Metadichol®, Vitamin C and GULO Gene Expression in Mouse Adipocytes

Abstract

Metadichol, a novel nano emulsion of lipid alcohols, up regulates the expression of GULO gene in mouse at
picogram levels. 3T3-L1 pre adipocyte cells were differentiated using differentiating media. Post differentiation, the
cells were treated with different concentrations of Metadichol for 24 hours and untreated cells served as control.
Whole RNA was isolated after the treatment period and semi-quantitative reverse transcription PCR was run with
GULO gene specific primer to obtain cDNA. Relative gene expression of GULO was determined by analysis of
GULO gene amplicons using image J software. The GULO gene expression in the treated cells was up regulated
fourfold relative to basal level of untreated cells. Relative gene expression at concentrations 1 μg/ml, 100 ng/ml, 1
ng/ml, 100 pg/ml, 1 pg/ml was found to be 2.11, 2.64, 2.96, 3.96, 3.25 fold compared to control

Full text

Metadichol®, Vitamin C and
GULO
Gene Expression in Mouse Adipocytes
Palayakotai R Raghavan*
Nanorx Inc, PO Box 131, Chappaqua, NY 10514, USA
*Corresponding author: Palayakotai R Raghavan, Founder and CEO, Nanorx Inc, Po Box 131, Chappaqua, NY 10514, USA, Tel: 9146710224; E-mail:
raghavan@nanorxinc.com
Received date: November 20, 2017; Accepted date: January 02, 2018; Published date: January 09, 2018
Copyright: © 2018 Raghavan PR. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution and reproduction in any medium, provided the original author and source are credited.
Abstract
Metadichol, a novel nano emulsion of lipid alcohols, up regulates the expression of GULO gene in mouse at
picogram levels. 3T3-L1 pre adipocyte cells were differentiated using differentiating media. Post differentiation, the
cells were treated with different concentrations of Metadichol for 24 hours and untreated cells served as control.
Whole RNA was isolated after the treatment period and semi-quantitative reverse transcription PCR was run with
GULO gene specific primer to obtain cDNA. Relative gene expression of GULO was determined by analysis of
GULO gene amplicons using image J software. The GULO gene expression in the treated cells was up regulated
fourfold relative to basal level of untreated cells. Relative gene expression at concentrations 1 μg/ml, 100 ng/ml, 1
ng/ml, 100 pg/ml, 1 pg/ml was found to be 2.11, 2.64, 2.96, 3.96, 3.25 fold compared to control.
Keywords: GULO (Gulonolactone oxidase); Vitamin C; Ascorbic
acid; Vitamin D receptor; Gene expression; Metadichol; Reverse
transcription polymerase chain reaction; Inverse agonist; Aryl
hydrocarbon agonist; Long chain alcohols; Nano formulation;
GULO
gene expression; Mouse 3T3-L1 adipocytes
Introduction
Metadichol® is a nanoformulation of long-chain alcohols that in
Zucker diabetic rats and humans has been shown to increases Vitamin
C levels above and beyond what is achieved orally [1-3]. Vitamin C is a
potent antioxidant required for many biological functions [4]. Humans
and a few other species are unable to synthesize their ascorbate, as we
lack the nal enzyme GULO (Gulonolactone oxidase) in the ascorbate
biosynthesis pathway [5]. GULO converts L-gulono-1,4-lactone
(Gulonolactone) to L-ascorbic acid in the liver of most animals. Plasma
levels of ascorbate are maintained though renal processes, and cellular
levels are regulated via ascorbate transporters, and ascorbate is labile
and short-lived [6].
Ascorbic acid (Vitamin C) is necessary for proper folding and
deposition of collagen proteins in the human body and has a
substantial impact on the extracellular matrix (ECM) [7]. Human cells
are unable to synthesize Vitamin C, and it is restored through the diet.
When there is the shortage of Vitamin C human cells cannot maintain
healthy tissues, and Vitamin C deciency in humans causes scurvy,
resulting in ECM dissolution and tissue disintegration.
