ResearchPDF Available

Journal of Global Pharma Technology Typing of Acinetobacter baumannii Isolates from some Iraqi Children infected with Head Lice

Authors:

Figures

Content may be subject to copyright.
ISSN 0975 -8542
Journal of Global Pharma Technology
Available Online at www.jgpt.co.in
Research Paper
©2009-2017, JGPT. All Rights Reserved 466
Typing of Acinetobacter baumannii Isolates from some Iraqi
Children infected with Head Lice
Eman N. Najii1*, Israa M.S. Al-Kadmy2, Sawsan Mohammed Kareem 2, Sarah
Naji Aziz2
1 Mustansiriyah University/College of Science/ Department of Biology/Branch of Microbiology.
2Mustansiriyah University/College of Science/ Department of Biology/Branch of Biotechnology.
Baghdad, Iraq.
*Corresponding Autor: Eman N. Najii
Introduction
Head lice invasion a worldwide health care
problem, which obligatory human
hematophagous ectoparasites belong to
pediculide family, it caused by pediculus
humans capitis [1] in fact the USA was
recorded 6-12 million of head lice invasion
appeared every year [2]. Children with head
lice usually related with negative feeling
additional to negative consequences as
quarantine, Furthermore increase resistance
of lice to treatment with neurotoxic
pediculicides, Meta-methrin one of the
neurotoxic insecticide shampoo which is used
to executive head lice, head lice removing are
getting scarcely to cure despite general home
clear out procedures.
Furthermore, many studies have been shown
the lice resistance to many of commonly
applied pediculicides [3]. The evidence of the
ability of lice to transmit some of the human
infectious agents such as Rickettsia
prowazekii, Bartonella Quintana and
Acinetobacter baumannii [4].
Acinetobacter baumannii called the Iraqi
bacter, A comparatively benign bug becomes
an extremely lethal pathogen, known to U.S.
soldiers as Iraqibacter after 2003 war in Iraq
[5]. A. baumannii has enduring to be a
terrible problem for veterans, researches in
environment and soldiers who served in Iraq
[6]. A. baumannii also the significant
member of ESKAPE pathogen (E. faecium,
Staph. aureus, K. pneumoniae, A. baumannii,
P. aeruginosa, and Enterobacter species), a
group of bacterial pathogens with a elevated
velocity of antibiotic resistance that are
responsible for the preponderance of A
hospital-acquired infection (HAI) [7]. It is
still an opportunistic human pathogen, which
causes life-threatening nosocomial infections
such as ventilator-associated pneumonia,
meningitis, urinary tract, bacteremia and
wound infections.
A. baumannii harboring a number of effective
virulence factors, which painstaking an
organism of low virulence, but the occurrence
of fulminant community-acquired
Acinetobacter pneumonia, indicates that
these organisms possibly sometimes shows
high pathogenicity and cause invasive
disease. These factors embrace the
connection and perseverance on dry and/or
solid surfaces, the capability to take
necessary nutrients such as iron, the
adhesion to and succeeding destroying of
epithelial cells, and the capacity in some
strains to produce gelatinases and
proteinases that injure host tissues [6].
Dissimilar to another type of the
Acinetobacter genus, which are often in
Eman N. Najii et. al.: Journal of Global Pharma Technology. 2017; 10(9):466-473
©2009-2017, JGPT. All Rights Reserved 467
accessible from the water, soil and animals
[8], A. The bunny is almost completely found
in the hospital setting, causing (HAI).
However, environmental incidence had been
notified in not many cases according to [9].
The highest occurrence of A. baumannii in
non-clinical sources appears to be associated
with lice [5-10]. Other non-human sources
include animals, with several strains isolated
from cases of infection of cats, dogs and
horses [11], and colonization of fish, poultry
and slaughterhouse meat [12].
A. baumannii can also found in aquaculture
and in soils [13-14], on human skin [15].In
remains to were estimated if these isolates,
which are infrequent, are the result of
hospital contamination or originate from
natural reservoirs of this species.
Material and Methods
One hundred twenty children infected with
lice in two Kindergartens (Al-Safa
Kindergarten and Al-Rayahin Kindergarten)
in Al-Rusafa, Baghdad, Iraq. These children
with ages 3->6 years included 93 girls and 27
boys. These lice and egg of lice collected from
a hair and skin of infected children (which
show in figure 1). The sample was rinsed into
a vial contains phosphate- buffered saline
solution (0.15 M, pH 7.3) and transport
media without any solidifying agents then,
sent to the laboratory of microbiology
department (college of science /Al-
Mustansiriya University). Each sample was
compressed slowly with sterilized glass rood
in phosphate buffer saline, suspend well,
then 0.1 ml of final suspension was
transferred to brain heart infusion broth
directly incubated for 24h at 37C°. The
specimens (cultured and swabs) were
inoculated onto appropriate plates for
standard aerobic and microaerophilic
bacteria (5-10% of co2) cultures were
incubated at 37C° for 24 h, 48 h respectively.
