![Amplified products of CymMV at different annealing temperatures with the specific primer pair [CymMVCP-F1 (ATGGGAGAGYCCACTCCARCYCCAGC) and CymMVCP-R1 (TTCAGTAGGGGGTGCAGGCA)] (Ladder-Molecular size marker 100bp, Lane 1-50 °C, Lane 2-50.6 °C, Lane 3-51.1 °C, Lane 4-52.4 °C, Lane 5-53.9 °C, Lane 6-55.3 °C, Lane 7-56 °C, Lane 8-57.3 °C, Lane 9-58.4 °C, Lane 10-59.4 °C, Lane 11-59.7 °C, Lane 12-60 °C)](https://www.researchgate.net/profile/Kamani-Ratnayake/publication/321867583/figure/fig5/AS:745326159880192@1554711012030/Amplified-products-of-CymMV-at-different-annealing-temperatures-with-the-specific-primer_Q320.jpg)
Content uploaded by Kamani Ratnayake
Author content
All content in this area was uploaded by Kamani Ratnayake on Apr 08, 2019
Content may be subject to copyright.
A preview of the PDF is not available
Aloe vera gel coating to enhance shelf life of papaya (Carica papaya L.).
Figures
Figures - uploaded by Kamani Ratnayake
Author content
All figure content in this area was uploaded by Kamani Ratnayake
Content may be subject to copyright.
ResearchGate has not been able to resolve any citations for this publication.
Tea production in smallholding sector, the dominant sector in Sri Lankan economy, is below its targeted level recently. Therefore, this paper attempts to study the effectiveness of the technology transferring system in tea smallholding sector in order to uplift its productivity. The study was carried out in Pasgoda DS division in Matara district, Southern, Sri Lanka. Seventy tea smallholders were interviewed in the study by using a pre-tested questionnaire. The results revealed that the existing technical knowledge of smallholders was very poor and it varied dramatically with different cultural practices. Based on Kruskal-Wollis ranking method, the study showed that the most efficient source of technology transfer was tea processing factories while the weakest source was mass-media. Further, the most effective mode was individual methods. The study showed very poor extension service in the study area. Based on the survey, the study recommends strengthening the extension services in order to disseminate technical knowledge among tea smallholders and improving the contribution of mass media in order to make the tea sector more efficient, effective and sustainable.
Anthropogenic activities are resulting in an increase of the use and
extraction of heavy metals. Heavy metals cannot be degraded and hence
accumulate in the environment, having the potential to contaminate the food
chain. This pollution threatens soil quality, plant survival and human
health. The remediation of heavy metals deserves attention, but it is
impaired by the cost of these processes. Phytoremediation and biochar are
two sound environmental technologies which could be at the forefront to
mitigate soil pollution. This review provides an overview of the state of
the art of the scientific research on phytoremediation and biochar
application to remediate heavy-metal-contaminated soils. Research to date
has attempted only in a limited number of occasions to combine both
techniques, however we discuss the potential advantages of combining both,
and the potential mechanisms involved in the interaction between
phytoremediators and biochar. We identified specific research needs to
ensure a sustainable use of phytoremediation and biochar as remediation
tools.
This study was conducted to investigate the nutrient composition of raw and hydrothermally processed watermelon whole seeds at different duration (0, 10, 20, 30, 40 and 50 minutes boiling time) to ascertain their suitability for incorporation into fish feed. The result showed that raw watermelon whole seeds contained 27.77±0.09% of ether extract, 30.35±0.13% Crude fibre and 17.76±0.09% Crude protein. However these parameters increased with increasing duration of hydrothermal processing. 40mins boiling time led to higher crude protein value of 19.26±0.12% while 50 minutes boiling time resulted to highest ether extract and crude fibre (30.78±0.07% and 39.84±0.09% respectively). Incorporating hydrothermally processed of watermelon seed is envisaged to result in better feed conversion in the nutrition of farmed fishes, hence further research is recommended to ascertain this claim.
The rice-wheat rotation is a dominant system that contributes immensely to the food security in South Asia. Intensification of the rice-wheat system requires innovative knowledge-based technologies such as precision land leveling; mechanical transplanting, seedling broadcasting, and wet seeding on puddled soil; transplanting on beds and dry drill seeding on flat land or on beds with conventional or minimum/zero tillage for nonpuddled soil; integrated weed control strategies; site-specific nutrient management; and improved machinery for crop establishment and fertilizer placement. Transplanting or direct drill seeding of rice on beds is more efficient in irrigation water use than traditional transplanting of rice on puddled soil. Laser leveling can further improve water use efficiency. The low-till or zero-till rice planting system seems to be promising. Higher yield and the efficient use of inputs in new systems mean lower cultivation costs and higher profit to farmers, lesser adverse effects of crop intensification on the environment, and better resource conservation and system sustainability. Research is ongoing to improve planting machines, to standardize soil moisture for dry seeding in different soil types, to tackle the problem of bird damage of seeds sown in open slits, to prevent micronutrient deficiency and termite attack, and to manage crop residues in low-till systems. Long-term monitoring of grain yield and profit, the evolution of weeds and other pests, soil physical and chemical conditions, and water productivity at the field and watershed level are critical to providing solutions to the sustainability problems of the rice-wheat rotation in nonpuddled soil.
An increasing amount of information is being collected on the ecological and socio-economic value of goods and services provided by natural and semi-natural ecosystems. However, much of this information appears scattered throughout a disciplinary academic literature, unpublished government agency reports, and across the World Wide Web. In addition, data on ecosystem goods and services often appears at incompatible scales of analysis and is classified differently by different authors. In order to make comparative ecological economic analysis possible, a standardized framework for the comprehensive assessment of ecosystem functions, goods and services is needed. In response to this challenge, this paper presents a conceptual framework and typology for describing, classifying and valuing ecosystem functions, goods and services in a clear and consistent manner. In the following analysis, a classification is given for the fullest possible range of 23 ecosystem functions that provide a much larger number of goods and services. In the second part of the paper, a checklist and matrix is provided, linking these ecosystem functions to the main ecological, socio–cultural and economic valuation methods.
A study was conducted in Thrissur taluk of Thrissur district to assess the training needs of farm women engaged in dairy farming. It was found that out of the five major farm operations studied, the farm women needed training the most in housing. The minor operations preferred the most for knowledge need were proper design of cattle shed, selection of breeds, compounding balanced feed using locally available ingredients, vaccination and banking and insurance. As for skill need, construction of scientific low cost cattle shed, selection of breeds, compounding balanced feed using locally available ingredients, symptoms of common diseases and banking and insurance were preferred the most.