Vitamin C has emerged as a critical regulator of stem cell behaviors
by enhancing somatic cell reprogramming, leading to a generation of
induced pluripotent stem cells (iPSCs), by modulating the cellular
epigenetic prole [8-10].
is semi quantitative RT-PCR study was initiated to conrm if
Metadichol enhances
GULO
in mouse 3T3-L1 adipocytes cells to
conrm the
in-vivo
results in diabetic Zucker Rats.
Experimental
All work outsourced and carried out by Skanda Life Sciences,
Bangalore, India. Primers synthesized at Eurons Genomics,
Bangalore, India Relative gene expression of
GULO
was determined by
analysis of
GULO
gene amplicons using image J soware.
Cell line
3T3-L1 obtained from ATCC.
Cell culture
3T3-L1 cells were cultured in DMEM complete medium with 10%
heat inactivated fetal bovine Serum, 100 units/ml penicillin G, and 100
μg/ml streptomycin at 37°C, 5% CO2 incubator.
Procedure
Cell seeding
6 ×105 cells were seeded in 35 mm cell culture dishes in DMEM
medium containing 10% FBS and 1% PenStrep. e cells were
incubated for 24 hr in the dishes at 37°C, 5% CO2 humidied
incubator. Aer 24 hr the cells were dierentiated into adipocytes.
Dierentiation of 3T3 L1 cells into Adipocytes
3T3-L1 cells were obtained from the ATCC and grown to
conuence in 12 well culture plates (60,000 cells/well). Two days post
conuence, cell dierentiation was initiated by incubation with 2
µg/ml insulin, 0.25 µM dexamethasone, and 0.5 mM isobutyl-methyl-
xanthine (IBMX) in Dulbecco’s modied eagle media (DMEM)
containing 10% fetal bovine serum and 1% antibiotic antimycotic for
48 h. Medium was removed and replaced with standard medium
containing 2 µg/ml insulin. Aer 2 more days, cells were replaced with
standard medium (Table 1).
B
i
o
l
o
g
y
a
n
d
M
e
d
i
c
i
n
e
ISSN: 0974-8369
Biology and Medicine
Raghavan, Biol Med (Aligarh) 2018, 10:1
DOI: 10.4172/0974-8369.1000426
Research Article Open Access
Biol Med (Aligarh), an open access journal
ISSN: 0974-8369
Volume 10 • Issue 1 • 1000426

Sample Concentration Cell Line
Metadichol
Control (untreated)
3T3-L1
1 μg/ml
100 ng/ml
1 ng/ml
100 pg/ml
1 pg/ml
Table 1: Treatment protocol.
RNA isolation
Treated adipocytes were washed twice with PBS and to the adherent
cells 1 ml of TRIzol (per P35 dish) was added and transferred to the
tube and vortexed. Samples were allowed to stand for 5 minutes at
room temperature. Added 0.2 ml of chloroform per 1 ml of TRIzol
used. Closed the tube and shaken vigorously for 15 seconds. e tube
was allowed to stand at room temperature for 5 minutes. Cells were
centrifuged at 10,000 rpm for 15 min at 4°C. Transparent colorless
upper aqueous phase was transferred to a new tube. 0.5 ml of
isopropanol was added per 1 ml of TRIZOL used, mixed gently by
inverting the sample 5 times and incubate at room temperature for 5
minutes. Contents were centrifuged at 10,000 rpm for 10 minutes at
4°C. Supernatant was discarded and the RNA pellet was washed by
adding 1ml of 70% ethanol. Mix gently by inverting the sample a few
times. Contents were centrifuged for 5 min at 14,000 rpm at 4°C.
Supernatant was discarded by inverting the tube on a clean tissue
paper. Later, the pellet was dried by incubating in a dry bath for 5min
at 55°C. e pellet was then re suspended in 25 µl of DEPC treated
water.