The positive cultured samples were tested for
the presence of different aerobic bacteria,
microaerophilic bacteria and Candida species
by general culture morphology, biochemical
test and germ tube test for Candida species.
The isolated pathogens were identified by
using the automated system VITEK 2 (Bio
Merieux, Marcy L’ Etoile, France).
Furthermore, some of these lice put it in
formalin 10% for electronic microscope study.
Genotype Diagnosis of A. baumannii
by PCR
RecAgene (a house keeping gene) was used
for A. baumannii genotypic diagnosis.
Specific primer listed in table 1 had been
employed and the amplified size was 240bp.
Template DNA was prepared by the boiling
method by [16]. Briefly, few isolated colonies
of overnight growth bacteria had suspended
thoroughly in (1mL) distilled water and
boiled in a water bath for (10min). After
centrifugation, supernatant had been used as
template DNA in PCR technique. Moreover
confirmed five isolates A. baumannii
genetically by using rec Agene as a
housekeeping gene as it appeared in the
Table (1).
Figure 1: Head lice collected from infected children, F: show the cheese like accumulation of Candida albicans, I & M: show
irritation, redness of lice bite
Eman N. Najii et. al.: Journal of Global Pharma Technology. 2017; 10(9):466-473
©2009-2017, JGPT. All Rights Reserved 468
Table 1: The primers used in the current study for PCR amplification
Name of
Genes
Primers 5 - 3
Size
products
Tm
Reference
RecA
F- CCTGAATCTTCYGGTAAAAC
R- GTTTCTGGGCTGCCAAACATTAC
425
54
17
RAPD
5′-ACGGCCGACC-3′
-
44
18
Antimicrobial Susceptibility Testing
It had performed by the disk diffusion
method according to the CLSI guidelines
2016[19]. The following disc (μg/disc). Ak:
amikacin (30 μg), GN: gentamicin (30 μg),
IMI: imipenem (10 μg), NOR: Norfloxacin
(10μg), ATH: Azithromycin (15 μg), LEV:
Levofloxacin (5 μg), AUG: Amoxicillin +
Clavulanic acid (30μg).MDR was defined as
resistance to three or more antibiotics of the
following classes: quinolones (ciprofloxacin),
aminoglycosides (gentamicin), extended
spectrum cephalosporins and carbapenems
(imipenem) (20)
The Minim inhibitory concentration MIC was
done by using the agar dilution method to
determine the break point of meta-methrin
insecticidal effect on Acinetobacter baumanii,
and using quality controlled standard strains
(Acinetobacter baumanii ATCC BAA-747)
obtained from the American Type Culture
Collection.
Virulence Factor Detection Assays
Virulence factor phenotypic detection of A.
baumannii isolates was done in order to
detect for the ability of biofilm formation and
other ten virulence factors. Which were
(Capsule, Motility, Twitching motility,
Heamolysin, Pellicle, Protease, Lipase,
Lecithenase, Gelatinase and Sidrophore) [21-
22].
PCR and Clonal Diversity Analysis
The clonality of A. baumannii isolates was
determined using the RAPID-PCR method
this primer for “random amplification of
polymorphic DNA” as seen in (table 1).
Cycling conditions for RAPID-PCR are as
follows: 45 cycles of 1 min each at 94°C,
44°C, and 72°C. After the last cycle, samples
had maintained at 72°C for 10 min. The PCR
products were analyzed by horizontal
electrophoresis according to Sam brook and
Russell (23) by using of (15μl) of the reaction
product on a 1% agarose gel and 10 kb DNA
ladder (Kapa, South Africa) as a molecular
marker, then PCR products were visualized
with UV light at 336 nm. The Numerical
Taxonomy System 1.8 software, using the
Jaccard coefficient of similarity, and the
unweighted pair-group method with
arithmetic mean (UPGMA) had used in
calculating genetic distance and obtaining a
phylogenetic tree.
Results
The results of this study showed 93 (77%)
girls infected while 27(22%) boys in head lice.
The positive cultures results from both
samples type's swabs and crushed lice
showed the diversity of bacterial isolates in
additions to the Candida albicans, these
isolates were: 3 isolates Candida albicans, 11
isolates Staph. sp., 3 isolates Pseudomonas
aeruginosa, 1 isolate of E. coli, 1 isolate of
Klebsiella pneumonia and 5 isolates A.
baumannii, which appear in Figure (2) All A.
baumannii was confirmed the diagnosis with
used recA gene (housekeeping gene).
Figure 2: Distribution of bacterial isolates Candida albicans, Staphylococcus spp., klebsiella, pseudomonas, E.coli
and A. baumannii from Lice
Eman N. Najii et. al.: Journal of Global Pharma Technology. 2017; 10(9):466-473
©2009-2017, JGPT. All Rights Reserved 469
While Figure (3) shows the resistance
percentage profile towards antibiotics used in
this study, these percentages diverge
completely from resistance towards CRO was
reached 100% for GN, LEV and CD, followed
by 80% for CEF, ATH, NOR, DO and CLR.
