efflux of vitamin C has been also described in a number of cell types and different pathophysiological functions were proposed for this phenomenon, in dependence of the cell model studied. Cellular efflux of AA is mediated through volume-sensitive (VSOAC) and Ca(2+)-dependent anion channels, gap-junction hemichannels, exocytosis of secretory vesicles and possibly through homo- and hetero-exchange systems at the plasma membrane level. Altogether, available data suggest that cellular efflux of ascorbic acid - besides its uptake - should be taken into account when evaluating the cellular homeostasis and functions of this important vitamin.
Article
Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by defined factors. However, the low efficiency and slow kinetics of the reprogramming process have hampered progress with this technology. Here we report that a natural compound, vitamin C (Vc), enhances iPSC generation from both mouse and human somatic cells. Vc acts at least in part by alleviating cell senescence, a recently identified roadblock for reprogramming. In addition, Vc accelerates gene expression changes and promotes the transition of pre-iPSC colonies to a fully reprogrammed state. Our results therefore highlight a straightforward method for improving the speed and efficiency of iPSC generation and provide additional insights into the mechanistic basis of the reprogramming process.
Article
Although ascorbic acid is an important water-soluble antioxidant and enzyme cofactor in plants and animals, humans and some other species do not synthesize ascorbate due to the lack of the enzyme catalyzing the final step of the biosynthetic pathway, and for them it has become a vitamin. This review focuses on the role of ascorbate in various hydroxylation reactions and in the redox homeostasis of subcellular compartments including mitochondria and endoplasmic reticulum. Recently discovered functions of ascorbate in nucleic acid and histone dealkylation and proteoglycan deglycanation are also summarized. These new findings might delineate a role for ascorbate in the modulation of both pro- and anti-carcinogenic mechanisms. Recent advances and perspectives in therapeutic applications are also reviewed. On the basis of new and earlier observations, the advantages of the lost ability to synthesize ascorbate are pondered. The increasing knowledge of the functions of ascorbate and of its molecular sites of action can mechanistically substantiate a place for ascorbate in the treatment of various diseases.