RT-PCR
A semi quantitative reverse transcriptase polymerase chain reaction
(RT-PCR) was carried out using Techno Prime system to determine
the levels GULO and β-Actin mRNA expressions. DNase treatment
was carried out before converting the RNA to cDNA. e cDNA was
synthesized from 2 µg of RNA using the Verso cDNA synthesis kit
(ermo-Fischer Scientic) with oligo dT primer according to the
manufacturer’s instructions. e reaction volume was set to 20 μl and
cDNA synthesis was performed at 42°C for 60 min, followed by RT
inactivation at 85°C for 5 min (Table 2).
Gene Primer pair Sequence Tm Product
size (bp)
β–actin FP TCCTCCTGAGCGCAAGTACTC
T
62 153
RP GCTCAGTAACAGTCCGCCTAG
AA
62
GULO FP CTTTGTTCAACTTCCTGTGG 60 140
RP GGTAGTACATCTCTGGACTG 54
Table 2: Primers details.
PCR
e PCR mixture (nal volume of 20 µL) contained 1 µL of cDNA,
10 µL of Red Taq Master Mix 2x (Amplicon) and 1 µM of each
complementary primer specic for
GULO
and
β-actin
(internal
control) sequence. e samples were denatured at 94°C for 5 minutes,
and amplied using 30 cycles of 94°C for 30 seconds, 52°C for 30
seconds, and 72°C for 1 minute for
GULO
, for β-actin the renaturation
was set to 55°C for 30 seconds followed by a nal elongation at 72°C
for 10 minutes. e optimal numbers of cycles have been selected for
amplication of these two genes experimentally so that amplications
were in the exponential range and have not reached a plateau. 10 µl of
the nal amplication product were run on a 2% EtBr-stained agarose
gel and photographed. Quantication of the results was accomplished
by measuring the optical density of the bands, using the computerized
imaging program Image J. e values were normalized to β-actin
intensity levels.
Lane 1-DNA Ladder; Lane 2- Control (Untreated cells); Lane 3-1
µg/ml treated Cells; Lane 4-100 ng/ml treated cells; Lane 5-1 ng/ml
treated cells; Lane 6-100 pg/ml treated cells; Lane 7-1 pg/ml treated
cells (Figure 1).
Figure 1: Amplication of β-actin gene in 3T3-L1 cells.
Lane 1- DNA Ladder; Lane 2- Control (Untreated cells); Lane 3-1
µg/ml treated Cells; Lane 4-100 ng/ml treated cells; Lane 5-1 ng/ml
treated cells; Lane 6-100 pg/ml treated cells; Lane 7-1 pg/ml treated
cells (Figure 2).
Figure 2: Amplication of
GULO
gene in 3T3-L1 cells.
Citation: Raghavan PR (2018) Metadichol®, Vitamin C and GULO Gene Expression in Mouse Adipocytes. Biol Med (Aligarh) 10: 426. doi:
10.4172/0974-8369.1000426
Page 2 of 4
Biol Med (Aligarh), an open access journal
ISSN: 0974-8369
Volume 10 • Issue 1 • 1000426

Results and Discussion
As discussed above that
in-vivo
study of Metadichol in Diabetic fed
rats and humans increases Vitamin C even though no Vitamin C
is administered. The present study (Table3, Figure 3) is a semi-
quantitative study
in-vitro
study that confirms results of the
in-vivo
study. Metadichol is the irst known agonist of the
GULO
gene that
ampli ies the expression even at one picogram/ml. Researchers have
shown that adding Vitamin C to the culture medium, obtain
high-quality iPSCs (Induced Pluripotent Stem Cells) from mouse
and human cells routinely. What has hampered progress is the low
eiciency and slow kinetics of the reprogramming process. The
activity of Metadichol at picogram levels compares favorably
with known hormones like T3 (thyroid), Estrogen
and Acetylcholine that are active at picogram levels. Vitamin C is
known to enhance production of pluripotent stem cells [11,12]. It
should be noted that one picogram corresponds to 12X in homeopathy
concentration [12]. Metadichol seems to follow the principles of
hormesis, the biological and toxicological concept that low doses are
more potent than larger doses [13]. Given these results, the eects of
Metadichol on human-derived adipocyte cells, is ongoing and
hopefully substantiate these indings and could be bene icial in the
identi ication of biomarkers and development of PSCs will be reported
in due course. Work is continuing how Metadichol aects human-
derived adipocyte cells, which will substantiate the results of this study
and its use in identi ication of biomarkers and development of PSCs
and will be reported in due course.