While this percentage reached 60% for AK,
PC, and AUG, also this percentage reached
40% for CX, and finally, the lowest and most
activities against this bacteria was IMI
which given 0% of resistance.
Figure 3: Antibiogram profile of Acinetobacter baumannii isolates
The results of MIC have been exposed the
capability of all A. baumannii isolated to
grow in concentration 2%, 3%, 4%, 5% of
meta-methrin while only one isolate can grow
in 6% concentration of meta-methrin.
Furthermore, the detection of virulence factor
have been revealed that each isolate have
more than one virulence factor as seen in the
Table (2) and figure (4), all A. baumannii
isolates non-biofilm producer, nonmotile and
negative in gelatinase and protease
reactions. Otherwise, all isolates were
capsulated and found to be positive in
twitching motility, pellicle producer but only
one isolate found to be positive in
Lecithinase, Siderophore production and β-
hemolysis on blood agar.
Table 2: The results of virulence factors detection assays for A.bumannii Lice isolates
Lecithenas
e
Protease
Pellicle
Biofilm
Heamolysi
n
Twitching
motility
Motility
Capsule
test
No.
+
-
+
-
Β
+
-
+
1
-
-
+
-
ˠ
+
-
+
2
+
-
+
-
ˠ
+
-
+
3
+
-
+
-
ˠ
+
-
+
4
+
-
+
-
ˠ
+
-
+
5
Figure 4: Positive and negative results of some virulence factors detection assays for A.bumannii Lice isolates. A:
Biofilm test. B& C: Protease assay (Caseinase), D: Lecithinase assay, E: Motility and twitching motility assay, F:
Siderophore produce assay, G: Gelatinase test, H: Hemolysin test.
0
20
40
60
80
100
GN LEV CD CEF ATH NOR DO CLR AK PC AUG CX IMI
Series 1, 0
Eman N. Najii et. al.: Journal of Global Pharma Technology. 2017; 10(9):466-473
©2009-2017, JGPT. All Rights Reserved 470
The results of random amplification of
polymorphic DNA (RAPD-PCR) were showed
each A. baumannii isolates isolated from lice
had specific genetic profile as shown in Figure
(5), while genetic segregation of isolates
depending on phylogenetic trees appeared in
Figures (6,7,8).
Figure 5: RAPD fingerprint profile of A. baumannii isolates. Agarose gel electrophoresis had performed using 1%
agarose gel, and the run lasted for 90 min at 70 V.
Figure 6: Dendrogram of A. baumannii by APGMA jaccard according to antibiotics resistant
Figure 7: dendogram of A. baumannii by APGMA jaccard according to virulence factors
Figure 8: Dendrogram of A. baumannii by APGMA jaccard according to RAPD-PCR
Eman N. Najii et. al.: Journal of Global Pharma Technology. 2017; 10(9):466-473
©2009-2017, JGPT. All Rights Reserved 471
Discussion
The outcome of the current search proved high
percentage of infected girls compared with
infected boys, according to many endemic
regions, the girls is more effected by head lice
than boys the ratio appear in Australia 2;1
while in turkey 12:1, there is belong to
gender-typical behaviors, long hair of girls
and it is not repercussion any biological
determined that increased susceptibility in
girls [24].
The cultures of crused lice and swabs were
showed more than one type of bacterial
isolate, moreover confirmed present A.
baumannii isolates in this study was agree
with (25) which refer to the percentage of A.
baumannii isolated from human lice was 58%
Rwanda, 35% peru and 18% in France. The
improve of present of A. baumannii very
effective by using PCR technique as recorded
by (26). Furthermore, some of S. aureus and
Streptococci isolates can cause secondary
infection belong to the crushed of skin (24).
A.baumannii, which is widespread in nature
(water, soil, living organisms, vegetables, and
the skin of patients and healthy subjects). An
increase in the frequency of community-
acquired infections with A. baumannii had
recorded during the last decade, mainly from
countries located in inter-tropical areas or
during international armed conflicts or
natural disasters, which raises the query of a
probable environmental reservoir. Our study
found that 5 isolates of A. baumannii (3 from
lice collected from girls one from skin girl swab
beside one Klebsielle and one Staph. spp
isolate and one from lice collected from boy
beside one isolate of Staph. spp) of hair lice
collected wide-reaching was naturally infected.
Until now, it is still unknown how all these
hair lice acquire their A. baumannii infections
and other bacteria, which isolated (5) but
perhaps the association of A.bumannii with
lice belong to undiagnosed bactermiain
patients harboring with lice. In animals and
arthropods (lice) infection due to Acinetobacter
sp. is consider as an emerging problem due to
escalating in the number of reports from
different countries across the global.
The results of antibiotics susceptibility teste
showed the high level of resistance against
almost antibiotics make it a multidrug
resistance bacteria which maybe use to treat
this infection if occurs in human specially
these isolates isolated from children, and
maybe interrupted any invasion or injury even
necrosis in human skin and cause bacteremia
or other terrible problem (27).The ability of A.
baumannii isolates to graw in meta-methrin
was appeared in MIC test, infact the dose was
used in children shampoo range from 2-4%
therefore the treatment appear usefulness to
treated this bacteria which found in lice or the
infected skin. As well as the virulence factors
plays asignificant role in resistance to defense
mechanisms such as leukocytes, antibodies,
and complement which found in blood meal of
those lice (24).
Moreover, A. baumannii able to cause a wide-
range of infections, is increasingly resistant to
antibiotics and may be associated with high
mortality rates in different patients, its
virulence factors, pathogenicity mechanisms
were largely unknown, and genetics study still
limited at this time for this bacteria (28).
However, we keep this isolates to study
different molecular mechanisms of virulence
factor, Quorum sensing, and Pathogenicity
Island in A. baumannii from lice. While still
all study in my country and across the global
in virulence factor is limited because eight
completed and annotated genome sequences of
A. baumannii are now available, and about 60
others are in progress according to (24) in
Italy. Also no study these factor in molecular
level or show increase or inhabit these factor
also no biotechnology application study of
isolates from lice and no study in Iraq isolate
or diagnosis bacterial head lice.
The results of random impifilication of
polymorphic DNA (RAPD-PCR) were showed
each A. baumannii isolates isolated from lice
had specific gene profile gave it special DNA
finger print as seen in Figure (5), in fact,
various gene-typing methods, like pulsed-field
gel electrophoresis (PFGE), restriction
fragment length polymorphism analysis,
RAPD-PCR, had been used for the typing of
strains from diverse sources. Genetic typing
methods had been found to be more
discriminatory than phenotypic methods for
typing A. baumannii isolates (26, 30). RAPD
does not require any specific knowledge of the
DNA sequence of the target organism. The
single short primer will amplify a sequence of
DNA, depending on positions that are
complementary to the sequence of a primer.
A baumannii is among the most disconcerting
pathogens and has been implicated in several
types of nosocomial infections due to its
Eman N. Najii et. al.: Journal of Global Pharma Technology. 2017; 10(9):466-473
©2009-2017, JGPT. All Rights Reserved 472
seemingly endless capacity to acquire
antimicrobial resistance mechanisms. In
addition to its ability to acquire substantial
resistance genes, its remarkable ability to
adjust itself in the hospital environment, thus
further enhancing its widespread
transmissibility had resulted in A. baumannii
becoming a leading pathogen of nosocomial
infection [28]. In 2006, the genome of A.
baumannii strain isolated from a human body
louse had sequenced and analyzed; results
showed that this remarkably susceptible
strain harbored several hundred-insertion
sequence elements (transposons, gene
cassettes from class 1 integrons), with gene
cassettes (sometimes chimeric) mostly
originating from the genera Pseudomonas,
Salmonella, and Escherichia.
Together with A. baumannii, many members
of these genera are commonly found in
aqueous environments of healthcare facilities,
where, under antimicrobial pressure in these
settings, genetic exchange among them may be
promoted) that have played a crucial role in its
genome reduction (5, 31). The clonal diversity
by APGAM jaccard was showed two major
groups of isolates furthermore the relatedness
between isolates which appeared isolated 4
and 5 more similar 0.83 distance while isolates
2, 4,5 descended from the same group as
appeared in figure (6).
On the other hands the dendrogram of
virulence factors was showed two major
groups one of them was contained isolate 1
and the other group showed high similarity 1.0
between 3, 4, 5 isolates as it appeared in figure
(7), while the dendrogram of profile genes
appeared the relatedness between 3,4 isolated
was 0.75 distance and gave view of diversity
between isolated despite the similarity
according to the antibiotics resistance and
virulence factors. The results of this study
were revealed isolate 1 have multi-virulence
factors additional to multidrug resistance and
special DNA fingerprinting making it in a
special group in dendrograms.
Conclusion
Our study is the first showing the presence of
A. baumannii in human head lice in children,
in Iraq, especially this bacteria is a very
adaptable pathogen, with an extraordinary
ability to acquire new genetic material, beside
other pathogenic bacterial species and the
effect of meta-methrin on bacteria. In addition,
one isolate of A. baumannii no.1 was epidemic
clonal lineages show multifactorial and
combinatorial traits and particularly,
resistance to different antibiotics, could have
favored the spread and persistence among
children in Kindergartens and also may be
transmitted to them families and another
member in them society with head lice and
causing epidemic with A. baumannii.
Acknowledgments
The Authors would like to thank AL-
Mustansiryia University
(http://uomustansiriyah.edu.iq/) Baghdad, Iraq
for its support in the present work. Finally,
We thank the management the two
Kindergarten to taken us permission to collect
these lice from children, we also thank the
staff in the lab of microbiology in Al-Numan
hospital to diagnosis these isolates from
human lice by automated system VITEK 2
system. We thank Dr. Hussam Sami Away to
help us in many tests.
References
1. Sunantaraporn S, Sanprasert V, Pengsakul T,
Phumee A, Boonserm R, Tawatsin A, Thavara U,
Siriyasatien P(2015) Molecular survey of the head
louse Pediculushumanus capitis in Thailand and its
potential role for transmitting Acinetobacter spp.