3T3-L1
Samples Band Intensity of PCR Amplicon of Genes
β-actin GULO Normalized Relative Gene Expression
Control 44477.3 11984.7 0.27 1
1 μg/ml 40980.5 23302.8 0.57 2.11
100 ng/ml 42919.9 30571.7 0.71 2.64
1 ng/ml 40756.2 32477.9 0.8 2.96
100 pg/ml 44945.3 49017.3 1.07 3.96
1 pg/ml 41650 36512.1 0.88 3.25
Table 3: Relative expression of
GULO
in treated and untreated 3T3-L1 cells.
Figure 3: Expression of
GULO
gene in 3T3-L1 adipocytes cells
treated with metadichol.
References
1. Raghavan PR (2014) US patents No. 8.722.093.
2. Raghavan PR (2017) Metadichol® Induced High Levels of Vitamin
C. Case Studies. Vitam Miner 6: 169.
3. Raghavan PR (2017) Metadichol® and Vitamin C Increase In Vivo, an
Open-Label Study. Vitam Miner 6: 163.
4. Mandl J, Szarka A, Bánhegyi G (2009) Vitamin C: Update on physiology
and pharmacology. Br J Pharmacol 157: 1097-1110.
5. Linster CL, Van Schaftingen E (2007) Vitamin C. Biosynthesis, recycling
and degradation in mammals. FEBS J 274: 1-22.
Gabbay KH, Bohren KM, Morello R, Bertin T, Liu J, et al. (2010)
Ascorbate synthesis pathway. Dual role of ascorbate in bone homeostasis.
J Biol Chem 285: 19510-19520.
Corti A, Casini AF, Pompella A (2010) Cellular pathways for transport
and elux of ascorbate and dehydroascorbate. Arch Biochem Biophys
500: 107-115.
D'Aniello C, Cermola F, Patriarca EJ, Minchiotti G (2017) Vitamin C in
Stem Cell Biology: Impact on Extracellular Matrix Homeostasis and
Epigenetics. Stem Cells Int.
D'Aniello C, Habibi E, Cermola F, Paris D, Russo F, et al. (2016) Vitamin
C and l-proline antagonistic effects capture alternative states in the
pluripotency continuum. Stem Cell Reports 8: 1-10.
Esteban MA, Wang T, Qin B, Yang J, Qin D, et al. (2010) Vitamin C
enhances the generation of mouse and human induced pluripotent stem
cells. Cell Stem Cell 6: 71-79.
Eid W, Abdel-Rehim W (2016) Vitamin C promotes pluripotency of
human induced pluripotent stem cells via the histone demethylase
JARID1A. Biol Chem 97: 1205-1213.
12.Bell IR, Koithan M (2012) A model for homeopathic remedy effects: low
dose nanoparticles, allostatic cross-adaptation, and time-dependent
sensitization in a complex adaptive system. BMC Complement Altern
Med 12: 191.
Citation: Raghavan PR (2018) Metadichol®, Vitamin C and GULO Gene Expression in Mouse Adipocytes. Biol Med (Aligarh) 10: 426. doi:
10.4172/0974-8369.1000426
Page 3 of 4
Biol Med (Aligarh), an open access journal ISSN: 0974-8369 Volume 10 • Issue 1 • 1000426
6
7
8
9
10
11
13 Hayes DP (2007) Nutritional Hormesis. European Journal of
Clinical Nutrition 61: 147-159.
Citation: Raghavan PR (2018) Metadichol®, Vitamin C and GULO Gene Expression in Mouse Adipocytes.
Biol Med (Aligarh) 10: 426. doi: 10.4172/0974-8369.1000426