Sunantaraporn et al. Parasites & Vectors; 8:127
2. Falagas ME, Matthaiou DK, Rafailidis PI, Panos G,
Pappas G (2008) Worldwide prevalence of head lice.
Emerg Infect Dis;14:14934.
3. Parison JC, Speare R, Canyon DV (2013) Head lice:
the feelings people have. Int J Dermatol; 52: 16971.
4. La Scola B, Raoult D (2004) Acinetobacter
baumanniiin Human Body Louse. Emerging
Infectious Diseases; 10(9):1671-1673.
5. Kempf M, Abdissa A, Diatta G, Trape JF, Angelakis
E, Mediannikov O, La Scola B, Raoult
D(2012)Detection of Acinetobacter baumanniiin
human head and body lice from Ethiopia and
identification of new genotypes. Int J Infect
Dis.;16(9):e680-3.
6. Young LS, Sabel AL, Price CS (2007) Epidemiologic,
clinical, and economic evaluation of an outbreak of
clonal multidrug-resistant Acinetobacter baumannii
infection in a surgical intensive care unit. Infect
Control Hosp Epidemiol.;28:12471254.
7. Rice LB (2008) Federal funding for the study of
antimicrobial resistance in nosocomial pathogens: no
ESKAPE. The Journal of Infectious Diseases. 197 (8):
107981.
8. Towner KJ (2009) Acinetobacter: an old friend, but a
new enemy. J Hosp Infect. 73(4):355-63.
Eman N. Najii et. al.: Journal of Global Pharma Technology. 2017; 10(9):466-473
©2009-2017, JGPT. All Rights Reserved 473
9. Sengstock DM, Thyagarajan R, Apalara J, Mira A,
Chopra T, Kaye KS (2010 ) Multidrug-resistant
Acinetobacter baumannii: an emerging pathogen
among older adults in community hospitals and
nursing homes. Clin Infect Dis.; 50(12):1611-6.
10. Bouvresse S, Socolovshi C, Berdjane Z, Durand R,
Izri A, Raoult D, Chosidow O, Brouqui P (2011) No
evidence of Bartonellaquintanabut detection of
Acinetobacter baumanniiin head lice from elementary
schoolchildren in Paris. Comp Immunol Microbiol
Infect Dis.; 34(6):475-7.
11. Endimiani A,Hujer KM, Hujer AM, Bertschy I,
Rossano A, Koch C, Gerber V, Francey T, Bonomo,
RA, Perreten V (2011) Acinetobacter
baumanniiisolates from pets and horses in
Switzerland: molecular characterization and clinical
data. J Antimicrob Chemother.; 66(10):2248-54.
12. Hamouda A, Findlay J, AlHassan L, Amyes SG
(2011)Epidemiology of Acinetobacter baumannii of
animal origin.Int J Antimicrob Agents.; 38(4):314-8.
13. Hoa PT, Managaki S, Nakada N, Takada H, Shimizu
A, Anh DH, Viet PH, Suzuki S (2011) Antibiotic
contamination and occurrence of antibiotic-resistant
bacteria in aquatic environments of northern
Vietnam.Sci Total Environ.; 409(15):2894-901.
14. Rokhbakhsh-Zamin F, Sachdev D, Kazemi-Pour N,
Engineer A, Pardesi KR, Zinjarde S, Dhakephalkar
PK, Chopade BA (2011) Characterization of plant-
growth-promoting traits of Acinetobacter species
isolated from rhizosphere of Pennisetumglaucum. J
Microbiol Biotechnol., 21(6):556-66.
15. Peleg AY, Seifert H, Paterson DL (2008)
Acinetobacter baumannii: emergence of a successful
pathogen. ClinMicrobiol Rev., 21(3):538-82.
16. Ruppé E, Hem S, Lath S, Gautier V, Ariey F, Sarthou
JL, Monchy D, Arlet G (2009) CTX-M β-Lactamases
in Escherichia coli from Community acquired Urinary
Tract Infections, Cambodia. Emerg Infect Dis.
15(5):741-8.
17. AL-Jubori SS, AL-kadmy IMS, AL-Ani ZIJ (2016)
Emergence of Multidrug resistance (MDR)
Acinetobacter baumannii Isolated from Iraqi
hospitals. Advances in Environmental Biology, 10(5):
265-275
18. Auda IG, Al-Kadmy IMS, Kareem SM, Lafta AK,
A’Affus MH, Khit IA, Al Kheraif AA, Divakar DD,
Ramakrishnaiah R (2017) RAPD- and ERIC-Based
Typing of Clinical and Environmental Pseudomonas
aeruginosa Isolates. J. AOAC Internation, 100 (2).
19. CLSI (2015) Performance standards for antimicrobial
susceptibility testing; Twenty-Four informational
supplement.M100-S25.35-.3.
20. Srinivasan VB, Rajamohan G,Pancholi P, Stevenson
K, Tadesse D, patchanee P et al (2009) Genetic
relatedness and molecular characterization of
multidrug resistant Acinetobacter baumannii
isolated in central Ohio, USA.Ann Clin Microbiol
Antimicrob; 8:21.
21. Atlas Ronald M, Alfred E Brown, Lawrence C (1995)
Parks Laboratory manual of experimental
microbiology. Mosby,
22. Vijayakumar S et al (2016) "Biofilm Formation and
Motility Depend on the nature of the Acinetobacter
baumannii clinical isolates." Frontiers in public
health.4 .
23. Sambrook JF, Russell DW (2001) Molecular Cloning:
A Laboratory Manual, third Ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
24. Meister L, Ochsendorf F (2016) Head Lice
Epidemiology, Biology, Diagnosis, and Treatment
Deutsches Ärzteblatt International | Dtsch Arztebl
Int., 113: 76372
25. La Scola B, Raoult D (2004) Acinetobacter baumannii
in human body louse.Emerg. Infect. Dis., 10:1671
1673.
26. Esaa RH, Najii EN, Awayid HS, Al-kadmey I( 2016)
Comparison of three diagnostic methods for
Acinetobacter baumannii isolated from Baghdad
Hospitals.Advances in Environmental Biology, 10(8):
87-93.
27. Houhamdi L, Raoult D (2006) Experimental infection
of human body lice with Acinetobacter baumannii.
Am J Trop Med Hyg.,74(4):526-31.
28. Kareem SM, Al-Kadmy SM, Al-Kaabi MH, Aziz SN,
Ahmad M (2017) Acinetobacter baumannii virulence
is enhanced by the combined presence of virulence
factors genes phospholipase C (plcN) and elastase
(lasB).Microbial Pathogenesis 110-568e572.
29. Houang ET, Chu YW, Leung CM, Chu KY, Berlau J,
Ng KC, Cheng AF (2001) Epidemiology and infection
control implications of Acinetobacter spp. in Hong
Kong. J ClinMicrobiol., 39(1):228-34.
30. Berlau J, Aucken HM, Houang E, Pitt TL (1999)
Isolation of Acinetobacter spp. including A.
baumanniifrom vegetables: implications for hospital-
acquired infections. J Hosp Infect., 42(3):201-4.
31. Byrne-Bailey KG, Gaze WH, Kay P, Boxall AB,
Hawkey PM, Wellington EM (2009) Prevalence of
sulfonamide resistance genes in bacterial isolates
from manured agricultural soils and pig slurry in the
United Kingdom. Antimicrob Agents Chemother.
53(2):696-702.
Eman N. Najii et. al.: Journal of Global Pharma Technology. 2017; 10(9):466-473
©2009-2017, JGPT. All Rights Reserved
... specially, vast used of extended -spectrum cephalosporins and quinolons [4,5]. Furthermore MDR Acinetobacter baumannii is a decidedly formidable pathogen and causes nosocomial infections belong to high morbidity and mortality at hospitals [6,7]. Biofilm formation play role in enhancing the pathogenicity and resistance initially on clinically important surfaces [8]. ...
Article
Full-text available
Forty five samples of urine were collected from patient with UTI in medical city, in Baghdad. At first all sample were cultured differentiation media (MacConkey & Nutrient agar) under suitable conditions, (20) isolates have been identified as Acinetobacter. Agar diffusion method was used to five antimicrobial agent toward all Acinetobacter isolates, the isolates showed different sensitivity against antimicrobial agents used. the isolates appeared resistance to more than one antimicrobial agents. The isolates display sensitivity toward aminoglycoside group (Amikacin AK 60% & Gentamycin 30%), While moderate sensitivity toward quinolones group (Ofloxacin 30% & Levofloxacin 20%) and finally which was observed Rifampicin the lowest effective antibiotic toward these isolates the sensitivity was (10%) toward Acinetobacter isolates. Agar dilution method was applied to determination of minimum inhibitory concentration (MIC) to antimicrobial agents (Rifampicin, Gentamicin and Amikacin) each of them separately, furthermore applied combination of (AK & R) and (CN & R), the results showed all Acinetobacter isolates were resist to rifampicin (100%), Gentamicin (80%) and Amikacin (60%) alone in all concentration of MICs. While results of combination of antimicrobial agents showed increase the sensitivity toward them, the synergic effect of the combination between (AK & R) up to (80%) while the combination between (CN & R) up to (60%). Polymerase chain reaction PCR was used to screening about some aminoglycoside modifying genes prevalence in all resistant isolates, the results showed predominance of (ant (4)IIb 12.5%, aac (6)Ib 12.5%, aph (3)VI 56.25% and 18.75% of isolates showed negative results to these genes.
... specially, vast used of extended -spectrum cephalosporins and quinolons [4,5]. Furthermore MDR Acinetobacter baumannii is a decidedly formidable pathogen and causes nosocomial infections belong to high morbidity and mortality at hospitals [6,7]. Biofilm formation play role in enhancing the pathogenicity and resistance initially on clinically important surfaces [8]. ...
Article
Full-text available
Forty five samples of urine were collected from patient with UTI in medical city, in Baghdad. At first all sample were cultured differentiation media (MacConkey & Nutrient agar) under suitable conditions, (20) isolates have been identified as Acinetobacter. Agar diffusion method was used to five antimicrobial agent toward all Acinetobacter isolates, the isolates showed different sensitivity against antimicrobial agents used. the isolates appeared resistance to more than one antimicrobial agents. The isolates display sensitivity toward aminoglycoside group (Amikacin AK 60% & Gentamycin 30%), While moderate sensitivity toward quinolones group (Ofloxacin 30% & Levofloxacin 20%) and finally which was observed Rifampicin the lowest effective antibiotic toward these isolates the sensitivity was (10%) toward Acinetobacter isolates. Agar dilution method was applied to determination of minimum inhibitory concentration (MIC) to antimicrobial agents (Rifampicin, Gentamicin and Amikacin) each of them separately, furthermore applied combination of (AK & R) and (CN & R), the results showed all Acinetobacter isolates were resist to rifampicin (100%), Gentamicin (80%) and Amikacin (60%) alone in all concentration of MICs. While results of combination of antimicrobial agents showed increase the sensitivity toward them, the synergic effect of the combination between (AK & R) up to (80%) while the combination between (CN & R) up to (60%). Polymerase chain reaction PCR was used to screening about some aminoglycoside modifying genes prevalence in all resistant isolates, the results showed predominance of (ant (4)IIb 12.5%, aac (6)Ib 12.5%, aph (3)VI 56.25% and 18.75% of isolates showed negative results to these genes.
Article
Full-text available
Twenty isolates primarily diagnosed as A.baumannii were isolated from wounds infections from patients submitted to Baghdad hospitals\Iraq. Bacterial diagnosis was performed depending on rapid morphological tests followed by identification using complementary Vitek system.recAgene(a house keeping gene) was used for genotypic diagnosis ,amplified size was 425bp. Antimicrobial susceptibility testing was performed by disk diffusion and 13 antibiotics related to different groups were used.The result revealed that most isolates displayed multidrug resistance(MDR) pattern ,and all isolates were resisted to gentamicin, piperacillin and ceftazidim while ticracillin and Tigecycline were most effective when only 1 and 2 isolates were susceptible respectively. The results of rapid ESβLs production via ESβL strips revealed that 20\20(100%) gave positive results in the preliminary screening of β-lactamases, 18\20 (90%) were ESβLs producers, for MβL, the rate was reduced to 12\20 (60%), finally 6 \20(30%) of the isolates were AmpC producers.In Hodeg test, up to 80%(16\20) gave positive results .Genotypic Screening test for antibiotic resistance genes showed that all the isolates covered MDR pattern and the most provenance gene was blaTEM (100%) followed by aminoglycoside modifying enzymes genes typeaac(3)-I(65%),aac(6)-Ib(55%), and aph(3′)VI (55%) .The percentage of Efflux pump genes were 50% and 60% formexX and mexY,respectively . The rate of carbapenemase genes IMP-1 and VIM were 50% and 25% respectively whiles gyrA gene(quinolone resistance ) and bla-CMY(Cefipem resistance ) were 45% and 20%, respectively .The lowest percentages of resistance were for 23s ribosomal methylation enzymes rmtC( 10|%), rmtB(0%) and rmtD(5%). Up to 14 genes were detected inA.baummanino.1, a sign for MDR emergence or a step for XDR among Iraqi isolates.
Article
Full-text available
Acinetobacter baumannii is a nosocomial pathogen involved in a variety of infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study we compared the extent of biofilm formation and motility displayed by sixty multidrug resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To our knowledge this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates.
Article
Full-text available
Head louse infestation, which is caused by Pediculus humanus capitis, occurs throughout the world. With the advent of molecular techniques, head lice have been classified into three clades. Recent reports have demonstrated that pathogenic organisms could be found in head lice. Head lice and their pathogenic bacteria in Thailand have never been investigated. In this study, we determined the genetic diversity of head lice collected from various areas of Thailand and demonstrated the presence of Acinetobacter spp. in head lice. Total DNA was extracted from 275 head louse samples that were collected from several geographic regions of Thailand. PCR was used to amplify the head louse COI gene and for detection of Bartonella spp. and Acinetobacter spp. The amplified PCR amplicons were cloned and sequenced. The DNA sequences were analyzed via the neighbor-joining method using Kimura's 2-parameter model. The phylogenetic tree based on the COI gene revealed that head lice in Thailand are clearly classified into two clades (A and C). Bartonella spp. was not detected in all the samples, whereas Acinetobacter spp. was detected in 10 samples (3.62%), which consisted of A. baumannii (1.45%), A. radioresistens (1.45%), and A. schindleri (0.72%). The relationship of Acinetobacter spp. and the head lice clades showed that Acinetobacter spp. was found in clade A and C. Head lice in Thailand are classified into clade A and B based on the COI gene sequences. Pathogenic Acinetobacter spp. was detected in both clades. The data obtained from the study might assist in the development of effective strategies for head lice control in the future. Detection of pathogenic bacteria in head lice could raise awareness of head lice as a source of nosocomial bacterial infections.
Article
Full-text available
Acinetobacter baumannii has previously been detected and genotyped in human body lice. The objectives of this study were to determine the presence of this bacterium in head and body lice collected from healthy individuals in Ethiopia by molecular methods and to characterize the genotype. Human lice from locations at different altitudes in Ethiopia were screened for the presence of Acinetobacter sp by targeting the rpoB gene. Acinetobacter baumannii was detected and genotyped using recA PCR amplification. A total of 115 head and 109 body lice were collected from 134 healthy individuals. Acinetobacter sp were found in 54 head (47%) and 77 body (71%) lice. The recA gene was sequenced for 60 of the Acinetobacter sp and 67% were positive for A. baumannii; genotype 1 was retrieved the most frequently. Our study is the first to show the presence of A. baumannii in human body lice, and also in head lice, in Ethiopia.
Article
The ability of multidrug resistance Acinetobacter baumannii to persist in any circumstances regard to the acquisition of many virulence factors genes and antibiotic resistance genes is major concern in the hospitals environments. In this study, thirty A. baumannii isolates were collected from blood infections from hospitalized patients were subjected to screening for virulence factors genes plcN and lasB by conventional PCR. The pathogenicity of representative isolates bearing these gene were tested using galleria mellonella infection assay and adhesion-invasion assay on A549 cell line, and compared with other strain without this gene. Phylogenetic tree revealed that isolates were sorted in two major groups one of them contained two clusters (Group II and III), and another had the other group (Group I). All the 30 A. baumannii isolates were investigated for the presence of virulence factors genes (plc-N and lasB genes) and results showed that, 16 (53.33%) were harboring lasB genes while 7 (23.3%) isolates were harboring plcN gene The presence of any of these gene enhance the killing ability of A. baumannii strain and increased invasiveness in A549 cell line. Increase nosocomial infection with A. baumannii isolates is serious problem especially because of its potency to gain virulence factors genes and its ability to persist in hospital environments. So the shed light in finding which virulence factors these isolates which have is necessary to discover new antimicrobials that targeting the virulence factor of these powerful pathogens.
Article
Background: Head lice are a source of amusement for outsiders and an embarrassing nuisance to those who have to deal with them. Our study collected the emotions experienced by people dealing with head lice. An area with extremely sparse literature, our purpose is to inform the development of more effective programs to control head lice. Methods: We asked "what were your feelings upon discovery of head lice?" as part of a study exploring the experience of those treating head lice. A short questionnaire was available via the authors' head lice information internet site. A total of 294 eligible responses were collected over several months and analyzed, supported by QSR N6. Results: The predominantly female (90 · 9%) respondents were residents of Australia (56 · 1%), USA (20 · 4%), Canada (7 · 2%), or UK (4 · 4%), and working full-time (43·0%) or part-time (34 · 2%). Reactions and feelings fell into three categories: strong (n = 320; 79% of all stated emotions), mediocre (n = 56; 20%), and neutral (n = 29; 9 · 8%). There were no positive emotions. Comment: The significant negative reaction was expected. The range of feeling expressed demonstrates the stigma held for these ectoparasites within western market economies. This contrasts with conceptions of head lice in traditional societies. The negative social effects of this perception create more problematic issues than the infection itself; these include quarantine, overtreatment, and a potentially negative psychological impact. Head lice control strategies and programs that address these negative emotional reactions may prove more effective than current biomedical focus.
Article
A total of 31 Acinetobacter isolates were obtained from the rhizosphere of Pennisetum glaucum and evaluated for their plant-growth-promoting traits. Two isolates, namely Acinetobacter sp. PUCM1007 and A. baumannii PUCM1029, produced indole acetic acid (10-13 μg/ml). A total of 26 and 27 isolates solubilized phosphates and zinc oxide, respectively. Among the mineral-solubilizing strains, A.calcoaceticus PUCM1006 solubilized phosphate most efficiently (84 mg/ml), whereas zinc oxide was solubilized by A.calcoaceticus PUCM1025 at the highest solubilization efficiency of 918%.All the Acinetobacter isolates, except PUCM1010, produced siderophores. The highest siderophore production (85.0 siderophore units) was exhibited by A.calcoaceticus PUCM1016. Strains PUCM1001 and PUCM1019 (both A.calcoaceticus) and PUCM1022 (Acinetobacter sp.) produced both hydroxamate- and catechol-type siderophores, whereas all the other strains only produced catechol-type siderophores. In vitro inhibition of Fusarium oxysporum under iron-limited conditions was demonstrated by the siderophore-producing Acinetobacter strains, where PUCM1018 was the most potent inhibitor of the fungal phytopathogen. Acinetobacter sp. PUCM1022 significantly enhanced the shoot height, root length, and root dry weights of pearl millet seedlings in pot experiments when compared with controls, underscoring the plant-growth-promoting potential of these isolates.